Disease:
Colorectal Neoplasms

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Gene ? Variant?
(147)
Alternate Names ? Chemicals ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
Translation
No VIP available CA No VIP available ABCB1 *2 (PMID: 11503014) N/A N/A N/A
No VIP available No VIP available No VIP available CYP2A6 *4A N/A N/A N/A
No VIP available No VIP available No VIP available CYP2A6 *7 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2A6 *9 N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *1 N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *2A N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *5 N/A N/A N/A
No VIP available No VIP available No VIP available G6PD Mediterranean, Dallas, Panama' Sassari, Cagliari, Birmingham N/A N/A N/A
No VIP available CA No VIP available GSTM1 non-null N/A N/A N/A
No VIP available CA No VIP available GSTM1 null N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *1 N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *6 N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *28 N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *60 N/A N/A N/A
No VIP available CA No VIP available UGT1A6 *2a N/A N/A N/A
No VIP available CA No VIP available UGT1A7 *3 N/A N/A N/A
No VIP available No Clinical Annotations available DPYD poor metabolizer
DPYD poor metabolizer N/A N/A N/A
No VIP available No Clinical Annotations available VA
rs10034692 15630454A>G, 37578A>G, 75419787A>G
A > G
Not Available
No VIP available No Clinical Annotations available VA
rs10049380 124487443T>C, 2017+417A>G, 30982589T>C
T > C
Intronic
No VIP available No Clinical Annotations available VA
rs1017733 *1825C>T, 15463017C>T, 75252350C>T
C > T
3' UTR
No VIP available No Clinical Annotations available VA
rs10380 1783C>T, 1864C>T, 32975C>T, 7887191C>T, 7897191C>T, His595Tyr, His622Tyr
C > T
Missense
His595Tyr
No VIP available CA VA
rs1045642 208920T>A, 208920T>C, 25171488A>G, 25171488A>T, 3435T>A, 3435T>C, 87138645A>G, 87138645A>T, ABCB1*6, ABCB1: 3435C>T, ABCB1: C3435T, ABCB1: c.3435C>T, ABCB1:3435C>T, Ile1145=, Ile1145Ile, MDR1 3435C>T, MDR1 C3435T, PGP C3435T, c.3435C>T, mRNA 3853C>T
A > T
A > G
Synonymous
Ile1145Ile
No VIP available No Clinical Annotations available VA
rs1049550 32731166G>A, 688C>T, 81926702G>A, ANXA11: T > C, Arg230Cys, R230C
G > A
Missense
Arg230Cys
No VIP available No Clinical Annotations available VA
rs10505806 10248888A>T, 17488764A>T
A > T
Not Available
No VIP available CA VA
rs1051266 3952235T>C, 46957794T>C, 80A>G, 9592A>G, : 80A>G, His27Arg, RFC-1, SCL19A1:80G>A, SLC19A1:Arg27His, SLC19A1:G80A, mRNA 199A>G
T > C
Missense
His27Arg
No VIP available CA VA
rs1056515 *3872C>A, 14601902G>T, 163113260G>T, 64704C>A
G > T
3' UTR
No VIP available No Clinical Annotations available VA
rs1063320 *233C>G, 1099028C>G, 1099078C>G, 1099348G>G, 1099370C>G, 1136315G>G, 1314654G>G, 29738749C>G, 29798749C>G, 8994C>G
C > G
3' UTR
No VIP available No Clinical Annotations available VA
rs10784749 31565335C>G, 69422029C>G
C > G
Not Available
No VIP available No Clinical Annotations available VA
rs10876844 18194012C>A, 56050706C>A
C > A
Not Available
No VIP available No Clinical Annotations available VA
rs10929302 -1791C>T, 172393G>A, 234665782G>A, 61-9898G>A, 612041G>A, 856-9898G>A, 862-9898G>A, 868-9898G>A, UGT1A1*93, UGT1A1:-3156G>A, UGT1A1:G-3156A
G > A
5' Flanking
No VIP available CA VA
rs10937158 130-1268A>G, 183708439T>C, 90203585T>C
T > C
Intronic
No VIP available No Clinical Annotations available VA
rs1105879 -7-243A>C, 108813A>C, 234602202A>C, 548461A>C, 552A>C, 855+10764A>C, 855+20767A>C, 855+56179A>C, 856-73478A>C, Arg184Ser
A > C
Intronic
Arg184Ser
No VIP available No Clinical Annotations available VA
rs11072508 45852954C>T, 75062397C>T
C > T
Not Available
No VIP available CA VA
rs11078659 233+9171C>T, 6507318G>A, 6903944G>A, 951+146G>A
G > A
Intronic
No VIP available No Clinical Annotations available VA
rs112445441 25398281C>A, g.25398281C>G, g.25398281C>T
G > A
G > T
G > C
Missense
Gly13Asp
Gly13Val
Gly13Ala
No VIP available No Clinical Annotations available VA
rs112723255 -14+175G>A, -14+420G>A, -368G>A, -398G>A, 1393G>A, 1408G>A, 22611C>T, 50964255C>T, 549478C>T, 5614G>A, 9260G>A, Ala465Thr, Ala470Thr
G > T
G > C
5' Flanking
Ala470Thr
No VIP available No Clinical Annotations available VA
rs1127648 *796T>C, 46757652A>G, 75967095A>G
A > G
3' UTR
No VIP available CA VA
rs1128503 1236T>C, 167964T>C, 87179601A>G, 87550285A>G, ABCB1 1236C>T, ABCB1*8, ABCB1: c.1236T>C, ABCB1:1236C>T, ABCB1:1236T>C, Gly412=, Gly412Gly, mRNA 1654T>C, p.Gly412Gly
A > G
Synonymous
Gly412Gly
No VIP available No Clinical Annotations available VA
rs1138272 12659374C>T, 341C>T, 67353579C>T, 7514C>T, A114V, Ala114Val, GSTP1: A114V, GSTP1: C341T
C > T
Missense
Ala114Val
No VIP available No Clinical Annotations available VA
rs11479 -14+194C>A, -14+194C>G, -14+194C>T, -14+439C>A, -14+439C>G, -14+439C>T, -349C>A, -349C>G, -349C>T, -379C>A, -379C>G, -379C>T, 1412C>A, 1412C>G, 1412C>T, 1427C>A, 1427C>G, 1427C>T, 22592G>A, 22592G>C, 22592G>T, 50525807G>A, 50525807G>C, 50525807G>T, 50964236G>A, 50964236G>C, 50964236G>T, 5633C>A, 5633C>G, 5633C>T, 9279C>A, 9279C>G, 9279C>T, Ser471Leu, Ser471Ter, Ser471Trp, Ser476Leu, Ser476Ter, Ser476Trp
G > A
G > T
G > C
5' Flanking
Ser471Trp
Ser471Leu
Ser471null
No VIP available CA VA
rs11563250 -1066A>G, 189961A>G, 234683350A>G, 629609A>G
A > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs11568315 55020563_55020564CA[9][14][15][16][17][18][19][20][21][22][23], 55088256_55088257CA[9][14][15][16][17][18][19][20][21][22][23], 6532_6533CA[9][14][15][16][17][18][19][20][21][22][23], 88+1198_88+1199CA[9][14][15][16][17][18][19][20][21][22][23]
CA > 19
CA > 15
CA > 16
CA > 17
CA > 18
CA > 22
CA > 23
CA > 14
CA > (CA)9
CA > 20
CA > 21
Intronic
No VIP available No Clinical Annotations available VA
rs11568972 110889007A>C, 1450-1120A>C, 1576-1120A>C, 35436728A>C, 59968A>C
A > C
Intronic
No VIP available No Clinical Annotations available VA
rs11568993 110897315C>T, 1851C>T, 1977C>T, 35445036C>T, 68276C>T, Cys617=, Cys659=
C > T
Synonymous
Cys659Cys
No VIP available CA VA
rs11615 18191871A>G, 354T>C, 45923653A>G, 63434T>C, Asn118=, ERCC1:19007T>C, ERCC1:Asn118Asn
A > G
Synonymous
Asn118Asn
No VIP available CA VA
rs11692021 234591205T>C, 537464T>C, 622T>C, 855+45182T>C, 855+63997T>C, 855+9770T>C, 97816T>C, Trp208Arg
T > C
Intronic
Trp208Arg
No VIP available No Clinical Annotations available VA
rs11722476 1066G>A, 19718560G>A, 47081G>A, 740G>A, 95170839G>A, Ser247Asn
G > A
Missense
Ser247Asn
No VIP available No Clinical Annotations available VA
rs11725706 15538775G>A, 75328108G>A
G > A
Not Available
No VIP available CA VA
rs11942466 15632745C>A, 39869C>A, 75422078C>A
C > A
Not Available
No VIP available No Clinical Annotations available VA
rs11997869 6628464C>G, 6638464C>G
C > G
Not Available
No VIP available CA VA
rs12022243 1906-14763G>A, 528836G>A, 67834698C>T, 97862780C>T
C > T
Intronic
No VIP available CA VA
rs12132152 67494922G>A, 97523004G>A
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs121913529
G > A
G > T
G > C
Missense
Gly12Asp
Gly12Val
Gly12Ala
No VIP available No Clinical Annotations available VA
rs12410394 150860186G>A, 2348828G>A, 61+397G>A
G > A
Intronic
No VIP available CA VA
rs13104811 13103G>A, 15605979G>A, 75395312G>A
G > A
Not Available
No VIP available CA VA
rs13181 *304T>G, 18123137T>G, 2251A>C, 23927A>C, 45854919T>G, ERCC2 Lys751Gln, ERCC2:2251A>C, ERCC2:Lys751Gln, Lys751Gln, rs13181:T>G
T > G
Missense
Lys751Gln
No VIP available CA VA
rs1353295 15539789G>A, 75329122G>A
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs1532268 13963C>T, 524C>T, 605C>T, 7868179C>T, 7878179C>T, Ser175Leu, Ser202Leu
C > T
Missense
Ser175Leu
No VIP available No Clinical Annotations available VA
rs1570360 -1154A>G, -614A>G, 43677830A>G, 43737830A>G, 4878A>G, VEGF -1154
A > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs1610696 *287C>G, 1099082C>G, 1099132C>G, 1099402G>G, 1099424C>G, 1136369G>G, 1314708G>G, 29738803C>G, 29798803C>G, 9048C>G
C > G
3' UTR
No VIP available No Clinical Annotations available VA
rs162036 1049A>G, 1130A>G, 21743A>G, 7875959A>G, 7885959A>G, Lys350Arg, Lys377Arg
A > G
Missense
Lys350Arg
No VIP available CA VA
rs16430 *145-368delA, *145-368delAinsCTTTAA, *447delT, *447delTinsTTAAAG, *861delA, *861delAinsCTTTAA, 20841delT, 20841delTinsTTAAAG, 663444delT, 663444delTinsTTAAAG, 673444delT, 673444delTinsTTAAAG
T > -
T > GAAATT
3' UTR
No VIP available No Clinical Annotations available VA
rs16857540 173900575C>G, 647-92530C>G, 80395721C>G
C > G
Intronic
No VIP available CA VA
rs1695 12658484A>G, 313A>G, 6624A>G, 67352689A>G, GSTP1*2, GSTP1*B, GSTP1: I105V, GSTP1:A313G, GSTP1:I105V, GSTP1:Ile105Val, Ile105Val, Part of haplotypes GSTP1*B and GSTP1*C, rs1695:A>G
A > G
Missense
Ile105Val
No VIP available No Clinical Annotations available VA
rs16973225 53020556A>C, 82229999A>C
A > C
Not Available
No VIP available No Clinical Annotations available VA
rs1707 *94C>T, 1098889T>T, 1098939T>T, 1099209T>T, 1099231T>T, 1136176T>T, 1314515T>T, 29738610C>T, 29798610C>T, 8855C>T
C > T
3' UTR
No VIP available No Clinical Annotations available VA
rs1710 *101G>C, 1098896G>C, 1098946G>C, 1099216C>C, 1099238G>C, 1136183C>C, 1314522C>C, 29738617G>C, 29798617G>C, 8862G>C
G > C
3' UTR
No VIP available No Clinical Annotations available VA
rs17116806 1740+8030G>T, 418364G>T, 67945170C>A, 97973252C>A
C > A
Intronic
No VIP available No Clinical Annotations available VA
rs17179101 *118C>A, 1098913C>A, 1098963C>A, 1099233C>A, 1099255C>A, 1136200C>A, 1314539C>A, 29738634C>A, 29798634C>A, 8879C>A
C > A
3' UTR
No VIP available CA VA
rs17179108 *126C>T, 1098921C>T, 1098971C>T, 1099241C>T, 1099263C>T, 1136208C>T, 1314547C>T, 29738642C>T, 29798642C>T, 8887C>T
C > T
3' UTR
No VIP available No Clinical Annotations available VA
rs17376848 1896T>C, 475992T>C, 67887542A>G, 97915624A>G, Phe632=, Phe632Phe
A > G
Synonymous
Phe632Phe
No VIP available CA VA
rs17626122 206474012T>C, 2958-6168T>C, 3054-6168T>C, 3075-6168T>C, 56683430T>C
T > C
Intronic
No VIP available No Clinical Annotations available VA
rs1799794 -260-1363A>G, -316A>G, 104179267T>C, 7557A>G, 85179267T>C
T > C
5' UTR
No VIP available No Clinical Annotations available VA
rs1801019 124456742G>C, 12530G>C, 30951888G>C, 590G>C, 638G>C, 843G>C, Gly213Ala, OPRT: Gly213Ala
G > C
Not Available
Gly213Ala
No VIP available No Clinical Annotations available VA
rs1801131 1040A>C, 11208431T>G, 11794419T>G, 1286A>C, 1409A>C, 16685A>C, A1298C, Glu347Ala, Glu429Ala, Glu470Ala, MTHFR:1298A>C
T > G
Not Available
Glu347Ala
No VIP available No Clinical Annotations available VA
rs1801133 11210333G>A, 11796321G>A, 14783C>T, 419C>T, 665C>T, 677C>T, 788C>T, A222V, Ala140Val, Ala222Val, Ala263Val, C677T, MTHFR: c.677C>T, MTHFR:667C>T, p.A222V
G > A
Not Available
Ala140Val
No VIP available No Clinical Annotations available VA
rs1801160 129-825C>T, 2194G>A, 620696G>A, 67742838C>T, 97770920C>T, Val732Ile
C > T
Missense
Val732Ile
No VIP available No Clinical Annotations available VA
rs1801265 39+37555C>T, 39+37555T>C, 42731T=, 42731T>C, 85C=, 85C>T, 85T=, 85T>C, 97883329A=, 97883329A>G, 98348885G=, 98348885G>A, Arg29=, Arg29Cys, Cys29=, Cys29Arg, DPYD*9A, DPYD:C29R, DYPD:T85C
A > G
Missense
Cys29Arg
No VIP available No Clinical Annotations available VA
rs1801274 12968387A>G, 161479745A>G, 497A>G, 500A>G, 9541A>G, FCGR2A:His131Arg
A > G
Missense
His167Arg
No VIP available No Clinical Annotations available VA
rs1801394 -172-1823T>C, 1-1823T>C, 147A>G, 66A>G, 6757A>G, 7860973A>G, 7870973A>G, Ile22Met, Ile49Met, MTRR 66A>G, MTRR:66A>G
A > G
Missense
Ile22Met
No VIP available No Clinical Annotations available VA
rs1805087 237048500A>G, 2756A>G, 30566279A>G, 94920A>G, Asp919Gly, MS 2756A>G, MS D919G, MTR:2756A>G, MTR:Asp919Gly
A > G
Missense
Asp919Gly
No VIP available No Clinical Annotations available VA
rs1885301 -1358A>G, -1360A>G, -1549A>G, -1549G>A, 101541053A>G, 3591A>G, 99781296A>G
A > G
5' Flanking
No VIP available CA VA
rs1979277 1303C>T, 1420C>T, 17835470G>A, 18232096G>A, 39761C>T, Leu435Phe, Leu474Phe, SHMT1 L435F
G > A
Missense
Leu435Phe
No VIP available No Clinical Annotations available VA
rs2010963 -634C>G, -94C>G, 43678350C>G, 43738350C>G, 5398C>G, VEGF-A 405 G/C, VEGFA:405G>C, VEGFA:C405G
C > G
5' UTR
No VIP available CA VA
rs2032582 186947T>A, 186947T>G, 2677A, 2677G, 2677T, 2677T>A, 2677T>G, 3095G>T/A, 87160618A>C, 87160618A>T, 87531302A>C, 87531302A>T, 893 Ala, 893 Ser, 893 Thr, ABCB1*7, ABCB1: 2677G>T/A, ABCB1: 2677T/A>G, ABCB1: A893S, ABCB1: G2677T/A, ABCB1: c.2677G>T/A, ABCB1:2677G>A/T, ABCB1:2677G>T/A, ABCB1:A893T, Ala893Ser/Thr, MDR1, MDR1 G2677T/A, Ser893Ala, Ser893Thr, mRNA 3095G>T/A, p.Ala893Ser/Thr
A > T
A > C
Missense
Ser893Ala
Ser893Thr
No VIP available No Clinical Annotations available VA
rs20417 -899G>C, 186650321C>G, 38138963C>G, 4239G>C, COX-2 G-765C, PTGS2:-765G>C
C > G
5' Flanking
No VIP available CA VA
rs2070959 -7-254A>G, 108802A>G, 234602191A>G, 541A>G, 548450A>G, 855+10753A>G, 855+20756A>G, 855+56168A>G, 856-73489A>G, Thr181Ala
A > G
Intronic
Thr181Ala
No VIP available No Clinical Annotations available VA
rs2072671 20589208A>C, 20915701A>C, 79A>C, CDA: c.79A>C, CDA:79A>C, K27Q, Lys27Gln, p.Lys27Gln
A > C
Missense
Lys27Gln
No VIP available No Clinical Annotations available VA
rs2073016 -165T>C, 40960922T>C, 41020922T>C
T > C
5' Flanking
No VIP available No Clinical Annotations available VA
rs2074087 145799C>G, 16124232C>G, 16184232C>G, 2461-30C>G
C > G
Intronic
No VIP available No Clinical Annotations available VA
rs2074390 110910016G>A, 2608+151G>A, 2734+151G>A, 35457737G>A, 80977G>A
G > A
Intronic
No VIP available No Clinical Annotations available VA
rs2132065 15535971A>T, 75325304A>T
A > T
Not Available
No VIP available CA VA
rs2227983 147531G>A, 147531G>C, 147531G>T, 1562G>A, 1562G>C, 1562G>T, 4818624G>A, 4818624G>C, 4818624G>T, 55229255G>A, 55229255G>C, 55229255G>T, Arg521Lys, Arg521Met, Arg521Thr, EGFR: 497G/A, EGFR:1562G>A, EGFR:R497K, R497K, R521K
G > A
G > T
G > C
Missense
Arg521Thr
Arg521Lys
Arg521Met
No VIP available No Clinical Annotations available VA
rs2228099 150808889C>G, 2297531C>G, 45356G>C, 522G>C, 567G>C, Val174=, Val189=
C > G
Synonymous
Val174Val
No VIP available CA VA
rs2231142 13600044G>T, 32689C>A, 421C>A, 89052323G>T, ABCG2: Q141K, ABCG2:421C>A, ABCG2:Q141K, ABCG2:c.421C>A, Gln141Lys, rs2231142
G > T
Missense
Gln141Lys
No VIP available No Clinical Annotations available VA
rs2236225 1958G>A, 45908845G>A, 59087G>A, 64908845G>A, Arg653Gln, MTHFD1:1958G>A, MTHFD1:Arg653Gln, R653Q
G > A
Missense
Arg653Gln
No VIP available No Clinical Annotations available VA
rs2242047 1528C>T, 444223C>T, 85478696C>T, Arg510Cys, R510C, SLC28A1:1543G>A
C > T
Missense
Arg510Cys
No VIP available CA VA
rs225440 220+7029C>T, 277+7029C>T, 286+7029C>T, 292+7029C>T, 319+7029C>T, 43653053C>T, 647494C>T
C > T
Intronic
No VIP available CA VA
rs2273697 101563815G>A, 1249G>A, 1438G>A, 1440G>A, 26353G>A, 553G>A, 99804058G>A, ABCC2: c.1249G>A, ABCC2:1249G>A, ABCC2:V417I, ABCC2:c.1249G>A, Val185Ile, Val417Ile, p.V417I
G > A
Not Available
Val417Ile
No VIP available No Clinical Annotations available VA
rs2286455 16020162C>T, 70462G>A, 7201959C>T, 759G>A, 786G>A, Ala253=, Ala262=
C > T
Synonymous
Ala262Ala
No VIP available CA VA
rs2292997 -54G>A, 129+7980C>T, 183724072G>A, 90219218G>A
G > A
5' Flanking
No VIP available No Clinical Annotations available VA
rs2297595 226525A>G, 496A>G, 68137009T>C, 98165091T>C, DPYD:496A>G, DPYD:Met166Val, Met166Val
T > C
Missense
Met166Val
No VIP available No Clinical Annotations available VA
rs2302273 -302C>T, 10698182G>A, 149535255G>A, 5168C>T
G > A
5' UTR
No VIP available CA VA
rs2302821 *9T>G, 132501881A>C, 61666413A>C
A > C
3' UTR
No VIP available CA VA
rs2306283 14089862A>G, 21329738A>G, 388A>G, 50611A>G, Asn130Asp, SLCO1B1*1B
A > G
Missense
Asn130Asp
No VIP available No Clinical Annotations available VA
rs2401863 1366+79G>T, 38943G>T, 71456188G>T, 90456188G>T
G > T
Intronic
No VIP available No Clinical Annotations available VA
rs2465403 120090827G>A, 149-11092G>A, 33364376G>A
G > A
Intronic
No VIP available No Clinical Annotations available VA
rs2470890 +, 1548C>T, 1548T=, 1548T>C, 295T>C, 37544C>T, 74755085T=, 74755085T>C, 75047426C>T, Asn516=, CYP1A2*1B, CYP1A2:1545T>C, CYP1A2:1548T>C, CYP1A2:5347T>C, CYP1A2:Asn516Asn, CYP1A2:Ex7
T > C
Synonymous
Asn516Asn
No VIP available CA VA
rs25487 1196A>G, 16323944T>C, 44055726T>C, Gln399Arg, XRCC1 Arg399Gln, XRCC1:Arg399Gln
T > C
Missense
Gln399Arg
No VIP available CA VA
rs2612091 496-227G>A, 673607C>T, 683607C>T, 742-227G>A, 805-227G>A
C > T
Intronic
No VIP available No Clinical Annotations available VA
rs2661280 *3757C>G, 14602017G>C, 163113375G>C, 64589C>G
G > C
3' UTR
No VIP available CA VA
rs2741171 194-3332A>G, 257-3332A>G, 63+5783A>G, 690687T>C, 700687T>C
T > C
Intronic
No VIP available No Clinical Annotations available VA
rs2912024 6628899C>T, 6638899C>T
C > T
Not Available
No VIP available No Clinical Annotations available VA
rs2928607 6628710C>G, 6638710C>G
C > G
Not Available
No VIP available No Clinical Annotations available VA
rs2928608 6629024T>C, 6639024T>C
T > C
Not Available
No VIP available No Clinical Annotations available VA
rs2928609 6629118T>C, 6639118T>C
T > C
Not Available
No VIP available No Clinical Annotations available VA
rs2936519 6629240G>A, 6639240G>A
G > A
Not Available
No VIP available CA VA
rs2965667 10204857A>T, 17444733A>T
A > T
Not Available
No VIP available No Clinical Annotations available VA
rs2978926 6629425A>G, 6639425A>G
A > G
Not Available
No VIP available No Clinical Annotations available VA
rs2978931 6628081C>A, 6638081C>A
C > A
Not Available
No VIP available CA VA
rs3025039 *171C>T, *237C>T, *253C>T, 19584C>T, 43692536C>T, 43752536C>T, VEGFA:C936T
C > T
3' UTR
No VIP available No Clinical Annotations available VA
rs3130 *1078A>G, 120686A>G, 15969938T>C, 7151735T>C
T > C
3' UTR
No VIP available No Clinical Annotations available VA
rs3136228 -152-405T>G, 26831703T>G, 4531T>G, 48009816T>G
T > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs3212948 18192580G>C, 321+74C>G, 45924362G>C, 62725C>G
G > C
Intronic
No VIP available No Clinical Annotations available VA
rs3215133 1032+107delA, 150802273delT, 2290915delT, 51972delA, 987+107delA
T > -
Intronic
No VIP available No Clinical Annotations available VA
rs329007 1053+99G>A, 9512606G>A, 9522606G>A
G > A
Intronic
No VIP available No Clinical Annotations available VA
rs34116584 241808314C>A, 241808314C>G, 241808314C>T, 32C>A, 32C>G, 32C>T, 5153C>A, 5153C>G, 5153C>T, 999182C>A, 999182C>G, 999182C>T, Pro11Arg, Pro11His, Pro11Leu
C > G
C > T
C > A
Missense
Pro11Arg
Pro11Leu
Pro11His
No VIP available CA VA
rs34489327 *145-370delT, *145-370delTinsCTTTAA, *449delA, *449delAinsTTAAAG, *859delT, *859delTinsCTTTAA, 20843delA, 20843delAinsTTAAAG, 6-basepair 3'UTR repeat, 663446delA, 663446delAinsTTAAAG, 673446delA, 673446delAinsTTAAAG, TYMS:-TTAAAG, TYMS:1494del, TYMS:1494del TTAAAG, ttaaag
T > -
T > TTAAAG
3' UTR
No VIP available CA VA
rs34743033 28-bp tandem repeats, CCGCGCCACTTGGCCTGCCTCCGTCCCG, TSER*2, TSER*3, TYMS: 28 bp tandem repeat, TYMS: 2R, TYMS: TSER *2/*3, TYMS:TSER 28-basepair 5'UTR enhancer region repeat
CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC > CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC
CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC > CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC
CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC > CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC
Not Available
No VIP available No Clinical Annotations available VA
rs35569394 -2026delT, -2026delTinsTCCCACTCTTCCCACAGG, -2566delT, -2566delTinsTCCCACTCTTCCCACAGG, 3466delT, 3466delTinsTCCCACTCTTCCCACAGG, 43676418delT, 43676418delTinsTCCCACTCTTCCCACAGG, 43736418delT, 43736418delTinsTCCCACTCTTCCCACAGG
T > -
T > TCCCACTCTTCCCACAGG
Non-synonymous
No VIP available CA VA
rs371194629 *280_*281insATTTGT, *280_*281insATTTGTTCATGCCT, *291_*295insATTTGT, *291_*295insATTTGTTCATGCCT, *65_*66insATTTGT, *65_*66insATTTGTTCATGCCT, *65_*67insATTTGT, *65_*67insATTTGTTCATGCCT, *65_*80insATTTGT, *65_*80insATTTGTTCATGCCT, *76_*80insATTTGT, *76_*80insATTTGTTCATGCCT, 1093275_1093276insATTTGT, 1093275_1093276insATTTGTTCATGCCT, 1093290_1093291insATTTGT, 1093290_1093291insATTTGTTCATGCCT, 1093570_1093585insATTTGT, 1093570_1093585insATTTGTTCATGCCT, 1093617_1093618insATTTGT, 1093617_1093618insATTTGTTCATGCCT, 1096416_1096431insATTTGT, 1096416_1096431insATTTGTTCATGCCT, 1098860_1098861insATTTGT, 1098860_1098861insATTTGTTCATGCCT, 1098910_1098911insATTTGT, 1098910_1098911insATTTGTTCATGCCT, 1099177_1099181insATTTGT, 1099177_1099181insATTTGTTCATGCCT, 1099202_1099203insATTTGT, 1099202_1099203insATTTGTTCATGCCT, 1136144_1136148insATTTGT, 1136144_1136148insATTTGTTCATGCCT, 1136835_1136850insATTTGT, 1136835_1136850insATTTGTTCATGCCT, 1314366_1314381insATTTGT, 1314366_1314381insATTTGTTCATGCCT, 1314472_1314474insATTTGT, 1314472_1314474insATTTGTTCATGCCT, 1612-1_1613insATTTGT, 1612-1_1613insATTTGTTCATGCCT, 1622_1626insATTTGT, 1622_1626insATTTGTTCATGCCT, 1680_1684insATTTGT, 1680_1684insATTTGTTCATGCCT, 1692-1_1692insATTTGT, 1692-1_1692insATTTGTTCATGCCT, 29798581_29798582insATTTGT, 29798581_29798582insATTTGTTCATGCCT, 29830804_29830805insATTTGT, 29830804_29830805insATTTGTTCATGCCT, 8826_8827insATTTGT, 8826_8827insATTTGTTCATGCCT
- > ATTTGTTCATGCCT
- > ATTTGT
3' UTR
No VIP available No Clinical Annotations available VA
rs3740066 101604207C>T, 3972C>T, 52408671C>T, 66745C>T, ABCC2:3972C>T, I1324I, Ile1324=
C > T
Synonymous
Ile1324Ile
No VIP available CA VA
rs3749438 183705184G>A, 591+374C>T, 90200330G>A
G > A
Intronic
No VIP available No Clinical Annotations available VA
rs3812718 166053034C>T, 166909544C>T, 25606G>A, 603-91G>A, 787-91G>A
C > T
Intronic
No VIP available No Clinical Annotations available VA
rs3913032 15547526A>C, 75336859A>C
A > C
Not Available
No VIP available No Clinical Annotations available VA
rs3918290 1905+1G>A, 476002G>A, 67887532C>T, 97915614C>T, DPYD*2A, DPYD:67887533 G>A, DPYD:IVS14 + 1G>A
C > T
Donor
No VIP available CA VA
rs396991 10872T>G, 13003184A>C, 158V/F, 161514542A>C, 176F/V, 523T>G, 526T>G, 631T>G, 634T>G, A559C, FCGR3A: V158F, Phe175Val, Phe176Val, Phe211Val, Phe212Val, T559G
A > C
Missense
Phe175Val
No VIP available CA VA
rs4133101 -1057T>C, 40669567T>C, 40679567T>C
T > C
5' Flanking
No VIP available No Clinical Annotations available VA
rs4148323 175755G>A, 211G>A, 234669144G>A, 61-6536G>A, 615403G>A, 856-6536G>A, 862-6536G>A, 868-6536G>A, Gly71Arg, UGT1A1*6, UGT1A1: G71R, UGT1A1:211G>A, UGT1A1:G211A, UGT1A1:Gly71Arg
G > A
Intronic
Gly71Arg
No VIP available No Clinical Annotations available VA
rs4149056 14091673T>C, 21331549T>C, 521T>C, 52422T>C, SLCO1B1*5, Val174Ala
T > C
Missense
Val174Ala
No VIP available No Clinical Annotations available VA
rs4243761 26282791G>T, 2717938G>T, 896-11481G>T
G > T
Intronic
No VIP available No Clinical Annotations available VA
rs425215 1007-898C>G, 43707101C>G, 701542C>G, 908-898C>G, 965-898C>G, 974-898C>G, 980-898C>G
C > G
Intronic
No VIP available No Clinical Annotations available VA
rs4377367 131724905C>T, 21473568C>T, 427+20697C>T
C > T
Intronic
No VIP available No Clinical Annotations available VA
rs4426527 1008384A>G, 1020A>G, 14355A>G, 241817516A>G, Ile340Met
A > G
Missense
Ile340Met
No VIP available CA VA
rs4444903 -382A>G, 110834110A>G, 35381831A>G, 5071A>G
A > G
5' UTR
No VIP available No Clinical Annotations available VA
rs45445694 *34+169_*34+196CGGGACGGAGGCAGGCCAAGTGGCGCGG[2][3][4][7][8][9], -97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], 2, 28-bp tandem repeats located in the TS enhancer region of 5'UTR, 5043_5070CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], 657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], TYMS:*2
CCGCGCCACTTGGCCTGCCTCCGTCCCG > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2
CCGCGCCACTTGGCCTGCCTCCGTCCCG > 4
CCGCGCCACTTGGCCTGCCTCCGTCCCG > 3
CCGCGCCACTTGGCCTGCCTCCGTCCCG > 8
CCGCGCCACTTGGCCTGCCTCCGTCCCG > 7
CCGCGCCACTTGGCCTGCCTCCGTCCCG > 9
5' UTR
No VIP available No Clinical Annotations available VA
rs4698803 110914427A>T, 2633A>T, 2735-1462A>T, 2759A>T, 35462148A>T, 85388A>T, Glu878Val, Glu920Val
A > T
Missense
Glu920Val
No VIP available CA VA
rs4702484 720+23431C>T, 7639860C>T, 7649860C>T
C > T
Intronic
No VIP available No Clinical Annotations available VA
rs4886410 45856201G>C, 75065644G>C
G > C
Not Available
No VIP available No Clinical Annotations available VA
rs4970722 39563T>A, 40-3123T>A, 68323971A>T, 98352053A>T
A > T
Intronic
No VIP available No Clinical Annotations available VA
rs5275 *427T>C, 11502T>C, 186643058A>G, 38131700A>G, COX-2 8473T>C, PTGS2 exon10+837T>C, PTGS2: 6498T>C, PTGS2:8473T>C
A > G
3' UTR
No VIP available No Clinical Annotations available VA
rs56038477 1236G>A, 352197G>A, 68011337C>T, 98039419C>T, Glu412=
C > T
Synonymous
Glu412Glu
No VIP available No Clinical Annotations available VA
rs562 *1243A>G, 183637845T>C, 90132991T>C
T > C
3' UTR
No VIP available No Clinical Annotations available VA
rs576523 12234718G>A, 160746076G>A
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs6072262 279+61G>A, 39704995G>A, 52534G>A, 9901087G>A
G > A
Intronic
No VIP available No Clinical Annotations available VA
rs61764370 *2505T>G, *2626T>G, 18120348A>C, 25360224A>C, 48631T>G, LCS6 (let-7 complementary sites 6)
A > C
3' UTR
No VIP available No Clinical Annotations available VA
rs6447003 15597581G>C, 4705G>C, 75386914G>C
G > C
Not Available
No VIP available No Clinical Annotations available VA
rs6533485 110927563G>C, 3166-1745G>C, 3169-1745G>C, 3292-1745G>C, 35475284G>C, 98524G>C
G > C
Intronic
No VIP available No Clinical Annotations available VA
rs67376798 2846A>T, 67519865T>A, 843669A>T, 97547947T>A, Asp949Val
T > A
Missense
Asp949Val
No VIP available No Clinical Annotations available VA
rs6759892 -7-776T>G, 108280T>G, 19T>G, 234601669T>G, 547928T>G, 855+10231T>G, 855+20234T>G, 855+55646T>G, 856-74011T>G, Ser7Ala
T > G
Intronic
Ser7Ala
No VIP available No Clinical Annotations available VA
rs6850557 110911015G>A, 2608+1150G>A, 2734+1150G>A, 35458736G>A, 81976G>A
G > A
Intronic
No VIP available CA VA
rs699947 -2055A>C, -2578, -2595A>C, 3437A>C, 43676389A>C, 43736389A>C, VEGF-A -2578 C/A, VEGFA:, VEGFA:C-2578A
A > C
5' Flanking
No VIP available CA VA
rs712829 -216G>T, 216G>T, 4676124G>T, 5031G>T, 55086755G>T, EGFR:-216G>T
G > T
5' UTR
No VIP available CA VA
rs712830 -191A>C, 191C>A, 4676149A>C, 5056A>C, 55086780A>C, EGFR:
A > C
5' UTR
No VIP available CA VA
rs717620 -24C>T, 101542578C>T, 5116C>T, 52347042C>T, ABCC2: 5'UTR, ABCC2:(-24)C>T, mRNA 118C>T
C > T
5' UTR
No VIP available CA VA
rs7325568 21798284C>T, 40818284C>T
C > T
Not Available
No VIP available No Clinical Annotations available VA
rs75017182 1129-5923C>G, 346167C>G, 68017367G>C, 98045449G>C
G > C
Intronic
No VIP available CA VA
rs7518660 37657361G>A, 58275G>A, 67685443G>A, 955+30G>A
G > A
Intronic
No VIP available No Clinical Annotations available VA
rs7548189 1906-19696G>T, 523903G>T, 67839631C>A, 97867713C>A
C > A
Intronic
No VIP available CA VA
rs76387818 67511318G>A, 97539400G>A
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs7687621 15460493T>C, 429-618T>C, 75249826T>C
T > C
Intronic
No VIP available CA VA
rs7699188 NC_000004.11, NG_032067.1, NM_001257386.1, NT_016354.19
G > A
Intronic
No VIP available No Clinical Annotations available VA
rs7952081 12630728G>A, 67324933G>A
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs8101143 13218938G>A, 134524G>A, 21956136G>A
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs8175347 233760235_233760236TA[5][6][7][8], 5-TA insertion in promoter, 7-TA insertion in promoter, 8-TA insertion in promoter, UGT1A1*28, UGT1A1*36, UGT1A1*37, microsatellite, short tandem repeat
(TA)6 > (TA)8
(TA)6 > (TA)5
(TA)6 > (TA)7
Not Available
No VIP available No Clinical Annotations available VA
rs833061 -1498C>T, -460, -958C>T, 43677486C>T, 43737486C>T, 4534C>T, VEGF-A -460 C/T, VEGFA:C-460T, VEGFA:T-1498C
C > T
5' Flanking
No VIP available CA VA
rs861539 104165753G>A, 1651-1239G>A, 1782-1239G>A, 21071C>T, 722C>T, 75229G>A, 85165753G>A, Thr241Met
G > A
Intronic
Thr241Met
No VIP available CA VA
rs885036 3978623A>G, 95-9860T>C, 99304794A>G
A > G
Intronic
No VIP available No Clinical Annotations available VA
rs895819 -119A>C, -119A>G, -119A>T, -189A>C, -189A>G, -189A>T, 13947292T>A, 13947292T>C, 13947292T>G, 182A>C, 182A>G, 182A>T, 40A>C, 40A>G, 40A>T, 5210094T>A, 5210094T>C, 5210094T>G
T > G
T > C
T > A
5' Flanking
No VIP available No Clinical Annotations available VA
rs929446 110883344C>T, 1186+203C>T, 1312+203C>T, 35431065C>T, 54305C>T
C > T
Intronic
No VIP available CA VA
rs9344 *1365+4648C>T, 12038G>A, 14768705G>A, 69462910G>A, 723G>A, CCND1 (A870G), CCND1:870G>A, Pro241=, rs603965
G > A
Intronic
Pro241Pro
No VIP available CA VA
rs9380142 *278A>G, 1099073G>G, 1099123A>G, 1099393A>G, 1099415G>G, 1136360A>G, 1314699A>G, 29738794A>G, 29798794A>G, 9039A>G
A > G
3' UTR
No VIP available CA VA
rs9996584 15632628A>G, 39752A>G, 75421961A>G
A > G
Not Available
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 147

Overview

Alternate Names: 
Synonym
Cancer, Colorectal; Cancers, Colorectal; Carcinoma, Colorectal; Carcinomas, Colorectal; Colorectal Cancer; Colorectal Cancers; Colorectal Carcinoma; Colorectal Carcinomas; Colorectal Neoplasm; Colorectal Tumor; Colorectal Tumors; Neoplasm of large intestine; Neoplasm, Colorectal; Neoplasms, Colorectal; Tumor of large intestine; Tumor, Colorectal; Tumors, Colorectal; Tumour of large intestine
PharmGKB Accession Id: PA446108
External Vocabularies

Curated Information ?

EvidenceGene
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ABCB1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ABCC1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ABCC2
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ABCC5
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ABCG1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ABCG2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABL1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABLIM2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ACE
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ACTA2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ACTC1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ADCY2
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
AGXT
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
AHR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ALK
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ALOX12
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ANXA11
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
AP3M2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
APC
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
APOB
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
APOBEC2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
APOE
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
APPBP2
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
AREG
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ARHGEF4
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ARNT
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
AURKB
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BCL2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BCR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BMP4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BPTF
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BRAF
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BRCA1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BRCA2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
C10orf11
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
C18orf56
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CACNA1S
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CBS
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CCND1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CD33
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CD52
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CDA
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CDH1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CDH10
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CDK8
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CDKN2A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CEP290
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CES1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CES2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CFTR
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CLCN6
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
COL3A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
COLEC10
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CRAC1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CSK
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CSPG4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CSPP1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CTDSPL
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CTH
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CTNNB1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CXCL8
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CXCR2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CXCR4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP1A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CYP1A2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP1B1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CYP2A6
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2C19
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2C8
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2C9
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2D6
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2W1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP3A4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP3A5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DAPK1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DFNB31
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DHFR
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
DPYD
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DPYS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DSC2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DSG2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DSP
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DTYMK
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DUT
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
E2F1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
EGF
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
EGFLAM
EGFR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
EIF1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
EML4
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ENOSF1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
EPHA5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ERBB2
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ERCC1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ERCC2
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
EREG
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ESR2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FAM73A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FANCM
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FASLG
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
FASTKD3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FBN1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
FCGR2A
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
FCGR3A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FDXR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FGD4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FGF1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FLT1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FMN1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FPGS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FZD3
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
G6PD
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GATA2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GGH
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GLA
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GLTSCR1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GPR133
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GREM1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTA1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
GSTM1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
GSTP1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTT1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HERC1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HIF1A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HLA-B
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
HLA-G
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HMGCR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HRAS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IGF1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IGF1R
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IGF2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IGFBP3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IGSF5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IL17F
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IL1RN
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
IL23R
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ISX
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KCNH2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KCNQ1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KDR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KIR2DL5A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KIR2DS1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KIR2DS5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KIR3DS1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KIT
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
KLC1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
KLC3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KMT2C
KRAS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
LAMB4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
LAMC3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
LDHA
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
LDLR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
LIFR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
LINS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
LMNA
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
LYRM5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MBTD1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MCPH1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MEN1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MET
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
MGAT4A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MGMT
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MIRLET7E
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MITF
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MLH1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MSH2
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
MSH6
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
MTHFD1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
MTHFR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MTOR
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
MTR
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
MTRR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MUC2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MUTYH
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MYBPC3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MYC
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MYH11
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MYH2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MYH7
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MYL2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MYL3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MYLK
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NAT1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NAT2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NF2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NFKB1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
NLGN1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NME1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NME2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NMT1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NOTCH3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NPEPPS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
NRAS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NT5C
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NTRK1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
OPRM1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
OR10AE3P
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
OTC
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
PARD3B
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PCDH15
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PCDH18
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PCSK9
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PDE4B
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PDGFA
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PDGFRA
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
PDGFRB
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PGR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PIK3C2B
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PIK3CA
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PKP2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PML
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PMS2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
POLE
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PPARD
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PPP1R3A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PRAM1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PRKAG2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PRKCZ
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PROC
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
PROM1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
PSMB3P
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PTCHD3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PTEN
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
PTGER4
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
PTGES
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
PTGS2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PTTG1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PXDN
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
RALBP1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
RB1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
RET
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
RGS5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
RHPN2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
RNF141
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
RRM1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
RRM2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
RYR1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
RYR2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SCG5
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SCN1A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SCN5A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SDHAF2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SDHB
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SDHC
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SDHD
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SEPT9
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SHMT1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SLC19A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC1A6
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SLC28A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC2A1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SLCO1B1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SMAD3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SMAD4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SMAD7
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SMARCA4
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SMARCAD1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SMURF2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SRGAP1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ST6GAL2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
STK11
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
SULT1A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
TDP1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TGFBR1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TGFBR2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TK1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TMEM43
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TNNI3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TNNT2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TNR
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
TOP1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TOP2A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TP53
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TPM1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TPMT
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TPO
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TREX2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TRPV1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TSC1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TSC2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TSPO
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
TYMP
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
TYMS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
UCK2
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UGT1A
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
UGT1A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
UGT1A10
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
UGT1A3
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
UGT1A4
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
UGT1A5
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UGT1A6
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UGT1A7
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
UGT1A8
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UGT1A9
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
UMPS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
UNG
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
UPB1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
UPP1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
VEGFA
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
VHL
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
VKORC1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
WT1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
XPA
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
XPO5
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
XRCC1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
XRCC3

Curated Information ?

Evidence Drug
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
abacavir
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
alemtuzumab
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
alfentanil
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
amitriptyline
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
anastrozole
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
aripiprazole
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
arsenic trioxide
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
aspirin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
atomoxetine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
atorvastatin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
azathioprine
No Dosing Guideline available DL CA VA No VIP available No VIP available
bevacizumab
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
bilirubin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
boceprevir
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
busulfan
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
caffeine
No Dosing Guideline available DL CA VA No VIP available No VIP available
capecitabine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
carbamazepine
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
carboplatin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
carisoprodol
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
carvedilol
No Dosing Guideline available DL CA VA No VIP available No VIP available
celecoxib
No Dosing Guideline available DL CA VA No VIP available No VIP available
cetuximab
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
cevimeline
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
chloroquine
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ciprofloxacin
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
cisplatin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
citalopram
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
clobazam
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
clomipramine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
clopidogrel
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
clozapine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
codeine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
crizotinib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
cyanocobalamin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
cyclophosphamide
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
cyclosporine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
dactinomycin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
dapsone
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
dasatinib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
daunorubicin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
desipramine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
dextromethorphan
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
diazepam
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
docetaxel
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
doxepin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
doxorubicin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
epirubicin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
erlotinib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
esomeprazole
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ethanol
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
exemestane
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
flavopiridol
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
fluorouracil
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
fluoxetine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
flurbiprofen
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
folic acid
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
fulvestrant
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
gefitinib
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
gemcitabine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
gemtuzumab ozogamicin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
hydralazine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
iloperidone
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
imatinib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
imipramine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
indacaterol
No Dosing Guideline available DL CA VA No VIP available No VIP available
irinotecan
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
isoniazid
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ivacaftor
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
lapatinib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
lenalidomide
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
letrozole
No Dosing Guideline available DL CA VA No VIP available No VIP available
leucovorin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
levonorgestrel
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
maraviroc
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
mercaptopurine
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
methotrexate
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
metoprolol
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
modafinil
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
morphine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
mycophenolate mofetil
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
nelfinavir
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
nilotinib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
norethindrone
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
nortriptyline
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
olanzapine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
omeprazole
No Dosing Guideline available DL CA VA No VIP available No VIP available
oxaliplatin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
paclitaxel
No Dosing Guideline available DL CA VA No VIP available No VIP available
panitumumab
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
pantoprazole
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
paroxetine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
peginterferon alfa-2b
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
pemetrexed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
perphenazine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
pertuzumab
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
phenytoin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
pimozide
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
platinum
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
prasugrel
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
pravastatin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
primaquine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
propafenone
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
propranolol
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
protriptyline
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
pyridoxine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
quinidine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
rabeprazole
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
raltitrexed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ramipril
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
rasburicase
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
regorafenib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
rifampin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
risperidone
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
rituximab
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
rofecoxib
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
s 1 (combination)
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
simvastatin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
sirolimus
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SN-38
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
sorafenib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
sunitinib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
tacrolimus
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
tamoxifen
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
tegafur
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
telaprevir
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
temsirolimus
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
terbinafine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
testosterone
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
tetrabenazine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
thioguanine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
thioridazine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ticagrelor
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
timolol
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
tiotropium
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
tolterodine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
toremifene
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
tramadol
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
trastuzumab
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
tretinoin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
trimipramine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
valproic acid
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
vatalanib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
vemurafenib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
venlafaxine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
vincristine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
vinorelbine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
voriconazole
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
warfarin

Relationships from National Drug File - Reference Terminology (NDF-RT)

May Treat
No related diseases are available

Publications related to Colorectal Neoplasms: 281

No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Meta-analysis comparing the efficacy of anti-EGFR monoclonal antibody therapy between KRAS G13D and other KRAS mutant metastatic colorectal cancer tumours. European journal of cancer (Oxford, England : 1990). 2016. Rowland Andrew, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Improvement of a predictive model in ovarian cancer patients submitted to platinum-based chemotherapy: implications of a GST activity profile. European journal of clinical pharmacology. 2016. Pereira Deolinda, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Correlation of UGT1A1(*)28 and (*)6 polymorphisms with irinotecan-induced neutropenia in Thai colorectal cancer patients. Drug metabolism and pharmacokinetics. 2015. Atasilp Chalirmporn, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BRAF in metastatic colorectal cancer: the future starts now. Pharmacogenomics. 2015. Orlandi Armando. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Significant effect of VEGFA polymorphisms on the clinical outcome of metastatic colorectal cancer patients treated with FOLFIRI-cetuximab. Pharmacogenomics. 2015. Rollin Jérôme, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Phase II study of single-agent cetuximab in KRAS G13D mutant metastatic colorectal cancer. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO. 2015. Schirripa M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Beating the odds: efficacy and toxicity of DPD-driven adaptive dosing of 5-FU in patients with digestive cancer. British journal of clinical pharmacology. 2015. Launay Manon, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Cetuximab treatment for metastatic colorectal cancer with KRAS p.G13D mutations improves progression-free survival. Molecular and clinical oncology. 2015. Osumi Hiroki, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ABCC5 and ABCG1 polymorphisms predict irinotecan-induced severe toxicity in metastatic colorectal cancer patients. Pharmacogenetics and genomics. 2015. Chen Sylvia, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
First-in-human, phase I study of elisidepsin (PM02734) administered as a 30-min or as a 3-hour intravenous infusion every three weeks in patients with advanced solid tumors. Investigational new drugs. 2015. Ratain Mark J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Next-Generation Sequencing Panels for the Diagnosis of Colorectal Cancer and Polyposis Syndromes: A Cost-Effectiveness Analysis. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2015. Gallego Carlos J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
DPD and UGT1A1 deficiency in colorectal cancer patients receiving triplet chemotherapy with fluoropyrimidines, oxaliplatin and irinotecan. British journal of clinical pharmacology. 2015. Falvella Felicia Stefania, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of Aspirin and NSAID Use With Risk of Colorectal Cancer According to Genetic Variants. JAMA. 2015. Nan Hongmei, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Clinical validation study of genetic markers for capecitabine efficacy in metastatic colorectal cancer patients. Pharmacogenetics and genomics. 2015. van Huis-Tanja Lieke H, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A novel UGT1 marker associated with better tolerance against irinotecan-induced severe neutropenia in metastatic colorectal cancer patients. The pharmacogenomics journal. 2015. Chen S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Germline TYMS genotype is highly predictive in patients with metastatic gastrointestinal malignancies receiving capecitabine-based chemotherapy. Cancer chemotherapy and pharmacology. 2015. Joerger M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genes involved in pericyte-driven tumor maturation predict treatment benefit of first-line FOLFIRI plus bevacizumab in patients with metastatic colorectal cancer. The pharmacogenomics journal. 2015. Volz N B, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Evaluation of association studies and meta-analyses of MTHFR gene polymorphisms in colorectal cancer. Pharmacogenomics. 2015. Haerian Batoul Sadat, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic markers of recurrence in colorectal cancer. Pharmacogenomics. 2015. Smolle Maria Anna, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Molecular biomarkers in colorectal carcinoma. Pharmacogenomics. 2015. Puerta-García Elena, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association between Polymorphisms in Vascular Endothelial Growth Factor Gene and Response to Chemotherapies in Colorectal Cancer: A Meta-Analysis. PloS one. 2015. Wang Lei, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GATA2 rs2335052 Polymorphism Predicts the Survival of Patients with Colorectal Cancer. PloS one. 2015. Liu Xijuan, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genome Wide Association Study for Predictors of Progression Free Survival in Patients on Capecitabine, Oxaliplatin, Bevacizumab and Cetuximab in First-Line Therapy of Metastatic Colorectal Cancer. PloS one. 2015. Pander Jan, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Glutathione S-Transferase Gene Polymorphisms and Treatment Outcome in Cervical Cancer Patients under Concomitant Chemoradiation. PloS one. 2015. Abbas Mohammad, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
HLA-G 3'UTR Polymorphisms Impact the Prognosis of Stage II-III CRC Patients in Fluoropyrimidine-Based Treatment. PloS one. 2015. Garziera Marica, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
A Phase I Study of UGT1A1 * 28/ * 6 Genotype-Directed Dosing of Irinotecan (CPT-11) in Korean Patients with Metastatic Colorectal Cancer Receiving FOLFIRI. Oncology. 2014. Kim Kyu-Pyo, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of the DNA repair pathways in advanced non-small cell lung cancer patients treated with platinum-based chemotherapy. Cancer letters. 2014. Sullivan Ivana, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
MTHFR-1298 A>C (rs1801131) is a predictor of survival in two cohorts of stage II/III colorectal cancer patients treated with adjuvant fluoropyrimidine chemotherapy with or without oxaliplatin. The pharmacogenomics journal. 2014. Cecchin E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Regorafenib (BAY 73-4506): antitumor and antimetastatic activities in preclinical models of colorectal cancer. International journal of cancer. Journal international du cancer. 2014. Schmieder Roberta, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A community-based multicenter trial of pharmacokinetically guided 5-fluorouracil dosing for personalized colorectal cancer therapy. The oncologist. 2014. Patel Jai N, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Prospective study of EGFR intron 1 (CA)n repeats variants as predictors of benefit from cetuximab and irinotecan in chemo-refractory metastatic colorectal cancer (mCRC) patients. The pharmacogenomics journal. 2014. Loupakis F, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variants in the glutathione S-transferase genes and survival in colorectal cancer patients after chemotherapy and differences according to treatment with oxaliplatin. Pharmacogenetics and genomics. 2014. Kap Elisabeth J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic research in partnership with American Indian and Alaska Native communities. Pharmacogenomics. 2014. Woodahl Erica L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
UGT1A1*28 polymorphisms: a potential pharmacological biomarker of irinotecan-based chemotherapies in colorectal cancer. Pharmacogenomics. 2014. Liu Xiang, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
X-ray repair cross-complementing 1 polymorphism and prognosis of platinum-based chemotherapy in gastric and colorectal cancer: a meta-analysis. Journal of gastroenterology and hepatology. 2014. Wu Hongju, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The role of IVS14+1 G > A genotype detection in the dihydropyrimidine dehydrogenase gene and pharmacokinetic monitoring of 5-fluorouracil in the individualized adjustment of 5-fluorouracil for patients with local advanced and metastatic colorectal cancer: a preliminary report. European review for medical and pharmacological sciences. 2014. Cai X, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A candidate gene study of capecitabine-related toxicity in colorectal cancer identifies new toxicity variants at DPYD and a putative role for ENOSF1 rather than TYMS. Gut. 2014. Rosmarin Dan, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic Markers of Toxicity From Capecitabine and Other Fluorouracil-Based Regimens: Investigation in the QUASAR2 Study, Systematic Review, and Meta-Analysis. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2014. Rosmarin Dan, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacokinetics, safety, and efficacy of FOLFIRI plus bevacizumab in Japanese colorectal cancer patients with UGT1A1 gene polymorphisms. Journal of clinical pharmacology. 2014. Suenaga Mitsukuni, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of single nucleotide polymorphisms in MTHFR and ABCG2 with the different efficacy of first-line chemotherapy in metastatic colorectal cancer. Medical oncology (Northwood, London, England). 2014. Zhao Jing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Prognostic advantage of irinotecan dose escalation according to uridine diphosphate glucuronosyltransferase 1A1 (UGT1A1) genotyping in patients with metastatic colorectal cancer treated with bevacizumab combined with 5-fluorouracil/leucovorin with irinotecan in a first-line setting. Translational research : the journal of laboratory and clinical medicine. 2014. Lu Chien-Yu, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of DNA repair gene polymorphisms in non-small-cell lung carcinoma patients on platinum-based chemotherapy. Genetics and molecular research : GMR. 2014. Zhang L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Clinical significance of UGT1A1 gene polymorphisms on irinotecan-based regimens as the treatment in metastatic colorectal cancer. OncoTargets and therapy. 2014. Li Minmin, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
ERCC1 Cys8092Ala and XRCC1 Arg399Gln polymorphisms predict progression-free survival after curative radiotherapy for nasopharyngeal carcinoma. PloS one. 2014. Jin Hekun, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic diversity of the KIR/HLA system and outcome of patients with metastatic colorectal cancer treated with chemotherapy. PloS one. 2014. De Re Valli, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Germline variation in colorectal risk Loci does not influence treatment effect or survival in metastatic colorectal cancer. PloS one. 2014. Sanoff Hanna K, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thymidylate synthase genotype-directed chemotherapy for patients with gastric and gastroesophageal junction cancers. PloS one. 2014. Goff Laura W, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Germline Variants and Advanced Colorectal Adenomas: Adenoma Prevention with Celecoxib Trial Genome-wide Association Study. Clinical cancer research : an official journal of the American Association for Cancer Research. 2013. Wang Jiping, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Excision Repair Cross-Complementation group 1 (ERCC1) C118T SNP does not affect cellular response to oxaliplatin. Mutation research. 2013. van Huis-Tanja Lieke H, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetics of ABC and SLC transporters in metastatic colorectal cancer patients receiving first-line FOLFIRI treatment. Pharmacogenetics and genomics. 2013. De Mattia Elena, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Potential of dihydropyrimidine dehydrogenase genotypes in personalizing 5-fluorouracil therapy among colorectal cancer patients. Therapeutic drug monitoring. 2013. Teh Lay Kek, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
S-1 plus irinotecan and oxaliplatin for the first-line treatment of patients with metastatic colorectal cancer: a prospective phase II study and pharmacogenetic analysis. British journal of cancer. 2013. Kim S Y, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphism of TS 3'-UTR predicts survival of Chinese advanced gastric cancer patients receiving first-line capecitabine plus paclitaxel. Clinical & translational oncology : official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico. 2013. Gao J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
PharmGKB summary: very important pharmacogene information for the epidermal growth factor receptor. Pharmacogenetics and genomics. 2013. Hodoglugil Ugur, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Intergenic polymorphisms in the amphiregulin gene region as biomarkers in metastatic colorectal cancer patients treated with anti-EGFR plus irinotecan. The pharmacogenomics journal. 2013. Sebio A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ACMG recommendations for reporting of incidental findings in clinical exome and genome sequencing. Genetics in medicine : official journal of the American College of Medical Genetics. 2013. Green Robert C, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic variants in the DPYD, TYMS, CDA and MTHFR genes are clinically significant predictors of fluoropyrimidine toxicity. British journal of cancer. 2013. Loganayagam A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Impact of genetic polymorphisms on adenoma recurrence and toxicity in a COX2 inhibitor (celecoxib) trial: results from a pilot study. Pharmacogenetics and genomics. 2013. Kraus Sarah, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of ABCB1 genetic polymorphisms with susceptibility to colorectal cancer and therapeutic prognosis. Pharmacogenomics. 2013. Wu Huizhe, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Gender-specific profiling in SCN1A polymorphisms and time-to-recurrence in patients with stage II/III colorectal cancer treated with adjuvant 5-fluoruracil chemotherapy. The pharmacogenomics journal. 2013. Benhaim L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Implications of Genome-Wide Association Studies in Cancer Therapeutics. British journal of clinical pharmacology. 2013. Patel Jai N, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Challenges in pharmacogenetics. European journal of clinical pharmacology. 2013. Cascorbi Ingolf, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic analysis of adjuvant FOLFOX for Korean patients with colon cancer. Cancer chemotherapy and pharmacology. 2013. Lee Kyung-Hun, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Exome Re-Sequencing Identifies Potential Tumor Suppressor Genes that Predispose to Colorectal Cancer. Human mutation. 2013. Smith Christopher G, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Refining the UGT1A haplotype associated with irinotecan-induced hematological toxicity in metastatic colorectal cancer patients treated with 5-fluorouracil/irinotecan-based regimens. The Journal of pharmacology and experimental therapeutics. 2013. Lévesque Eric, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The LCS6 polymorphism in the binding site of let-7 microRNA to the KRAS 3'-untranslated region: its role in the efficacy of anti-EGFR-based therapy in metastatic colorectal cancer patients. Pharmacogenetics and genomics. 2013. Sebio Ana, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Association of UGT1A1*28 polymorphisms with irinotecan-induced toxicities in colorectal cancer: a meta-analysis in Caucasians. The pharmacogenomics journal. 2013. Liu X, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
MTHFR polymorphisms and capecitabine-induced toxicity in patients with metastatic colorectal cancer. Pharmacogenetics and genomics. 2013. van Huis-Tanja Lieke H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Association between KRAS codon 13 mutations and clinical response to anti-EGFR treatment in patients with metastatic colorectal cancer: results from a meta-analysis. Cancer chemotherapy and pharmacology. 2013. Chen Jian, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Role of immunoglobulin G fragment C receptor polymorphism-mediated antibody-dependant cellular cytotoxicity in colorectal cancer treated with cetuximab therapy. The pharmacogenomics journal. 2013. Negri F V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Influence of KRAS p.G13D mutation in patients with metastatic colorectal cancer treated with cetuximab. Clinical colorectal cancer. 2012. Gajate Pablo, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Clinical outcome of Japanese metastatic colorectal cancer patients harbouring the KRAS p.G13D mutation treated with cetuximab + irinotecan. Japanese journal of clinical oncology. 2012. Bando Hideaki, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A Novel Fully Automated Molecular Diagnostic System (AMDS) for Colorectal Cancer Mutation Detection. PloS one. 2013. Kitano Shiro, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Evaluating predictive pharmacogenetic signatures of adverse events in colorectal cancer patients treated with fluoropyrimidines. PloS one. 2013. Jennings Barbara A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SLCO1B1 and SLC19A1 Gene Variants and Irinotecan-Induced Rapid Response and Survival: A Prospective Multicenter Pharmacogenetics Study of Metastatic Colorectal Cancer. PloS one. 2013. Huang Liu, et al. PubMed
Association of KRAS G13D tumor mutations with outcome in patients with metastatic colorectal cancer treated with first-line chemotherapy with or without cetuximab. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2012. Tejpar Sabine, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A prospective validation pharmacogenomic study in the adjuvant setting of colorectal cancer patients treated with the 5-fluorouracil/leucovorin/oxaliplatin (FOLFOX4) regimen. The pharmacogenomics journal. 2012. Cecchin E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Effect of genetic polymorphisms on therapeutic response and clinical outcomes in pancreatic cancer patients treated with gemcitabine. Pharmacogenomics. 2012. Woo Hye In, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic variants of thiopurine and folate metabolic pathways determine 6-MP-mediated hematological toxicity in childhood ALL. Pharmacogenomics. 2012. Dorababu Patchva, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics and pharmacogenomics: role of mutational analysis in anti-cancer targeted therapy. The pharmacogenomics journal. 2012. Savonarola A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Intratumoral expression profiling of genes involved in angiogenesis in colorectal cancer patients treated with chemotherapy plus the VEGFR inhibitor PTK787/ZK 222584 (vatalanib). The pharmacogenomics journal. 2012. Wilson P M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Multifactorial pharmacogenetic analysis in colorectal cancer patients receiving 5-fluorouracil-based therapy together with cetuximab-irinotecan. British journal of clinical pharmacology. 2012. Etienne-Grimaldi Marie-Christine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Absence of transcriptomic signature of response to chemotherapy in metastatic colorectal carcinoma patients. Pharmacogenomics. 2012. Laroche-Clary Audrey, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association between polymorphisms of ERCC1 and survival in epithelial ovarian cancer patients with chemotherapy. Pharmacogenomics. 2012. Yan Li, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms in key methotrexate pathway genes are associated with response to treatment in rheumatoid arthritis patients. The pharmacogenomics journal. 2012. Owen S A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenomics in colorectal cancer: a genome-wide association study to predict toxicity after 5-fluorouracil or FOLFOX administration. The pharmacogenomics journal. 2012. Fernandez-Rozadilla C, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Impact of SHMT1 polymorphism on the clinical outcome of patients with metastatic colorectal cancer treated with first-line FOLFIRI+bevacizumab. Pharmacogenetics and genomics. 2012. Budai Barna, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Combinatorial therapies to overcome B-RAF inhibitor resistance in melanomas. Pharmacogenomics. 2012. Lo Roger S. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genomic approach towards personalized anticancer drug therapy. Pharmacogenomics. 2012. Midorikawa Yutaka, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenomics of cisplatin-based chemotherapy in ovarian cancer patients of different ethnic origins. Pharmacogenomics. 2012. Khrunin Andrey, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacogenetic profiling of CD133 is associated with response rate (RR) and progression-free survival (PFS) in patients with metastatic colorectal cancer (mCRC), treated with bevacizumab-based chemotherapy. The pharmacogenomics journal. 2012. Pohl A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association between DNA-repair polymorphisms and survival in pancreatic cancer patients treated with combination chemotherapy. Pharmacogenomics. 2011. Giovannetti Elisa, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Association of eleven common, low-penetrance colorectal cancer susceptibility genetic variants at six risk Loci with clinical outcome. PloS one. 2012. Hoskins Janelle M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Meta-analysis on pharmacogenetics of platinum-based chemotherapy in non small cell lung cancer (NSCLC) patients. PloS one. 2012. Yin Ji-Ye, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Modeling the 5-fluorouracil area under the curve versus dose relationship to develop a pharmacokinetic dosing algorithm for colorectal cancer patients receiving FOLFOX6. The oncologist. 2012. Kaldate Rajesh R, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic predictors for EGFR-inhibitor-associated skin toxicity. The pharmacogenomics journal. 2011. Parmar S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Potential responders to FOLFOX therapy for colorectal cancer by Random Forests analysis. British journal of cancer. 2011. Tsuji S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Single nucleotide polymorphisms of ABCC5 and ABCG1 transporter genes correlate to irinotecan-associated gastrointestinal toxicity in colorectal cancer patients: A DMET microarray profiling study. Cancer biology & therapy. 2011. Di Martino Maria Teresa, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of Oxaliplatin as Adjuvant Treatment in Colon Carcinoma: Are Single Nucleotide Polymorphisms in GSTP1, ERCC1, and ERCC2 Good Predictive Markers?. Molecular diagnosis & therapy. 2011. Fariña Sarasqueta Arantza, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic analyses of cisplatin-induced nephrotoxicity indicate a renoprotective effect of ERCC1 polymorphisms. Pharmacogenomics. 2011. Tzvetkov Mladen V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Somatic deletions of genes regulating MSH2 protein stability cause DNA mismatch repair deficiency and drug resistance in human leukemia cells. Nature medicine. 2011. Diouf Barthelemy, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The association of polymorphisms in 5-fluorouracil metabolism genes with outcome in adjuvant treatment of colorectal cancer. Pharmacogenomics. 2011. Afzal Shoaib, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thymidylate synthase expression and genotype have no major impact on the clinical outcome of colorectal cancer patients treated with 5-fluorouracil. Pharmacological research : the official journal of the Italian Pharmacological Society. 2011. Vignoli Marina, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Nucleotide excision repair gene variants and association with survival in osteosarcoma patients treated with neoadjuvant chemotherapy. The pharmacogenomics journal. 2011. Biason P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Vascular endothelial growth factor polymorphisms and clinical outcome in colorectal cancer patients treated with irinotecan-based chemotherapy and bevacizumab. The pharmacogenomics journal. 2011. Koutras A K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TS and ERCC-1 mRNA expressions and clinical outcome in patients with metastatic colon cancer in CONFIRM-1 and -2 clinical trials. The pharmacogenomics journal. 2011. Grimminger P P, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
EGF61 polymorphism predicts complete pathologic response to cetuximab-based chemoradiation independent of KRAS status in locally advanced rectal cancer patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Hu-Lieskovan Siwen, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
VEGF -460T ¿ C polymorphism and its association with VEGF expression and outcome to FOLFOX-4 treatment in patients with colorectal carcinoma. The pharmacogenomics journal. 2011. Chen M-H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Relationship between single nucleotide polymorphisms and haplotypes in DPYD and toxicity and efficacy of capecitabine in advanced colorectal cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Deenen Maarten J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Frequency of KRAS, BRAF, and NRAS mutations in colorectal cancer. Genes, chromosomes & cancer. 2011. Vaughn Cecily P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Identification of potential pharmacogenomic markers of clinical efficacy of 5-fluorouracil in colorectal cancer. International journal of cancer. Journal international du cancer. 2011. Nobili Stefania, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic profiling of Aurora kinase B is associated with overall survival in metastatic colorectal cancer. The pharmacogenomics journal. 2011. Pohl A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Novel chemosensitive single-nucleotide polymorphism markers to targeted regimens in metastatic colorectal cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Kim Jin C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A phase I study of sirolimus and bevacizumab in patients with advanced malignancies. European journal of cancer (Oxford, England : 1990). 2011. Cohen E E W, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
RNA expression of the molecular signature genes for metastasis in colorectal cancer. Oncology reports. 2011. Carvalho Luciano, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Systems pharmacology assessment of the 5-fluorouracil pathway. Pharmacogenomics. 2011. Muhale Filipe A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Use of a comprehensive panel of biomarkers to predict response to a fluorouracil-oxaliplatin regimen in patients with metastatic colorectal cancer. Pharmacogenomics. 2011. Lamas Maria J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Associations of various gene polymorphisms with toxicity in colorectal cancer patients receiving oral uracil and tegafur plus leucovorin: a prospective study. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO. 2011. Tsunoda A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genetic variation in the bioactivation pathway for polycyclic hydrocarbons and heterocyclic amines in relation to risk of colorectal neoplasia. Carcinogenesis. 2011. Wang Hansong, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A POLYMORPHISM IN THE CYTIDINE DEAMINASE PROMOTER PREDICTS SEVERE CAPECITABINE-INDUCED HAND-FOOT SYNDROME. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Caronia Daniela, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Prediction of irinotecan and 5-fluorouracil toxicity and response in patients with advanced colorectal cancer. The pharmacogenomics journal. 2011. Glimelius B, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The predictive value of genetic variations in the vascular endothelial growth factor A gene in metastatic colorectal cancer. The pharmacogenomics journal. 2011. Hansen T F, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic Tailoring of Irinotecan-based First-line Chemotherapy in Metastatic Colorectal Cancer: Results of a Pilot Study. Anticancer research. 2011. Freyer Gilles, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Associations between gene polymorphisms of thymidylate synthase with its protein expression and chemosensitivity to 5-fluorouracil in pancreatic carcinoma cells. Chinese medical journal. 2011. Zhang Qiang, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
THYMIDYLATE SYNTHASE AND EXCISION REPAIR-CROSS-COMPLEMENTING GROUP-1 AS PREDICTORS OF RESPONSIVENESS IN MESOTHELIOMA PATIENTS TREATED WITH PEMETREXED-CARBOPLATIN. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Zucali Paolo Andrea, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Multiple genetic polymorphisms in the prediction of clinical outcome of metastatic colorectal cancer patients treated with first-line FOLFOX-4 chemotherapy. Pharmacogenetics and genomics. 2011. Huang Ming-Yii, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gender-specific genomic profiling in metastatic colorectal cancer patients treated with 5-fluorouracil and oxaliplatin. Pharmacogenomics. 2011. Gordon Michael A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic tests in cancer chemotherapy: what physicians should know for clinical application. The Journal of pathology. 2011. Lee Soo-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic profiling and cetuximab outcome in patients with advanced colorectal cancer. BMC cancer. 2011. Dahan Laetitia, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomic contribution to drug response. Cancer journal (Sudbury, Mass.). 2011. Watson Roshawn G, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
X-Ray Cross-Complementing Group 1 and Thymidylate Synthase Polymorphisms Might Predict Response to Chemoradiotherapy in Rectal Cancer Patients. International journal of radiation oncology, biology, physics. 2010. Lamas Maria J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ABCB1 gene polymorphisms are associated with adverse reactions in fluoropyrimidine-treated colorectal cancer patients. Pharmacogenomics. 2010. Gonzalez-Haba Eva, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Value of gene polymorphisms as markers of 5-FU therapy response in stage III colon carcinoma: a pilot study. Cancer chemotherapy and pharmacology. 2010. Fariña-Sarasqueta Arantza, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thymidylate synthase germline polymorphisms in rectal cancer patients treated with neoadjuvant chemoradiotherapy based on 5-fluorouracil. Journal of cancer research and clinical oncology. 2010. Páez David, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Systematic review of pharmacoeconomic studies of pharmacogenomic tests. Pharmacogenomics. 2010. Beaulieu Mathieu, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Distribution of TYMS, MTHFR, p53 and MDR1 gene polymorphisms in patients with breast cancer treated with neoadjuvant chemotherapy. Cancer epidemiology. 2010. Henríquez-Hernández Luis Alberto, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thymidylate Synthase Gene Polymorphism Affects the Response to Preoperative 5-Fluorouracil Chemoradiation Therapy in Patients With Rectal Cancer. International journal of radiation oncology, biology, physics. 2010. Hur Hyuk, et al. PubMed
Association of KRAS p.G13D mutation with outcome in patients with chemotherapy-refractory metastatic colorectal cancer treated with cetuximab. JAMA. 2010. De Roock Wendy, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic modulation of the Let-7 microRNA binding to KRAS 3'-untranslated region and survival of metastatic colorectal cancer patients treated with salvage cetuximab-irinotecan. The pharmacogenomics journal. 2010. Graziano F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Ciprofloxacin-induced acute haemolytic anaemia in a patient with glucose-6-phosphate dehydrogenase Mediterranean deficiency: a case report. Annals of hematology. 2010. Sansone Stefano, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic predictors of adverse events and response to chemotherapy in metastatic colorectal cancer: results from North American Gastrointestinal Intergroup Trial N9741. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2010. McLeod Howard L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2W1 variant alleles in Caucasians and association of the CYP2W1 G541A (Ala181Thr) polymorphism with increased colorectal cancer risk. Pharmacogenomics. 2010. Gervasini Guillermo, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphisms within the folate pathway predict folate concentrations but are not associated with disease activity in rheumatoid arthritis patients on methotrexate. Pharmacogenetics and genomics. 2010. Stamp Lisa K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of primary miRNA polymorphic variants in metastatic colon cancer patients treated with 5-fluorouracil and irinotecan. The pharmacogenomics journal. 2010. Boni V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic variation in 3-hydroxy-3-methylglutaryl CoA reductase modifies the chemopreventive activity of statins for colorectal cancer. Cancer prevention research (Philadelphia, Pa.). 2010. Lipkin Steven M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Targeted cancer therapies in the twenty-first century: lessons from imatinib. Clinical pharmacology and therapeutics. 2010. Stegmeier F, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic assessment of toxicity and outcome in patients with metastatic colorectal cancer treated with LV5FU2, FOLFOX, and FOLFIRI: FFCD 2000-05. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2010. Boige Valérie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Polymorphisms in xenobiotic metabolizing enzymes and diet influence colorectal adenoma risk. Pharmacogenetics and genomics. 2010. Northwood Emma L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Oxaliplatin, irinotecan and capecitabine as first-line therapy in metastatic colorectal cancer (mCRC): a dose-finding study and pharmacogenomic analysis. British journal of cancer. 2010. Zarate R, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms and the efficacy and toxicity of cisplatin-based chemotherapy in ovarian cancer patients. The pharmacogenomics journal. 2010. Khrunin A V, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Methylenetetrahydrofolate reductase (MTHFR) gene polymorphisms and FOLFOX response in colorectal cancer patients. British journal of clinical pharmacology. 2010. Etienne-Grimaldi Marie-Christine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Colorectal cancer cell lines lack the molecular heterogeneity of clinical colorectal tumors. Clinical colorectal cancer. 2010. Auman James Todd, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genetic polymorphisms in GST genes and survival of colorectal cancer patients treated with chemotherapy. Pharmacogenomics. 2010. Funke Silvia, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms associated with 5-Fluorouracil-induced neurotoxicity. Chemotherapy. 2010. Kim Suk-Ran, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Variants in the dihydropyrimidine dehydrogenase, methylenetetrahydrofolate reductase and thymidylate synthase genes predict early toxicity of 5-fluorouracil in colorectal cancer patients. The Journal of international medical research. 2010. Kristensen M H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leveraging learning from a phase III colorectal cancer clinical trial: outcomes, methodology, meta-analysis and pharmacogenetics. Transactions of the American Clinical and Climatological Association. 2010. Goldberg Richard M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Association of molecular markers with toxicity outcomes in a randomized trial of chemotherapy for advanced colorectal cancer: the FOCUS trial. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2009. Braun Michael S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MTHFR polymorphisms and 5-FU-based adjuvant chemotherapy in colorectal cancer. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO. 2009. Afzal S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Prostaglandin synthase 2/cyclooxygenase 2 (PTGS2/COX2) 8473T>C polymorphism associated with prognosis for patients with colorectal cancer treated with capecitabine and oxaliplatin. Cancer chemotherapy and pharmacology. 2009. Kim Jong Gwang, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No evidence for variation in colorectal cancer risk associated with different types of postmenopausal hormone therapy. Clinical pharmacology and therapeutics. 2009. Hoffmeister M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Chemotherapy: Optimizing irinotecan regimens for colorectal cancer. Nature reviews. Clinical oncology. 2009. Yim Kein-Leong, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Common variations in ERCC2 are associated with response to cisplatin chemotherapy and clinical outcome in osteosarcoma patients. The pharmacogenomics journal. 2009. Caronia D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Investigation of inter-individual variability of the one-carbon folate pathway: a bioinformatic and genetic review. The pharmacogenomics journal. 2009. Carr D F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cost effectiveness of pharmacogenetic testing for uridine diphosphate glucuronosyltransferase 1A1 before irinotecan administration for metastatic colorectal cancer. Cancer. 2009. Gold Heather Taffet, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Cisplatin pharmacogenetics, DNA repair polymorphisms, and esophageal cancer outcomes. Pharmacogenetics and genomics. 2009. Bradbury Penelope A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MTHFR gene polymorphisms and response to chemotherapy in colorectal cancer: a meta-analysis. Pharmacogenomics. 2009. Zintzaras Elias, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Circulating methylated SEPT9 DNA in plasma is a biomarker for colorectal cancer. Clinical chemistry. 2009. deVos Theo, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Very important pharmacogene summary: sulfotransferase 1A1. Pharmacogenetics and genomics. 2009. Hildebrandt Michelle, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics and biomarkers in colorectal cancer. The pharmacogenomics journal. 2009. Strimpakos A S, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Predictors of survival and toxicity in patients on adjuvant therapy with 5-fluorouracil for colorectal cancer. British journal of cancer. 2009. Gusella M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms affecting clinical outcomes in epithelial ovarian cancer patients treated with taxanes and platinum compounds: a Korean population-based study. Gynecologic oncology. 2009. Kim Hee Seung, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Predictive role of the UGT1A1, UGT1A7, and UGT1A9 genetic variants and their haplotypes on the outcome of metastatic colorectal cancer patients treated with fluorouracil, leucovorin, and irinotecan. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2009. Cecchin Erika, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
UGT1A1*28 genotype predicts gastrointestinal toxicity in patients treated with intermediate-dose irinotecan. Pharmacogenomics. 2009. Ferraldeschi Roberta, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Methotrexate in pediatric osteosarcoma: response and toxicity in relation to genetic polymorphisms and dihydrofolate reductase and reduced folate carrier 1 expression. The Journal of pediatrics. 2009. Patiño-García Ana, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Prognostic significance of p53 codon 72 polymorphism differs with race in colorectal adenocarcinoma. Clinical cancer research : an official journal of the American Association for Cancer Research. 2009. Katkoori Venkat R, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
DNA repair gene polymorphisms predict favorable clinical outcome in advanced non-small-cell lung cancer. Clinical lung cancer. 2009. Kalikaki Aristea, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A transposon-based genetic screen in mice identifies genes altered in colorectal cancer. Science (New York, N.Y.). 2009. Starr Timothy K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Variations in the interleukin-1 receptor antagonist gene impact on survival of patients with advanced colorectal cancer. The pharmacogenomics journal. 2009. Graziano F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics and pharmacogenomics of anticancer agents. CA: a cancer journal for clinicians. 2009. Huang R Stephanie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Predicting clinical outcome of 5-fluorouracil-based chemotherapy for colon cancer patients: is the CpG island methylator phenotype the 5-fluorouracil-responsive subgroup?. International journal of clinical oncology / Japan Society of Clinical Oncology. 2008. Iacopetta Barry, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Meta-analysis of genome-wide association data identifies four new susceptibility loci for colorectal cancer. Nature genetics. 2008. Houlston Richard S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Influence of dihydropyrimidine dehydrogenase gene (DPYD) coding sequence variants on the development of fluoropyrimidine-related toxicity in patients with high-grade toxicity and patients with excellent tolerance of fluoropyrimidine-based chemotherapy. Neoplasma. 2009. Kleibl Z, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Predictive Factors for Response and Toxicity in Chemotherapy: Pharmacogenomics. Seminars in colon & rectal surgery. 2008. Sanoff Hanna K, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of ATP-binding cassette, sub-family C, number 2 (ABCC2) genotype with pharmacokinetics of irinotecan in Japanese patients with metastatic colorectal cancer treated with irinotecan plus infusional 5-fluorouracil/leucovorin (FOLFIRI). Biological & pharmaceutical bulletin. 2008. Fujita Ken-ichi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Red meat intake, doneness, polymorphisms in genes that encode carcinogen-metabolizing enzymes, and colorectal cancer risk. Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology. 2008. Cotterchio Michelle, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The 18-kDa translocator protein, formerly known as the peripheral-type benzodiazepine receptor, confers proapoptotic and antineoplastic effects in a human colorectal cancer cell line. Pharmacogenetics and genomics. 2008. Shoukrun Rami, et al. PubMed
No Dosing Guideline available