Gene:
CCR5
chemokine (C-C motif) receptor 5 (gene/pseudogene)

PharmGKB contains no dosing guidelines for this . To report known genotype-based dosing guidelines, or if you are interested in developing guidelines, click here.

PharmGKB annotates drug labels containing pharmacogenetic information approved by the US Food and Drug Administration (FDA), European Medicines Agency (EMA), the Pharmaceuticals and Medical Devices Agency, Japan (PMDA), and Health Canada (Santé Canada) (HCSC). PharmGKB annotations provide a brief summary of the PGx in the label, an excerpt from the label and a downloadable highlighted label PDF file. A list of genes and phenotypes found within the label is mapped to label section headers and listed at the end of each annotation. PharmGKB also attempts to interpret the level of action implied in each label with the "PGx Level" tag.

See the legend for more information about drug label sources and PGx Levels.

We welcome any information regarding drug labels containing PGx information approved by the FDA, EMA, PMDA, HCSC or other Medicine Agencies around the world - please contact feedback.



last updated 05/28/2015

FDA Label for maraviroc and CCR5

Genetic testing required

Summary

The drug labeling for maraviroc is not related to genetic testing of the patient, rather testing of the HIV-1 strain that has infected the patient. The FDA-approved label states that HIV tropism testing be carried out before treatment with Maraviroc. This drug is indicated only for CCR5-tropic HIV-1 infection, and due to its mechanism of action, is not effective against CXCR4-tropic and dual-tropic HIV-1.

There's more of this label. Read more.


last updated 10/27/2013

European Medicines Agency (EMA) Label for maraviroc and CCR5

Genetic testing required

Summary

The drug labeling for maraviroc is not related to genetic testing of the patient, rather testing of the HIV-1 strain that has infected the patient. The EMA European Public Assessment Report (EPAR) for Maraviroc (CELSENTRI) contains information regarding its indication only in patients with CCR5-tropic HIV-1 and not CXCR4- or dual/mixed tropic virus, due to its mechanism of action as a CCR5 antagonist.

There's more of this label. Read more.


last updated 06/08/2015

Health Canada Santé Canada (HCSC) Label for maraviroc and CCR5

Genetic testing required

Summary

The product monograph for maraviroc contains information related to testing of the HIV-1 strain that has infected the patient. The product monograph states maraviroc is indicated for CCR5-tropic HIV-1 infection, and is not recommended in CXCR4-tropic or dual/mixed-tropic HIV-1 infection due to lack of efficacy.

There's more of this label. Read more.


PharmGKB contains no Clinical Variants that meet the highest level of criteria.

Disclaimer: The PharmGKB's clinical annotations reflect expert consensus based on clinical evidence and peer-reviewed literature available at the time they are written and are intended only to assist clinicians in decision-making and to identify questions for further research. New evidence may have emerged since the time an annotation was submitted to the PharmGKB. The annotations are limited in scope and are not applicable to interventions or diseases that are not specifically identified.

The annotations do not account for individual variations among patients, and cannot be considered inclusive of all proper methods of care or exclusive of other treatments. It remains the responsibility of the health-care provider to determine the best course of treatment for a patient. Adherence to any guideline is voluntary, with the ultimate determination regarding its application to be made solely by the clinician and the patient. PharmGKB assumes no responsibility for any injury or damage to persons or property arising out of or related to any use of the PharmGKB clinical annotations, or for any errors or omissions.

? = Mouse-over for quick help

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page on the appropriate tab.

Links in the "Drugs" column lead to PharmGKB Drug Pages.

List of all variant annotations for CCR5

Variant?
(144)
Alternate Names ? Drugs ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
Translation
No VIP available No Clinical Annotations available VA
rs333 46354947_46354978del32, 46414947_46414978del32, 554_585del32, 8315_8346del32, CCR5: 554_585del32, Ser185_Thr195delinsIlefs, delta32, ¿32
GTCAGTATCAATTCTGGAAGAATTTCCAGACA > -
Frameshift
SerGlnTyrGlnPheTrpLysAsnPheGlnThr185Ile
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 144

Overview

Alternate Names:  CMKBR5
Alternate Symbols:  CC-CKR-5; CD195; CKR-5; CKR5; IDDM22
PharmGKB Accession Id: PA26170

Details

Cytogenetic Location: chr3 : p21.31 - p21.31
GP mRNA Boundary: chr3 : 46411633 - 46417697
GP Gene Boundary: chr3 : 46401633 - 46420697
Strand: plus

Visualization

UCSC has a Genome Browser that you can use to view PharmGKB annotations for this gene in context with many other sources of information.

View on UCSC Browser
The mRNA boundaries are calculated using the gene's default feature set from NCBI, mapped onto the UCSC Golden Path. PharmGKB sets gene boundaries by expanding the mRNA boundaries by no less than 10,000 bases upstream (5') and 3,000 bases downstream (3') to allow for potential regulatory regions.

PharmGKB Curated Pathways

Pathways created internally by PharmGKB based primarily on literature evidence.

PharmGKB contains no curated pathways for this gene. If you would like to volunteer to work on a pathway, please let us know.

External Pathways

Links to non-PharmGKB pathways.

  1. il12 and stat4 dependent signaling pathway in th1 development - (BioCarta via Pathway Interaction Database)
  2. IL12-mediated signaling events - (Pathway Interaction Database NCI-Nature Curated)
  3. pertussis toxin-insensitive ccr5 signaling in macrophage - (BioCarta via Pathway Interaction Database)
No related genes are available

Curated Information ?

Curated Information ?

Evidence Disease
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Multiple Sclerosis

Publications related to CCR5: 10

No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The Dual Role of Pharmacogenetics in HIV Treatment: Mutations and Polymorphisms Regulating Antiretroviral Drug Resistance and Disposition. Pharmacological reviews. 2012. Michaud Veronique, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HIV-1 antiretroviral drug therapy. Cold Spring Harbor perspectives in medicine. 2012. Arts Eric J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Allelic combinations of immune-response genes associated with glatiramer acetate treatment response in Russian multiple sclerosis patients. Pharmacogenomics. 2012. Tsareva Ekaterina Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic association of the CCR5 region with lipid levels in at-risk cardiovascular patients. Circulation. Cardiovascular genetics. 2010. Hyde Craig L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Diverse genome-wide association studies associate the IL12/IL23 pathway with Crohn Disease. American journal of human genetics. 2009. Wang Kai, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Reduction of CCR5 with low-dose rapamycin enhances the antiviral activity of vicriviroc against both sensitive and drug-resistant HIV-1. Proceedings of the National Academy of Sciences of the United States of America. 2008. Heredia Alonso, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of antiretroviral agents. Current opinion in HIV and AIDS. 2008. Owen Andrew, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CCL3L1-CCR5 genotype influences durability of immune recovery during antiretroviral therapy of HIV-1-infected individuals. Nature medicine. 2008. Ahuja Sunil K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of minimal residual disease response in children with B-precursor acute lymphoblastic leukemia: a report from the Children's Oncology Group. Blood. 2008. Davies Stella M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Chemokine receptor CCR5 promotes leukocyte trafficking to the brain and survival in West Nile virus infection. The Journal of experimental medicine. 2005. Glass William G, et al. PubMed

LinkOuts

UniProtKB:
CCR5_HUMAN (P51681)
Q38L21_HUMAN (Q38L21)
Ensembl:
ENSG00000160791
GenAtlas:
CCR5
GeneCard:
CCR5
MutDB:
CCR5
ALFRED:
LO000410F
HuGE:
CCR5
Comparative Toxicogenomics Database:
1234
ModBase:
O14708
HumanCyc Gene:
HS08536
IUPHAR Receptor:
CCR5 (62)
HGNC:
1606

Common Searches