Drug Class
Pyrimidine analogues

PharmGKB contains no dosing guidelines for this . To report known genotype-based dosing guidelines, or if you are interested in developing guidelines, click here.

PharmGKB has no annotated drug labels with pharmacogenomic information for this . If you know of a drug label with PGx, send us a message.

Clinical Variants that meet the highest level of criteria, manually curated by PharmGKB, are shown below.

To see more Clinical Variants with lower levels of criteria, click the button at the bottom of the page.

Disclaimer: The PharmGKB's clinical annotations reflect expert consensus based on clinical evidence and peer-reviewed literature available at the time they are written and are intended only to assist clinicians in decision-making and to identify questions for further research. New evidence may have emerged since the time an annotation was submitted to the PharmGKB. The annotations are limited in scope and are not applicable to interventions or diseases that are not specifically identified.

The annotations do not account for individual variations among patients, and cannot be considered inclusive of all proper methods of care or exclusive of other treatments. It remains the responsibility of the health-care provider to determine the best course of treatment for a patient. Adherence to any guideline is voluntary, with the ultimate determination regarding its application to be made solely by the clinician and the patient. PharmGKB assumes no responsibility for any injury or damage to persons or property arising out of or related to any use of the PharmGKB clinical annotations, or for any errors or omissions.

? = Mouse-over for quick help

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Links in the "Gene" column lead to PharmGKB Gene Pages.

List of all variant annotations for Pyrimidine analogues

Gene ? Variant?
Alternate Names ? Drugs ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
No VIP available CA No Variant Annotations available
rs34743033 28-bp tandem repeats, CCGCGCCACTTGGCCTGCCTCCGTCCCG, TSER*2, TSER*3, TYMS: 28 bp tandem repeat, TYMS: 2R, TYMS: TSER *2/*3, TYMS:TSER 28-basepair 5'UTR enhancer region repeat
Not Available
No VIP available CA VA
rs3918290 1905+1G>A, 476002G>A, 67887532C>T, 97915614C>T, DPYD*2A, DPYD:67887533 G>A, DPYD:IVS14 + 1G>A
C > T
No VIP available CA No Variant Annotations available
rs55886062 1679T>G, 410273T>G, 67953261A>C, 97981343A>C, Ile560Ser
A > T
A > C
No VIP available CA No Variant Annotations available
rs67376798 2846A>T, 67519865T>A, 843669A>T, 97547947T>A, Asp949Val
T > A
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 144


Generic Names
Trade Names
Brand Mixture Names

PharmGKB Accession Id:

Other Vocabularies

Drugs And Small Molecules

The following have been classified under this therapeutic category:

PharmGKB Curated Pathways

Pathways created internally by PharmGKB based primarily on literature evidence.

  1. Antimetabolite Pathway - Folate Cycle, Pharmacodynamics
    Model non-tissue specific cancer cell displaying candidate genes which may be involved in the pharmacodynamics of antimetabolite drugs acting on the folate cycle.

External Pathways

Links to non-PharmGKB pathways.

PharmGKB contains no links to external pathways for this drug. To report a pathway, click here.

Genes that are associated with this drug in PharmGKB's database based on (1) variant annotations, (2) literature review, (3) pathways or (4) information automatically retrieved from DrugBank, depending on the "evidence" and "source" listed below.

Curated Information ?

No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available PW
No related drugs are available.

Curated Information ?

Publications related to Pyrimidine analogues: 56

No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genotype-phenotype correlations in 5-fluorouracil metabolism: a candidate DPYD haplotype to improve toxicity prediction. The pharmacogenomics journal. 2015. Gentile G, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
DPYD Variants as Predictors of 5-fluorouracil Toxicity in Adjuvant Colon Cancer Treatment (NCCTG N0147). Journal of the National Cancer Institute. 2014. Lee Adam M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The role of IVS14+1 G > A genotype detection in the dihydropyrimidine dehydrogenase gene and pharmacokinetic monitoring of 5-fluorouracil in the individualized adjustment of 5-fluorouracil for patients with local advanced and metastatic colorectal cancer: a preliminary report. European review for medical and pharmacological sciences. 2014. Cai X, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic Markers of Toxicity From Capecitabine and Other Fluorouracil-Based Regimens: Investigation in the QUASAR2 Study, Systematic Review, and Meta-Analysis. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2014. Rosmarin Dan, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thymidylate synthase genotype-directed chemotherapy for patients with gastric and gastroesophageal junction cancers. PloS one. 2014. Goff Laura W, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphism of TS 3'-UTR predicts survival of Chinese advanced gastric cancer patients receiving first-line capecitabine plus paclitaxel. Clinical & translational oncology : official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico. 2013. Gao J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
DPYD IVS14+1G>A and 2846A>T genotyping for the prediction of severe fluoropyrimidine-related toxicity: a meta-analysis. Pharmacogenomics. 2013. Terrazzino Salvatore, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic variants in the DPYD, TYMS, CDA and MTHFR genes are clinically significant predictors of fluoropyrimidine toxicity. British journal of cancer. 2013. Loganayagam A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A DPYD Variant (Y186C) in Individuals of African Ancestry Is Associated With Reduced DPD Enzyme Activity. Clinical pharmacology and therapeutics. 2013. Offer S M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Fluoropyrimidine toxicity in patients with dihydropyrimidine dehydrogenase splice site variant: the need for further revision of dose and schedule. Internal and emergency medicine. 2013. Magnani Elena, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Dihydropyrimidine Dehydrogenase Gene (DPYD) Polymorphism among Caucasian and non-Caucasian Patients with 5-FU- and Capecitabine-related Toxicity Using Full Sequencing of DPYD. Cancer genomics & proteomics. 2013. Saif Muhammad Wasif. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Evaluating predictive pharmacogenetic signatures of adverse events in colorectal cancer patients treated with fluoropyrimidines. PloS one. 2013. Jennings Barbara A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Relationship between single nucleotide polymorphisms and haplotypes in DPYD and toxicity and efficacy of capecitabine in advanced colorectal cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Deenen Maarten J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Associations of various gene polymorphisms with toxicity in colorectal cancer patients receiving oral uracil and tegafur plus leucovorin: a prospective study. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO. 2011. Tsunoda A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A POLYMORPHISM IN THE CYTIDINE DEAMINASE PROMOTER PREDICTS SEVERE CAPECITABINE-INDUCED HAND-FOOT SYNDROME. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Caronia Daniela, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic Tailoring of Irinotecan-based First-line Chemotherapy in Metastatic Colorectal Cancer: Results of a Pilot Study. Anticancer research. 2011. Freyer Gilles, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Associations between gene polymorphisms of thymidylate synthase with its protein expression and chemosensitivity to 5-fluorouracil in pancreatic carcinoma cells. Chinese medical journal. 2011. Zhang Qiang, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Phase II study of preoperative radiation plus concurrent daily tegafur-uracil (UFT) with leucovorin for locally advanced rectal cancer. BMC cancer. 2011. Cellier Patrice, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
X-Ray Cross-Complementing Group 1 and Thymidylate Synthase Polymorphisms Might Predict Response to Chemoradiotherapy in Rectal Cancer Patients. International journal of radiation oncology, biology, physics. 2010. Lamas Maria J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Value of gene polymorphisms as markers of 5-FU therapy response in stage III colon carcinoma: a pilot study. Cancer chemotherapy and pharmacology. 2010. Fariña-Sarasqueta Arantza, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thymidylate synthase germline polymorphisms in rectal cancer patients treated with neoadjuvant chemoradiotherapy based on 5-fluorouracil. Journal of cancer research and clinical oncology. 2010. Páez David, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Distribution of TYMS, MTHFR, p53 and MDR1 gene polymorphisms in patients with breast cancer treated with neoadjuvant chemotherapy. Cancer epidemiology. 2010. Henríquez-Hernández Luis Alberto, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thymidylate Synthase Gene Polymorphism Affects the Response to Preoperative 5-Fluorouracil Chemoradiation Therapy in Patients With Rectal Cancer. International journal of radiation oncology, biology, physics. 2010. Hur Hyuk, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Investigation of IVS14 + 1G > A polymorphism of DPYD gene in a group of Bosnian patients treated with 5-Fluorouracil and capecitabine. Bosnian journal of basic medical sciences / Udru¿enje basi¿nih mediciniskih znanosti = Association of Basic Medical Sciences. 2010. Ceri¿ Timur, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic assessment of toxicity and outcome in patients with metastatic colorectal cancer treated with LV5FU2, FOLFOX, and FOLFIRI: FFCD 2000-05. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2010. Boige Valérie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Tumor response is predicted by patient genetic profile in rectal cancer patients treated with neo-adjuvant chemo-radiotherapy. The pharmacogenomics journal. 2010. Cecchin E, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Promoter methylation and large intragenic rearrangements of DPYD are not implicated in severe toxicity to 5-fluorouracil-based chemotherapy in gastrointestinal cancer patients. BMC cancer. 2010. Savva-Bordalo Joana, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms associated with 5-Fluorouracil-induced neurotoxicity. Chemotherapy. 2010. Kim Suk-Ran, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Variants in the dihydropyrimidine dehydrogenase, methylenetetrahydrofolate reductase and thymidylate synthase genes predict early toxicity of 5-fluorouracil in colorectal cancer patients. The Journal of international medical research. 2010. Kristensen M H, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association of molecular markers with toxicity outcomes in a randomized trial of chemotherapy for advanced colorectal cancer: the FOCUS trial. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2009. Braun Michael S, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Dihydropyrimidine dehydrogenase gene variation and severe 5-fluorouracil toxicity: a haplotype assessment. Pharmacogenomics. 2009. Amstutz Ursula, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Predictors of survival and toxicity in patients on adjuvant therapy with 5-fluorouracil for colorectal cancer. British journal of cancer. 2009. Gusella M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Influence of dihydropyrimidine dehydrogenase gene (DPYD) coding sequence variants on the development of fluoropyrimidine-related toxicity in patients with high-grade toxicity and patients with excellent tolerance of fluoropyrimidine-based chemotherapy. Neoplasma. 2009. Kleibl Z, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The influence of fluorouracil outcome parameters on tolerance and efficacy in patients with advanced colorectal cancer. The pharmacogenomics journal. 2008. Capitain O, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacokinetics of 5-fluorouracil in patients heterozygous for the IVS14+1G > A mutation in the dihydropyrimidine dehydrogenase gene. Nucleosides, nucleotides & nucleic acids. 2008. van Kuilenburg A B P, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Role of genetic and nongenetic factors for fluorouracil treatment-related severe toxicity: a prospective clinical trial by the German 5-FU Toxicity Study Group. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2008. Schwab Matthias, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
5-Fluorouracil toxicity-attributable IVS14 + 1G > A mutation of the dihydropyrimidine dehydrogenase gene in Polish colorectal cancer patients. Pharmacological reports : PR. 2008. Sulzyc-Bielicka Violetta, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
DPYD*2A mutation: the most common mutation associated with DPD deficiency. Cancer chemotherapy and pharmacology. 2007. Saif M W, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Dihydropyrimidine dehydrogenase activity and the IVS14+1G>A mutation in patients developing 5FU-related toxicity. British journal of clinical pharmacology. 2007. Magné Nicolas, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
5-Fluorouracil-related severe toxicity: a comparison of different methods for the pretherapeutic detection of dihydropyrimidine dehydrogenase deficiency. Cancer letters. 2007. Boisdron-Celle M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphisms in the thymidylate synthase and dihydropyrimidine dehydrogenase genes predict response and toxicity to capecitabine-raltitrexed in colorectal cancer. Oncology reports. 2007. Salgado Josefa, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Clinical relevance of different dihydropyrimidine dehydrogenase gene single nucleotide polymorphisms on 5-fluorouracil tolerance. Molecular cancer therapeutics. 2006. Morel Alain, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of capecitabine in advanced breast cancer patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2006. Largillier Rémy, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Orotate phosphoribosyltransferase gene polymorphism predicts toxicity in patients treated with bolus 5-fluorouracil regimen. Clinical cancer research : an official journal of the American Association for Cancer Research. 2006. Ichikawa Wataru, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphic tandem repeat sequences of the thymidylate synthase gene correlates with cellular-based sensitivity to fluoropyrimidine antitumor agents. Cancer chemotherapy and pharmacology. 2005. Yawata Ayako, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of extraordinary responses to 5-FU/cisplatin chemotherapy in advanced gastric cancer -- report of 2 cases. Onkologie. 2005. Wolschke Christine, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Relationships between promoter polymorphisms in the thymidylate synthase gene and mRNA levels in colorectal cancers. European journal of cancer (Oxford, England : 1990). 2005. Morganti Maria, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Analysis of the DPYD gene implicated in 5-fluorouracil catabolism in a cohort of Caucasian individuals. Clinical cancer research : an official journal of the American Association for Cancer Research. 2005. Seck Katharina, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Dihydropyrimidine dehydrogenase deficiency presenting at birth. Journal of inherited metabolic disease. 2005. Al-Sanna'a N A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Mutations in exon 14 of dihydropyrimidine dehydrogenase and 5-Fluorouracil toxicity in Portuguese colorectal cancer patients. Genetics in medicine : official journal of the American College of Medical Genetics. 2004. Salgueiro Natália, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Identification and functional analysis of single nucleotide polymorphism in the tandem repeat sequence of thymidylate synthase gene. Cancer research. 2003. Kawakami Kazuyuki, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Prevalence of a common point mutation in the dihydropyrimidine dehydrogenase (DPD) gene within the 5'-splice donor site of intron 14 in patients with severe 5-fluorouracil (5-FU)- related toxicity compared with controls. Clinical cancer research : an official journal of the American Association for Cancer Research. 2001. Raida M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thymidylate synthase gene polymorphism determines response and toxicity of 5-FU chemotherapy. The pharmacogenomics journal. 2001. Pullarkat S T, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Known variant DPYD alleles do not explain DPD deficiency in cancer patients. Pharmacogenetics. 2000. Collie-Duguid E S, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genotype and phenotype in patients with dihydropyrimidine dehydrogenase deficiency. Human genetics. 1999. Van Kuilenburg A B, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphic tandem repeats in the thymidylate synthase gene is associated with its protein expression in human gastrointestinal cancers. Anticancer research. 1999. Kawakami K, et al. PubMed

Clinical Trials

These are trials that mention Pyrimidine analogues and are related to either pharmacogenetics or pharmacogenomics.

No trials found.

Common Searches

Search PubMed
Search Medline Plus
Search PubChem
Search CTD

Sources for PharmGKB drug information: DrugBank, Open Eye Scientific Software.