Colorectal Neoplasms

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Gene ? Variant?
Alternate Names ? Drugs ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
No VIP available CA No VIP available ABCB1 *2 (PMID: 11503014) N/A N/A N/A
No VIP available No VIP available No VIP available CYP2A6 *4A N/A N/A N/A
No VIP available No VIP available No VIP available CYP2A6 *7 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2A6 *9 N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *1 N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *5 N/A N/A N/A
No VIP available No VIP available No VIP available G6PD Mediterranean, Dallas, Panama' Sassari, Cagliari, Birmingham N/A N/A N/A
No VIP available No VIP available No VIP available GSTM1 non-null N/A N/A N/A
No VIP available No VIP available No VIP available GSTM1 null N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *1 N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *6 N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *28 N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *60 N/A N/A N/A
No VIP available CA No VIP available UGT1A6 *2a N/A N/A N/A
No VIP available CA No VIP available UGT1A7 *3 N/A N/A N/A
No VIP available No Clinical Annotations available VA
rs10034692 15630454A>G, 37578A>G, 75419787A>G
A > G
Not Available
No VIP available No Clinical Annotations available VA
rs10049380 124487443T>C, 2017+417A>G, 30982589T>C
T > C
No VIP available No Clinical Annotations available VA
rs1017733 *1825C>T, 15463017C>T, 75252350C>T
C > T
3' UTR
No VIP available CA VA
rs1045642 208920T>A, 208920T>C, 25171488A>G, 25171488A>T, 3435T>A, 3435T>C, 87138645A>G, 87138645A>T, ABCB1*6, ABCB1: 3435C>T, ABCB1: C3435T, ABCB1: c.3435C>T, ABCB1:3435C>T, Ile1145=, Ile1145Ile, MDR1 3435C>T, MDR1 C3435T, PGP C3435T, c.3435C>T, mRNA 3853C>T
A > T
A > G
No VIP available No Clinical Annotations available VA
rs1049550 32731166G>A, 688C>T, 81926702G>A, ANXA11: T > C, Arg230Cys, R230C
G > A
No VIP available No Clinical Annotations available VA
rs10505806 10248888A>T, 17488764A>T
A > T
Not Available
No VIP available CA VA
rs1051266 3952235T>C, 46957794T>C, 80A>G, 9592A>G, : 80A>G, His27Arg, RFC-1, SCL19A1:80G>A, SLC19A1:Arg27His, SLC19A1:G80A, mRNA 199A>G
T > C
No VIP available No Clinical Annotations available VA
rs10784749 31565335C>G, 69422029C>G
C > G
Not Available
No VIP available No Clinical Annotations available VA
rs10876844 18194012C>A, 56050706C>A
C > A
Not Available
No VIP available No Clinical Annotations available VA
rs10929302 -1791C>T, 172393G>A, 234665782G>A, 61-9898G>A, 612041G>A, 856-9898G>A, 862-9898G>A, 868-9898G>A, UGT1A1*93, UGT1A1:-3156G>A, UGT1A1:G-3156A
G > A
5' Flanking
No VIP available No Clinical Annotations available VA
rs1105879 -7-243A>C, 108813A>C, 234602202A>C, 548461A>C, 552A>C, 855+10764A>C, 855+20767A>C, 855+56179A>C, 856-73478A>C, Arg184Ser
A > C
No VIP available No Clinical Annotations available VA
rs11072508 45852954C>T, 75062397C>T
C > T
Not Available
No VIP available No Clinical Annotations available VA
rs11078659 233+9171C>T, 6507318G>A, 6903944G>A, 951+146G>A
G > A
No VIP available No Clinical Annotations available VA
rs112723255 -14+175G>A, -14+420G>A, -368G>A, -398G>A, 1393G>A, 1408G>A, 22611C>T, 50964255C>T, 549478C>T, 5614G>A, 9260G>A, Ala465Thr, Ala470Thr
G > T
G > C
5' Flanking
No VIP available CA VA
rs1128503 1236T>C, 167964T>C, 25043506A>G, 87550285A>G, ABCB1 1236C>T, ABCB1*8, ABCB1: c.1236T>C, ABCB1:1236C>T, ABCB1:1236T>C, Gly412=, Gly412Gly, mRNA 1654T>C, p.Gly412Gly
A > G
Not Available
No VIP available No Clinical Annotations available VA
rs1138272 12659374C>T, 341C>T, 67353579C>T, 7514C>T, A114V, Ala114Val, GSTP1: A114V, GSTP1: C341T
C > T
No VIP available No Clinical Annotations available VA
rs11479 -14+194C>T, -14+439C>T, -349C>T, -379C>T, 1412C>T, 1427C>T, 22592G>A, 50964236G>A, 549459G>A, 5633C>T, 9279C>T, Ser471Leu, Ser476Leu
C > G
C > A
5' Flanking
No VIP available No Clinical Annotations available VA
rs11568315 55020563_55020564CA[9][14][15][16][17][18][19][20][21][22][23]
Not Available
No VIP available No Clinical Annotations available VA
rs11568972 110889007A>C, 1450-1120A>C, 1576-1120A>C, 35436728A>C, 59968A>C
A > C
No VIP available No Clinical Annotations available VA
rs11568993 110897315C>T, 1851C>T, 1977C>T, 35445036C>T, 68276C>T, Cys617=, Cys659=
C > T
No VIP available CA VA
rs11615 18191871A>G, 354T>C, 45923653A>G, 63434T>C, Asn118=, ERCC1:19007T>C, ERCC1:Asn118Asn
A > G
No VIP available CA VA
rs11692021 234591205T>C, 537464T>C, 622T>C, 855+45182T>C, 855+63997T>C, 855+9770T>C, 97816T>C, Trp208Arg
T > C
No VIP available No Clinical Annotations available VA
rs11725706 15538775G>A, 75328108G>A
G > A
Not Available
No VIP available CA VA
rs11942466 15632745C>A, 39869C>A, 75422078C>A
C > A
Not Available
No VIP available CA VA
rs12022243 1906-14763G>A, 528836G>A, 67834698C>T, 97862780C>T
C > T
No VIP available CA VA
rs12132152 67494922G>A, 97523004G>A
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs12410394 150860186G>A, 2348828G>A, 61+397G>A
G > A
No VIP available CA VA
rs13104811 13103G>A, 15605979G>A, 75395312G>A
G > A
Not Available
No VIP available CA VA
rs13181 *304T>G, 18123137T>G, 2251A>C, 23927A>C, 45854919T>G, ERCC2 Lys751Gln, ERCC2:2251A>C, ERCC2:Lys751Gln, Lys751Gln, rs13181:T>G
T > G
No VIP available CA VA
rs1353295 15539789G>A, 75329122G>A
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs1570360 -1154A>G, -614A>G, 43677830A>G, 43737830A>G, 4878A>G, VEGF -1154
A > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs16430 *145-368delA, *145-368delAinsCTTTAA, *447delT, *447delTinsTTAAAG, *861delA, *861delAinsCTTTAA, 20841delT, 20841delTinsTTAAAG, 663444delT, 663444delTinsTTAAAG, 673444delT, 673444delTinsTTAAAG
T > -
3' UTR
No VIP available No Clinical Annotations available VA
rs16857540 173900575C>G, 647-92530C>G, 80395721C>G
C > G
No VIP available CA VA
rs1695 12658484A>G, 313A>G, 6624A>G, 67352689A>G, GSTP1*2, GSTP1*B, GSTP1: I105V, GSTP1:A313G, GSTP1:I105V, GSTP1:Ile105Val, Ile105Val, Part of haplotypes GSTP1*B and GSTP1*C, rs1695:A>G
A > G
No VIP available No Clinical Annotations available VA
rs16973225 53020556A>C, 82229999A>C
A > C
Not Available
No VIP available No Clinical Annotations available VA
rs17116806 1740+8030G>T, 418364G>T, 67945170C>A, 97973252C>A
C > A
No VIP available CA VA
rs17376848 1896T>C, 475992T>C, 67887542A>G, 97915624A>G, Phe632=, Phe632Phe
A > G
No VIP available CA VA
rs17626122 206474012T>C, 2958-6168T>C, 3054-6168T>C, 3075-6168T>C, 56683430T>C
T > C
No VIP available No Clinical Annotations available VA
rs1799794 -260-1363A>G, -316A>G, 104179267T>C, 7557A>G, 85179267T>C
T > C
5' UTR
No VIP available No Clinical Annotations available VA
rs1801019 124456742G>C, 12530G>C, 30951888G>C, 590G>C, 638G>C, 843G>C, Gly213Ala, OPRT: Gly213Ala
G > C
Not Available
No VIP available CA VA
rs1801131 1040A>C, 11208431T>G, 11794419T>G, 1286A>C, 1409A>C, 16685A>C, A1298C, Glu347Ala, Glu429Ala, Glu470Ala, MTHFR:1298A>C
T > G
Not Available
No VIP available No Clinical Annotations available VA
rs1801133 11210333G>A, 11796321G>A, 14783C>T, 419C>T, 665C>T, 677C>T, 788C>T, A222V, Ala140Val, Ala222Val, Ala263Val, C677T, MTHFR: c.677C>T, MTHFR:667C>T, p.A222V
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs1801160 129-825C>T, 2194G>A, 620696G>A, 67742838C>T, 97770920C>T, Val732Ile
C > T
No VIP available CA VA
rs1801265 42731T>C, 42731T>T, 68320803G>A, 68320803G>G, 85T>C, 85T>T, 98348885G>A, 98348885G>G, Cys29=, DPYD*9A, DPYD:C29R, DYPD:T85C
G > A
No VIP available No Clinical Annotations available VA
rs1801274 12968387A>G, 161479745A>G, 497A>G, 500A>G, 9541A>G, FCGR2A:His131Arg
A > G
No VIP available No Clinical Annotations available VA
rs1801394 -172-1823T>C, 1-1823T>C, 147A>G, 66A>G, 6757A>G, 7860973A>G, 7870973A>G, Ile22Met, Ile49Met, MTRR 66A>G, MTRR:66A>G
A > G
No VIP available No Clinical Annotations available VA
rs1805087 237048500A>G, 2756A>G, 30566279A>G, 94920A>G, Asp919Gly, MS 2756A>G, MS D919G, MTR:2756A>G, MTR:Asp919Gly
A > G
No VIP available No Clinical Annotations available VA
rs1885301 -1549A>G, -1549G>A, 101541053A>G, 3591A>G, 52345517A>G
A > G
5' Flanking
No VIP available CA VA
rs1979277 1303C>T, 1420C>T, 17835470G>A, 18232096G>A, 39761C>T, Leu435Phe, Leu474Phe, SHMT1 L435F
G > A
No VIP available No Clinical Annotations available VA
rs2010963 -634C>G, -94C>G, 43678350C>G, 43738350C>G, 5398C>G, VEGF-A 405 G/C, VEGFA:405G>C, VEGFA:C405G
C > G
5' UTR
No VIP available No Clinical Annotations available VA
rs2032582 186947T>A, 186947T>G, 25193461A>C, 25193461A>T, 2677A, 2677G, 2677T, 2677T>A, 2677T>G, 3095G>T/A, 87160618A>C, 87160618A>T, 893 Ala, 893 Ser, 893 Thr, ABCB1*7, ABCB1: 2677G>T/A, ABCB1: 2677T/A>G, ABCB1: A893S, ABCB1: G2677T/A, ABCB1: c.2677G>T/A, ABCB1:2677G>A/T, ABCB1:2677G>T/A, ABCB1:A893T, Ala893Ser/Thr, MDR1, MDR1 G2677T/A, Ser893Ala, Ser893Thr, mRNA 3095G>T/A, p.Ala893Ser/Thr
A > T
A > C
No VIP available No Clinical Annotations available VA
rs20417 -899G>C, 186650321C>G, 38138963C>G, 4239G>C, COX-2 G-765C, PTGS2:-765G>C
C > G
5' Flanking
No VIP available CA VA
rs2070959 -7-254A>G, 108802A>G, 234602191A>G, 541A>G, 548450A>G, 855+10753A>G, 855+20756A>G, 855+56168A>G, 856-73489A>G, Thr181Ala
A > G
No VIP available No Clinical Annotations available VA
rs2072671 20915701A>C, 7595789A>C, 79A>C, CDA: c.79A>C, CDA:79A>C, K27Q, Lys27Gln, p.Lys27Gln
A > C
No VIP available No Clinical Annotations available VA
rs2074087 145799C>G, 16124232C>G, 16184232C>G, 2461-30C>G
C > G
No VIP available No Clinical Annotations available VA
rs2074390 110910016G>A, 2608+151G>A, 2734+151G>A, 35457737G>A, 80977G>A
G > A
No VIP available No Clinical Annotations available VA
rs2132065 15535971A>T, 75325304A>T
A > T
Not Available
No VIP available CA VA
rs2227983 147531G>A, 147531G>C, 147531G>T, 1562G>A, 1562G>C, 1562G>T, 4818624G>A, 4818624G>C, 4818624G>T, 55229255G>A, 55229255G>C, 55229255G>T, Arg521Lys, Arg521Met, Arg521Thr, EGFR: 497G/A, EGFR:1562G>A, EGFR:R497K, R497K, R521K
G > A
G > T
G > C
No VIP available No Clinical Annotations available VA
rs2228099 150808889C>G, 2297531C>G, 45356G>C, 522G>C, 567G>C, Val174=, Val189=
C > G
No VIP available CA VA
rs2231142 13600044G>T, 32689C>A, 421C>A, 89052323G>T, ABCG2: Q141K, ABCG2:421C>A, ABCG2:Q141K, ABCG2:c.421C>A, Gln141Lys, rs2231142
G > T
No VIP available No Clinical Annotations available VA
rs2236225 1958G>A, 45908845G>A, 59087G>A, 64908845G>A, Arg653Gln, MTHFD1:1958G>A, MTHFD1:Arg653Gln, R653Q
G > A
No VIP available No Clinical Annotations available VA
rs2242047 1528C>T, 444223C>T, 85478696C>T, Arg510Cys, R510C, SLC28A1:1543G>A
C > T
No VIP available CA VA
rs2273697 101563815G>A, 1249G>A, 26353G>A, 52368279G>A, ABCC2: c.1249G>A, ABCC2:1249G>A, ABCC2:V417I, ABCC2:c.1249G>A, Val417Ile, p.V417I
G > A
No VIP available No Clinical Annotations available VA
rs2286455 16020162C>T, 70462G>A, 7201959C>T, 759G>A, 786G>A, Ala253=, Ala262=
C > T
No VIP available CA VA
rs2297595 226525A>G, 496A>G, 68137009T>C, 98165091T>C, DPYD:496A>G, DPYD:Met166Val, Met166Val
T > C
No VIP available No Clinical Annotations available VA
rs2302821 *9T>G, 132501881A>C, 61666413A>C
A > C
3' UTR
No VIP available CA VA
rs2306283 14089862A>G, 21329738A>G, 388A>G, 50611A>G, Asn130Asp, SLCO1B1*1B
A > G
No VIP available No Clinical Annotations available VA
rs2401863 1366+79G>T, 38943G>T, 71456188G>T, 90456188G>T
G > T
No VIP available No Clinical Annotations available VA
rs2465403 120090827G>A, 149-11092G>A, 33364376G>A
G > A
No VIP available No Clinical Annotations available VA
rs2470890 +, 1548C>T, 295T>C, 37544C>T, 45837983C>T, 75047426C>T, Asn516=, CYP1A2*1B, CYP1A2:1545T>C, CYP1A2:1548T>C, CYP1A2:5347T>C, CYP1A2:Asn516Asn, CYP1A2:Ex7
C > T
No VIP available CA VA
rs25487 1196A>G, 16323944T>C, 44055726T>C, Gln399Arg, XRCC1 Arg399Gln, XRCC1:Arg399Gln
T > C
No VIP available CA VA
rs2612091 496-227G>A, 673607C>T, 683607C>T, 742-227G>A, 805-227G>A
C > T
No VIP available CA VA
rs2741171 194-3332A>G, 257-3332A>G, 63+5783A>G, 690687T>C, 700687T>C
T > C
No VIP available No Clinical Annotations available VA
rs2965667 10204857A>T, 17444733A>T
A > T
Not Available
No VIP available No Clinical Annotations available VA
rs3130 *1078A>G, 120686A>G, 15969938T>C, 7151735T>C
T > C
3' UTR
No VIP available No Clinical Annotations available VA
rs3136228 -152-405T>G, 26831703T>G, 4531T>G, 48009816T>G
T > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs3212948 18192580G>C, 321+74C>G, 45924362G>C, 62725C>G
G > C
No VIP available No Clinical Annotations available VA
rs3215133 1032+107delA, 150802273delT, 2290915delT, 51972delA, 987+107delA
T > -
No VIP available No Clinical Annotations available VA
rs34116584 241808314C>A, 241808314C>G, 241808314C>T, 32C>A, 32C>G, 32C>T, 5153C>A, 5153C>G, 5153C>T, 999182C>A, 999182C>G, 999182C>T, Pro11Arg, Pro11His, Pro11Leu
C > G
C > T
C > A
No VIP available CA VA
rs34489327 *145-370delT, *145-370delTinsCTTTAA, *449delA, *449delAinsTTAAAG, *859delT, *859delTinsCTTTAA, 20843delA, 20843delAinsTTAAAG, 6-basepair 3'UTR repeat, 663446delA, 663446delAinsTTAAAG, 673446delA, 673446delAinsTTAAAG, TYMS:-TTAAAG, TYMS:1494del, TYMS:1494del TTAAAG, ttaaag
T > -
3' UTR
No VIP available CA VA
rs34743033 28-bp tandem repeats, CCGCGCCACTTGGCCTGCCTCCGTCCCG, TSER*2, TSER*3, TYMS: 28 bp tandem repeat, TYMS: 2R, TYMS: TSER *2/*3, TYMS:TSER 28-basepair 5'UTR enhancer region repeat
Not Available
No VIP available No Clinical Annotations available VA
rs3740066 101604207C>T, 3972C>T, 52408671C>T, 66745C>T, ABCC2:3972C>T, I1324I, Ile1324=
C > T
No VIP available No Clinical Annotations available VA
rs3812718 166909544C>T, 17118962C>T, 25606G>A, 603-91G>A
C > T
No VIP available No Clinical Annotations available VA
rs3913032 15547526A>C, 75336859A>C
A > C
Not Available
No VIP available No Clinical Annotations available VA
rs3918290 1905+1G>A, 476002G>A, 67887532C>T, 97915614C>T, DPYD*2A, DPYD:67887533 G>A, DPYD:IVS14 + 1G>A
C > T
No VIP available CA VA
rs396991 10872T>G, 13003184A>C, 158V/F, 161514542A>C, 176F/V, 523T>G, 526T>G, 631T>G, 634T>G, A559C, FCGR3A: V158F, Phe175Val, Phe176Val, Phe211Val, Phe212Val, T559G
A > C
No VIP available No Clinical Annotations available VA
rs4133101 -1057T>C, 40669567T>C, 40679567T>C
T > C
5' Flanking
No VIP available No Clinical Annotations available VA
rs4149056 14091673T>C, 21331549T>C, 521T>C, 52422T>C, SLCO1B1*5, Val174Ala
T > C
No VIP available No Clinical Annotations available VA
rs4243761 26282791G>T, 2717938G>T, 896-11481G>T
G > T
No VIP available No Clinical Annotations available VA
rs425215 1007-898C>G, 43707101C>G, 701542C>G, 908-898C>G, 965-898C>G, 974-898C>G, 980-898C>G
C > G
No VIP available No Clinical Annotations available VA
rs4426527 1008384A>G, 1020A>G, 14355A>G, 241817516A>G, Ile340Met
A > G
No VIP available CA VA
rs4444903 -382A>G, 110834110A>G, 35381831A>G, 5071A>G
A > G
5' UTR
No VIP available No Clinical Annotations available VA
rs45445694 2, 28-bp tandem repeats located in the TS enhancer region of 5'UTR, TYMS:*2
Not Available
No VIP available No Clinical Annotations available VA
rs4698803 110914427A>T, 2633A>T, 2735-1462A>T, 2759A>T, 35462148A>T, 85388A>T, Glu878Val, Glu920Val
A > T
No VIP available No Clinical Annotations available VA
rs4886410 45856201G>C, 75065644G>C
G > C
Not Available
No VIP available No Clinical Annotations available VA
rs4970722 39563T>A, 40-3123T>A, 68323971A>T, 98352053A>T
A > T
No VIP available No Clinical Annotations available VA
rs5275 *427T>C, 11502T>C, 186643058A>G, 38131700A>G, COX-2 8473T>C, PTGS2 exon10+837T>C, PTGS2: 6498T>C, PTGS2:8473T>C
A > G
3' UTR
No VIP available No Clinical Annotations available VA
rs56038477 1236G>A, 352197G>A, 68011337C>T, 98039419C>T, Glu412=
C > T
No VIP available No Clinical Annotations available VA
rs562 *1243A>G, 183637845T>C, 90132991T>C
T > C
3' UTR
No VIP available No Clinical Annotations available VA
rs6072262 279+61G>A, 39704995G>A, 52534G>A, 9901087G>A
G > A
No VIP available No Clinical Annotations available VA
rs61764370 *2505T>G, *2626T>G, 18120348A>C, 25360224A>C, 48631T>G
A > C
3' UTR
No VIP available No Clinical Annotations available VA
rs6447003 15597581G>C, 4705G>C, 75386914G>C
G > C
Not Available
No VIP available No Clinical Annotations available VA
rs6533485 110927563G>C, 3166-1745G>C, 3169-1745G>C, 3292-1745G>C, 35475284G>C, 98524G>C
G > C
No VIP available CA VA
rs67376798 2846A>T, 67519865T>A, 843669A>T, 97547947T>A, Asp949Val
T > A
No VIP available No Clinical Annotations available VA
rs6759892 -7-776T>G, 108280T>G, 19T>G, 234601669T>G, 547928T>G, 855+10231T>G, 855+20234T>G, 855+55646T>G, 856-74011T>G, Ser7Ala
T > G
No VIP available No Clinical Annotations available VA
rs6850557 110911015G>A, 2608+1150G>A, 2734+1150G>A, 35458736G>A, 81976G>A
G > A
No VIP available No Clinical Annotations available VA
rs699947 -2055A>C, -2578, -2595A>C, 3437A>C, 43676389A>C, 43736389A>C, VEGF-A -2578 C/A, VEGFA:, VEGFA:C-2578A
A > C
5' Flanking
No VIP available CA VA
rs712829 -216G>T, 216G>T, 4676124G>T, 5031G>T, 55086755G>T, EGFR:-216G>T
G > T
5' UTR
No VIP available CA VA
rs717620 -24C>T, 101542578C>T, 5116C>T, 52347042C>T, ABCC2: 5'UTR, ABCC2:(-24)C>T, mRNA 118C>T
C > T
5' UTR
No VIP available CA VA
rs7325568 21798284C>T, 40818284C>T
C > T
Not Available
No VIP available CA VA
rs75017182 1129-5923C>G, 346167C>G, 68017367G>C, 98045449G>C
G > C
No VIP available No Clinical Annotations available VA
rs7518660 37657361G>A, 58275G>A, 67685443G>A, 955+30G>A
G > A
No VIP available No Clinical Annotations available VA
rs7548189 1906-19696G>T, 523903G>T, 67839631C>A, 97867713C>A
C > A
No VIP available CA VA
rs76387818 67511318G>A, 97539400G>A
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs7687621 15460493T>C, 429-618T>C, 75249826T>C
T > C
No VIP available No Clinical Annotations available VA
rs7699188 NC_000004.11, NG_032067.1, NM_001257386.1, NT_016354.19
G > A
No VIP available No Clinical Annotations available VA
rs7952081 12630728G>A, 67324933G>A
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs8175347 233760235_233760236TA[5][6][7][8], 5-TA insertion in promoter, 7-TA insertion in promoter, 8-TA insertion in promoter, UGT1A1*28, UGT1A1*36, UGT1A1*37, microsatellite, short tandem repeat
(TA)6 > (TA)8
(TA)6 > (TA)5
(TA)6 > (TA)7
Not Available
No VIP available No Clinical Annotations available VA
rs833061 -1498C>T, -460, -958C>T, 43677486C>T, 43737486C>T, 4534C>T, VEGF-A -460 C/T, VEGFA:C-460T, VEGFA:T-1498C
C > T
5' Flanking
No VIP available CA VA
rs861539 104165753G>A, 1651-1239G>A, 1782-1239G>A, 21071C>T, 722C>T, 75229G>A, 85165753G>A, Thr241Met
G > A
No VIP available No Clinical Annotations available VA
rs895819 -119A>C, -119A>G, -119A>T, -189A>C, -189A>G, -189A>T, 13947292T>A, 13947292T>C, 13947292T>G, 182A>C, 182A>G, 182A>T, 40A>C, 40A>G, 40A>T, 5210094T>A, 5210094T>C, 5210094T>G
T > G
T > C
T > A
5' Flanking
No VIP available No Clinical Annotations available VA
rs929446 110883344C>T, 1186+203C>T, 1312+203C>T, 35431065C>T, 54305C>T
C > T
No VIP available CA VA
rs9344 *1365+4648C>T, 12038G>A, 14768705G>A, 69462910G>A, 723G>A, CCND1 (A870G), CCND1:870G>A, Pro241=, rs603965
G > A
No VIP available CA VA
rs9996584 15632628A>G, 39752A>G, 75421961A>G
A > G
Not Available
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 142


Alternate Names: 
Cancer, Colorectal; Cancers, Colorectal; Carcinoma, Colorectal; Carcinomas, Colorectal; Colorectal Cancer; Colorectal Cancers; Colorectal Carcinoma; Colorectal Carcinomas; Colorectal Neoplasm; Colorectal Tumor; Colorectal Tumors; Neoplasm of large intestine; Neoplasm, Colorectal; Neoplasms, Colorectal; Tumor of large intestine; Tumor, Colorectal; Tumors, Colorectal; Tumour of large intestine
PharmGKB Accession Id: PA446108
External Vocabularies

Curated Information ?

Curated Information ?

Relationships from National Drug File - Reference Terminology (NDF-RT)

May Treat
No related diseases are available

Publications related to Colorectal Neoplasms: 252

No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
DPD and UGT1A1 deficiency in colorectal cancer patients receiving triplet chemotherapy with fluoropyrimidines, oxaliplatin and irinotecan. British journal of clinical pharmacology. 2015. Falvella Felicia Stefania, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Association of Aspirin and NSAID Use With Risk of Colorectal Cancer According to Genetic Variants. JAMA. 2015. Nan Hongmei, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
DPYD Variants as Predictors of 5-fluorouracil Toxicity in Adjuvant Colon Cancer Treatment (NCCTG N0147). Journal of the National Cancer Institute. 2014. Lee Adam M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
A Phase I Study of UGT1A1 * 28/ * 6 Genotype-Directed Dosing of Irinotecan (CPT-11) in Korean Patients with Metastatic Colorectal Cancer Receiving FOLFIRI. Oncology. 2014. Kim Kyu-Pyo, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of the DNA repair pathways in advanced non-small cell lung cancer patients treated with platinum-based chemotherapy. Cancer letters. 2014. Sullivan Ivana, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Prospective study of EGFR intron 1 (CA)n repeats variants as predictors of benefit from cetuximab and irinotecan in chemo-refractory metastatic colorectal cancer (mCRC) patients. The pharmacogenomics journal. 2014. Loupakis F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genetic variants in the glutathione S-transferase genes and survival in colorectal cancer patients after chemotherapy and differences according to treatment with oxaliplatin. Pharmacogenetics and genomics. 2014. Kap Elisabeth J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
UGT1A1*28 polymorphisms: a potential pharmacological biomarker of irinotecan-based chemotherapies in colorectal cancer. Pharmacogenomics. 2014. Liu Xiang, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
X-ray repair cross-complementing 1 polymorphism and prognosis of platinum-based chemotherapy in gastric and colorectal cancer: a meta-analysis. Journal of gastroenterology and hepatology. 2014. Wu Hongju, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The role of IVS14+1 G > A genotype detection in the dihydropyrimidine dehydrogenase gene and pharmacokinetic monitoring of 5-fluorouracil in the individualized adjustment of 5-fluorouracil for patients with local advanced and metastatic colorectal cancer: a preliminary report. European review for medical and pharmacological sciences. 2014. Cai X, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A candidate gene study of capecitabine-related toxicity in colorectal cancer identifies new toxicity variants at DPYD and a putative role for ENOSF1 rather than TYMS. Gut. 2014. Rosmarin Dan, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic Markers of Toxicity From Capecitabine and Other Fluorouracil-Based Regimens: Investigation in the QUASAR2 Study, Systematic Review, and Meta-Analysis. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2014. Rosmarin Dan, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacokinetics, safety, and efficacy of FOLFIRI plus bevacizumab in Japanese colorectal cancer patients with UGT1A1 gene polymorphisms. Journal of clinical pharmacology. 2014. Suenaga Mitsukuni, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of single nucleotide polymorphisms in MTHFR and ABCG2 with the different efficacy of first-line chemotherapy in metastatic colorectal cancer. Medical oncology (Northwood, London, England). 2014. Zhao Jing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Prognostic advantage of irinotecan dose escalation according to uridine diphosphate glucuronosyltransferase 1A1 (UGT1A1) genotyping in patients with metastatic colorectal cancer treated with bevacizumab combined with 5-fluorouracil/leucovorin with irinotecan in a first-line setting. Translational research : the journal of laboratory and clinical medicine. 2014. Lu Chien-Yu, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of DNA repair gene polymorphisms in non-small-cell lung carcinoma patients on platinum-based chemotherapy. Genetics and molecular research : GMR. 2014. Zhang L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Clinical significance of UGT1A1 gene polymorphisms on irinotecan-based regimens as the treatment in metastatic colorectal cancer. OncoTargets and therapy. 2014. Li Minmin, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
ERCC1 Cys8092Ala and XRCC1 Arg399Gln polymorphisms predict progression-free survival after curative radiotherapy for nasopharyngeal carcinoma. PloS one. 2014. Jin Hekun, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic diversity of the KIR/HLA system and outcome of patients with metastatic colorectal cancer treated with chemotherapy. PloS one. 2014. De Re Valli, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Germline variation in colorectal risk Loci does not influence treatment effect or survival in metastatic colorectal cancer. PloS one. 2014. Sanoff Hanna K, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thymidylate synthase genotype-directed chemotherapy for patients with gastric and gastroesophageal junction cancers. PloS one. 2014. Goff Laura W, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Germline Variants and Advanced Colorectal Adenomas: Adenoma Prevention with Celecoxib Trial Genome-wide Association Study. Clinical cancer research : an official journal of the American Association for Cancer Research. 2013. Wang Jiping, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Excision Repair Cross-Complementation group 1 (ERCC1) C118T SNP does not affect cellular response to oxaliplatin. Mutation research. 2013. van Huis-Tanja Lieke H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacogenetics of ABC and SLC transporters in metastatic colorectal cancer patients receiving first-line FOLFIRI treatment. Pharmacogenetics and genomics. 2013. De Mattia Elena, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Potential of dihydropyrimidine dehydrogenase genotypes in personalizing 5-fluorouracil therapy among colorectal cancer patients. Therapeutic drug monitoring. 2013. Teh Lay Kek, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
S-1 plus irinotecan and oxaliplatin for the first-line treatment of patients with metastatic colorectal cancer: a prospective phase II study and pharmacogenetic analysis. British journal of cancer. 2013. Kim S Y, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphism of TS 3'-UTR predicts survival of Chinese advanced gastric cancer patients receiving first-line capecitabine plus paclitaxel. Clinical & translational oncology : official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico. 2013. Gao J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
PharmGKB summary: very important pharmacogene information for the epidermal growth factor receptor. Pharmacogenetics and genomics. 2013. Hodoglugil Ugur, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
DPYD IVS14+1G>A and 2846A>T genotyping for the prediction of severe fluoropyrimidine-related toxicity: a meta-analysis. Pharmacogenomics. 2013. Terrazzino Salvatore, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Intergenic polymorphisms in the amphiregulin gene region as biomarkers in metastatic colorectal cancer patients treated with anti-EGFR plus irinotecan. The pharmacogenomics journal. 2013. Sebio A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ACMG recommendations for reporting of incidental findings in clinical exome and genome sequencing. Genetics in medicine : official journal of the American College of Medical Genetics. 2013. Green Robert C, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic variants in the DPYD, TYMS, CDA and MTHFR genes are clinically significant predictors of fluoropyrimidine toxicity. British journal of cancer. 2013. Loganayagam A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Impact of genetic polymorphisms on adenoma recurrence and toxicity in a COX2 inhibitor (celecoxib) trial: results from a pilot study. Pharmacogenetics and genomics. 2013. Kraus Sarah, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of ABCB1 genetic polymorphisms with susceptibility to colorectal cancer and therapeutic prognosis. Pharmacogenomics. 2013. Wu Huizhe, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Gender-specific profiling in SCN1A polymorphisms and time-to-recurrence in patients with stage II/III colorectal cancer treated with adjuvant 5-fluoruracil chemotherapy. The pharmacogenomics journal. 2013. Benhaim L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Implications of Genome-Wide Association Studies in Cancer Therapeutics. British journal of clinical pharmacology. 2013. Patel Jai N, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Challenges in pharmacogenetics. European journal of clinical pharmacology. 2013. Cascorbi Ingolf, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic analysis of adjuvant FOLFOX for Korean patients with colon cancer. Cancer chemotherapy and pharmacology. 2013. Lee Kyung-Hun, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Exome Re-Sequencing Identifies Potential Tumor Suppressor Genes that Predispose to Colorectal Cancer. Human mutation. 2013. Smith Christopher G, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Refining the UGT1A haplotype associated with irinotecan-induced hematological toxicity in metastatic colorectal cancer patients treated with 5-fluorouracil/irinotecan-based regimens. The Journal of pharmacology and experimental therapeutics. 2013. Lévesque Eric, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The LCS6 polymorphism in the binding site of let-7 microRNA to the KRAS 3'-untranslated region: its role in the efficacy of anti-EGFR-based therapy in metastatic colorectal cancer patients. Pharmacogenetics and genomics. 2013. Sebio Ana, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Association of UGT1A1*28 polymorphisms with irinotecan-induced toxicities in colorectal cancer: a meta-analysis in Caucasians. The pharmacogenomics journal. 2013. Liu X, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
MTHFR polymorphisms and capecitabine-induced toxicity in patients with metastatic colorectal cancer. Pharmacogenetics and genomics. 2013. van Huis-Tanja Lieke H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Role of immunoglobulin G fragment C receptor polymorphism-mediated antibody-dependant cellular cytotoxicity in colorectal cancer treated with cetuximab therapy. The pharmacogenomics journal. 2013. Negri F V, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Dihydropyrimidine Dehydrogenase Gene (DPYD) Polymorphism among Caucasian and non-Caucasian Patients with 5-FU- and Capecitabine-related Toxicity Using Full Sequencing of DPYD. Cancer genomics & proteomics. 2013. Saif Muhammad Wasif. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A Novel Fully Automated Molecular Diagnostic System (AMDS) for Colorectal Cancer Mutation Detection. PloS one. 2013. Kitano Shiro, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Evaluating predictive pharmacogenetic signatures of adverse events in colorectal cancer patients treated with fluoropyrimidines. PloS one. 2013. Jennings Barbara A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SLCO1B1 and SLC19A1 Gene Variants and Irinotecan-Induced Rapid Response and Survival: A Prospective Multicenter Pharmacogenetics Study of Metastatic Colorectal Cancer. PloS one. 2013. Huang Liu, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A prospective validation pharmacogenomic study in the adjuvant setting of colorectal cancer patients treated with the 5-fluorouracil/leucovorin/oxaliplatin (FOLFOX4) regimen. The pharmacogenomics journal. 2012. Cecchin E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Effect of genetic polymorphisms on therapeutic response and clinical outcomes in pancreatic cancer patients treated with gemcitabine. Pharmacogenomics. 2012. Woo Hye In, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic variants of thiopurine and folate metabolic pathways determine 6-MP-mediated hematological toxicity in childhood ALL. Pharmacogenomics. 2012. Dorababu Patchva, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics and pharmacogenomics: role of mutational analysis in anti-cancer targeted therapy. The pharmacogenomics journal. 2012. Savonarola A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Intratumoral expression profiling of genes involved in angiogenesis in colorectal cancer patients treated with chemotherapy plus the VEGFR inhibitor PTK787/ZK 222584 (vatalanib). The pharmacogenomics journal. 2012. Wilson P M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Absence of transcriptomic signature of response to chemotherapy in metastatic colorectal carcinoma patients. Pharmacogenomics. 2012. Laroche-Clary Audrey, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association between polymorphisms of ERCC1 and survival in epithelial ovarian cancer patients with chemotherapy. Pharmacogenomics. 2012. Yan Li, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms in key methotrexate pathway genes are associated with response to treatment in rheumatoid arthritis patients. The pharmacogenomics journal. 2012. Owen S A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenomics in colorectal cancer: a genome-wide association study to predict toxicity after 5-fluorouracil or FOLFOX administration. The pharmacogenomics journal. 2012. Fernandez-Rozadilla C, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Impact of SHMT1 polymorphism on the clinical outcome of patients with metastatic colorectal cancer treated with first-line FOLFIRI+bevacizumab. Pharmacogenetics and genomics. 2012. Budai Barna, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Combinatorial therapies to overcome B-RAF inhibitor resistance in melanomas. Pharmacogenomics. 2012. Lo Roger S. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genomic approach towards personalized anticancer drug therapy. Pharmacogenomics. 2012. Midorikawa Yutaka, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenomics of cisplatin-based chemotherapy in ovarian cancer patients of different ethnic origins. Pharmacogenomics. 2012. Khrunin Andrey, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacogenetic profiling of CD133 is associated with response rate (RR) and progression-free survival (PFS) in patients with metastatic colorectal cancer (mCRC), treated with bevacizumab-based chemotherapy. The pharmacogenomics journal. 2012. Pohl A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association between DNA-repair polymorphisms and survival in pancreatic cancer patients treated with combination chemotherapy. Pharmacogenomics. 2011. Giovannetti Elisa, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Association of eleven common, low-penetrance colorectal cancer susceptibility genetic variants at six risk Loci with clinical outcome. PloS one. 2012. Hoskins Janelle M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Meta-analysis on pharmacogenetics of platinum-based chemotherapy in non small cell lung cancer (NSCLC) patients. PloS one. 2012. Yin Ji-Ye, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Modeling the 5-fluorouracil area under the curve versus dose relationship to develop a pharmacokinetic dosing algorithm for colorectal cancer patients receiving FOLFOX6. The oncologist. 2012. Kaldate Rajesh R, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic predictors for EGFR-inhibitor-associated skin toxicity. The pharmacogenomics journal. 2011. Parmar S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Potential responders to FOLFOX therapy for colorectal cancer by Random Forests analysis. British journal of cancer. 2011. Tsuji S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Single nucleotide polymorphisms of ABCC5 and ABCG1 transporter genes correlate to irinotecan-associated gastrointestinal toxicity in colorectal cancer patients: A DMET microarray profiling study. Cancer biology & therapy. 2011. Di Martino Maria Teresa, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of Oxaliplatin as Adjuvant Treatment in Colon Carcinoma: Are Single Nucleotide Polymorphisms in GSTP1, ERCC1, and ERCC2 Good Predictive Markers?. Molecular diagnosis & therapy. 2011. Fariña Sarasqueta Arantza, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic analyses of cisplatin-induced nephrotoxicity indicate a renoprotective effect of ERCC1 polymorphisms. Pharmacogenomics. 2011. Tzvetkov Mladen V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Somatic deletions of genes regulating MSH2 protein stability cause DNA mismatch repair deficiency and drug resistance in human leukemia cells. Nature medicine. 2011. Diouf Barthelemy, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The association of polymorphisms in 5-fluorouracil metabolism genes with outcome in adjuvant treatment of colorectal cancer. Pharmacogenomics. 2011. Afzal Shoaib, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thymidylate synthase expression and genotype have no major impact on the clinical outcome of colorectal cancer patients treated with 5-fluorouracil. Pharmacological research : the official journal of the Italian Pharmacological Society. 2011. Vignoli Marina, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Nucleotide excision repair gene variants and association with survival in osteosarcoma patients treated with neoadjuvant chemotherapy. The pharmacogenomics journal. 2011. Biason P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Vascular endothelial growth factor polymorphisms and clinical outcome in colorectal cancer patients treated with irinotecan-based chemotherapy and bevacizumab. The pharmacogenomics journal. 2011. Koutras A K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TS and ERCC-1 mRNA expressions and clinical outcome in patients with metastatic colon cancer in CONFIRM-1 and -2 clinical trials. The pharmacogenomics journal. 2011. Grimminger P P, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
EGF61 polymorphism predicts complete pathologic response to cetuximab-based chemoradiation independent of KRAS status in locally advanced rectal cancer patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Hu-Lieskovan Siwen, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
VEGF -460T ¿ C polymorphism and its association with VEGF expression and outcome to FOLFOX-4 treatment in patients with colorectal carcinoma. The pharmacogenomics journal. 2011. Chen M-H, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Relationship between single nucleotide polymorphisms and haplotypes in DPYD and toxicity and efficacy of capecitabine in advanced colorectal cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Deenen Maarten J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Identification of potential pharmacogenomic markers of clinical efficacy of 5-fluorouracil in colorectal cancer. International journal of cancer. Journal international du cancer. 2011. Nobili Stefania, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic profiling of Aurora kinase B is associated with overall survival in metastatic colorectal cancer. The pharmacogenomics journal. 2011. Pohl A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Novel chemosensitive single-nucleotide polymorphism markers to targeted regimens in metastatic colorectal cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Kim Jin C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A phase I study of sirolimus and bevacizumab in patients with advanced malignancies. European journal of cancer (Oxford, England : 1990). 2011. Cohen E E W, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
RNA expression of the molecular signature genes for metastasis in colorectal cancer. Oncology reports. 2011. Carvalho Luciano, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Systems pharmacology assessment of the 5-fluorouracil pathway. Pharmacogenomics. 2011. Muhale Filipe A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Use of a comprehensive panel of biomarkers to predict response to a fluorouracil-oxaliplatin regimen in patients with metastatic colorectal cancer. Pharmacogenomics. 2011. Lamas Maria J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Associations of various gene polymorphisms with toxicity in colorectal cancer patients receiving oral uracil and tegafur plus leucovorin: a prospective study. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO. 2011. Tsunoda A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic variation in the bioactivation pathway for polycyclic hydrocarbons and heterocyclic amines in relation to risk of colorectal neoplasia. Carcinogenesis. 2011. Wang Hansong, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A POLYMORPHISM IN THE CYTIDINE DEAMINASE PROMOTER PREDICTS SEVERE CAPECITABINE-INDUCED HAND-FOOT SYNDROME. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Caronia Daniela, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Prediction of irinotecan and 5-fluorouracil toxicity and response in patients with advanced colorectal cancer. The pharmacogenomics journal. 2011. Glimelius B, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The predictive value of genetic variations in the vascular endothelial growth factor A gene in metastatic colorectal cancer. The pharmacogenomics journal. 2011. Hansen T F, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic Tailoring of Irinotecan-based First-line Chemotherapy in Metastatic Colorectal Cancer: Results of a Pilot Study. Anticancer research. 2011. Freyer Gilles, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Associations between gene polymorphisms of thymidylate synthase with its protein expression and chemosensitivity to 5-fluorouracil in pancreatic carcinoma cells. Chinese medical journal. 2011. Zhang Qiang, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Multiple genetic polymorphisms in the prediction of clinical outcome of metastatic colorectal cancer patients treated with first-line FOLFOX-4 chemotherapy. Pharmacogenetics and genomics. 2011. Huang Ming-Yii, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gender-specific genomic profiling in metastatic colorectal cancer patients treated with 5-fluorouracil and oxaliplatin. Pharmacogenomics. 2011. Gordon Michael A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic tests in cancer chemotherapy: what physicians should know for clinical application. The Journal of pathology. 2011. Lee Soo-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic profiling and cetuximab outcome in patients with advanced colorectal cancer. BMC cancer. 2011. Dahan Laetitia, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Phase II study of preoperative radiation plus concurrent daily tegafur-uracil (UFT) with leucovorin for locally advanced rectal cancer. BMC cancer. 2011. Cellier Patrice, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomic contribution to drug response. Cancer journal (Sudbury, Mass.). 2011. Watson Roshawn G, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
X-Ray Cross-Complementing Group 1 and Thymidylate Synthase Polymorphisms Might Predict Response to Chemoradiotherapy in Rectal Cancer Patients. International journal of radiation oncology, biology, physics. 2010. Lamas Maria J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ABCB1 gene polymorphisms are associated with adverse reactions in fluoropyrimidine-treated colorectal cancer patients. Pharmacogenomics. 2010. Gonzalez-Haba Eva, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Value of gene polymorphisms as markers of 5-FU therapy response in stage III colon carcinoma: a pilot study. Cancer chemotherapy and pharmacology. 2010. Fariña-Sarasqueta Arantza, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thymidylate synthase germline polymorphisms in rectal cancer patients treated with neoadjuvant chemoradiotherapy based on 5-fluorouracil. Journal of cancer research and clinical oncology. 2010. Páez David, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Systematic review of pharmacoeconomic studies of pharmacogenomic tests. Pharmacogenomics. 2010. Beaulieu Mathieu, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Distribution of TYMS, MTHFR, p53 and MDR1 gene polymorphisms in patients with breast cancer treated with neoadjuvant chemotherapy. Cancer epidemiology. 2010. Henríquez-Hernández Luis Alberto, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thymidylate Synthase Gene Polymorphism Affects the Response to Preoperative 5-Fluorouracil Chemoradiation Therapy in Patients With Rectal Cancer. International journal of radiation oncology, biology, physics. 2010. Hur Hyuk, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic modulation of the Let-7 microRNA binding to KRAS 3'-untranslated region and survival of metastatic colorectal cancer patients treated with salvage cetuximab-irinotecan. The pharmacogenomics journal. 2010. Graziano F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Ciprofloxacin-induced acute haemolytic anaemia in a patient with glucose-6-phosphate dehydrogenase Mediterranean deficiency: a case report. Annals of hematology. 2010. Sansone Stefano, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic predictors of adverse events and response to chemotherapy in metastatic colorectal cancer: results from North American Gastrointestinal Intergroup Trial N9741. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2010. McLeod Howard L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2W1 variant alleles in Caucasians and association of the CYP2W1 G541A (Ala181Thr) polymorphism with increased colorectal cancer risk. Pharmacogenomics. 2010. Gervasini Guillermo, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphisms within the folate pathway predict folate concentrations but are not associated with disease activity in rheumatoid arthritis patients on methotrexate. Pharmacogenetics and genomics. 2010. Stamp Lisa K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of primary miRNA polymorphic variants in metastatic colon cancer patients treated with 5-fluorouracil and irinotecan. The pharmacogenomics journal. 2010. Boni V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic variation in 3-hydroxy-3-methylglutaryl CoA reductase modifies the chemopreventive activity of statins for colorectal cancer. Cancer prevention research (Philadelphia, Pa.). 2010. Lipkin Steven M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Targeted cancer therapies in the twenty-first century: lessons from imatinib. Clinical pharmacology and therapeutics. 2010. Stegmeier F, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic assessment of toxicity and outcome in patients with metastatic colorectal cancer treated with LV5FU2, FOLFOX, and FOLFIRI: FFCD 2000-05. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2010. Boige Valérie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Polymorphisms in xenobiotic metabolizing enzymes and diet influence colorectal adenoma risk. Pharmacogenetics and genomics. 2010. Northwood Emma L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Oxaliplatin, irinotecan and capecitabine as first-line therapy in metastatic colorectal cancer (mCRC): a dose-finding study and pharmacogenomic analysis. British journal of cancer. 2010. Zarate R, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms and the efficacy and toxicity of cisplatin-based chemotherapy in ovarian cancer patients. The pharmacogenomics journal. 2010. Khrunin A V, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Methylenetetrahydrofolate reductase (MTHFR) gene polymorphisms and FOLFOX response in colorectal cancer patients. British journal of clinical pharmacology. 2010. Etienne-Grimaldi Marie-Christine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Colorectal cancer cell lines lack the molecular heterogeneity of clinical colorectal tumors. Clinical colorectal cancer. 2010. Auman James Todd, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genetic polymorphisms in GST genes and survival of colorectal cancer patients treated with chemotherapy. Pharmacogenomics. 2010. Funke Silvia, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms associated with 5-Fluorouracil-induced neurotoxicity. Chemotherapy. 2010. Kim Suk-Ran, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Variants in the dihydropyrimidine dehydrogenase, methylenetetrahydrofolate reductase and thymidylate synthase genes predict early toxicity of 5-fluorouracil in colorectal cancer patients. The Journal of international medical research. 2010. Kristensen M H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leveraging learning from a phase III colorectal cancer clinical trial: outcomes, methodology, meta-analysis and pharmacogenetics. Transactions of the American Clinical and Climatological Association. 2010. Goldberg Richard M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Association of molecular markers with toxicity outcomes in a randomized trial of chemotherapy for advanced colorectal cancer: the FOCUS trial. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2009. Braun Michael S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MTHFR polymorphisms and 5-FU-based adjuvant chemotherapy in colorectal cancer. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO. 2009. Afzal S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Prostaglandin synthase 2/cyclooxygenase 2 (PTGS2/COX2) 8473T>C polymorphism associated with prognosis for patients with colorectal cancer treated with capecitabine and oxaliplatin. Cancer chemotherapy and pharmacology. 2009. Kim Jong Gwang, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No evidence for variation in colorectal cancer risk associated with different types of postmenopausal hormone therapy. Clinical pharmacology and therapeutics. 2009. Hoffmeister M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Chemotherapy: Optimizing irinotecan regimens for colorectal cancer. Nature reviews. Clinical oncology. 2009. Yim Kein-Leong, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Common variations in ERCC2 are associated with response to cisplatin chemotherapy and clinical outcome in osteosarcoma patients. The pharmacogenomics journal. 2009. Caronia D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Investigation of inter-individual variability of the one-carbon folate pathway: a bioinformatic and genetic review. The pharmacogenomics journal. 2009. Carr D F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cost effectiveness of pharmacogenetic testing for uridine diphosphate glucuronosyltransferase 1A1 before irinotecan administration for metastatic colorectal cancer. Cancer. 2009. Gold Heather Taffet, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Cisplatin pharmacogenetics, DNA repair polymorphisms, and esophageal cancer outcomes. Pharmacogenetics and genomics. 2009. Bradbury Penelope A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MTHFR gene polymorphisms and response to chemotherapy in colorectal cancer: a meta-analysis. Pharmacogenomics. 2009. Zintzaras Elias, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Circulating methylated SEPT9 DNA in plasma is a biomarker for colorectal cancer. Clinical chemistry. 2009. deVos Theo, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Very important pharmacogene summary: sulfotransferase 1A1. Pharmacogenetics and genomics. 2009. Hildebrandt Michelle, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Dihydropyrimidine dehydrogenase gene variation and severe 5-fluorouracil toxicity: a haplotype assessment. Pharmacogenomics. 2009. Amstutz Ursula, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics and biomarkers in colorectal cancer. The pharmacogenomics journal. 2009. Strimpakos A S, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Predictors of survival and toxicity in patients on adjuvant therapy with 5-fluorouracil for colorectal cancer. British journal of cancer. 2009. Gusella M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms affecting clinical outcomes in epithelial ovarian cancer patients treated with taxanes and platinum compounds: a Korean population-based study. Gynecologic oncology. 2009. Kim Hee Seung, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Predictive role of the UGT1A1, UGT1A7, and UGT1A9 genetic variants and their haplotypes on the outcome of metastatic colorectal cancer patients treated with fluorouracil, leucovorin, and irinotecan. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2009. Cecchin Erika, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
UGT1A1*28 genotype predicts gastrointestinal toxicity in patients treated with intermediate-dose irinotecan. Pharmacogenomics. 2009. Ferraldeschi Roberta, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Methotrexate in pediatric osteosarcoma: response and toxicity in relation to genetic polymorphisms and dihydrofolate reductase and reduced folate carrier 1 expression. The Journal of pediatrics. 2009. Patiño-García Ana, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Prognostic significance of p53 codon 72 polymorphism differs with race in colorectal adenocarcinoma. Clinical cancer research : an official journal of the American Association for Cancer Research. 2009. Katkoori Venkat R, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
DNA repair gene polymorphisms predict favorable clinical outcome in advanced non-small-cell lung cancer. Clinical lung cancer. 2009. Kalikaki Aristea, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A transposon-based genetic screen in mice identifies genes altered in colorectal cancer. Science (New York, N.Y.). 2009. Starr Timothy K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Variations in the interleukin-1 receptor antagonist gene impact on survival of patients with advanced colorectal cancer. The pharmacogenomics journal. 2009. Graziano F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics and pharmacogenomics of anticancer agents. CA: a cancer journal for clinicians. 2009. Huang R Stephanie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Predicting clinical outcome of 5-fluorouracil-based chemotherapy for colon cancer patients: is the CpG island methylator phenotype the 5-fluorouracil-responsive subgroup?. International journal of clinical oncology / Japan Society of Clinical Oncology. 2008. Iacopetta Barry, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Meta-analysis of genome-wide association data identifies four new susceptibility loci for colorectal cancer. Nature genetics. 2008. Houlston Richard S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Influence of dihydropyrimidine dehydrogenase gene (DPYD) coding sequence variants on the development of fluoropyrimidine-related toxicity in patients with high-grade toxicity and patients with excellent tolerance of fluoropyrimidine-based chemotherapy. Neoplasma. 2009. Kleibl Z, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Predictive Factors for Response and Toxicity in Chemotherapy: Pharmacogenomics. Seminars in colon & rectal surgery. 2008. Sanoff Hanna K, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of ATP-binding cassette, sub-family C, number 2 (ABCC2) genotype with pharmacokinetics of irinotecan in Japanese patients with metastatic colorectal cancer treated with irinotecan plus infusional 5-fluorouracil/leucovorin (FOLFIRI). Biological & pharmaceutical bulletin. 2008. Fujita Ken-ichi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Red meat intake, doneness, polymorphisms in genes that encode carcinogen-metabolizing enzymes, and colorectal cancer risk. Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology. 2008. Cotterchio Michelle, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The 18-kDa translocator protein, formerly known as the peripheral-type benzodiazepine receptor, confers proapoptotic and antineoplastic effects in a human colorectal cancer cell line. Pharmacogenetics and genomics. 2008. Shoukrun Rami, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacokinetic and pharmacogenetic determinants of the activity and toxicity of irinotecan in metastatic colorectal cancer patients. British journal of cancer. 2008. Rouits E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
K-ras mutations and benefit from cetuximab in advanced colorectal cancer. The New England journal of medicine. 2008. Karapetis Christos S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Transcription factor-binding sites in the thymidylate synthase gene: predictors of outcome in patients with metastatic colorectal cancer treated with 5-fluorouracil and oxaliplatin?. The pharmacogenomics journal. 2008. Paré L, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphisms in folate-related genes: association with side effects of high-dose methotrexate in childhood acute lymphoblastic leukemia. Leukemia : official journal of the Leukemia Society of America, Leukemia Research Fund, U.K. 2008. Huang L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CDK8 is a colorectal cancer oncogene that regulates beta-catenin activity. Nature. 2008. Firestein Ron, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Core signaling pathways in human pancreatic cancers revealed by global genomic analyses. Science (New York, N.Y.). 2008. Jones Sin, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Germline allele-specific expression of TGFBR1 confers an increased risk of colorectal cancer. Science (New York, N.Y.). 2008. Valle Laura, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics in colorectal cancer: a systematic review. Pharmacogenomics. 2008. Funke Silvia, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic profiling in patients with advanced colorectal cancer treated with first-line FOLFIRI chemotherapy. The pharmacogenomics journal. 2008. Ruzzo A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The influence of fluorouracil outcome parameters on tolerance and efficacy in patients with advanced colorectal cancer. The pharmacogenomics journal. 2008. Capitain O, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
UGT1A1*28 genotype and irinotecan dosage in patients with metastatic colorectal cancer: a Dutch Colorectal Cancer Group study. British journal of cancer. 2008. Kweekel D M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Capecitabine: an overview of the side effects and their management. Anti-cancer drugs. 2008. Saif Muhammad Wasif, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Low expression of gamma-glutamyl hydrolase mRNA in primary colorectal cancer with the CpG island methylator phenotype. British journal of cancer. 2008. Kawakami K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
UGT1A1*28 polymorphism predicts irinotecan-induced severe toxicities without affecting treatment outcome and survival in patients with metastatic colorectal carcinoma. Cancer. 2008. Liu Chun-Yu, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A carboxylesterase 2 gene polymorphism as predictor of capecitabine on response and time to progression. Current drug metabolism. 2008. Ribelles N, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cost-effectiveness of UGT1A1 genotyping in second-line, high-dose, once every 3 weeks irinotecan monotherapy treatment of colorectal cancer. Pharmacogenomics. 2008. Obradovic Marko, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Common polymorphisms in the folate pathway predict efficacy of combination regimens containing methotrexate and sulfasalazine in early rheumatoid arthritis. The Journal of rheumatology. 2008. James Heather M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Irinotecan pharmacogenetics: influence of pharmacodynamic genes. Clinical cancer research : an official journal of the American Association for Cancer Research. 2008. Hoskins Janelle M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic profiling for cetuximab plus irinotecan therapy in patients with refractory advanced colorectal cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2008. Graziano Francesco, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Meat intake, heterocyclic amine exposure, and metabolizing enzyme polymorphisms in relation to colorectal polyp risk. Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology. 2008. Shin Aesun, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thymidylate synthase and methylenetetrahydrofolate reductase gene polymorphisms and toxicity to capecitabine in advanced colorectal cancer patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2008. Sharma Rohini, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Common genetic variants at the CRAC1 (HMPS) locus on chromosome 15q13.3 influence colorectal cancer risk. Nature genetics. 2008. Jaeger Emma, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ERCC2 2251A>C genetic polymorphism was highly correlated with early relapse in high-risk stage II and stage III colorectal cancer patients: a preliminary study. BMC cancer. 2008. Huang Ming-Yii, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genotyping panel for assessing response to cancer chemotherapy. BMC medical genomics. 2008. Dai Zunyan, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Determination of ERCC2 Lys751Gln and GSTP1 Ile105Val gene polymorphisms in colorectal cancer patients: relationships with treatment outcome. Pharmacogenomics. 2007. Le Morvan Valérie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
5-Fluorouracil toxicity-attributable IVS14 + 1G > A mutation of the dihydropyrimidine dehydrogenase gene in Polish colorectal cancer patients. Pharmacological reports : PR. 2008. Sulzyc-Bielicka Violetta, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Strong association of a common dihydropyrimidine dehydrogenase gene polymorphism with fluoropyrimidine-related toxicity in cancer patients. PloS one. 2008. Gross Eva, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Relationship of EGFR mutations, expression, amplification, and polymorphisms to epidermal growth factor receptor inhibitors in the NCI60 cell lines. Clinical cancer research : an official journal of the American Association for Cancer Research. 2007. Liu Wanqing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A genome-wide association study shows that common alleles of SMAD7 influence colorectal cancer risk. Nature genetics. 2007. Broderick Peter, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
In silico and in vitro pharmacogenetic analysis in mice. Proceedings of the National Academy of Sciences of the United States of America. 2007. Guo Yingying, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cetuximab for the treatment of colorectal cancer. The New England journal of medicine. 2007. Jonker Derek J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms of folate metabolic enzymes and toxicities of high dose methotrexate in children with acute lymphoblastic leukemia. Annals of hematology. 2007. Pakakasama Samart, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
FCGR2A and FCGR3A polymorphisms associated with clinical outcome of epidermal growth factor receptor expressing metastatic colorectal cancer patients treated with single-agent cetuximab. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2007. Zhang Wu, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
G>C SNP of thymidylate synthase with respect to colorectal cancer. Pharmacogenomics. 2007. Gusella Milena, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphisms in folate, pyrimidine, and purine metabolism are associated with efficacy and toxicity of methotrexate in psoriasis. The Journal of investigative dermatology. 2007. Campalani Emanuela, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
5-Fluorouracil-related severe toxicity: a comparison of different methods for the pretherapeutic detection of dihydropyrimidine dehydrogenase deficiency. Cancer letters. 2007. Boisdron-Celle M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Aspirin and colon cancer--targeting prevention?. The New England journal of medicine. 2007. Markowitz Sanford D. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Aspirin and the risk of colorectal cancer in relation to the expression of COX-2. The New England journal of medicine. 2007. Chan Andrew T, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic profiling in patients with advanced colorectal cancer treated with first-line FOLFOX-4 chemotherapy. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2007. Ruzzo Annamaria, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Circulating VEGF reduction, response and outcome in advanced colorectal cancer patients treated with cetuximab plus irinotecan. Pharmacogenomics. 2007. Vincenzi Bruno, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Thymidylate synthase (TYMS) and dihydropyrimidine dehydrogenase (DPYD) polymorphisms in the Korean population for prediction of 5-fluorouracil-associated toxicity. Therapeutic drug monitoring. 2007. Cho Hyun-Jung, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Polymorphisms in the thymidylate synthase and dihydropyrimidine dehydrogenase genes predict response and toxicity to capecitabine-raltitrexed in colorectal cancer. Oncology reports. 2007. Salgado Josefa, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Results from an in vitro and a clinical/pharmacological phase I study with the combination irinotecan and sorafenib. European journal of cancer (Oxford, England : 1990). 2007. Mross K, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
XRCC1 R399Q polymorphism is associated with response to platinum-based neoadjuvant chemotherapy in bulky cervical cancer. Gynecologic oncology. 2006. Chung Hyun Hoon, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of irinotecan: clinical perspectives on the utility of genotyping. Pharmacogenomics. 2006. Innocenti Federico, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Clinical relevance of different dihydropyrimidine dehydrogenase gene single nucleotide polymorphisms on 5-fluorouracil tolerance. Molecular cancer therapeutics. 2006. Morel Alain, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinical pharmacokinetics of irinotecan-based chemotherapy in colorectal cancer patients. Current clinical pharmacology. 2006. Di Paolo Antonello, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Glutathione-S-transferase P1 isoenzyme polymorphisms, platinum-based chemotherapy, and non-small cell lung cancer. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2006. Booton Richard, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of SLCO1B1 gene and the impact of *1b and *15 haplotypes on irinotecan disposition in Asian cancer patients. Pharmacogenetics and genomics. 2006. Xiang Xiaoqiang, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Orotate phosphoribosyltransferase gene polymorphism predicts toxicity in patients treated with bolus 5-fluorouracil regimen. Clinical cancer research : an official journal of the American Association for Cancer Research. 2006. Ichikawa Wataru, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The role of UGT1A1*28 polymorphism in the pharmacodynamics and pharmacokinetics of irinotecan in patients with metastatic colorectal cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2006. Toffoli Giuseppe, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Cyclin D1 and epidermal growth factor polymorphisms associated with survival in patients with advanced colorectal cancer treated with Cetuximab. Pharmacogenetics and genomics. 2006. Zhang Wu, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Acquired resistance to the anticancer drug paclitaxel is associated with induction of cytochrome P450 2C8. Pharmacogenomics. 2006. García-Martín Elena, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Glutathione S-transferase P1 polymorphism (Ile105Val) predicts cumulative neuropathy in patients receiving oxaliplatin-based chemotherapy. Clinical cancer research : an official journal of the American Association for Cancer Research. 2006. Lecomte Thierry, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Uridine diphosphate glucuronosyl transferase 1A1 promoter polymorphism predicts the risk of gastrointestinal toxicity and fatigue induced by irinotecan-based chemotherapy. Cancer. 2006. Massacesi Cristian, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Heterozygous mutations in PMS2 cause hereditary nonpolyposis colorectal carcinoma (Lynch syndrome). Gastroenterology. 2006. Hendriks Yvonne M C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Protective effect of nonsteroidal anti-inflammatory drugs on colorectal adenomas is modified by a polymorphism in peroxisome proliferator-activated receptor delta. Pharmacogenetics and genomics. 2006. Siezen Christine L E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A novel G/C single-nucleotide polymorphism in the double 28-bp repeat thymidylate synthase allele. The pharmacogenomics journal. 2006. Gusella M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphic tandem repeat sequences of the thymidylate synthase gene correlates with cellular-based sensitivity to fluoropyrimidine antitumor agents. Cancer chemotherapy and pharmacology. 2005. Yawata Ayako, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of extraordinary responses to 5-FU/cisplatin chemotherapy in advanced gastric cancer -- report of 2 cases. Onkologie. 2005. Wolschke Christine, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Relationships between promoter polymorphisms in the thymidylate synthase gene and mRNA levels in colorectal cancers. European journal of cancer (Oxford, England : 1990). 2005. Morganti Maria, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MGMT promoter methylation and field defect in sporadic colorectal cancer. Journal of the National Cancer Institute. 2005. Shen Lanlan, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Analysis of the DPYD gene implicated in 5-fluorouracil catabolism in a cohort of Caucasian individuals. Clinical cancer research : an official journal of the American Association for Cancer Research. 2005. Seck Katharina, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Effect of polymorphisms in folate-related genes on in vitro methotrexate sensitivity in pediatric acute lymphoblastic leukemia. Blood. 2005. de Jonge Robert, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of outcome in children with acute lymphoblastic leukemia. Blood. 2005. Rocha Jose Claudio C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cardiovascular risk associated with celecoxib in a clinical trial for colorectal adenoma prevention. The New England journal of medicine. 2005. Solomon Scott D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Bile acids induce MUC2 overexpression in human colon carcinoma cells. Cancer. 2005. Song Shumei, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
PTGS2 (COX-2) -765G > C promoter variant reduces risk of colorectal adenoma among nonusers of nonsteroidal anti-inflammatory drugs. Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology. 2005. Ulrich Cornelia M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic variants in the UGT1A6 enzyme, aspirin use, and the risk of colorectal adenoma. Journal of the National Cancer Institute. 2005. Chan Andrew T, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Loss of imprinting of Igf2 alters intestinal maturation and tumorigenesis in mice. Science (New York, N.Y.). 2005. Sakatani Takashi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cardiovascular events associated with rofecoxib in a colorectal adenoma chemoprevention trial. The New England journal of medicine. 2005. Bresalier Robert S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Colorectal adenoma risk is modified by the interplay between polymorphisms in arachidonic acid pathway genes and fish consumption. Carcinogenesis. 2005. Siezen Christine L E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Methylenetetrahydrofolate reductase gene polymorphisms and response to fluorouracil-based treatment in advanced colorectal cancer patients. Pharmacogenetics. 2004. Etienne Marie-Christine, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Combining several polymorphisms of thymidylate synthase gene for pharmacogenetic analysis. The pharmacogenomics journal. 2005. Krajinovic M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
UGT1A1 gene variations and irinotecan treatment in patients with metastatic colorectal cancer. British journal of cancer. 2004. Marcuello E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Relevance of different UGT1A1 polymorphisms in irinotecan-induced toxicity: a molecular and clinical study of 75 patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2004. Rouits Elisabeth, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A multivariate analysis of genomic polymorphisms: prediction of clinical outcome to 5-FU/oxaliplatin combination chemotherapy in refractory colorectal cancer. British journal of cancer. 2004. Stoehlmacher J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
High frequency of mutations of the PIK3CA gene in human cancers. Science (New York, N.Y.). 2004. Samuels Yardena, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Methionine synthase D919G polymorphism, folate metabolism, and colorectal adenoma risk. Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology. 2004. Goode Ellen L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Mutations in exon 14 of dihydropyrimidine dehydrogenase and 5-Fluorouracil toxicity in Portuguese colorectal cancer patients. Genetics in medicine : official journal of the American College of Medical Genetics. 2004. Salgueiro Natália, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Detailed analysis of five mutations in dihydropyrimidine dehydrogenase detected in cancer patients with 5-fluorouracil-related side effects. Human mutation. 2003. Gross Eva, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Role of polymorphisms in MTHFR and MTHFD1 genes in the outcome of childhood acute lymphoblastic leukemia. The pharmacogenomics journal. 2004. Krajinovic M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Ferredoxin reductase: pharmacogenomic assessment in colorectal cancer. Cancer research. 2003. Yu Jinsheng, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Identification and functional analysis of single nucleotide polymorphism in the tandem repeat sequence of thymidylate synthase gene. Cancer research. 2003. Kawakami Kazuyuki, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The influence of cyclin D1 (CCND1) 870A>G polymorphism and CCND1-thymidylate synthase (TS) gene-gene interaction on the outcome of childhood acute lymphoblastic leukaemia. Pharmacogenetics. 2003. Costea Irina, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thymidylate synthase gene polymorphism and its association with relapse in childhood B-cell precursor acute lymphoblastic leukemia. Haematologica. 2003. Lauten Melchior, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Irinotecan activation by human carboxylesterases in colorectal adenocarcinoma cells. Clinical cancer research : an official journal of the American Association for Cancer Research. 2002. Wu Michael H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Association between glutathione S-transferase P1, T1, and M1 genetic polymorphism and survival of patients with metastatic colorectal cancer. Journal of the National Cancer Institute. 2002. Stoehlmacher Jan, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphism of the thymidylate synthase gene and outcome of acute lymphoblastic leukaemia. Lancet. 2002. Krajinovic M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Arylamine N-acetyltransferase type 2 and glutathione S-transferases M1 and T1 polymorphisms in familial adenomatous polyposis. Pharmacogenetics. 2002. Lamberti Christof, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A Xeroderma pigmentosum group D gene polymorphism predicts clinical outcome to platinum-based chemotherapy in patients with advanced colorectal cancer. Cancer research. 2001. Park D J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thymidylate synthase gene polymorphism determines response and toxicity of 5-FU chemotherapy. The pharmacogenomics journal. 2001. Pullarkat S T, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A polymorphism of the methionine synthase gene: association with plasma folate, vitamin B12, homocyst(e)ine, and colorectal cancer risk. Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology. 1999. Ma J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphic tandem repeats in the thymidylate synthase gene is associated with its protein expression in human gastrointestinal cancers. Anticancer research. 1999. Kawakami K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Predictors of N-acetyltransferase activity: should caffeine phenotyping and NAT2 genotyping be used interchangeably in epidemiological studies?. Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology. 1996. Le Marchand L, et al. PubMed