Annotation of rs28363170
Genotype GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT/GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT is associated with increased response to disulfiram in people with Cocaine-Related Disorders as compared to genotypes GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT/del + del/del.
GGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCAGT allele referred to in the paper as the 10-repeat allele. Patients with the 10,10-repeat genotype showed a significantly greater decrease in the number of cocaine-positive urine tests and a significantly greater increase in the number of cocaine-negative urine tests than patients with either the 9,9-repeat or 9,10-repeat genotypes. This association was not seen in genotyped patients treated with placebo.
From Publication
Gene
Variant
Phenotype Category
Association Significance
PharmGKB ID
Score More info on scoring
Evidence for Clinical Annotations
This annotation has been used as evidence for the following clinical annotations.
Study Parameters
1.
Study type
Study size
Association p-value
Allele frequency
Biogeographical group More info on groups
Population description
Study Cohort: Allele frequency given for the total study cohort of 67 patients, including those treated with placebo. P-value given for association of genotype with change in number of cocaine-positive urine tests.
2.
Study type
Study size
Association p-value
Allele frequency
Biogeographical group More info on groups
Population description
Study Cohort: Allele frequency given for the total study cohort of 67 patients, including those treated with placebo. P-value given for association of genotype with change in number of cocaine-negative urine tests.
Note: Alleles in PharmGKB are mapped to the positive chromosomal strand. Therefore, variants in genes on the "minus" strand (eg. VKORC1) are complemented in PharmGKB annotations.
History
No history available.