Gene:
ADRA2C
adrenoceptor alpha 2C

PharmGKB contains no dosing guidelines for this . To report known genotype-based dosing guidelines, or if you are interested in developing guidelines, click here.

PharmGKB has no annotated drug labels with pharmacogenomic information for this . If you know of a drug label with PGx, send us a message.

PharmGKB contains no Clinical Variants that meet the highest level of criteria.

To see more Clinical Variants with lower levels of criteria, click the button at the bottom of the table.

Disclaimer: The PharmGKB's clinical annotations reflect expert consensus based on clinical evidence and peer-reviewed literature available at the time they are written and are intended only to assist clinicians in decision-making and to identify questions for further research. New evidence may have emerged since the time an annotation was submitted to the PharmGKB. The annotations are limited in scope and are not applicable to interventions or diseases that are not specifically identified.

The annotations do not account for individual variations among patients, and cannot be considered inclusive of all proper methods of care or exclusive of other treatments. It remains the responsibility of the health-care provider to determine the best course of treatment for a patient. Adherence to any guideline is voluntary, with the ultimate determination regarding its application to be made solely by the clinician and the patient. PharmGKB assumes no responsibility for any injury or damage to persons or property arising out of or related to any use of the PharmGKB clinical annotations, or for any errors or omissions.

? = Mouse-over for quick help

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page on the appropriate tab.

Links in the "Drugs" column lead to PharmGKB Drug Pages.

List of all variant annotations for ADRA2C

Variant?
(147)
Alternate Names ? Chemicals ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
Translation
No VIP available CA VA
rs11269124 NC_000004.11:g.3769789_3769790insGGGAGCTTTCCCAGAGACCC, NC_000004.11:g.3769789_3769790insGGGGAGCTTTCCCAGAGACCC, NC_000004.12:g.3768062_3768063insGGGAGCTTTCCCAGAGACCC, NC_000004.12:g.3768062_3768063insGGGGAGCTTTCCCAGAGACCC, NG_012640.1:g.6494_6495insGGGAGCTTTCCCAGAGACCC, NG_012640.1:g.6494_6495insGGGGAGCTTTCCCAGAGACCC, NM_000683.3:c.*67_*68insGGGAGCTTTCCCAGAGACCC, NM_000683.3:c.*67_*68insGGGGAGCTTTCCCAGAGACCC, rs147319738
- > GGGAGCTTTCCCAGAGACCC
- > GGGGAGCTTTCCCAGAGACCC
indel
No VIP available CA VA
rs61767072 NC_000004.11:g.3769297_3769308delGGGGCGGGGCCG, NC_000004.12:g.3767570_3767581delGGGGCGGGGCCG, NG_012640.1:g.6002_6013delGGGGCGGGGCCG, NM_000683.3:c.964_975delGGGGCGGGGCCG, NP_000674.2:p.Gly324_Ala327del
GGGGCGGGGCCG > -
indel
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 147

Overview

Alternate Names:  ADRA2L2; ADRA2RL2
Alternate Symbols:  ADRARL2
PharmGKB Accession Id: PA37

Details

Cytogenetic Location: chr4 : p16.3 - p16.3
GP mRNA Boundary: chr4 : 3768296 - 3770253
GP Gene Boundary: chr4 : 3758296 - 3773253
Strand: plus

Visualization

UCSC has a Genome Browser that you can use to view PharmGKB annotations for this gene in context with many other sources of information.

View on UCSC Browser
The mRNA boundaries are calculated using the gene's default feature set from NCBI, mapped onto the UCSC Golden Path. PharmGKB sets gene boundaries by expanding the mRNA boundaries by no less than 10,000 bases upstream (5') and 3,000 bases downstream (3') to allow for potential regulatory regions.

PharmGKB Curated Pathways

Pathways created internally by PharmGKB based primarily on literature evidence.

  1. Sympathetic Nerve Pathway (Neuroeffector Junction)
    Simplified diagram of a sympathetic neuroeffector junction displaying genes which may be involved.
No related genes are available

Curated Information ?

Curated Information ?

Publications related to ADRA2C: 9

No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetics and pharmacogenetics of aminergic transmitter pathways in functional gastrointestinal disorders. Pharmacogenomics. 2015. Martinucci Irene, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacogenetics and healthcare outcomes in patients with chronic heart failure. European journal of clinical pharmacology. 2012. Kim Kye-Min, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Combinatorial pharmacogenetic interactions of bucindolol and beta1, alpha2C adrenergic receptor polymorphisms. PloS one. 2012. O'Connor Christopher M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cardiovascular Pharmacogenomics of Adrenergic Receptor Signaling: Clinical Implications and Future Directions. Clinical pharmacology and therapeutics. 2011. Johnson J A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of the G-protein and alpha2-adrenergic receptor gene and plasma norepinephrine level with clonidine improvement of the effects of diuretics in patients with cirrhosis with refractory ascites: a randomised clinical trial. Gut. 2010. Yang Y Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
An alpha2C-adrenergic receptor polymorphism alters the norepinephrine-lowering effects and therapeutic response of the beta-blocker bucindolol in chronic heart failure. Circulation. Heart failure. 2010. Bristow Michael R, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Synergistic polymorphisms of beta1 and alpha2C-adrenergic receptors and the influence on left ventricular ejection fraction response to beta-blocker therapy in heart failure. Pharmacogenetics and genomics. 2007. Lobmeyer Maximilian T, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Sympathoneural and adrenomedullary functional effects of alpha2C-adrenoreceptor gene polymorphism in healthy humans. Pharmacogenetics and genomics. 2005. Neumeister Alexander, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Polymorphisms of cardiac presynaptic alpha2C adrenergic receptors: Diverse intragenic variability with haplotype-specific functional effects. Proceedings of the National Academy of Sciences of the United States of America. 2004. Small Kersten M, et al. PubMed

LinkOuts

NCBI Gene:
152
OMIM:
104250
UCSC Genome Browser:
NM_000683
RefSeq RNA:
NM_000683
RefSeq Protein:
NP_000674
RefSeq DNA:
NG_012640
NT_006051
UniProtKB:
ADA2C_HUMAN (P18825)
Q4W594_HUMAN (Q4W594)
Ensembl:
ENSG00000184160
GenAtlas:
ADRA2C
GeneCard:
ADRA2C
MutDB:
ADRA2C
ALFRED:
LO107128T
HuGE:
ADRA2C
Comparative Toxicogenomics Database:
152
ModBase:
P18825
IUPHAR Receptor:
α2C-adrenoceptor (27)
HGNC:
283

Common Searches