Colorectal Neoplasms

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Gene ? Variant?
Alternate Names ? Chemicals ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
No VIP available CA No VIP available ABCB1 *2 (PMID: 11503014) N/A N/A N/A
No VIP available No VIP available No VIP available CYP2A6 *4A N/A N/A N/A
No VIP available No VIP available No VIP available CYP2A6 *7 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2A6 *9 N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *1 N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *2A N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *2B N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *4 N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *5 N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *9A N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *13 N/A N/A N/A
No VIP available No VIP available No VIP available G6PD Mediterranean, Dallas, Panama' Sassari, Cagliari, Birmingham N/A N/A N/A
No VIP available CA No VIP available GSTM1 non-null N/A N/A N/A
No VIP available CA No VIP available GSTM1 null N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *1 N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *6 N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *28 N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *60 N/A N/A N/A
No VIP available CA No VIP available UGT1A6 *2a N/A N/A N/A
No VIP available CA No VIP available UGT1A7 *3 N/A N/A N/A
No VIP available No Clinical Annotations available VA
DPYD poor metabolizer N/A N/A N/A
No VIP available No Clinical Annotations available VA
rs10034692 NC_000004.11:g.75419787A>G, NC_000004.12:g.74554070A>G, NW_003571035.1:g.37578A>G, rs61009756
A > G
No VIP available No Clinical Annotations available VA
rs10049380 NC_000003.11:g.124487443T>C, NC_000003.12:g.124768596T>C, NM_002213.4:c.2017+417A>G, XM_005247436.1:c.1927+417A>G, XM_005247436.2:c.1927+417A>G, XM_006713630.2:c.1882+417A>G, rs59662485
T > C
No VIP available No Clinical Annotations available VA
rs1017733 NC_000004.11:g.75252350C>T, NC_000004.12:g.74386633C>T, NM_001432.2:c.*1825C>T, rs60002456, rs61714962
C > T
No VIP available No Clinical Annotations available VA
rs10380 NC_000005.10:g.7897078C>T, NC_000005.9:g.7897191C>T, NG_008856.1:g.32975C>T, NM_002454.2:c.1783C>T, NM_024010.2:c.1864C>T, NP_002445.2:p.His595Tyr, NP_076915.2:p.His622Tyr, NR_134480.1:n.1906C>T, NR_134481.1:n.1831C>T, NR_134482.1:n.1766C>T, XM_005248304.1:c.1828C>T, XM_005248305.1:c.1783C>T, XM_011514043.1:c.1864C>T, XM_011514044.1:c.1783C>T, XP_005248361.1:p.His610Tyr, XP_005248362.1:p.His595Tyr, XP_011512345.1:p.His622Tyr, XP_011512346.1:p.His595Tyr, XR_241702.1:n.1905C>T, XR_241703.1:n.1790C>T, XR_925614.1:n.1909C>T, rs1134946, rs17354145, rs2287782, rs3197331, rs52810705, rs60582795, rs9282886
C > -
C > T
No VIP available CA VA
rs1045642 NC_000007.13:g.87138645A>G, NC_000007.14:g.87509329A>G, NG_011513.1:g.208920T>C, NM_000927.4:c.3435T>C, NP_000918.2:p.Ile1145=, rs10239679, rs11568726, rs117328163, rs17210003, rs2229108, rs386513066, rs60023214, rs9690664
A > G
No VIP available No Clinical Annotations available VA
rs1049550 NC_000010.10:g.81926702G>A, NC_000010.11:g.80166946G>A, NM_001157.2:c.688C>T, NM_001278407.1:c.688C>T, NM_001278408.1:c.688C>T, NM_001278409.1:c.589C>T, NM_145868.1:c.688C>T, NM_145869.1:c.688C>T, NP_001148.1:p.Arg230Cys, NP_001265336.1:p.Arg230Cys, NP_001265337.1:p.Arg230Cys, NP_001265338.1:p.Arg197Cys, NP_665875.1:p.Arg230Cys, NP_665876.1:p.Arg230Cys, XM_005269741.1:c.988C>T, XM_005269741.3:c.988C>T, XM_005269742.1:c.688C>T, XM_006717813.1:c.688C>T, XM_006717814.2:c.688C>T, XM_011539735.1:c.688C>T, XM_011539736.1:c.688C>T, XP_005269798.1:p.Arg330Cys, XP_005269799.1:p.Arg230Cys, XP_006717876.1:p.Arg230Cys, XP_006717877.1:p.Arg230Cys, XP_011538037.1:p.Arg230Cys, XP_011538038.1:p.Arg230Cys, rs17676239, rs1802933, rs2070070, rs2228426, rs3189725, rs52830790
G > A
No VIP available No Clinical Annotations available VA
rs10505806 NC_000012.11:g.17488764A>T, NC_000012.12:g.17335830A>T, rs17382305
A > T
No VIP available CA VA
rs1051266 NC_000021.8:g.46957794T>C, NC_000021.9:g.45537880T>C, NG_028278.1:g.9592A>G, NM_001205206.1:c.80A>G, NM_194255.2:c.80A>G, NP_001192135.1:p.His27Arg, NP_919231.1:p.His27Arg, XM_005261163.1:c.80A>G, XM_005261164.1:c.-279A>G, XM_005261164.2:c.-279A>G, XM_011529696.1:c.371A>G, XM_011529697.1:c.371A>G, XM_011529698.1:c.146A>G, XM_011529699.1:c.-1639A>G, XM_011529700.1:c.80A>G, XM_011529701.1:c.80A>G, XM_011529702.1:c.80A>G, XM_011529703.1:c.80A>G, XM_011529704.1:c.80A>G, XM_011529705.1:c.371A>G, XM_011529707.1:c.371A>G, XM_011529708.1:c.80A>G, XM_011529709.1:c.-279A>G, XM_011529710.1:c.-165-5732A>G, XP_005261220.1:p.His27Arg, XP_011527998.1:p.His124Arg, XP_011527999.1:p.His124Arg, XP_011528000.1:p.His49Arg, XP_011528002.1:p.His27Arg, XP_011528003.1:p.His27Arg, XP_011528004.1:p.His27Arg, XP_011528005.1:p.His27Arg, XP_011528006.1:p.His27Arg, XP_011528007.1:p.His124Arg, XP_011528009.1:p.His124Arg, XP_011528010.1:p.His27Arg, rs17844977, rs17857726, rs3171496, rs386514057, rs61510559
T > C
No VIP available CA VA
rs1056515 NC_000001.10:g.163113260G>T, NC_000001.11:g.163143470G>T, NG_027731.2:g.183322C>A, NM_001195303.2:c.*3872C>A, NM_001254748.1:c.*3872C>A, NM_001254749.1:c.*3872C>A, NM_003617.3:c.*3872C>A, rs111183181, rs386514407, rs58775087, rs59069797
G > T
No VIP available No Clinical Annotations available VA
rs1063320 NC_000006.11:g.29798749C=, NC_000006.11:g.29798749C>G, NC_000006.12:g.29830972C=, NC_000006.12:g.29830972C>G, NG_029039.1:g.8994C=, NG_029039.1:g.8994C>G, NM_002127.5:c.*233C=, NM_002127.5:c.*233C>G, NT_113891.3:g.1314548G=, NT_113891.3:g.1314548G>C, NT_167244.2:g.1096598G=, NT_167244.2:g.1096598G>C, NT_167245.1:g.1099370C=, NT_167245.1:g.1099370C>G, NT_167245.2:g.1093785C=, NT_167245.2:g.1093785C>G, NT_167246.1:g.1099078C=, NT_167246.1:g.1099078C>G, NT_167246.2:g.1093458C=, NT_167246.2:g.1093458C>G, NT_167247.1:g.1099028C=, NT_167247.1:g.1099028C>G, NT_167247.2:g.1093443C=, NT_167247.2:g.1093443C>G, NT_167248.2:g.1093752G=, NT_167248.2:g.1093752G>C, NT_167249.2:g.1137017G=, NT_167249.2:g.1137017G>C, XM_005249055.1:c.*233C=, XM_005249055.1:c.*233C>G, XM_005249056.1:c.*233C>G, XM_005249056.1:c.*233G>C, XM_005249057.1:c.*448C>G, XM_005249057.1:c.*448G>C, XM_005249058.1:c.*233C=, XM_005249058.1:c.*233C>G, XM_005272810.1:c.*247G=, XM_005272810.1:c.*247G>C, XM_005274964.1:c.*233C=, XM_005274964.1:c.*233C>G, XM_005274965.1:c.*233C=, XM_005274965.1:c.*233C>G, XM_005274966.1:c.*448C>G, XM_005274966.1:c.*448G>C, XM_005274967.1:c.*233C=, XM_005274967.1:c.*233C>G, XM_005275119.1:c.*233C=, XM_005275119.1:c.*233C>G, XM_005275120.1:c.*233C>G, XM_005275120.1:c.*233G>C, XM_005275121.1:c.*448C>G, XM_005275121.1:c.*448G>C, XM_005275122.1:c.*233C>G, XM_005275122.1:c.*233G>C, XM_005275246.1:c.*233C=, XM_005275246.1:c.*233C>G, XM_005275247.1:c.*233C=, XM_005275247.1:c.*233C>G, XM_005275248.1:c.*448C>G, XM_005275248.1:c.*448G>C, XM_005275249.1:c.*233C=, XM_005275249.1:c.*233C>G, XM_005275394.1:c.*247G=, XM_005275394.1:c.*247G>C, XM_005275549.1:c.*247G=, XM_005275549.1:c.*247G>C, XM_005275550.1:c.*247C>G, XM_005275550.1:c.*247G>C, XM_005275551.1:c.*462C>G, XM_005275551.1:c.*462G>C, XM_005275552.1:c.*247G=, XM_005275552.1:c.*247G>C, XM_011547651.1:c.*233C=, XM_011547651.1:c.*233C>G, XM_011547882.1:c.*233C=, XM_011547882.1:c.*233C>G, XM_011548048.1:c.*233C=, XM_011548048.1:c.*233C>G, XM_011548236.1:c.*247G=, XM_011548236.1:c.*247G>C, XM_011548237.1:c.*247G=, XM_011548237.1:c.*247G>C, XM_011548430.1:c.*247G=, XM_011548430.1:c.*247G>C, XM_011548431.1:c.*247G=, XM_011548431.1:c.*247G>C, XR_241896.1:n.1859C=, XR_241896.1:n.1859C>G, XR_246963.1:n.1793G=, XR_246963.1:n.1793G>C, XR_247353.1:n.1859C=, XR_247353.1:n.1859C>G, XR_247370.1:n.1859C=, XR_247370.1:n.1859C>G, XR_247389.1:n.1859C=, XR_247389.1:n.1859C>G, XR_247402.1:n.1793G=, XR_247402.1:n.1793G>C, XR_247423.1:n.1851G=, XR_247423.1:n.1851G>C, rs115928989, rs117512550, rs1632929, rs16867727, rs17185496, rs3204385, rs386485817, rs58677621, rs9258500
C > C
C > G
No VIP available No Clinical Annotations available VA
rs10784749 NC_000012.11:g.69422029C>G, NC_000012.12:g.69028249C>G, rs58473609
C > G
No VIP available No Clinical Annotations available VA
rs10876844 NC_000012.11:g.56050706C>A, NC_000012.12:g.55656922C>A, XM_011538339.1:c.-700+2791G>T, rs61345690
C > A
No VIP available No Clinical Annotations available VA
rs10929302 NC_000002.11:g.234665782G>A, NC_000002.12:g.233757136G>A, NG_002601.2:g.172393G>A, NG_033238.1:g.1864G>A, NM_001072.3:c.862-9898G>A, NM_007120.2:c.868-9898G>A, NM_019075.2:c.856-9898G>A, NM_019076.4:c.856-9898G>A, NM_019077.2:c.856-9898G>A, NM_019078.1:c.868-9898G>A, NM_019093.2:c.868-9898G>A, NM_021027.2:c.856-9898G>A, NM_205862.1:c.61-9898G>A, NR_037694.1:n.-1791C>T, NR_037695.1:n.-1791C>T, NR_037696.1:n.-1791C>T, XR_241238.1:n.924-9898G>A, XR_241240.1:n.1023-9898G>A, XR_241241.1:n.942-9898G>A
G > A
No VIP available CA VA
rs10937158 NC_000003.11:g.183708439T>C, NC_000003.12:g.183990651T>C, NM_001023587.2:c.130-1268A>G, NM_001320032.1:c.-1402-1268A>G, NM_005688.3:c.130-1268A>G, NR_135125.1:n.316-1268A>G, XM_005247058.1:c.130-1268A>G, XM_005247058.3:c.130-1268A>G, XM_005247059.1:c.130-1268A>G, XM_005247059.3:c.130-1268A>G, XM_005247060.1:c.130-1268A>G, XM_005247061.1:c.130-1268A>G, XM_005247062.1:c.-1402-1268A>G, XM_011512314.1:c.130-1268A>G, XM_011512315.1:c.130-1268A>G, XM_011512316.1:c.-1402-1268A>G
T > C
No VIP available No Clinical Annotations available VA
rs1105879 NC_000002.11:g.234602202A>C, NC_000002.12:g.233693556A>C, NG_002601.2:g.108813A>C, NM_001072.3:c.552A>C, NM_019075.2:c.855+56179A>C, NM_019076.4:c.856-73478A>C, NM_019077.2:c.855+10764A>C, NM_021027.2:c.855+20767A>C, NM_205862.1:c.-7-243A>C, NP_001063.2:p.Arg184Ser, XR_241240.1:n.713A>C, XR_241241.1:n.941+20767A>C, rs17684024, rs386516515, rs4365457, rs61226878
A > C
No VIP available No Clinical Annotations available VA
rs11072508 NC_000015.10:g.74770056C>T, NC_000015.9:g.75062397C>T, rs17419373
C > T
No VIP available CA VA
rs11078659 NC_000017.10:g.6903944G>A, NC_000017.11:g.7000625G>A, NM_000697.2:c.951+146G>A, NR_040089.1:n.233+9171C>T, XM_005256588.1:c.585+146G>A, XM_011523780.1:c.1101+146G>A, XR_243530.1:n.386-1039C>T, XR_243532.1:n.281-1039C>T, rs57178620
G > A
No VIP available CA VA
rs112445441 NC_000012.11:g.25398281C>A, NC_000012.11:g.25398281C>G, NC_000012.11:g.25398281C>T, NC_000012.12:g.25245347C>A, NC_000012.12:g.25245347C>G, NC_000012.12:g.25245347C>T, NG_007524.1:g.10574G>A, NG_007524.1:g.10574G>C, NG_007524.1:g.10574G>T, NM_004985.4:c.38G>A, NM_004985.4:c.38G>C, NM_004985.4:c.38G>T, NM_033360.3:c.38G>A, NM_033360.3:c.38G>C, NM_033360.3:c.38G>T, NP_004976.2:p.Gly13Ala, NP_004976.2:p.Gly13Asp, NP_004976.2:p.Gly13Val, NP_203524.1:p.Gly13Ala, NP_203524.1:p.Gly13Asp, NP_203524.1:p.Gly13Val, XM_005253365.1:c.38G>A, XM_005253365.1:c.38G>C, XM_005253365.1:c.38G>T, XM_006719069.2:c.38G>A, XM_006719069.2:c.38G>C, XM_006719069.2:c.38G>T, XM_011520653.1:c.38G>A, XM_011520653.1:c.38G>C, XM_011520653.1:c.38G>T, XP_005253422.1:p.Gly13Ala, XP_005253422.1:p.Gly13Asp, XP_005253422.1:p.Gly13Val, XP_006719132.1:p.Gly13Ala, XP_006719132.1:p.Gly13Asp, XP_006719132.1:p.Gly13Val, XP_011518955.1:p.Gly13Ala, XP_011518955.1:p.Gly13Asp, XP_011518955.1:p.Gly13Val
C > A
C > G
C > T
No VIP available No Clinical Annotations available VA
rs112723255 NC_000022.10:g.50964255C>T, NC_000022.11:g.50525826C>T, NG_011860.1:g.9260G>A, NG_016235.1:g.5614G>A, NG_021419.1:g.22611C>T, NM_001113755.2:c.1393G>A, NM_001113756.2:c.1393G>A, NM_001169109.1:c.-14+420G>A, NM_001169110.1:c.-14+175G>A, NM_001169111.1:c.-398G>A, NM_001257988.1:c.1393G>A, NM_001257989.1:c.1408G>A, NM_001953.4:c.1393G>A, NM_005138.2:c.-368G>A, NP_001107227.1:p.Ala465Thr, NP_001107228.1:p.Ala465Thr, NP_001244917.1:p.Ala465Thr, NP_001244918.1:p.Ala470Thr, NP_001944.1:p.Ala465Thr
C > T
No VIP available No Clinical Annotations available VA
rs1127648 NC_000015.10:g.75674754A>G, NC_000015.9:g.75967095A>G, NM_001897.4:c.*796T>C, rs17591523, rs3183827, rs59364090
A > G
No VIP available CA VA
rs1128503 NC_000007.13:g.87179601A>G, NC_000007.14:g.87550285A>G, NG_011513.1:g.167964T>C, NM_000927.4:c.1236T>C, NP_000918.2:p.Gly412=, rs116989428, rs17276907, rs2032587, rs2229105, rs28365046, rs386518005, rs58257317
A > G
No VIP available No Clinical Annotations available VA
rs1138272 NC_000011.10:g.67586108C>T, NC_000011.9:g.67353579C>T, NG_012075.1:g.7514C>T, NM_000852.3:c.341C>T, NP_000843.1:p.Ala114Val, XM_005273958.1:c.338C>T, XP_005274015.1:p.Ala113Val, rs11553894, rs17434783, rs1799811, rs1804665, rs3202011, rs4134657, rs52800258, rs61323549
C > T
No VIP available No Clinical Annotations available VA
rs11479 NC_000022.10:g.50964236G>A, NC_000022.11:g.50525807G>A, NG_011860.1:g.9279C>T, NG_016235.1:g.5633C>T, NG_021419.1:g.22592G>A, NM_001113755.2:c.1412C>T, NM_001113756.2:c.1412C>T, NM_001169109.1:c.-14+439C>T, NM_001169110.1:c.-14+194C>T, NM_001169111.1:c.-379C>T, NM_001257988.1:c.1412C>T, NM_001257989.1:c.1427C>T, NM_001953.4:c.1412C>T, NM_005138.2:c.-349C>T, NP_001107227.1:p.Ser471Leu, NP_001107228.1:p.Ser471Leu, NP_001244917.1:p.Ser471Leu, NP_001244918.1:p.Ser476Leu, NP_001944.1:p.Ser471Leu, rs17846490, rs17859554, rs3202233, rs3829983
G > A
No VIP available CA VA
rs11563250 NC_000002.11:g.234683350A>G, NC_000002.12:g.233774704A>G, NG_002601.2:g.189961A>G, NG_033238.1:g.19432A>G, NM_001287395.1:c.-1068A>G, XM_011511080.1:c.-1068A>G, XM_291007.11:c.-1068A>G, rs35837558
A > G
No VIP available No Clinical Annotations available VA
(CA)16 > (CA)14
(CA)16 > (CA)15
(CA)16 > (CA)17
(CA)16 > (CA)18
(CA)16 > (CA)19
(CA)16 > (CA)20
(CA)16 > (CA)21
(CA)16 > (CA)22
(CA)16 > (CA)23
(CA)16 > (CA)9
No VIP available No Clinical Annotations available VA
rs11568972 NC_000004.11:g.110889007A>C, NC_000004.12:g.109967851A>C, NG_011441.1:g.59968A>C, NM_001178130.2:c.1576-1120A>C, NM_001178131.2:c.1450-1120A>C, NM_001963.5:c.1576-1120A>C, XM_005262796.1:c.1576-1120A>C, XM_005262796.2:c.1576-1120A>C, XM_005262797.1:c.1450-1120A>C, XM_005262797.2:c.1450-1120A>C, XM_005262798.1:c.1576-1120A>C, XM_005262798.2:c.1576-1120A>C, XM_005262799.1:c.1576-1120A>C, XM_005262800.1:c.1576-1120A>C, XM_005262800.2:c.1576-1120A>C, XM_005262801.1:c.1576-1120A>C, XM_005262801.2:c.1576-1120A>C, XM_005262802.1:c.1576-1120A>C, XM_005262802.2:c.1576-1120A>C, XM_006714124.2:c.1576-1120A>C, XM_011531707.1:c.1465-1120A>C, XM_011531708.1:c.1576-1120A>C, XM_011531709.1:c.1576-1120A>C, XR_427532.2:n.2029-1120A>C, XR_938699.1:n.2029-1120A>C
A > C
No VIP available No Clinical Annotations available VA
rs11568993 NC_000004.11:g.110897315C>T, NC_000004.12:g.109976159C>T, NG_011441.1:g.68276C>T, NM_001178130.2:c.1977C>T, NM_001178131.2:c.1851C>T, NM_001963.5:c.1977C>T, NP_001171601.1:p.Cys659=, NP_001171602.1:p.Cys617=, NP_001954.2:p.Cys659=, XM_005262796.1:c.1977C>T, XM_005262796.2:c.1977C>T, XM_005262797.1:c.1851C>T, XM_005262797.2:c.1851C>T, XM_005262798.1:c.1977C>T, XM_005262798.2:c.1977C>T, XM_005262799.1:c.1977C>T, XM_005262800.1:c.1977C>T, XM_005262800.2:c.1977C>T, XM_005262801.1:c.1977C>T, XM_005262801.2:c.1977C>T, XM_005262802.1:c.1977C>T, XM_005262802.2:c.1977C>T, XM_006714124.2:c.1977C>T, XM_011531707.1:c.1866C>T, XM_011531708.1:c.1977C>T, XM_011531709.1:c.1977C>T, XP_005262853.1:p.Cys659=, XP_005262854.1:p.Cys617=, XP_005262855.1:p.Cys659=, XP_005262856.1:p.Cys659=, XP_005262857.1:p.Cys659=, XP_005262858.1:p.Cys659=, XP_005262859.1:p.Cys659=, XP_006714187.1:p.Cys659=, XP_011530009.1:p.Cys622=, XP_011530010.1:p.Cys659=, XP_011530011.1:p.Cys659=, XR_427532.2:n.2430C>T, XR_938699.1:n.2430C>T, rs58950882
C > T
No VIP available CA VA
rs11615 NC_000019.10:g.45420395A>G, NC_000019.9:g.45923653A>G, NG_015839.2:g.63434T>C, NM_001166049.1:c.354T>C, NM_001983.3:c.354T>C, NM_202001.2:c.354T>C, NP_001159521.1:p.Asn118=, NP_001974.1:p.Asn118=, NP_973730.1:p.Asn118=, XM_005258634.1:c.354T>C, XM_005258635.1:c.354T>C, XM_005258635.2:c.354T>C, XM_005258636.1:c.354T>C, XM_005258636.3:c.354T>C, XM_005258637.1:c.354T>C, XM_005258638.1:c.138T>C, XM_011526610.1:c.354T>C, XP_005258691.1:p.Asn118=, XP_005258692.1:p.Asn118=, XP_005258693.1:p.Asn118=, XP_005258694.1:p.Asn118=, XP_005258695.1:p.Asn46=, XP_011524912.1:p.Asn118=, rs1130005, rs17285882, rs17359303, rs17845191, rs17858003, rs17859564, rs2228629, rs3177700, rs3188446, rs3752251, rs59923575
A > G
No VIP available CA VA
rs11692021 NC_000002.11:g.234591205T>C, NC_000002.12:g.233682559T>C, NG_002601.2:g.97816T>C, NM_019075.2:c.855+45182T>C, NM_019076.4:c.855+63997T>C, NM_019077.2:c.622T>C, NM_021027.2:c.855+9770T>C, NP_061950.2:p.Trp208Arg, XM_005246081.1:c.622T>C, XP_005246138.1:p.Trp208Arg, XR_241241.1:n.941+9770T>C, rs17863779, rs57605148
T > C
No VIP available No Clinical Annotations available VA
rs11722476 NC_000004.11:g.95170839G>A, NC_000004.12:g.94249688G>A, NG_031945.1:g.47081G>A, NM_001128429.2:c.740G>A, NM_001128430.1:c.740G>A, NM_020159.4:c.740G>A, NP_001121901.1:p.Ser247Asn, NP_001121902.1:p.Ser247Asn, NP_064544.2:p.Ser247Asn, NR_045644.1:n.1066G>A, XR_938765.1:n.995G>A, XR_938766.1:n.995G>A, rs17854343, rs52806084, rs60379623
G > -
G > A
No VIP available No Clinical Annotations available VA
rs11725706 NC_000004.11:g.75328108G>A, NC_000004.12:g.74462391G>A, rs57576418
G > A
No VIP available No Clinical Annotations available VA
rs1187075 NC_000010.10:g.33246796A>G, NC_000010.11:g.32957868A>G, NG_029012.1:g.5498T>C, NM_002211.3:c.-1+277T>C, NM_133376.2:c.-110T>C, XM_005252448.1:c.-1+277T>C
A > G
No VIP available CA VA
rs11942466 NC_000004.11:g.75422078C>A, NC_000004.12:g.74556361C>A, NW_003571035.1:g.39869C>A
C > A
No VIP available No Clinical Annotations available VA
rs11997869 NC_000008.10:g.6638464C>G, NC_000008.11:g.6780943C>G
C > A
C > G
No VIP available CA VA
rs12022243 NC_000001.10:g.97862780C>T, NC_000001.11:g.97397224C>T, NG_008807.2:g.528836G>A, NM_000110.3:c.1906-14763G>A, XM_005270561.1:c.1795-14763G>A, XM_005270562.1:c.1690-14763G>A, XM_005270562.3:c.1690-14763G>A, XM_005270563.1:c.1906-14763G>A, XM_006710397.2:c.1906-14763G>A
C > T
No VIP available CA VA
rs12132152 NC_000001.10:g.97523004G>A, NC_000001.11:g.97057448G>A, rs58172137
G > A
No VIP available No Clinical Annotations available VA
rs121913529 NC_000012.11:g.25398284C>A, NC_000012.11:g.25398284C>G, NC_000012.11:g.25398284C>T, NC_000012.12:g.25245350C>A, NC_000012.12:g.25245350C>G, NC_000012.12:g.25245350C>T, NG_007524.1:g.10571G>A, NG_007524.1:g.10571G>C, NG_007524.1:g.10571G>T, NM_004985.4:c.35G>A, NM_004985.4:c.35G>C, NM_004985.4:c.35G>T, NM_033360.3:c.35G>A, NM_033360.3:c.35G>C, NM_033360.3:c.35G>T, NP_004976.2:p.Gly12Ala, NP_004976.2:p.Gly12Asp, NP_004976.2:p.Gly12Val, NP_203524.1:p.Gly12Ala, NP_203524.1:p.Gly12Asp, NP_203524.1:p.Gly12Val, XM_005253365.1:c.35G>A, XM_005253365.1:c.35G>C, XM_005253365.1:c.35G>T, XM_006719069.2:c.35G>A, XM_006719069.2:c.35G>C, XM_006719069.2:c.35G>T, XM_011520653.1:c.35G>A, XM_011520653.1:c.35G>C, XM_011520653.1:c.35G>T, XP_005253422.1:p.Gly12Ala, XP_005253422.1:p.Gly12Asp, XP_005253422.1:p.Gly12Val, XP_006719132.1:p.Gly12Ala, XP_006719132.1:p.Gly12Asp, XP_006719132.1:p.Gly12Val, XP_011518955.1:p.Gly12Ala, XP_011518955.1:p.Gly12Asp, XP_011518955.1:p.Gly12Val, rs121913531, rs121913534
C > A
C > G
C > T
No VIP available No Clinical Annotations available VA
rs12410394 NC_000001.10:g.150860186G>A, NC_000001.11:g.150887710G>A, XR_158744.2:n.96+397G>A, XR_158744.3:n.61+397G>A, XR_241119.1:n.-123G>A, rs17609040, rs59537282
G > A
No VIP available CA VA
rs13104811 NC_000004.11:g.75395312G>A, NC_000004.12:g.74529595G>A, NW_003571035.1:g.13103G>A
G > A
No VIP available CA VA
rs13181 NC_000019.10:g.45351661T>G, NC_000019.9:g.45854919T>G, NG_007067.2:g.23927A>C, NM_000400.3:c.2251A>C, NM_177417.2:c.*304T>G, NP_000391.1:p.Lys751Gln, XM_005258536.1:c.*128T>G, XM_005258536.3:c.*128T>G, XM_005258537.1:c.*128T>G, XM_005258538.1:c.*304T>G, XM_005258539.1:c.*304T>G, XM_005258639.1:c.2179A>C, XM_005258640.1:c.2017A>C, XM_005258641.1:c.1513A>C, XM_011526611.1:c.2173A>C, XP_005258696.1:p.Lys727Gln, XP_005258697.1:p.Lys673Gln, XP_005258698.1:p.Lys505Gln, XP_011524913.1:p.Lys725Gln, rs1052559, rs17285142, rs17355147, rs17359310, rs3170171, rs3859422, rs60606175
T > G
No VIP available CA VA
rs1353295 NC_000004.11:g.75329122G>A, NC_000004.12:g.74463405G>A, rs1797595, rs59361263
G > A
No VIP available No Clinical Annotations available VA
rs151264360 NC_000018.10:g.673444_673449delTTAAAG, NC_000018.9:g.673444_673449delTTAAAG, NG_028255.1:g.20841_20846delTTAAAG, NM_001071.2:c.*447_*452delTTAAAG, NM_001126123.3:c.*145-373_*145-368del, NM_001126123.3:c.*145-373_*145-368delCTTTAA, NM_001318759.1:c.*145-373_*145-368del, NM_001318759.1:c.*145-373_*145-368delCTTTAA, NM_001318760.1:c.*446+410_*446+415delCTTTAA, NM_001318760.1:c.*856_*861del, NM_017512.5:c.*856_*861delCTTTAA, NM_202758.3:c.*856_*861delCTTTAA, XM_005258111.1:c.*856_*861delCTTTAA, XM_005258112.1:c.*856_*861delCTTTAA, XM_005258113.1:c.*856_*861delCTTTAA, XM_005258114.1:c.*856_*861delCTTTAA, XM_005258115.1:c.*856_*861delCTTTAA, XM_005258116.1:c.*856_*861delCTTTAA, XM_005258117.1:c.*856_*861delCTTTAA, XM_005258118.1:c.*856_*861delCTTTAA, XM_005258118.2:c.*856_*861del, XM_005258120.1:c.*856_*861delCTTTAA, XM_005258137.1:c.*447_*452delTTAAAG, XM_005258138.1:c.*447_*452delTTAAAG, XM_011525677.1:c.*856_*861del, XM_011525678.1:c.*856_*861del, XM_011525679.1:c.*856_*861del, XM_011525680.1:c.*856_*861del, XM_011525681.1:c.*856_*861del, XM_011525682.1:c.*856_*861del, XM_011525683.1:c.*856_*861del, XM_011525684.1:c.*856_*861del, XM_011525685.1:c.*856_*861del, XM_011525686.1:c.*856_*861del, XM_011525687.1:c.*856_*861del, XM_011525688.1:c.*856_*861del, XM_011525689.1:c.*856_*861del, XM_011525690.1:c.*856_*861del, XM_011525691.1:c.*856_*861del, XM_011525692.1:c.*856_*861del, XM_011525693.1:c.*856_*861del, XM_011525694.1:c.*856_*861del, XM_011525695.1:c.*856_*861del, XM_011525696.1:c.*856_*861del, XM_011525697.1:c.*856_*861del, XM_011525698.1:c.*856_*861del, XM_011525699.1:c.*856_*861del, XR_243810.1:n.1672-373_1672-368delCTTTAA, XR_243810.3:n.1513-373_1513-368del, XR_243811.1:n.1538-373_1538-368delCTTTAA, XR_243811.2:n.1538-373_1538-368del, XR_243812.1:n.2112_2117delCTTTAA, XR_430041.2:n.1633-373_1633-368del, XR_935066.1:n.2109_2114del, XR_935067.1:n.1967_1972del
No VIP available No Clinical Annotations available VA
rs1532268 NC_000005.10:g.7878066C>T, NC_000005.9:g.7878179C>T, NG_008856.1:g.13963C>T, NM_002454.2:c.524C>T, NM_024010.2:c.605C>T, NP_002445.2:p.Ser175Leu, NP_076915.2:p.Ser202Leu, NR_134480.1:n.647C>T, NR_134481.1:n.661C>T, NR_134482.1:n.507C>T, XM_005248304.1:c.569C>T, XM_005248305.1:c.524C>T, XM_006714474.2:c.605C>T, XM_011514043.1:c.605C>T, XM_011514044.1:c.524C>T, XM_011514045.1:c.605C>T, XP_005248361.1:p.Ser190Leu, XP_005248362.1:p.Ser175Leu, XP_006714537.1:p.Ser202Leu, XP_011512345.1:p.Ser202Leu, XP_011512346.1:p.Ser175Leu, XP_011512347.1:p.Ser202Leu, XR_241701.1:n.627C>T, XR_241702.1:n.627C>T, XR_241703.1:n.620C>T, XR_925614.1:n.627C>T, XR_925615.1:n.627C>T, rs58799540
C > -
C > T
No VIP available No Clinical Annotations available VA
rs1570360 NC_000006.11:g.43737830A>G, NC_000006.12:g.43770093A>G, NG_008732.1:g.4878A>G, NM_001025366.2:c.-614A>G, NM_001025367.2:c.-614A>G, NM_001025368.2:c.-614A>G, NM_001025369.2:c.-614A>G, NM_001025370.2:c.-614A>G, NM_001033756.2:c.-614A>G, NM_001171622.1:c.-614A>G, NM_001171623.1:c.-1154A>G, NM_001171624.1:c.-1154A>G, NM_001171625.1:c.-1154A>G, NM_001171626.1:c.-1154A>G, NM_001171627.1:c.-1154A>G, NM_001171628.1:c.-1154A>G, NM_001171629.1:c.-1154A>G, NM_001171630.1:c.-1154A>G, NM_001204384.1:c.-1154A>G, NM_001204385.1:c.-614A>G, NM_001287044.1:c.-2027A>G, NM_001317010.1:c.-1154A>G, NM_003376.5:c.-614A>G, XM_005249363.1:c.-2027A>G, rs36208386, rs58036053
A > G
No VIP available No Clinical Annotations available VA
rs1610696 NC_000006.11:g.29798803C=, NC_000006.11:g.29798803C>G, NC_000006.12:g.29831026C=, NC_000006.12:g.29831026C>G, NG_029039.1:g.9048C=, NG_029039.1:g.9048C>G, NM_002127.5:c.*287C=, NM_002127.5:c.*287C>G, NT_113891.3:g.1314602G=, NT_113891.3:g.1314602G>C, NT_167244.2:g.1096652G=, NT_167244.2:g.1096652G>C, NT_167245.1:g.1099424C=, NT_167245.1:g.1099424C>G, NT_167245.2:g.1093839C=, NT_167245.2:g.1093839C>G, NT_167246.1:g.1099132C=, NT_167246.1:g.1099132C>G, NT_167246.2:g.1093512C=, NT_167246.2:g.1093512C>G, NT_167247.1:g.1099082C=, NT_167247.1:g.1099082C>G, NT_167247.2:g.1093497C=, NT_167247.2:g.1093497C>G, NT_167248.2:g.1093806G=, NT_167248.2:g.1093806G>C, NT_167249.2:g.1137071G=, NT_167249.2:g.1137071G>C, XM_005249055.1:c.*287C>G, XM_005249055.1:c.*287G>C, XM_005249056.1:c.*287C>G, XM_005249056.1:c.*287G>C, XM_005249057.1:c.*502C>G, XM_005249057.1:c.*502G>C, XM_005249058.1:c.*287C>G, XM_005249058.1:c.*287G>C, XM_005272810.1:c.*301C>G, XM_005272810.1:c.*301G>C, XM_005274964.1:c.*287C>G, XM_005274964.1:c.*287G>C, XM_005274965.1:c.*287C>G, XM_005274965.1:c.*287G>C, XM_005274966.1:c.*502C>G, XM_005274966.1:c.*502G>C, XM_005274967.1:c.*287C>G, XM_005274967.1:c.*287G>C, XM_005275119.1:c.*287C>G, XM_005275119.1:c.*287G>C, XM_005275120.1:c.*287C>G, XM_005275120.1:c.*287G>C, XM_005275121.1:c.*502C>G, XM_005275121.1:c.*502G>C, XM_005275122.1:c.*287C>G, XM_005275122.1:c.*287G>C, XM_005275246.1:c.*287C>G, XM_005275246.1:c.*287G>C, XM_005275247.1:c.*287C>G, XM_005275247.1:c.*287G>C, XM_005275248.1:c.*502C>G, XM_005275248.1:c.*502G>C, XM_005275249.1:c.*287C>G, XM_005275249.1:c.*287G>C, XM_005275394.1:c.*301C>G, XM_005275394.1:c.*301G>C, XM_005275549.1:c.*301C>G, XM_005275549.1:c.*301G>C, XM_005275550.1:c.*301C>G, XM_005275550.1:c.*301G>C, XM_005275551.1:c.*516C>G, XM_005275551.1:c.*516G>C, XM_005275552.1:c.*301G=, XM_005275552.1:c.*301G>C, XM_011547651.1:c.*287C>G, XM_011547651.1:c.*287G>C, XM_011547882.1:c.*287C=, XM_011547882.1:c.*287C>G, XM_011548048.1:c.*287C>G, XM_011548048.1:c.*287G>C, XM_011548236.1:c.*301C>G, XM_011548236.1:c.*301G>C, XM_011548237.1:c.*301C>G, XM_011548237.1:c.*301G>C, XM_011548430.1:c.*301C>G, XM_011548430.1:c.*301G>C, XM_011548431.1:c.*301C>G, XM_011548431.1:c.*301G>C, XR_241896.1:n.1913C>G, XR_241896.1:n.1913G>C, XR_246963.1:n.1847C>G, XR_246963.1:n.1847G>C, XR_247353.1:n.1913C>G, XR_247353.1:n.1913G>C, XR_247370.1:n.1913C>G, XR_247370.1:n.1913G>C, XR_247389.1:n.1913C>G, XR_247389.1:n.1913G>C, XR_247402.1:n.1847C>G, XR_247402.1:n.1847G>C, XR_247423.1:n.1905C>G, XR_247423.1:n.1905G>C, rs115045214, rs117220578, rs17185510
C > C
C > G
No VIP available No Clinical Annotations available VA
rs162036 NC_000005.10:g.7885846A>G, NC_000005.9:g.7885959A>G, NG_008856.1:g.21743A>G, NM_002454.2:c.1049A>G, NM_024010.2:c.1130A>G, NP_002445.2:p.Lys350Arg, NP_076915.2:p.Lys377Arg, NR_134480.1:n.1172A>G, NR_134481.1:n.1186A>G, NR_134482.1:n.1032A>G, XM_005248304.1:c.1094A>G, XM_005248305.1:c.1049A>G, XM_006714474.2:c.1130A>G, XM_011514043.1:c.1130A>G, XM_011514044.1:c.1049A>G, XM_011514045.1:c.*103A>G, XP_005248361.1:p.Lys365Arg, XP_005248362.1:p.Lys350Arg, XP_006714537.1:p.Lys377Arg, XP_011512345.1:p.Lys377Arg, XP_011512346.1:p.Lys350Arg, XR_241701.1:n.1152A>G, XR_241702.1:n.1152A>G, XR_241703.1:n.1145A>G, XR_925614.1:n.1152A>G, XR_925615.1:n.1152A>G, rs1189017, rs16879313, rs327619, rs329836, rs52821116, rs61092918, rs696311
A > -
A > G
No VIP available No Clinical Annotations available VA
rs16857540 NC_000003.11:g.173900575C>G, NC_000003.12:g.174182785C>G, NM_014932.3:c.647-92530C>G, XM_005247231.1:c.767-92530C>G, XM_005247232.1:c.707-92530C>G, XM_005247233.1:c.707-92530C>G, XM_005247234.1:c.647-92530C>G, XM_005247235.1:c.647-92530C>G, XM_005247235.2:c.647-92530C>G, XM_005247236.1:c.647-92530C>G, XM_005247237.1:c.191-92530C>G, XM_005247237.2:c.191-92530C>G, XM_006713540.2:c.707-92530C>G, XM_011512551.1:c.707-92530C>G, XM_011512552.1:c.707-92530C>G, XM_011512553.1:c.-297+46205C>G, XM_011512554.1:c.-270+46205C>G, rs56587723, rs59949065, rs61398694
C > G
No VIP available CA VA
rs1695 NC_000011.10:g.67585218A>G, NC_000011.9:g.67352689A>G, NG_012075.1:g.6624A>G, NM_000852.3:c.313A>G, NP_000843.1:p.Ile105Val, XM_005273958.1:c.313A>G, XP_005274015.1:p.Ile105Val, rs1138257, rs11553891, rs17353321, rs17856342, rs2230827, rs4609, rs56971933, rs947894
A > G
No VIP available CA VA
rs16973225 NC_000015.10:g.81937658A>C, NC_000015.9:g.82229999A>C, XR_932527.1:n.399-11633T>G, XR_932528.1:n.399-7533T>G
A > C
No VIP available No Clinical Annotations available VA
rs1707 NC_000006.11:g.29798610C=, NC_000006.11:g.29798610C>T, NC_000006.12:g.29830833C=, NC_000006.12:g.29830833C>T, NG_029039.1:g.8855C=, NG_029039.1:g.8855C>T, NM_002127.5:c.*94C=, NM_002127.5:c.*94C>T, NT_113891.3:g.1314409T=, NT_113891.3:g.1314409T>C, NT_167244.2:g.1096459T=, NT_167244.2:g.1096459T>C, NT_167245.1:g.1099231T=, NT_167245.1:g.1099231T>C, NT_167245.2:g.1093646T=, NT_167245.2:g.1093646T>C, NT_167246.1:g.1098939T=, NT_167246.1:g.1098939T>C, NT_167246.2:g.1093319T=, NT_167246.2:g.1093319T>C, NT_167247.1:g.1098889T=, NT_167247.1:g.1098889T>C, NT_167247.2:g.1093304T=, NT_167247.2:g.1093304T>C, NT_167248.2:g.1093613T=, NT_167248.2:g.1093613T>C, NT_167249.2:g.1136878T=, NT_167249.2:g.1136878T>C, XM_005249055.1:c.*94C=, XM_005249055.1:c.*94C>T, XM_005249056.1:c.*94C=, XM_005249056.1:c.*94C>T, XM_005249057.1:c.*309C>T, XM_005249057.1:c.*309T>C, XM_005249058.1:c.*94C=, XM_005249058.1:c.*94C>T, XM_005272810.1:c.*108T=, XM_005272810.1:c.*108T>C, XM_005274964.1:c.*94T=, XM_005274964.1:c.*94T>C, XM_005274965.1:c.*94T=, XM_005274965.1:c.*94T>C, XM_005274966.1:c.*309C>T, XM_005274966.1:c.*309T>C, XM_005274967.1:c.*94T=, XM_005274967.1:c.*94T>C, XM_005275119.1:c.*94T=, XM_005275119.1:c.*94T>C, XM_005275120.1:c.*94T=, XM_005275120.1:c.*94T>C, XM_005275121.1:c.*309C>T, XM_005275121.1:c.*309T>C, XM_005275122.1:c.*94T=, XM_005275122.1:c.*94T>C, XM_005275246.1:c.*94T=, XM_005275246.1:c.*94T>C, XM_005275247.1:c.*94T=, XM_005275247.1:c.*94T>C, XM_005275248.1:c.*309C>T, XM_005275248.1:c.*309T>C, XM_005275249.1:c.*94T=, XM_005275249.1:c.*94T>C, XM_005275394.1:c.*108T=, XM_005275394.1:c.*108T>C, XM_005275549.1:c.*108T=, XM_005275549.1:c.*108T>C, XM_005275550.1:c.*108T=, XM_005275550.1:c.*108T>C, XM_005275551.1:c.*323C>T, XM_005275551.1:c.*323T>C, XM_005275552.1:c.*108T=, XM_005275552.1:c.*108T>C, XM_011547651.1:c.*94T=, XM_011547651.1:c.*94T>C, XM_011547882.1:c.*94T=, XM_011547882.1:c.*94T>C, XM_011548048.1:c.*94T=, XM_011548048.1:c.*94T>C, XM_011548236.1:c.*108T=, XM_011548236.1:c.*108T>C, XM_011548237.1:c.*108T=, XM_011548237.1:c.*108T>C, XM_011548430.1:c.*108T=, XM_011548430.1:c.*108T>C, XM_011548431.1:c.*108T=, XM_011548431.1:c.*108T>C, XR_241896.1:n.1720C=, XR_241896.1:n.1720C>T, XR_246963.1:n.1654T=, XR_246963.1:n.1654T>C, XR_247353.1:n.1720T=, XR_247353.1:n.1720T>C, XR_247370.1:n.1720T=, XR_247370.1:n.1720T>C, XR_247389.1:n.1720T=, XR_247389.1:n.1720T>C, XR_247402.1:n.1654T=, XR_247402.1:n.1654T>C, XR_247423.1:n.1712T=, XR_247423.1:n.1712T>C, rs113572485, rs115689421, rs117926242, rs1233332, rs1632931, rs17179087, rs17375406, rs57754052, rs75256208
C > C
C > T
No VIP available No Clinical Annotations available VA
rs1710 NC_000006.11:g.29798617G=, NC_000006.11:g.29798617G>C, NC_000006.12:g.29830840G=, NC_000006.12:g.29830840G>C, NG_029039.1:g.8862G=, NG_029039.1:g.8862G>C, NM_002127.5:c.*101G=, NM_002127.5:c.*101G>C, NT_113891.3:g.1314416C=, NT_113891.3:g.1314416C>G, NT_167244.2:g.1096466C=, NT_167244.2:g.1096466C>G, NT_167245.1:g.1099238G=, NT_167245.1:g.1099238G>C, NT_167245.2:g.1093653G=, NT_167245.2:g.1093653G>C, NT_167246.1:g.1098946G=, NT_167246.1:g.1098946G>C, NT_167246.2:g.1093326G=, NT_167246.2:g.1093326G>C, NT_167247.1:g.1098896G=, NT_167247.1:g.1098896G>C, NT_167247.2:g.1093311G=, NT_167247.2:g.1093311G>C, NT_167248.2:g.1093620C=, NT_167248.2:g.1093620C>G, NT_167249.2:g.1136885C=, NT_167249.2:g.1136885C>G, XM_005249055.1:c.*101G=, XM_005249055.1:c.*101G>C, XM_005249056.1:c.*101G=, XM_005249056.1:c.*101G>C, XM_005249057.1:c.*316C>G, XM_005249057.1:c.*316G>C, XM_005249058.1:c.*101G=, XM_005249058.1:c.*101G>C, XM_005272810.1:c.*115C=, XM_005272810.1:c.*115C>G, XM_005274964.1:c.*101G=, XM_005274964.1:c.*101G>C, XM_005274965.1:c.*101G=, XM_005274965.1:c.*101G>C, XM_005274966.1:c.*316C>G, XM_005274966.1:c.*316G>C, XM_005274967.1:c.*101G=, XM_005274967.1:c.*101G>C, XM_005275119.1:c.*101G=, XM_005275119.1:c.*101G>C, XM_005275120.1:c.*101G=, XM_005275120.1:c.*101G>C, XM_005275121.1:c.*316C>G, XM_005275121.1:c.*316G>C, XM_005275122.1:c.*101G=, XM_005275122.1:c.*101G>C, XM_005275246.1:c.*101G=, XM_005275246.1:c.*101G>C, XM_005275247.1:c.*101G=, XM_005275247.1:c.*101G>C, XM_005275248.1:c.*316C>G, XM_005275248.1:c.*316G>C, XM_005275249.1:c.*101G=, XM_005275249.1:c.*101G>C, XM_005275394.1:c.*115C=, XM_005275394.1:c.*115C>G, XM_005275549.1:c.*115C=, XM_005275549.1:c.*115C>G, XM_005275550.1:c.*115C=, XM_005275550.1:c.*115C>G, XM_005275551.1:c.*330C>G, XM_005275551.1:c.*330G>C, XM_005275552.1:c.*115C=, XM_005275552.1:c.*115C>G, XM_011547651.1:c.*101G=, XM_011547651.1:c.*101G>C, XM_011547882.1:c.*101G=, XM_011547882.1:c.*101G>C, XM_011548048.1:c.*101G=, XM_011548048.1:c.*101G>C, XM_011548236.1:c.*115C=, XM_011548236.1:c.*115C>G, XM_011548237.1:c.*115C=, XM_011548237.1:c.*115C>G, XM_011548430.1:c.*115C=, XM_011548430.1:c.*115C>G, XM_011548431.1:c.*115C=, XM_011548431.1:c.*115C>G, XR_241896.1:n.1727G=, XR_241896.1:n.1727G>C, XR_246963.1:n.1661C=, XR_246963.1:n.1661C>G, XR_247353.1:n.1727G=, XR_247353.1:n.1727G>C, XR_247370.1:n.1727G=, XR_247370.1:n.1727G>C, XR_247389.1:n.1727G=, XR_247389.1:n.1727G>C, XR_247402.1:n.1661C=, XR_247402.1:n.1661C>G, XR_247423.1:n.1719C=, XR_247423.1:n.1719C>G, rs1049037, rs111577111, rs116152775, rs117391931, rs1632930, rs17179094, rs3189113, rs77969756
G > C
G > G
No VIP available No Clinical Annotations available VA
rs17116806 NC_000001.10:g.97973252C>A, NC_000001.11:g.97507696C>A, NG_008807.2:g.418364G>T, NM_000110.3:c.1740+8030G>T, XM_005270561.1:c.1629+8030G>T, XM_005270562.1:c.1524+41864G>T, XM_005270562.3:c.1524+41864G>T, XM_005270563.1:c.1740+8030G>T, XM_006710397.2:c.1740+8030G>T, rs59151739
C > A
No VIP available No Clinical Annotations available VA
rs17179101 NC_000006.11:g.29798634C>A, NC_000006.12:g.29830857C>A, NG_029039.1:g.8879C>A, NM_002127.5:c.*118C>A, NT_113891.3:g.1314433C>A, NT_167244.2:g.1096483C>A, NT_167245.1:g.1099255C>A, NT_167245.2:g.1093670C>A, NT_167246.1:g.1098963C>A, NT_167246.2:g.1093343C>A, NT_167247.1:g.1098913C>A, NT_167247.2:g.1093328C>A, NT_167248.2:g.1093637C>A, NT_167249.2:g.1136902C>A, XM_005249055.1:c.*118C>A, XM_005249056.1:c.*118C>A, XM_005249057.1:c.*333C>A, XM_005249058.1:c.*118C>A, XM_005272810.1:c.*132C>A, XM_005274964.1:c.*118C>A, XM_005274965.1:c.*118C>A, XM_005274966.1:c.*333C>A, XM_005274967.1:c.*118C>A, XM_005275119.1:c.*118C>A, XM_005275120.1:c.*118C>A, XM_005275121.1:c.*333C>A, XM_005275122.1:c.*118C>A, XM_005275246.1:c.*118C>A, XM_005275247.1:c.*118C>A, XM_005275248.1:c.*333C>A, XM_005275249.1:c.*118C>A, XM_005275394.1:c.*132C>A, XM_005275549.1:c.*132C>A, XM_005275550.1:c.*132C>A, XM_005275551.1:c.*347C>A, XM_005275552.1:c.*132C>A, XM_011547651.1:c.*118C>A, XM_011547882.1:c.*118C>A, XM_011548048.1:c.*118C>A, XM_011548236.1:c.*132C>A, XM_011548237.1:c.*132C>A, XM_011548430.1:c.*132C>A, XM_011548431.1:c.*132C>A, XR_241896.1:n.1744C>A, XR_246963.1:n.1678C>A, XR_247353.1:n.1744C>A, XR_247370.1:n.1744C>A, XR_247389.1:n.1744C>A, XR_247402.1:n.1678C>A, XR_247423.1:n.1736C>A, rs115810666, rs118174970
C > A
No VIP available CA VA
rs17179108 NC_000006.11:g.29798642C>T, NC_000006.12:g.29830865C>T, NG_029039.1:g.8887C>T, NM_002127.5:c.*126C>T, NT_113891.3:g.1314441C>T, NT_167244.2:g.1096491C>T, NT_167245.1:g.1099263C>T, NT_167245.2:g.1093678C>T, NT_167246.1:g.1098971C>T, NT_167246.2:g.1093351C>T, NT_167247.1:g.1098921C>T, NT_167247.2:g.1093336C>T, NT_167248.2:g.1093645C>T, NT_167249.2:g.1136910C>T, XM_005249055.1:c.*126C>T, XM_005249056.1:c.*126C>T, XM_005249057.1:c.*341C>T, XM_005249058.1:c.*126C>T, XM_005272810.1:c.*140C>T, XM_005274964.1:c.*126C>T, XM_005274965.1:c.*126C>T, XM_005274966.1:c.*341C>T, XM_005274967.1:c.*126C>T, XM_005275119.1:c.*126C>T, XM_005275120.1:c.*126C>T, XM_005275121.1:c.*341C>T, XM_005275122.1:c.*126C>T, XM_005275246.1:c.*126C>T, XM_005275247.1:c.*126C>T, XM_005275248.1:c.*341C>T, XM_005275249.1:c.*126C>T, XM_005275394.1:c.*140C>T, XM_005275549.1:c.*140C>T, XM_005275550.1:c.*140C>T, XM_005275551.1:c.*355C>T, XM_005275552.1:c.*140C>T, XM_011547651.1:c.*126C>T, XM_011547882.1:c.*126C>T, XM_011548048.1:c.*126C>T, XM_011548236.1:c.*140C>T, XM_011548237.1:c.*140C>T, XM_011548430.1:c.*140C>T, XM_011548431.1:c.*140C>T, XR_241896.1:n.1752C>T, XR_246963.1:n.1686C>T, XR_247353.1:n.1752C>T, XR_247370.1:n.1752C>T, XR_247389.1:n.1752C>T, XR_247402.1:n.1686C>T, XR_247423.1:n.1744C>T, rs115100128, rs117118691, rs17875407
C > T
No VIP available No Clinical Annotations available VA
rs17376848 NC_000001.10:g.97915624A>G, NC_000001.11:g.97450068A>G, NG_008807.2:g.475992T>C, NM_000110.3:c.1896T>C, NP_000101.2:p.Phe632=, XM_005270561.1:c.1785T>C, XM_005270562.1:c.1680T>C, XM_005270562.3:c.1680T>C, XM_005270563.1:c.1896T>C, XM_006710397.2:c.1896T>C, XP_005270618.1:p.Phe595=, XP_005270619.1:p.Phe560=, XP_005270619.2:p.Phe560=, XP_005270620.1:p.Phe632=, XP_006710460.1:p.Phe632=, rs117467766, rs52815410, rs58485702
A > G
No VIP available CA VA
rs17626122 NC_000002.11:g.206474012T>C, NC_000002.12:g.205609288T>C, NM_001302769.1:c.3261-6168T>C, NM_057177.6:c.3054-6168T>C, NM_152526.5:c.3075-6168T>C, NM_205863.3:c.2958-6168T>C, XM_005246273.1:c.3261-6168T>C, XM_005246274.1:c.2664-6168T>C, XM_011510550.1:c.3321-908T>C, XM_011510551.1:c.3261-908T>C, XM_011510552.1:c.3285-6168T>C, rs56463399, rs57676795
T > C
No VIP available No Clinical Annotations available VA
rs1799794 NC_000014.8:g.104179267T>C, NC_000014.9:g.103712930T>C, NG_011516.1:g.7557A>G, NM_001100118.1:c.-260-1363A>G, NM_001100119.1:c.-316A>G, NM_005432.3:c.-316A>G, XM_005268045.1:c.-316A>G, XM_005268046.1:c.-354-1269A>G, XM_005268047.1:c.-251A>G, XM_005268048.1:c.-260-1363A>G, XM_011537138.1:c.-316A>G, rs3212034
T > C
No VIP available No Clinical Annotations available VA
rs1801019 NC_000003.11:g.124456742G>C, NC_000003.12:g.124737895G>C, NG_017037.1:g.12530G>C, NM_000373.3:c.638G>C, NP_000364.1:p.Gly213Ala, NR_033434.1:n.590G>C, NR_033437.1:n.843G>C, XM_005247741.1:c.362G>C, XM_005247742.1:c.104G>C, XM_005247743.1:c.124-20G>C, XM_005247744.1:c.104G>C, XP_005247798.1:p.Gly121Ala, XP_005247799.1:p.Gly35Ala, XP_005247801.1:p.Gly35Ala, rs17843818, rs199469590, rs3172286, rs3772805, rs52826107, rs58177968
G > C
No VIP available No Clinical Annotations available VA
rs1801131 NC_000001.10:g.11854476T>G, NC_000001.11:g.11794419T>G, NG_013351.1:g.16685A>C, NM_005957.4:c.1286A>C, NP_005948.3:p.Glu429Ala, XM_005263458.1:c.1409A>C, XM_005263458.2:c.1409A>C, XM_005263459.1:c.1355A>C, XM_005263460.1:c.1286A>C, XM_005263460.3:c.1286A>C, XM_005263461.1:c.1286A>C, XM_005263461.3:c.1286A>C, XM_005263462.1:c.1286A>C, XM_005263462.3:c.1286A>C, XM_005263463.1:c.1040A>C, XM_005263463.2:c.1040A>C, XM_011541495.1:c.1406A>C, XM_011541496.1:c.1409A>C, XP_005263515.1:p.Glu470Ala, XP_005263516.1:p.Glu452Ala, XP_005263517.1:p.Glu429Ala, XP_005263518.1:p.Glu429Ala, XP_005263519.1:p.Glu429Ala, XP_005263520.1:p.Glu347Ala, XP_011539797.1:p.Glu469Ala, XP_011539798.1:p.Glu470Ala, rs17367365, rs17857426, rs4134712
T > G
No VIP available No Clinical Annotations available VA
rs1801133 NC_000001.10:g.11856378G>A, NC_000001.11:g.11796321G>A, NG_013351.1:g.14783C>T, NM_005957.4:c.665C>T, NP_005948.3:p.Ala222Val, XM_005263458.1:c.788C>T, XM_005263458.2:c.788C>T, XM_005263459.1:c.734C>T, XM_005263460.1:c.665C>T, XM_005263460.3:c.665C>T, XM_005263461.1:c.665C>T, XM_005263461.3:c.665C>T, XM_005263462.1:c.665C>T, XM_005263462.3:c.665C>T, XM_005263463.1:c.419C>T, XM_005263463.2:c.419C>T, XM_011541495.1:c.785C>T, XM_011541496.1:c.788C>T, XP_005263515.1:p.Ala263Val, XP_005263516.1:p.Ala245Val, XP_005263517.1:p.Ala222Val, XP_005263518.1:p.Ala222Val, XP_005263519.1:p.Ala222Val, XP_005263520.1:p.Ala140Val, XP_011539797.1:p.Ala262Val, XP_011539798.1:p.Ala263Val, rs386545618, rs4134713, rs59514310
G > A
No VIP available No Clinical Annotations available VA
rs1801158 NC_000001.10:g.97981421C>T, NC_000001.11:g.97515865C>T, NG_008807.2:g.410195G>A, NM_000110.3:c.1601G>A, NP_000101.2:p.Ser534Asn, XM_005270561.1:c.1490G>A, XM_005270562.1:c.1524+33695G>A, XM_005270562.3:c.1524+33695G>A, XM_005270563.1:c.1601G>A, XM_005270564.1:c.1601G>A, XM_006710397.2:c.1601G>A, XP_005270618.1:p.Ser497Asn, XP_005270620.1:p.Ser534Asn, XP_005270621.1:p.Ser534Asn, XP_006710460.1:p.Ser534Asn, rs199469539, rs52824375, rs59516208
C > T
No VIP available No Clinical Annotations available VA
rs1801159 NC_000001.10:g.97981395T>C, NC_000001.11:g.97515839T>C, NG_008807.2:g.410221A>G, NM_000110.3:c.1627A>G, NP_000101.2:p.Ile543Val, XM_005270561.1:c.1516A>G, XM_005270562.1:c.1524+33721A>G, XM_005270562.3:c.1524+33721A>G, XM_005270563.1:c.1627A>G, XM_005270564.1:c.1627A>G, XM_006710397.2:c.1627A>G, XP_005270618.1:p.Ile506Val, XP_005270620.1:p.Ile543Val, XP_005270621.1:p.Ile543Val, XP_006710460.1:p.Ile543Val, rs117999026, rs17116825, rs199469541, rs386545620, rs58945530
T > C
No VIP available No Clinical Annotations available VA
rs1801160 NC_000001.10:g.97770920C>T, NC_000001.11:g.97305364C>T, NG_008807.2:g.620696G>A, NM_000110.3:c.2194G>A, NP_000101.2:p.Val732Ile, NR_046590.1:n.129-825C>T, XM_005270561.1:c.2083G>A, XM_005270562.1:c.1978G>A, XM_005270562.3:c.1978G>A, XM_005270563.1:c.2194G>A, XM_006710397.2:c.2194G>A, XP_005270618.1:p.Val695Ile, XP_005270619.1:p.Val660Ile, XP_005270619.2:p.Val660Ile, XP_005270620.1:p.Val732Ile, XP_006710460.1:p.Val732Ile, rs12720467, rs12720468, rs199469554
C > T
No VIP available No Clinical Annotations available VA
rs1801265 NC_000001.10:g.98348885G=, NC_000001.10:g.98348885G>A, NC_000001.11:g.97883329A=, NC_000001.11:g.97883329A>G, NG_008807.2:g.42731T=, NG_008807.2:g.42731T>C, NM_000110.3:c.85T=, NM_000110.3:c.85T>C, NM_001160301.1:c.85T=, NM_001160301.1:c.85T>C, NP_000101.2:p.Cys29=, NP_000101.2:p.Cys29Arg, NP_001153773.1:p.Cys29=, NP_001153773.1:p.Cys29Arg, XM_005270561.1:c.39+37555C>T, XM_005270561.1:c.39+37555T>C, XM_005270562.1:c.85C=, XM_005270562.1:c.85C>T, XM_005270562.3:c.85T=, XM_005270562.3:c.85T>C, XM_005270563.1:c.85C=, XM_005270563.1:c.85C>T, XM_005270564.1:c.85C=, XM_005270564.1:c.85C>T, XM_006710397.2:c.85T=, XM_006710397.2:c.85T>C, XP_005270619.1:p.Arg29=, XP_005270619.1:p.Arg29Cys, XP_005270619.2:p.Cys29=, XP_005270619.2:p.Cys29Arg, XP_005270620.1:p.Arg29=, XP_005270620.1:p.Arg29Cys, XP_005270621.1:p.Arg29=, XP_005270621.1:p.Arg29Cys, XP_006710460.1:p.Cys29=, XP_006710460.1:p.Cys29Arg, rs199469510, rs3211355, rs52823090, rs57596852
G > A
No VIP available No Clinical Annotations available VA
rs1801266 NC_000001.10:g.98157332G>A, NC_000001.11:g.97691776G>A, NG_008807.2:g.234284C>T, NM_000110.3:c.703C>T, NP_000101.2:p.Arg235Trp, XM_005270561.1:c.592C>T, XM_005270562.1:c.703C>T, XM_005270562.3:c.703C>T, XM_005270563.1:c.703C>T, XM_005270564.1:c.703C>T, XM_006710397.2:c.703C>T, XP_005270618.1:p.Arg198Trp, XP_005270619.1:p.Arg235Trp, XP_005270619.2:p.Arg235Trp, XP_005270620.1:p.Arg235Trp, XP_005270621.1:p.Arg235Trp, XP_006710460.1:p.Arg235Trp, rs386545627
G > A
No VIP available No Clinical Annotations available VA
rs1801274 NC_000001.10:g.161479745A>G, NC_000001.11:g.161509955A>G, NG_012066.1:g.9541A>G, NM_001136219.1:c.500A>G, NM_021642.3:c.497A>G, NP_001129691.1:p.His167Arg, NP_067674.2:p.His166Arg, XM_005244960.1:c.500A>G, XM_011509287.1:c.500A>G, XM_011509288.1:c.497A>G, XM_011509289.1:c.500A>G, XM_011509290.1:c.500A>G, XM_011509291.1:c.500A>G, XP_005245017.1:p.His167Arg, XP_011507589.1:p.His167Arg, XP_011507590.1:p.His166Arg, XP_011507591.1:p.His167Arg, XP_011507592.1:p.His167Arg, XP_011507593.1:p.His167Arg, rs16830404, rs17851761, rs386545630, rs52796393, rs58440466
A > G
No VIP available No Clinical Annotations available VA
rs1801394 NC_000005.10:g.7870860A>G, NC_000005.9:g.7870973A>G, NG_008856.1:g.6757A>G, NG_033101.1:g.3178T>C, NM_002454.2:c.66A>G, NM_024010.2:c.147A>G, NM_024091.3:c.-1995T>C, NP_002445.2:p.Ile22Met, NP_076915.2:p.Ile49Met, NR_036553.1:n.-1823T>C, NR_073608.1:n.-1823T>C, NR_134480.1:n.203A>G, NR_134481.1:n.203A>G, NR_134482.1:n.203A>G, XM_005248304.1:c.111A>G, XM_005248305.1:c.66A>G, XM_006714474.2:c.147A>G, XM_006714498.1:c.-1906T>C, XM_011514043.1:c.147A>G, XM_011514044.1:c.66A>G, XM_011514045.1:c.147A>G, XP_005248361.1:p.Ile37Met, XP_005248362.1:p.Ile22Met, XP_006714537.1:p.Ile49Met, XP_011512345.1:p.Ile49Met, XP_011512346.1:p.Ile22Met, XP_011512347.1:p.Ile49Met, XR_241701.1:n.169A>G, XR_241702.1:n.169A>G, XR_241703.1:n.162A>G, XR_427664.1:n.-1823T>C, XR_925614.1:n.169A>G, XR_925615.1:n.169A>G, rs52813630
A > G
No VIP available No Clinical Annotations available VA
rs1805087 NC_000001.10:g.237048500A>G, NC_000001.11:g.236885200A>G, NG_008959.1:g.94920A>G, NM_000254.2:c.2756A>G, NM_001291939.1:c.2603A>G, NM_001291940.1:c.1535A>G, NP_000245.2:p.Asp919Gly, NP_001278868.1:p.Asp868Gly, NP_001278869.1:p.Asp512Gly, XM_005273140.1:c.2924A>G, XM_005273141.1:c.2753A>G, XM_005273141.3:c.2753A>G, XM_005273142.1:c.2666A>G, XM_005273143.1:c.2603A>G, XM_005273144.1:c.2318A>G, XM_005273145.1:c.1118A>G, XM_006711769.2:c.2756A>G, XM_006711770.1:c.1820A>G, XM_011544193.1:c.2567A>G, XM_011544194.1:c.2924A>G, XP_005273197.1:p.Asp975Gly, XP_005273198.1:p.Asp918Gly, XP_005273199.1:p.Asp889Gly, XP_005273200.1:p.Asp868Gly, XP_005273201.1:p.Asp773Gly, XP_005273202.1:p.Asp373Gly, XP_006711832.1:p.Asp919Gly, XP_006711833.1:p.Asp607Gly, XP_011542495.1:p.Asp856Gly, XP_011542496.1:p.Asp975Gly, rs17658739, rs56618494, rs61036243
A > G
No VIP available No Clinical Annotations available VA
rs1885301 NC_000010.10:g.101541053A>G, NC_000010.11:g.99781296A>G, NG_011798.1:g.3591A>G, NM_000392.4:c.-1549A>G, XM_005269536.1:c.-1549A>G, XM_006717631.2:c.-1549A>G, XM_011539291.1:c.-1549A>G, XR_945604.1:n.-1360A>G, XR_945605.1:n.-1358A>G, rs17216261, rs59934936
A > G
No VIP available CA VA
rs1979277 NC_000017.10:g.18232096G>A, NC_000017.11:g.18328782G>A, NG_017111.1:g.39761C>T, NM_001281786.1:c.1006C>T, NM_004169.4:c.1420C>T, NM_148918.2:c.1303C>T, NP_001268715.1:p.Leu336Phe, NP_004160.3:p.Leu474Phe, NP_683718.1:p.Leu435Phe, XM_005256767.1:c.1420C>T, XM_005256767.2:c.1420C>T, XM_005256768.1:c.1006C>T, XM_011523992.1:c.1180C>T, XP_005256824.1:p.Leu474Phe, XP_005256825.1:p.Leu336Phe, XP_011522294.1:p.Leu394Phe, rs17850285, rs2230025, rs3183766, rs57933897
G > A
No VIP available CA VA
rs2010963 NC_000006.11:g.43738350C>G, NC_000006.12:g.43770613C>G, NG_008732.1:g.5398C>G, NM_001025366.2:c.-94C>G, NM_001025367.2:c.-94C>G, NM_001025368.2:c.-94C>G, NM_001025369.2:c.-94C>G, NM_001025370.2:c.-94C>G, NM_001033756.2:c.-94C>G, NM_001171622.1:c.-94C>G, NM_001171623.1:c.-634C>G, NM_001171624.1:c.-634C>G, NM_001171625.1:c.-634C>G, NM_001171626.1:c.-634C>G, NM_001171627.1:c.-634C>G, NM_001171628.1:c.-634C>G, NM_001171629.1:c.-634C>G, NM_001171630.1:c.-634C>G, NM_001204384.1:c.-634C>G, NM_001204385.1:c.-94C>G, NM_001287044.1:c.-1507C>G, NM_001317010.1:c.-634C>G, NM_003376.5:c.-94C>G, XM_005249363.1:c.-1507C>G
C > G
No VIP available CA VA
rs2032582 NC_000007.13:g.87160618A>C, NC_000007.13:g.87160618A>T, NC_000007.14:g.87531302A>C, NC_000007.14:g.87531302A>T, NG_011513.1:g.186947T>A, NG_011513.1:g.186947T>G, NM_000927.4:c.2677T>A, NM_000927.4:c.2677T>G, NP_000918.2:p.Ser893Ala, NP_000918.2:p.Ser893Thr, rs10228331, rs2229106, rs386553610, rs57135550, rs9641018
A > C
No VIP available No Clinical Annotations available VA
rs20417 NC_000001.10:g.186650321C>G, NC_000001.11:g.186681189C>G, NG_028206.2:g.4239G>C, NM_000963.3:c.-899G>C, NR_125801.1:n.536C>G, rs11567816
C > G
No VIP available CA VA
rs2070959 NC_000002.11:g.234602191A>G, NC_000002.12:g.233693545A>G, NG_002601.2:g.108802A>G, NM_001072.3:c.541A>G, NM_019075.2:c.855+56168A>G, NM_019076.4:c.856-73489A>G, NM_019077.2:c.855+10753A>G, NM_021027.2:c.855+20756A>G, NM_205862.1:c.-7-254A>G, NP_001063.2:p.Thr181Ala, XR_241240.1:n.702A>G, XR_241241.1:n.941+20756A>G, rs17683988, rs386556316, rs3903007, rs61246460
A > G
No VIP available No Clinical Annotations available VA
rs2072671 NC_000001.10:g.20915701A>C, NC_000001.11:g.20589208A>C, NM_001785.2:c.79A>C, NP_001776.1:p.Lys27Gln, rs57221291
A > C
No VIP available No Clinical Annotations available VA
rs2073016 NC_000006.11:g.41020922T>C, NC_000006.12:g.41053183T>C, NM_006789.3:c.-165T>C
T > C
No VIP available No Clinical Annotations available VA
rs2074087 NC_000016.10:g.16090375C=, NC_000016.10:g.16090375C>G, NC_000016.9:g.16184232C>G, NG_028268.1:g.145799C=, NG_028268.1:g.145799C>G, NM_004996.3:c.2461-30C>G, NM_004996.3:c.2461-30G>C, NT_187607.1:g.1748233G=, NT_187607.1:g.1748233G>C, XM_005255326.1:c.2461-30C>G, XM_005255327.1:c.2335-30C>G, XM_005255328.1:c.2323-30C>G, XM_005255329.1:c.2284-30C>G, XM_011522497.1:c.2437-30C>G, XM_011522497.1:c.2437-30G>C, XM_011522498.1:c.2368-30C>G, XM_011522498.1:c.2368-30G>C, rs57718684
C > G
No VIP available No Clinical Annotations available VA
rs2074390 NC_000004.11:g.110910016G>A, NC_000004.12:g.109988860G>A, NG_011441.1:g.80977G>A, NM_001178130.2:c.2734+151G>A, NM_001178131.2:c.2608+151G>A, NM_001963.5:c.2734+151G>A, XM_005262796.1:c.2734+151G>A, XM_005262796.2:c.2734+151G>A, XM_005262797.1:c.2608+151G>A, XM_005262797.2:c.2608+151G>A, XM_005262798.1:c.2492-4387G>A, XM_005262798.2:c.2492-4387G>A, XM_005262799.1:c.2734+151G>A, XM_005262800.1:c.2492-4387G>A, XM_005262800.2:c.2492-4387G>A, XM_005262801.1:c.2491+5319G>A, XM_005262801.2:c.2491+5319G>A, XM_006714124.2:c.2734+151G>A, XM_011531707.1:c.2623+151G>A, XM_011531708.1:c.2734+151G>A, XR_427532.2:n.3187+151G>A, XR_938699.1:n.3187+151G>A, rs17253568, rs58663575
G > A
No VIP available No Clinical Annotations available VA
rs2132065 NC_000004.11:g.75325304A>T, NC_000004.12:g.74459587A>T, rs59208677
A > T
No VIP available CA VA
rs2227983 NC_000007.13:g.55229255G>A, NC_000007.14:g.55161562G>A, NG_007726.3:g.147531G>A, NM_005228.3:c.1562G>A, NM_201282.1:c.1562G>A, NM_201284.1:c.1562G>A, NP_005219.2:p.Arg521Lys, NP_958439.1:p.Arg521Lys, NP_958441.1:p.Arg521Lys, XM_005271746.1:c.1427G>A, XM_005271747.1:c.1403G>A, XM_005271748.1:c.1562G>A, XP_005271803.1:p.Arg476Lys, XP_005271804.1:p.Arg468Lys, XP_005271805.1:p.Arg521Lys, rs11543848, rs117960725, rs12234746, rs17336807, rs3752650
G > A
No VIP available No Clinical Annotations available VA
rs2228099 NC_000001.10:g.150808889C>G, NC_000001.11:g.150836413C>G, NG_028248.1:g.45356G>C, NM_001197325.1:c.522G>C, NM_001286035.1:c.540G>C, NM_001286036.1:c.567G>C, NM_001668.3:c.567G>C, NM_178427.2:c.522G>C, NP_001184254.1:p.Val174=, NP_001272964.1:p.Val180=, NP_001272965.1:p.Val189=, NP_001659.1:p.Val189=, NP_848514.1:p.Val174=, XM_005245151.1:c.567G>C, XM_005245152.1:c.567G>C, XM_005245153.1:c.567G>C, XM_005245154.1:c.540G>C, XM_005245154.2:c.540G>C, XM_005245155.1:c.540G>C, XM_005245156.1:c.519G>C, XM_005245157.1:c.567G>C, XM_005245158.1:c.567G>C, XM_005245159.1:c.519G>C, XM_005245160.1:c.255G>C, XM_011509542.1:c.564G>C, XM_011509543.1:c.564G>C, XM_011509544.1:c.561G>C, XM_011509545.1:c.519G>C, XM_011509546.1:c.471G>C, XM_011509547.1:c.519G>C, XP_005245208.1:p.Val189=, XP_005245209.1:p.Val189=, XP_005245210.1:p.Val189=, XP_005245211.1:p.Val180=, XP_005245212.1:p.Val180=, XP_005245213.1:p.Val173=, XP_005245214.1:p.Val189=, XP_005245215.1:p.Val189=, XP_005245216.1:p.Val173=, XP_005245217.1:p.Val85=, XP_011507844.1:p.Val188=, XP_011507845.1:p.Val188=, XP_011507846.1:p.Val187=, XP_011507847.1:p.Val173=, XP_011507848.1:p.Val157=, XP_011507849.1:p.Val173=, rs17846580, rs17859661, rs2271009, rs4521999, rs61350770
C > G
No VIP available No Clinical Annotations available VA
rs2230395 NC_000010.10:g.33211227T>G, NC_000010.11:g.32922299T>G, NG_029012.1:g.41067A>C, NM_002211.3:c.1086A>C, NM_033668.2:c.1086A>C, NM_133376.2:c.1086A>C, NP_002202.2:p.Ala362=, NP_391988.1:p.Ala362=, NP_596867.1:p.Ala362=, XM_005252448.1:c.1086A>C, XP_005252505.1:p.Ala362=, rs11009147, rs117994969, rs2298140, rs57973085, rs59510058
T > G
No VIP available CA VA
rs2231142 NC_000004.11:g.89052323G>T, NC_000004.12:g.88131171G>T, NG_032067.2:g.105152C>A, NM_001257386.1:c.421C>A, NM_004827.2:c.421C>A, NP_001244315.1:p.Gln141Lys, NP_004818.2:p.Gln141Lys, XM_005263354.1:c.421C>A, XM_005263354.2:c.421C>A, XM_005263355.1:c.421C>A, XM_005263355.2:c.421C>A, XM_005263356.1:c.421C>A, XM_005263356.2:c.421C>A, XM_011532420.1:c.421C>A, XP_005263411.1:p.Gln141Lys, XP_005263412.1:p.Gln141Lys, XP_005263413.1:p.Gln141Lys, XP_011530722.1:p.Gln141Lys, rs12721641, rs28365035, rs3736117, rs52809243, rs58973676
G > T
No VIP available No Clinical Annotations available VA
rs2236225 NC_000014.8:g.64908845G>A, NC_000014.9:g.64442127G>A, NG_012450.1:g.59087G>A, NM_005956.3:c.1958G>A, NP_005947.3:p.Arg653Gln, XM_005267693.1:c.2126G>A, XP_005267750.1:p.Arg709Gln, rs117048039, rs17751608, rs17850560, rs52810262, rs56503831, rs58065500
G > A
No VIP available No Clinical Annotations available VA
rs2242047 NC_000015.10:g.84935465C>T, NC_000015.9:g.85478696C>T, NM_001287761.1:c.1084-7980C>T, NM_001287762.1:c.1528C>T, NM_004213.4:c.1528C>T, NP_001274691.1:p.Arg510Cys, NP_004204.3:p.Arg510Cys, XM_005254988.1:c.1528C>T, XM_005254989.1:c.1528C>T, XM_005254990.1:c.1528C>T, XM_005254991.1:c.1528C>T, XM_005254992.1:c.1501C>T, XM_005254993.1:c.1450C>T, XM_005254994.1:c.1294C>T, XM_005254995.1:c.1084-7980C>T, XM_011522203.1:c.1528C>T, XM_011522204.1:c.1528C>T, XM_011522205.1:c.1528C>T, XM_011522206.1:c.1528C>T, XM_011522207.1:c.1528C>T, XM_011522208.1:c.1501C>T, XM_011522209.1:c.1450C>T, XM_011522210.1:c.1528C>T, XM_011522211.1:c.1294C>T, XM_011522212.1:c.1528C>T, XM_011522213.1:c.1528C>T, XM_011522214.1:c.1528C>T, XM_011522215.1:c.1084-7980C>T, XM_011522216.1:c.1294C>T, XM_011522217.1:c.1084-7980C>T, XP_005255045.1:p.Arg510Cys, XP_005255046.1:p.Arg510Cys, XP_005255047.1:p.Arg510Cys, XP_005255048.1:p.Arg510Cys, XP_005255049.1:p.Arg501Cys, XP_005255050.1:p.Arg484Cys, XP_005255051.1:p.Arg432Cys, XP_011520505.1:p.Arg510Cys, XP_011520506.1:p.Arg510Cys, XP_011520507.1:p.Arg510Cys, XP_011520508.1:p.Arg510Cys, XP_011520509.1:p.Arg510Cys, XP_011520510.1:p.Arg501Cys, XP_011520511.1:p.Arg484Cys, XP_011520512.1:p.Arg510Cys, XP_011520513.1:p.Arg432Cys, XP_011520514.1:p.Arg510Cys, XP_011520515.1:p.Arg510Cys, XP_011520516.1:p.Arg510Cys, XP_011520518.1:p.Arg432Cys, XR_931944.1:n.1603C>T, rs17222400, rs56742164
C > T
No VIP available CA VA
rs225440 NC_000021.8:g.43653053C>T, NC_000021.9:g.42232943C>T, NM_004915.3:c.286+7029C>T, NM_016818.2:c.286+7029C>T, NM_207174.1:c.319+7029C>T, NM_207627.1:c.292+7029C>T, NM_207628.1:c.220+7029C>T, NM_207629.1:c.277+7029C>T, XM_005261209.1:c.319+7029C>T, XM_011529806.1:c.319+7029C>T, XM_011529807.1:c.319+7029C>T, rs3827226, rs386562698, rs474673, rs56980987, rs872748
C > T
No VIP available CA VA
rs2273697 NC_000010.10:g.101563815G>A, NC_000010.11:g.99804058G>A, NG_011798.1:g.26353G>A, NM_000392.4:c.1249G>A, NP_000383.1:p.Val417Ile, XM_005269536.1:c.1249G>A, XM_006717630.2:c.553G>A, XM_006717631.2:c.1249G>A, XM_011539291.1:c.1249G>A, XP_005269593.1:p.Val417Ile, XP_006717693.1:p.Val185Ile, XP_006717694.1:p.Val417Ile, XP_011537593.1:p.Val417Ile, XR_945604.1:n.1438G>A, XR_945605.1:n.1440G>A, rs17216184, rs60620335
G > A
No VIP available No Clinical Annotations available VA
rs2286455 NC_000004.11:g.16020162C>T, NC_000004.12:g.16018539C>T, NG_011696.1:g.70462G>A, NM_001145847.1:c.759G>A, NM_001145848.1:c.759G>A, NM_001145849.1:c.786G>A, NM_001145850.1:c.786G>A, NM_001145851.1:c.759G>A, NM_001145852.1:c.759G>A, NM_006017.2:c.786G>A, NP_001139319.1:p.Ala253=, NP_001139320.1:p.Ala253=, NP_001139321.1:p.Ala262=, NP_001139322.1:p.Ala262=, NP_001139323.1:p.Ala253=, NP_001139324.1:p.Ala253=, NP_006008.1:p.Ala262=, XM_005248194.1:c.786G>A, XM_005248195.1:c.759G>A, XM_005248195.3:c.759G>A, XM_005248196.1:c.759G>A, XM_005248196.3:c.759G>A, XM_006713974.2:c.552G>A, XM_011513890.1:c.786G>A, XM_011513891.1:c.786G>A, XM_011513892.1:c.786G>A, XM_011513893.1:c.786G>A, XM_011513894.1:c.786G>A, XM_011513895.1:c.786G>A, XM_011513896.1:c.786G>A, XM_011513897.1:c.786G>A, XM_011513898.1:c.786G>A, XM_011513899.1:c.759G>A, XM_011513900.1:c.786G>A, XM_011513901.1:c.786G>A, XM_011513902.1:c.786G>A, XM_011513903.1:c.579G>A, XM_011513904.1:c.513G>A, XP_005248251.1:p.Ala262=, XP_005248252.1:p.Ala253=, XP_005248253.1:p.Ala253=, XP_006714037.1:p.Ala184=, XP_011512192.1:p.Ala262=, XP_011512193.1:p.Ala262=, XP_011512194.1:p.Ala262=, XP_011512195.1:p.Ala262=, XP_011512196.1:p.Ala262=, XP_011512197.1:p.Ala262=, XP_011512198.1:p.Ala262=, XP_011512199.1:p.Ala262=, XP_011512200.1:p.Ala262=, XP_011512201.1:p.Ala253=, XP_011512202.1:p.Ala262=, XP_011512203.1:p.Ala262=, XP_011512204.1:p.Ala262=, XP_011512205.1:p.Ala193=, XP_011512206.1:p.Ala171=, rs56605149, rs60672150
C > T
No VIP available CA VA
rs2292997 NC_000003.11:g.183724072G>A, NC_000003.12:g.184006284G>A, NM_001023587.2:c.129+7980C>T, NM_001320032.1:c.-1403+7980C>T, NM_005688.3:c.129+7980C>T, NR_046570.1:n.-54G>A, NR_135125.1:n.315+7980C>T, XM_005247058.1:c.129+7980C>T, XM_005247058.3:c.129+7980C>T, XM_005247059.1:c.129+7980C>T, XM_005247059.3:c.129+7980C>T, XM_005247060.1:c.129+7980C>T, XM_005247061.1:c.129+7980C>T, XM_005247062.1:c.-1403+7980C>T, XM_011512314.1:c.129+7980C>T, XM_011512315.1:c.129+7980C>T, XM_011512316.1:c.-1403+7980C>T, rs17750557, rs56715946
G > A
No VIP available No Clinical Annotations available VA
rs2297595 NC_000001.10:g.98165091T>C, NC_000001.11:g.97699535T>C, NG_008807.2:g.226525A>G, NM_000110.3:c.496A>G, NP_000101.2:p.Met166Val, XM_005270561.1:c.385A>G, XM_005270562.1:c.496A>G, XM_005270562.3:c.496A>G, XM_005270563.1:c.496A>G, XM_005270564.1:c.496A>G, XM_006710397.2:c.496A>G, XP_005270618.1:p.Met129Val, XP_005270619.1:p.Met166Val, XP_005270619.2:p.Met166Val, XP_005270620.1:p.Met166Val, XP_005270621.1:p.Met166Val, XP_006710460.1:p.Met166Val, rs118014431, rs199469517, rs52827192, rs61243782
T > C
No VIP available No Clinical Annotations available VA
rs2302273 NC_000005.10:g.150155692G>A, NC_000005.9:g.149535255G>A, NG_023367.1:g.5168C>T, NM_002609.3:c.-302C>T, XM_005268464.1:c.-448C>T, XM_005268464.2:c.-448C>T, XM_011537659.1:c.-769C>T, rs56934659
G > A
No VIP available CA VA
rs2302821 NC_000009.11:g.132501881A>C, NC_000009.12:g.129739602A>C, NM_004878.4:c.*9T>G, XM_011519210.1:c.*9T>G, rs386564384, rs59943369
A > C
No VIP available CA VA
rs2306283 NC_000012.11:g.21329738A>G, NC_000012.12:g.21176804A>G, NG_011745.1:g.50611A>G, NM_006446.4:c.388A>G, NP_006437.3:p.Asn130Asp, rs17389242, rs52832430, rs60767041
A > G
No VIP available No Clinical Annotations available VA
rs2401863 NC_000014.8:g.90456188G>T, NC_000014.9:g.89989844G>T, NG_009164.1:g.38943G>T, NM_001008744.1:c.1366+79G>T, NM_018319.3:c.1366+79G>T, XM_005267847.1:c.1366+79G>T, XM_005267847.2:c.1366+79G>T, XM_005267848.1:c.1366+79G>T, XM_005267849.1:c.1366+79G>T, XM_006720197.2:c.1366+79G>T, XM_006720198.2:c.1366+79G>T, XM_006720199.1:c.571+79G>T, XM_006720200.2:c.571+79G>T, XM_011536941.1:c.1366+79G>T, XM_011536942.1:c.1366+79G>T, XM_011536943.1:c.1366+79G>T, XM_011536944.1:c.1366+79G>T, rs34560941, rs58608928
G > T
No VIP available No Clinical Annotations available VA
rs2465403 NC_000008.10:g.120090827G>A, NC_000008.11:g.119078588G>A, NM_006438.3:c.149-11092G>A, XM_005250756.1:c.-59-11092G>A, XM_005250756.2:c.-59-11092G>A, XM_011516795.1:c.-59-11092G>A
G > A
No VIP available No Clinical Annotations available VA
rs2470890 NC_000015.10:g.74755085T>C, NC_000015.9:g.75047426C>T, NG_008431.1:g.37544C=, NG_008431.1:g.37544C>T, NM_000761.3:c.1548C=, NM_000761.3:c.1548C>T, NM_000761.4:c.1548T=, NM_000761.4:c.1548T>C, NP_000752.2:p.Asn516=, rs17334605, rs17861161, rs3211365, rs386481450
C > C
C > T
No VIP available CA VA
rs25487 NC_000019.10:g.43551574T>C, NC_000019.9:g.44055726T>C, NG_033799.1:g.29005A>G, NM_006297.2:c.1196A>G, NP_006288.2:p.Gln399Arg, rs11553658, rs17435395, rs3817410, rs386493716, rs57378728
T > C
No VIP available CA VA
rs2612091 NC_000018.10:g.683607C>T, NC_000018.9:g.683607C>T, NM_001126123.3:c.496-227G>A, NM_001318759.1:c.742-227G>A, NM_001318760.1:c.199-227G>A, NM_017512.5:c.742-227G>A, NM_202758.3:c.805-227G>A, XM_005258111.1:c.886-227G>A, XM_005258112.1:c.661-227G>A, XM_005258113.1:c.658-227G>A, XM_005258114.1:c.514-227G>A, XM_005258115.1:c.496-227G>A, XM_005258116.1:c.496-227G>A, XM_005258117.1:c.310-227G>A, XM_005258118.1:c.199-227G>A, XM_005258118.2:c.199-227G>A, XM_005258120.1:c.157-227G>A, XM_011525677.1:c.769-212G>A, XM_011525678.1:c.760-212G>A, XM_011525679.1:c.769-227G>A, XM_011525680.1:c.742-212G>A, XM_011525681.1:c.730-212G>A, XM_011525682.1:c.703-212G>A, XM_011525683.1:c.580-212G>A, XM_011525684.1:c.553-212G>A, XM_011525685.1:c.541-212G>A, XM_011525686.1:c.517-212G>A, XM_011525687.1:c.514-227G>A, XM_011525688.1:c.496-212G>A, XM_011525689.1:c.364-212G>A, XM_011525690.1:c.364-212G>A, XM_011525691.1:c.310-212G>A, XM_011525692.1:c.310-212G>A, XM_011525693.1:c.310-212G>A, XM_011525694.1:c.310-227G>A, XM_011525695.1:c.271-212G>A, XM_011525696.1:c.199-212G>A, XM_011525697.1:c.157-212G>A, XM_011525698.1:c.157-212G>A, XM_011525699.1:c.157-212G>A, XR_243810.1:n.937-227G>A, XR_243810.3:n.778-227G>A, XR_243811.1:n.803-227G>A, XR_243811.2:n.803-227G>A, XR_243812.1:n.938-227G>A, XR_430041.2:n.940-227G>A, XR_935066.1:n.778-212G>A, XR_935067.1:n.778-212G>A, rs61671949
C > T
No VIP available No Clinical Annotations available VA
rs2661280 NC_000001.10:g.163113375G>C, NC_000001.11:g.163143585G>C, NG_027731.2:g.183207C>G, NM_001195303.2:c.*3757C>G, NM_001254748.1:c.*3757C>G, NM_001254749.1:c.*3757C>G, NM_003617.3:c.*3757C>G, rs17361582, rs56558782, rs57479307, rs60251204
G > C
No VIP available CA VA
rs2741171 NC_000018.10:g.700687T>C, NC_000018.9:g.700687T>C, NM_001126123.3:c.63+5783A>G, NM_001318759.1:c.194-3332A>G, NM_001318760.1:c.-352-3332A>G, NM_017512.5:c.194-3332A>G, NM_202758.3:c.257-3332A>G, XM_005258111.1:c.338-3332A>G, XM_005258112.1:c.113-3332A>G, XM_005258113.1:c.337+5783A>G, XM_005258114.1:c.193+5783A>G, XM_005258115.1:c.63+5783A>G, XM_005258116.1:c.63+5783A>G, XM_005258118.1:c.-352-3332A>G, XM_005258118.2:c.-352-3332A>G, XM_005258119.1:c.338-3332A>G, XM_011525677.1:c.221-3332A>G, XM_011525678.1:c.212-3332A>G, XM_011525679.1:c.221-3332A>G, XM_011525680.1:c.194-3332A>G, XM_011525681.1:c.221-3332A>G, XM_011525682.1:c.194-3332A>G, XM_011525683.1:c.220+5783A>G, XM_011525684.1:c.193+5783A>G, XM_011525685.1:c.220+5783A>G, XM_011525686.1:c.85-6353A>G, XM_011525687.1:c.193+5783A>G, XM_011525688.1:c.63+5783A>G, XM_011525689.1:c.-112-3332A>G, XM_011525690.1:c.-171-3273A>G, XM_011525691.1:c.-673-3332A>G, XM_011525692.1:c.-645-3332A>G, XM_011525694.1:c.-267-3332A>G, XM_011525695.1:c.-673-3332A>G, XM_011525696.1:c.-758-3332A>G, XM_011525697.1:c.-855-3332A>G, XM_011525698.1:c.-259+5783A>G, XR_243810.1:n.389-3332A>G, XR_243810.3:n.230-3332A>G, XR_243811.1:n.255-3332A>G, XR_243811.2:n.255-3332A>G, XR_243812.1:n.390-3332A>G, XR_430041.2:n.392-3332A>G, XR_935066.1:n.230-3332A>G, XR_935067.1:n.230-3332A>G
T > C
No VIP available No Clinical Annotations available VA
T > C
No VIP available No Clinical Annotations available VA
rs2912024 NC_000008.10:g.6638899C>T, NC_000008.11:g.6781378C>T, rs56641910, rs57353971
C > T
No VIP available No Clinical Annotations available VA
rs2928607 NC_000008.10:g.6638710C>G, NC_000008.11:g.6781189C>G
C > G
No VIP available No Clinical Annotations available VA
rs2928608 NC_000008.10:g.6639024T>C, NC_000008.11:g.6781503T>C, rs58017964
T > C
No VIP available No Clinical Annotations available VA
rs2928609 NC_000008.10:g.6639118T>C, NC_000008.11:g.6781597T>C, rs56794760
T > C
No VIP available No Clinical Annotations available VA
rs2936519 NC_000008.10:g.6639240G>A, NC_000008.11:g.6781719G>A, rs59917631
G > A
No VIP available CA VA
rs2965667 NC_000012.11:g.17444733A>T, NC_000012.12:g.17291799A>T
A > T
No VIP available No Clinical Annotations available VA
rs2978926 NC_000008.10:g.6639425A>G, NC_000008.11:g.6781904A>G, rs56514514, rs57794753, rs58364937
A > G
No VIP available No Clinical Annotations available VA
rs2978931 NC_000008.10:g.6638081C>A, NC_000008.11:g.6780560C>A, rs386578178, rs59726576
C > A
No VIP available CA VA
rs3025039 NC_000006.11:g.43752536C>T, NC_000006.12:g.43784799C>T, NG_008732.1:g.19584C>T, NM_001025366.2:c.*237C>T, NM_001025367.2:c.*237C>T, NM_001025368.2:c.*237C>T, NM_001025369.2:c.*253C>T, NM_001025370.2:c.*237C>T, NM_001033756.2:c.*171C>T, NM_001171622.1:c.*237C>T, NM_001171623.1:c.*237C>T, NM_001171624.1:c.*237C>T, NM_001171625.1:c.*237C>T, NM_001171626.1:c.*237C>T, NM_001171627.1:c.*253C>T, NM_001171628.1:c.*237C>T, NM_001171629.1:c.*171C>T, NM_001171630.1:c.*237C>T, NM_001204384.1:c.*237C>T, NM_001204385.1:c.*237C>T, NM_001287044.1:c.*237C>T, NM_001317010.1:c.*171C>T, NM_003376.5:c.*237C>T, XM_005249363.1:c.*237C>T, rs11575898
C > T
No VIP available No Clinical Annotations available VA
rs3130 NC_000004.11:g.15969938T>C, NC_000004.12:g.15968315T>C, NG_011696.1:g.120686A>G, NM_001145847.1:c.*1078A>G, NM_001145848.1:c.*1078A>G, NM_001145849.1:c.*1078A>G, NM_001145850.1:c.*1078A>G, NM_001145851.1:c.*1078A>G, NM_001145852.1:c.*1078A>G, NM_006017.2:c.*1078A>G, XM_005248194.1:c.*1078A>G, XM_005248195.1:c.*1078A>G, XM_005248195.3:c.*1078A>G, XM_005248196.1:c.*1078A>G, XM_005248196.3:c.*1078A>G, XM_006713974.2:c.*1078A>G, XM_011513890.1:c.*1078A>G, XM_011513891.1:c.*1078A>G, XM_011513892.1:c.*1078A>G, XM_011513893.1:c.*1078A>G, XM_011513894.1:c.*1078A>G, XM_011513895.1:c.*1078A>G, XM_011513896.1:c.*1078A>G, XM_011513897.1:c.*1078A>G, XM_011513900.1:c.*1078A>G, XM_011513901.1:c.*1078A>G, XM_011513902.1:c.*1078A>G, XM_011513903.1:c.*1078A>G, XM_011513904.1:c.*1078A>G, rs11552440, rs17477709, rs3194369, rs56565902, rs60023481, rs60646405, rs7752
T > C
No VIP available No Clinical Annotations available VA
rs3136228 NC_000002.11:g.48009816T>G, NC_000002.12:g.47782677T>G, NG_007111.1:g.4531T>G, NM_000179.2:c.-557T>G, NM_001281492.1:c.-557T>G, NM_001281493.1:c.-1293T>G, NM_001281494.1:c.-2071T>G, XM_005264271.1:c.-1599T>G, XM_011532798.1:c.-1253T>G, XM_011532799.1:c.-1139T>G, XM_011532800.1:c.-592T>G, rs58009211
T > G
No VIP available No Clinical Annotations available VA
rs3212948 NC_000019.10:g.45421104G>C, NC_000019.9:g.45924362G>C, NG_015839.2:g.62725C>G, NM_001166049.1:c.321+74C>G, NM_001983.3:c.321+74C>G, NM_202001.2:c.321+74C>G, XM_005258634.1:c.321+74C>G, XM_005258635.1:c.321+74C>G, XM_005258635.2:c.321+74C>G, XM_005258636.1:c.321+74C>G, XM_005258636.3:c.321+74C>G, XM_005258637.1:c.321+74C>G, XM_005258638.1:c.106-677C>G, XM_011526610.1:c.321+74C>G, rs3737560, rs57311942
G > C
No VIP available No Clinical Annotations available VA
rs3215133 NC_000001.10:g.150802273delT, NC_000001.11:g.150829797delT, NG_028248.1:g.51972delA, NM_001197325.1:c.987+107del, NM_001197325.1:c.987+107delA, NM_001286035.1:c.990+107del, NM_001286035.1:c.990+107delA, NM_001286036.1:c.1032+107del, NM_001286036.1:c.1032+107delA, NM_001668.3:c.1032+107del, NM_001668.3:c.1032+107delA, NM_178427.2:c.987+107del, NM_178427.2:c.987+107delA, XM_005245151.1:c.1032+107del, XM_005245151.1:c.1032+107delA, XM_005245152.1:c.1032+107delA, XM_005245153.1:c.1017+107del, XM_005245153.1:c.1017+107delA, XM_005245154.1:c.1005+107delA, XM_005245154.2:c.1005+107del, XM_005245155.1:c.990+107delA, XM_005245156.1:c.984+107delA, XM_005245157.1:c.1032+107del, XM_005245157.1:c.1032+107delA, XM_005245158.1:c.1032+107delA, XM_005245159.1:c.984+107delA, XM_005245160.1:c.720+107delA, XM_011509542.1:c.1029+107del, XM_011509543.1:c.1029+107del, XM_011509544.1:c.1026+107del, XM_011509545.1:c.984+107del, XM_011509546.1:c.936+107del, XM_011509547.1:c.984+107del, rs148442690, rs369991348
T > -
No VIP available No Clinical Annotations available VA
rs329007 NC_000018.10:g.9522608G>A, NC_000018.9:g.9522606G>A, NM_006788.3:c.1053+99G>A, XM_005258080.1:c.1053+99G>A, rs59437962
G > A
No VIP available No Clinical Annotations available VA
rs34116584 NC_000002.11:g.241808314C>A, NC_000002.11:g.241808314C>G, NC_000002.11:g.241808314C>T, NC_000002.12:g.240868897C>A, NC_000002.12:g.240868897C>G, NC_000002.12:g.240868897C>T, NG_008005.1:g.5153C>A, NG_008005.1:g.5153C>G, NG_008005.1:g.5153C>T, NM_000030.2:c.32C>A, NM_000030.2:c.32C>G, NM_000030.2:c.32C>T, NP_000021.1:p.Pro11Arg, NP_000021.1:p.Pro11His, NP_000021.1:p.Pro11Leu, XR_924060.1:n.405+1336G>A, XR_924060.1:n.405+1336G>C, XR_924060.1:n.405+1336G>T
C > A
C > G
C > T
No VIP available CA VA
No VIP available No Clinical Annotations available VA
rs35569394 unknown
No VIP available CA VA
rs371194629 NC_000006.11:g.29798581_29798582insATTTGT, NC_000006.11:g.29798581_29798582insATTTGTTCATGCCT, NC_000006.12:g.29830804_29830805insATTTGT, NC_000006.12:g.29830804_29830805insATTTGTTCATGCCT, NG_029039.1:g.8826_8827insATTTGT, NG_029039.1:g.8826_8827insATTTGTTCATGCCT, NM_002127.5:c.*65_*66insATTTGT, NM_002127.5:c.*65_*66insATTTGTTCATGCCT, NT_113891.3:g.1314366_1314381insATTTGT, NT_113891.3:g.1314366_1314381insATTTGTTCATGCCT, NT_167244.2:g.1096416_1096431insATTTGT, NT_167244.2:g.1096416_1096431insATTTGTTCATGCCT, NT_167245.1:g.1099202_1099203insATTTGT, NT_167245.1:g.1099202_1099203insATTTGTTCATGCCT, NT_167245.2:g.1093617_1093618insATTTGT, NT_167245.2:g.1093617_1093618insATTTGTTCATGCCT, NT_167246.1:g.1098910_1098911insATTTGT, NT_167246.1:g.1098910_1098911insATTTGTTCATGCCT, NT_167246.2:g.1093290_1093291insATTTGT, NT_167246.2:g.1093290_1093291insATTTGTTCATGCCT, NT_167247.1:g.1098860_1098861insATTTGT, NT_167247.1:g.1098860_1098861insATTTGTTCATGCCT, NT_167247.2:g.1093275_1093276insATTTGT, NT_167247.2:g.1093275_1093276insATTTGTTCATGCCT, NT_167248.2:g.1093570_1093585insATTTGT, NT_167248.2:g.1093570_1093585insATTTGTTCATGCCT, NT_167249.2:g.1136835_1136850insATTTGT, NT_167249.2:g.1136835_1136850insATTTGTTCATGCCT, XM_005249055.1:c.*65_*66insATTTGT, XM_005249055.1:c.*65_*66insATTTGTTCATGCCT, XM_005249056.1:c.*65_*66insATTTGT, XM_005249056.1:c.*65_*66insATTTGTTCATGCCT, XM_005249057.1:c.*280_*281insATTTGT, XM_005249057.1:c.*280_*281insATTTGTTCATGCCT, XM_005249058.1:c.*65_*66insATTTGT, XM_005249058.1:c.*65_*66insATTTGTTCATGCCT, XM_005272810.1:c.*65_*67insATTTGT, XM_005272810.1:c.*65_*67insATTTGTTCATGCCT, XM_005274964.1:c.*65_*66insATTTGT, XM_005274964.1:c.*65_*66insATTTGTTCATGCCT, XM_005274965.1:c.*65_*66insATTTGT, XM_005274965.1:c.*65_*66insATTTGTTCATGCCT, XM_005274966.1:c.*280_*281insATTTGT, XM_005274966.1:c.*280_*281insATTTGTTCATGCCT, XM_005274967.1:c.*65_*66insATTTGT, XM_005274967.1:c.*65_*66insATTTGTTCATGCCT, XM_005275119.1:c.*65_*66insATTTGT, XM_005275119.1:c.*65_*66insATTTGTTCATGCCT, XM_005275120.1:c.*65_*66insATTTGT, XM_005275120.1:c.*65_*66insATTTGTTCATGCCT, XM_005275121.1:c.*280_*281insATTTGT, XM_005275121.1:c.*280_*281insATTTGTTCATGCCT, XM_005275122.1:c.*65_*66insATTTGT, XM_005275122.1:c.*65_*66insATTTGTTCATGCCT, XM_005275246.1:c.*65_*66insATTTGT, XM_005275246.1:c.*65_*66insATTTGTTCATGCCT, XM_005275247.1:c.*65_*66insATTTGT, XM_005275247.1:c.*65_*66insATTTGTTCATGCCT, XM_005275248.1:c.*280_*281insATTTGT, XM_005275248.1:c.*280_*281insATTTGTTCATGCCT, XM_005275249.1:c.*65_*66insATTTGT, XM_005275249.1:c.*65_*66insATTTGTTCATGCCT, XM_005275394.1:c.*76_*80insATTTGT, XM_005275394.1:c.*76_*80insATTTGTTCATGCCT, XM_005275549.1:c.*76_*80insATTTGT, XM_005275549.1:c.*76_*80insATTTGTTCATGCCT, XM_005275550.1:c.*76_*80insATTTGT, XM_005275550.1:c.*76_*80insATTTGTTCATGCCT, XM_005275551.1:c.*291_*295insATTTGT, XM_005275551.1:c.*291_*295insATTTGTTCATGCCT, XM_005275552.1:c.*76_*80insATTTGT, XM_005275552.1:c.*76_*80insATTTGTTCATGCCT, XM_011547651.1:c.*65_*66insATTTGT, XM_011547651.1:c.*65_*66insATTTGTTCATGCCT, XM_011547882.1:c.*65_*66insATTTGT, XM_011547882.1:c.*65_*66insATTTGTTCATGCCT, XM_011548048.1:c.*65_*66insATTTGT, XM_011548048.1:c.*65_*66insATTTGTTCATGCCT, XM_011548236.1:c.*65_*80insATTTGT, XM_011548236.1:c.*65_*80insATTTGTTCATGCCT, XM_011548237.1:c.*65_*80insATTTGT, XM_011548237.1:c.*65_*80insATTTGTTCATGCCT, XM_011548430.1:c.*65_*80insATTTGT, XM_011548430.1:c.*65_*80insATTTGTTCATGCCT, XM_011548431.1:c.*65_*80insATTTGT, XM_011548431.1:c.*65_*80insATTTGTTCATGCCT, XR_241896.1:n.1692-1_1692insATTTGT, XR_241896.1:n.1692-1_1692insATTTGTTCATGCCT, XR_246963.1:n.1612-1_1613insATTTGT, XR_246963.1:n.1612-1_1613insATTTGTTCATGCCT, XR_247353.1:n.1692-1_1692insATTTGT, XR_247353.1:n.1692-1_1692insATTTGTTCATGCCT, XR_247370.1:n.1692-1_1692insATTTGT, XR_247370.1:n.1692-1_1692insATTTGTTCATGCCT, XR_247389.1:n.1692-1_1692insATTTGT, XR_247389.1:n.1692-1_1692insATTTGTTCATGCCT, XR_247402.1:n.1622_1626insATTTGT, XR_247402.1:n.1622_1626insATTTGTTCATGCCT, XR_247423.1:n.1680_1684insATTTGT, XR_247423.1:n.1680_1684insATTTGTTCATGCCT
No VIP available No Clinical Annotations available VA
rs3740066 NC_000010.10:g.101604207C>T, NC_000010.11:g.99844450C>T, NG_011798.1:g.66745C>T, NM_000392.4:c.3972C>T, NP_000383.1:p.Ile1324=, XM_005269536.1:c.3693C>T, XM_006717630.2:c.3276C>T, XP_005269593.1:p.Ile1231=, XP_006717693.1:p.Ile1092=, XR_945604.1:n.4161C>T, XR_945605.1:n.4036C>T, rs12780340, rs17216303, rs59292214
C > T
No VIP available CA VA
rs3749438 NC_000003.11:g.183705184G>A, NC_000003.12:g.183987396G>A, NM_001023587.2:c.591+374C>T, NM_001320032.1:c.-941+374C>T, NM_005688.3:c.591+374C>T, NR_135125.1:n.777+374C>T, XM_005247058.1:c.591+374C>T, XM_005247058.3:c.591+374C>T, XM_005247059.1:c.591+374C>T, XM_005247059.3:c.591+374C>T, XM_005247060.1:c.591+374C>T, XM_005247061.1:c.591+374C>T, XM_005247062.1:c.-941+374C>T, XM_011512314.1:c.591+374C>T, XM_011512315.1:c.591+374C>T, XM_011512316.1:c.-941+374C>T, rs117658700, rs17218232, rs60372003
G > A
No VIP available No Clinical Annotations available VA
rs3812718 AB093548.1:c.603-91G>A, NC_000002.11:g.166909544C>T, NC_000002.12:g.166053034C>T, NG_011906.1:g.25606G>A, NM_001165963.1:c.603-91G>A, NM_001165964.1:c.603-91G>A, NM_001202435.1:c.603-91G>A, NM_006920.4:c.603-91G>A, XM_011511598.1:c.603-91G>A, XM_011511599.1:c.603-91G>A, XM_011511600.1:c.603-91G>A, XM_011511601.1:c.603-91G>A, XM_011511602.1:c.603-91G>A, XM_011511603.1:c.603-91G>A, XM_011511604.1:c.603-91G>A, XM_011511605.1:c.603-91G>A, XM_011511606.1:c.603-91G>A, XM_011511607.1:c.603-91G>A, XR_922981.1:n.787-91G>A, rs57229005
C > T
No VIP available No Clinical Annotations available VA
rs3913032 NC_000004.11:g.75336859A>C, NC_000004.12:g.74471142A>C, rs60356243
A > C
No VIP available No Clinical Annotations available VA
rs3918290 NC_000001.10:g.97915614C>T, NC_000001.11:g.97450058C>T, NG_008807.2:g.476002G>A, NM_000110.3:c.1905+1G>A, XM_005270561.1:c.1794+1G>A, XM_005270562.1:c.1689+1G>A, XM_005270562.3:c.1689+1G>A, XM_005270563.1:c.1905+1G>A, XM_006710397.2:c.1905+1G>A, rs199469548, rs386589337
C > G
C > T
No VIP available CA VA
rs396991 NC_000001.10:g.161514542A>C, NC_000001.11:g.161544752A>C, NG_009066.1:g.10872T>G, NM_000569.6:c.634T>G, NM_001127592.1:c.631T>G, NM_001127593.1:c.526T>G, NM_001127595.1:c.526T>G, NM_001127596.1:c.523T>G, NP_000560.5:p.Phe212Val, NP_001121064.1:p.Phe211Val, NP_001121065.1:p.Phe176Val, NP_001121067.1:p.Phe176Val, NP_001121068.1:p.Phe175Val, XM_011509293.1:c.428-1553T>G, rs17857127, rs2229097, rs3171040, rs4151086, rs61228128
A > C
No VIP available CA VA
rs4133101 NC_000005.10:g.40679465T>C, NC_000005.9:g.40679567T>C, NM_000958.2:c.-1057T>C, XM_005248326.1:c.-1529T>C, XM_005248326.3:c.-1057T>C, XM_005248327.1:c.-1529T>C, XM_005248327.2:c.-1057T>C, XM_011514070.1:c.-1057T>C, XM_011514071.1:c.-1057T>C, XR_241709.1:n.-1486T>C, XR_925635.1:n.-33T>C, XR_925943.1:n.25A>G, rs17671182, rs57352811
T > C
No VIP available No Clinical Annotations available VA
rs4148323 NC_000002.11:g.234669144G>A, NC_000002.12:g.233760498G>A, NG_002601.2:g.175755G>A, NG_033238.1:g.5226G>A, NM_000463.2:c.211G>A, NM_001072.3:c.862-6536G>A, NM_007120.2:c.868-6536G>A, NM_019075.2:c.856-6536G>A, NM_019076.4:c.856-6536G>A, NM_019077.2:c.856-6536G>A, NM_019078.1:c.868-6536G>A, NM_019093.2:c.868-6536G>A, NM_021027.2:c.856-6536G>A, NM_205862.1:c.61-6536G>A, NP_000454.1:p.Gly71Arg, XR_241238.1:n.924-6536G>A, XR_241239.1:n.233G>A, XR_241240.1:n.1023-6536G>A, XR_241241.1:n.942-6536G>A, rs113525835, rs34360183, rs58105808, rs58585123
G > A
No VIP available No Clinical Annotations available VA
rs4149056 NC_000012.11:g.21331549T>C, NC_000012.12:g.21178615T>C, NG_011745.1:g.52422T>C, NM_006446.4:c.521T>C, NP_006437.3:p.Val174Ala, rs52816141, rs60037639
T > C
No VIP available No Clinical Annotations available VA
rs4243761 NC_000015.10:g.26037644G>T, NC_000015.9:g.26282791G>T, NR_040082.1:n.896-11481G>T, rs17558024, rs61389947
G > T
No VIP available No Clinical Annotations available VA
rs425215 NC_000021.8:g.43707101C>G, NC_000021.9:g.42286991C>G, NM_004915.3:c.974-898C>G, NM_016818.2:c.974-898C>G, NM_207174.1:c.1007-898C>G, NM_207627.1:c.980-898C>G, NM_207628.1:c.908-898C>G, NM_207629.1:c.965-898C>G, XM_005261209.1:c.1007-898C>G, XM_011529806.1:c.1007-898C>G, XM_011529807.1:c.1007-898C>G, rs17767113, rs59807195, rs690665
C > G
No VIP available No Clinical Annotations available VA
rs4377367 NC_000002.11:g.131724905C>T, NC_000002.12:g.130967332C>T, NM_015320.3:c.427+20697C>T, NM_032995.2:c.427+20697C>T, XM_005263681.1:c.3985+20697C>T, XM_005263682.1:c.3874+20697C>T, XM_005263683.1:c.3985+20697C>T, XM_005263687.1:c.58+3083C>T, XM_005263687.2:c.58+3083C>T, XM_011511274.1:c.3985+20697C>T, XM_011511275.1:c.3949+20697C>T, XM_011511276.1:c.-55+20697C>T, XR_244821.1:n.4023+20697C>T, rs58214874
C > T
No VIP available No Clinical Annotations available VA
rs4426527 NC_000002.11:g.241817516A>G, NC_000002.12:g.240878099A>G, NG_008005.1:g.14355A>G, NM_000030.2:c.1020A>G, NP_000021.1:p.Ile340Met, rs17501831
A > G
No VIP available CA VA
rs4444903 NC_000004.11:g.110834110A>G, NC_000004.12:g.109912954A>G, NG_011441.1:g.5071A>G, NM_001178130.2:c.-382A>G, NM_001178131.2:c.-382A>G, NM_001963.5:c.-382A>G, XM_005262796.1:c.-382A>G, XM_005262796.2:c.-382A>G, XM_005262797.1:c.-382A>G, XM_005262797.2:c.-382A>G, XM_005262798.1:c.-382A>G, XM_005262798.2:c.-382A>G, XM_005262799.1:c.-382A>G, XM_005262800.1:c.-382A>G, XM_005262800.2:c.-382A>G, XM_005262801.1:c.-382A>G, XM_005262801.2:c.-382A>G, XM_005262802.1:c.-382A>G, XM_005262802.2:c.-382A>G, XM_006714124.2:c.-382A>G, XM_011531707.1:c.-632A>G, XM_011531708.1:c.-382A>G, XM_011531709.1:c.-382A>G, XR_427532.2:n.72A>G, XR_938699.1:n.72A>G, rs58193687
A > G
No VIP available CA VA
rs45445694 NC_000018.10:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NC_000018.9:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NG_028255.1:g.5043_5070CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NM_001012716.2:c.*34+169_*34+196CGGGACGGAGGCAGGCCAAGTGGCGCGG[2][3][4][7][8][9], NM_001071.2:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258137.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258138.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9]
No VIP available No Clinical Annotations available VA
rs45589337 NC_000001.10:g.98144726T>C, NC_000001.11:g.97679170T>C, NG_008807.2:g.246890A>G, NM_000110.3:c.775A>G, NP_000101.2:p.Lys259Glu, XM_005270561.1:c.664A>G, XM_005270562.1:c.775A>G, XM_005270562.3:c.775A>G, XM_005270563.1:c.775A>G, XM_005270564.1:c.775A>G, XM_006710397.2:c.775A>G, XP_005270618.1:p.Lys222Glu, XP_005270619.1:p.Lys259Glu, XP_005270619.2:p.Lys259Glu, XP_005270620.1:p.Lys259Glu, XP_005270621.1:p.Lys259Glu, XP_006710460.1:p.Lys259Glu, rs59034382
T > C
No VIP available No Clinical Annotations available VA
rs4698803 NC_000004.11:g.110914427A>T, NC_000004.12:g.109993271A>T, NG_011441.1:g.85388A>T, NM_001178130.2:c.2735-1462A>T, NM_001178131.2:c.2633A>T, NM_001963.5:c.2759A>T, NP_001171602.1:p.Glu878Val, NP_001954.2:p.Glu920Val, XM_005262796.1:c.2759A>T, XM_005262796.2:c.2759A>T, XM_005262797.1:c.2633A>T, XM_005262797.2:c.2633A>T, XM_005262798.1:c.2516A>T, XM_005262798.2:c.2516A>T, XM_005262799.1:c.2759A>T, XM_005262800.1:c.2516A>T, XM_005262800.2:c.2516A>T, XM_005262801.1:c.2491+9730A>T, XM_005262801.2:c.2491+9730A>T, XM_006714124.2:c.2759A>T, XM_011531707.1:c.2648A>T, XM_011531708.1:c.2734+4562A>T, XP_005262853.1:p.Glu920Val, XP_005262854.1:p.Glu878Val, XP_005262855.1:p.Glu839Val, XP_005262856.1:p.Glu920Val, XP_005262857.1:p.Glu839Val, XP_006714187.1:p.Glu920Val, XP_011530009.1:p.Glu883Val, XR_427532.2:n.3187+4562A>T, XR_938699.1:n.3187+4562A>T, rs17253807, rs52809851, rs58275734
A > T
No VIP available CA VA
rs4702484 NC_000005.10:g.7649747C>T, NC_000005.9:g.7649860C>T, NM_020546.2:c.720+23431C>T, XM_011513942.1:c.720+23431C>T, XR_427657.2:n.734+23431C>T, rs57296477
C > T
No VIP available No Clinical Annotations available VA
rs4886410 NC_000015.10:g.74773303G>C, NC_000015.9:g.75065644G>C
G > C
No VIP available No Clinical Annotations available VA
rs4970722 NC_000001.10:g.98352053A>T, NC_000001.11:g.97886497A>T, NG_008807.2:g.39563T>A, NM_000110.3:c.40-3123T>A, NM_001160301.1:c.40-3123T>A, XM_005270561.1:c.39+34387T>A, XM_005270562.1:c.40-3123T>A, XM_005270562.3:c.40-3123T>A, XM_005270563.1:c.40-3123T>A, XM_005270564.1:c.40-3123T>A, XM_006710397.2:c.40-3123T>A, rs56417891, rs60365769, rs61301156
A > T
No VIP available CA VA
rs5275 NC_000001.10:g.186643058A>G, NC_000001.11:g.186673926A>G, NG_028206.2:g.11502T>C, NM_000963.3:c.*427T>C, rs3170885, rs59727615
A > G
No VIP available No Clinical Annotations available VA
rs55886062 NC_000001.10:g.97981343A>C, NC_000001.11:g.97515787A>C, NG_008807.2:g.410273T>G, NM_000110.3:c.1679T>G, NP_000101.2:p.Ile560Ser, XM_005270561.1:c.1568T>G, XM_005270562.1:c.1524+33773T>G, XM_005270562.3:c.1524+33773T>G, XM_005270563.1:c.1679T>G, XM_005270564.1:c.1679T>G, XM_006710397.2:c.1679T>G, XP_005270618.1:p.Ile523Ser, XP_005270620.1:p.Ile560Ser, XP_005270621.1:p.Ile560Ser, XP_006710460.1:p.Ile560Ser, rs199469542
A > C
No VIP available No Clinical Annotations available VA
rs56038477 NC_000001.10:g.98039419C>T, NC_000001.11:g.97573863C>T, NG_008807.2:g.352197G>A, NM_000110.3:c.1236G>A, NP_000101.2:p.Glu412=, XM_005270561.1:c.1125G>A, XM_005270562.1:c.1236G>A, XM_005270562.3:c.1236G>A, XM_005270563.1:c.1236G>A, XM_005270564.1:c.1236G>A, XM_006710397.2:c.1236G>A, XP_005270618.1:p.Glu375=, XP_005270619.1:p.Glu412=, XP_005270619.2:p.Glu412=, XP_005270620.1:p.Glu412=, XP_005270621.1:p.Glu412=, XP_006710460.1:p.Glu412=, rs199469533, rs61730901
C > T
No VIP available No Clinical Annotations available VA
rs562 NC_000003.11:g.183637845T>C, NC_000003.12:g.183920057T>C, NM_001320032.1:c.*1243A>G, NM_005688.3:c.*1243A>G, XM_005247058.1:c.*1243A>G, XM_005247058.3:c.*1243A>G, XM_005247059.1:c.*1243A>G, XM_005247059.3:c.*1243A>G, XM_005247060.1:c.*1243A>G, XM_005247062.1:c.*1243A>G, XM_011512314.1:c.*1243A>G, XM_011512316.1:c.*1243A>G, rs17675, rs3193906, rs3805113, rs59910781
T > C
No VIP available No Clinical Annotations available VA
A > G
No VIP available No Clinical Annotations available VA
rs576523 NC_000001.10:g.160746076G>A, NC_000001.11:g.160776286G>A, XR_922204.1:n.447C>T, XR_922205.1:n.414+33C>T, XR_922206.1:n.447C>T, rs56592820, rs57939783, rs58334060
G > A
No VIP available No Clinical Annotations available VA
rs6072262 NC_000020.10:g.39704995G>A, NC_000020.11:g.41076355G>A, NG_012262.1:g.52534G>A, NM_003286.2:c.279+61G>A, XM_005260541.1:c.183+61G>A
G > A
No VIP available No Clinical Annotations available VA
rs61764370 NC_000012.11:g.25360224A>C, NC_000012.12:g.25207290A>C, NG_007524.1:g.48631T>G, NM_004985.4:c.*2505T>G, NM_033360.3:c.*2626T>G, XM_011520653.1:c.*2505T>G, rs200812391
A > C
No VIP available No Clinical Annotations available VA
rs6447003 NC_000004.11:g.75386914G>C, NC_000004.12:g.74521197G>C, NW_003571035.1:g.4705G>C, rs17476698, rs61199787
G > C
No VIP available No Clinical Annotations available VA
rs6533485 NC_000004.11:g.110927563G>C, NC_000004.12:g.110006407G>C, NG_011441.1:g.98524G>C, NM_001178130.2:c.3169-1745G>C, NM_001178131.2:c.3166-1745G>C, NM_001963.5:c.3292-1745G>C, XM_005262796.1:c.3292-1745G>C, XM_005262796.2:c.3292-1745G>C, XM_005262797.1:c.3166-1745G>C, XM_005262797.2:c.3166-1745G>C, XM_005262798.1:c.3049-1745G>C, XM_005262798.2:c.3049-1745G>C, XM_005262800.1:c.3048+1785G>C, XM_005262800.2:c.3048+1785G>C, XM_005262801.1:c.2492-4795G>C, XM_005262801.2:c.2492-4795G>C, XM_006714124.2:c.3291+1785G>C, XM_011531707.1:c.3181-1745G>C, XR_427532.2:n.3305+1785G>C, XR_938699.1:n.3306-1745G>C
G > C
No VIP available No Clinical Annotations available VA
rs67376798 NC_000001.10:g.97547947T>A, NC_000001.11:g.97082391T>A, NG_008807.2:g.843669A>T, NM_000110.3:c.2846A>T, NP_000101.2:p.Asp949Val, XM_005270561.1:c.2735A>T, XM_005270562.1:c.2630A>T, XM_005270562.3:c.2630A>T, XP_005270618.1:p.Asp912Val, XP_005270619.1:p.Asp877Val, XP_005270619.2:p.Asp877Val, rs199469564, rs386467430, rs67376799
T > A
No VIP available No Clinical Annotations available VA
rs6759892 NC_000002.11:g.234601669T>G, NC_000002.12:g.233693023T>G, NG_002601.2:g.108280T>G, NM_001072.3:c.19T>G, NM_019075.2:c.855+55646T>G, NM_019076.4:c.856-74011T>G, NM_019077.2:c.855+10231T>G, NM_021027.2:c.855+20234T>G, NM_205862.1:c.-7-776T>G, NP_001063.2:p.Ser7Ala, XR_241240.1:n.180T>G, XR_241241.1:n.941+20234T>G, rs17670302, rs60624335
T > G
No VIP available No Clinical Annotations available VA
rs6850557 NC_000004.11:g.110911015G>A, NC_000004.12:g.109989859G>A, NG_011441.1:g.81976G>A, NM_001178130.2:c.2734+1150G>A, NM_001178131.2:c.2608+1150G>A, NM_001963.5:c.2734+1150G>A, XM_005262796.1:c.2734+1150G>A, XM_005262796.2:c.2734+1150G>A, XM_005262797.1:c.2608+1150G>A, XM_005262797.2:c.2608+1150G>A, XM_005262798.1:c.2492-3388G>A, XM_005262798.2:c.2492-3388G>A, XM_005262799.1:c.2734+1150G>A, XM_005262800.1:c.2492-3388G>A, XM_005262800.2:c.2492-3388G>A, XM_005262801.1:c.2491+6318G>A, XM_005262801.2:c.2491+6318G>A, XM_006714124.2:c.2734+1150G>A, XM_011531707.1:c.2623+1150G>A, XM_011531708.1:c.2734+1150G>A, XR_427532.2:n.3187+1150G>A, XR_938699.1:n.3187+1150G>A
G > A
No VIP available CA VA
rs699947 NC_000006.11:g.43736389A>C, NC_000006.12:g.43768652A>C, NG_008732.1:g.3437A>C, NM_001025366.2:c.-2055A>C, NM_001025367.2:c.-2055A>C, NM_001025368.2:c.-2055A>C, NM_001025369.2:c.-2055A>C, NM_001025370.2:c.-2055A>C, NM_001033756.2:c.-2055A>C, NM_001171622.1:c.-2055A>C, NM_001171623.1:c.-2595A>C, NM_001171624.1:c.-2595A>C, NM_001171625.1:c.-2595A>C, NM_001171626.1:c.-2595A>C, NM_001171627.1:c.-2595A>C, NM_001171628.1:c.-2595A>C, NM_001171629.1:c.-2595A>C, NM_001171630.1:c.-2595A>C, NM_001204384.1:c.-2595A>C, NM_001204385.1:c.-2055A>C, NM_001317010.1:c.-2595A>C, NM_003376.5:c.-2055A>C, rs1310065, rs36208051, rs61399354
A > C
No VIP available CA VA
rs712829 NC_000007.13:g.55086755G>T, NC_000007.14:g.55019062G>T, NG_007726.3:g.5031G>T, NM_005228.3:c.-216G>T, NM_201282.1:c.-216G>T, NM_201283.1:c.-216G>T, NM_201284.1:c.-216G>T, XM_005271746.1:c.-216G>T, XM_005271748.1:c.-216G>T, rs17288931
G > T
No VIP available CA VA
rs712830 NC_000007.13:g.55086780A>C, NC_000007.14:g.55019087A>C, NG_007726.3:g.5056A>C, NM_005228.3:c.-191A>C, NM_201282.1:c.-191A>C, NM_201283.1:c.-191A>C, NM_201284.1:c.-191A>C, XM_005271746.1:c.-191A>C, XM_005271748.1:c.-191A>C, rs17288938
A > C
No VIP available CA VA
rs717620 NC_000010.10:g.101542578C>T, NC_000010.11:g.99782821C>T, NG_011798.1:g.5116C>T, NM_000392.4:c.-24C>T, XM_005269536.1:c.-24C>T, XM_006717631.2:c.-24C>T, XM_011539291.1:c.-24C>T, XR_945604.1:n.166C>T, XR_945605.1:n.168C>T, rs17216163, rs386485129, rs58371376
C > T
No VIP available CA VA
rs7325568 NC_000013.10:g.40818284C>T, NC_000013.11:g.40244147C>T
C > T
No VIP available No Clinical Annotations available VA
rs75017182 NC_000001.10:g.98045449G>C, NC_000001.11:g.97579893G>C, NG_008807.2:g.346167C>G, NM_000110.3:c.1129-5923C>G, XM_005270561.1:c.1018-5923C>G, XM_005270562.1:c.1129-5923C>G, XM_005270562.3:c.1129-5923C>G, XM_005270563.1:c.1129-5923C>G, XM_005270564.1:c.1129-5923C>G, XM_006710397.2:c.1129-5923C>G
G > C
No VIP available CA VA
rs7518660 NC_000001.10:g.67685443G>A, NC_000001.11:g.67219760G>A, NG_011498.1:g.58275G>A, NM_144701.2:c.955+30G>A, XM_005270512.1:c.346+30G>A, XM_005270513.1:c.346+30G>A, XM_005270514.1:c.346+30G>A, XM_005270515.1:c.230-16953G>A, XM_005270516.1:c.193+30G>A, XM_005270516.2:c.193+30G>A, XM_005270517.1:c.190+30G>A, XM_005270518.1:c.193+30G>A, XM_005270519.1:c.44-16953G>A, XM_011540789.1:c.1045+30G>A, XM_011540790.1:c.955+30G>A, XM_011540791.1:c.955+30G>A, rs59447794
G > A
No VIP available No Clinical Annotations available VA
rs7548189 NC_000001.10:g.97867713C>A, NC_000001.11:g.97402157C>A, NG_008807.2:g.523903G>T, NM_000110.3:c.1906-19696G>T, XM_005270561.1:c.1795-19696G>T, XM_005270562.1:c.1690-19696G>T, XM_005270562.3:c.1690-19696G>T, XM_005270563.1:c.1906-19696G>T, XM_006710397.2:c.1906-19696G>T, rs17600129, rs59836182
C > A
No VIP available CA VA
rs76387818 NC_000001.10:g.97539400G>A, NC_000001.11:g.97073844G>A
G > A
No VIP available No Clinical Annotations available VA
rs7687621 NC_000004.11:g.75249826T>C, NC_000004.12:g.74384109T>C, NM_001432.2:c.429-618T>C, rs60629826
T > C
No VIP available CA VA
rs7699188 NC_000004.11:g.89096061G>A, NC_000004.12:g.88174909G>A, NG_032067.2:g.61414C>T, NM_001257386.1:c.-19-34895C>T, XM_005263355.1:c.-19-34895C>T, XM_005263355.2:c.-19-34895C>T, XM_011532420.1:c.-19-34895C>T, rs57955088
G > A
G > C
No VIP available No Clinical Annotations available VA
C > A
C > T
No VIP available No Clinical Annotations available VA
rs7952081 NC_000011.10:g.67557462G>A, NC_000011.9:g.67324933G>A, rs56809733
G > A
No VIP available No Clinical Annotations available VA
rs8101143 NC_000019.10:g.21773334G>A, NC_000019.9:g.21956136G>A, NW_003315964.2:g.134524G>A, rs17686410, rs58479809
G > A
No VIP available No Clinical Annotations available VA
(TA)6 > (TA)5
(TA)6 > (TA)7
(TA)6 > (TA)8
No VIP available No Clinical Annotations available VA
rs833061 NC_000006.11:g.43737486C>T, NC_000006.12:g.43769749C>T, NG_008732.1:g.4534C>T, NM_001025366.2:c.-958C>T, NM_001025367.2:c.-958C>T, NM_001025368.2:c.-958C>T, NM_001025369.2:c.-958C>T, NM_001025370.2:c.-958C>T, NM_001033756.2:c.-958C>T, NM_001171622.1:c.-958C>T, NM_001171623.1:c.-1498C>T, NM_001171624.1:c.-1498C>T, NM_001171625.1:c.-1498C>T, NM_001171626.1:c.-1498C>T, NM_001171627.1:c.-1498C>T, NM_001171628.1:c.-1498C>T, NM_001171629.1:c.-1498C>T, NM_001171630.1:c.-1498C>T, NM_001204384.1:c.-1498C>T, NM_001204385.1:c.-958C>T, NM_001317010.1:c.-1498C>T, NM_003376.5:c.-958C>T, rs36208046, rs60746584
C > T
No VIP available CA VA
rs861539 NC_000014.8:g.104165753G>A, NC_000014.9:g.103699416G>A, NG_011516.1:g.21071C>T, NG_012307.1:g.75229G>A, NM_001100118.1:c.722C>T, NM_001100119.1:c.722C>T, NM_001130107.1:c.1782-1239G>A, NM_005432.3:c.722C>T, NM_182923.3:c.1651-1239G>A, NP_001093588.1:p.Thr241Met, NP_001093589.1:p.Thr241Met, NP_005423.1:p.Thr241Met, XM_005267599.1:c.1924-1239G>A, XM_005267600.1:c.*17-1239G>A, XM_005267602.1:c.1897-1239G>A, XM_005267603.1:c.*17-1239G>A, XM_005267604.1:c.1857-1239G>A, XM_005267605.1:c.1849-1239G>A, XM_005267606.1:c.*17-1239G>A, XM_005267607.1:c.1830-1239G>A, XM_005267608.1:c.1825-1239G>A, XM_005267609.1:c.1822-1239G>A, XM_005267610.1:c.*46-1239G>A, XM_005267612.1:c.*17-1239G>A, XM_005267613.1:c.1758-1239G>A, XM_005267614.1:c.1755-1239G>A, XM_005267615.1:c.1726-1239G>A, XM_005267616.1:c.*17-1239G>A, XM_005267617.1:c.1699-1239G>A, XM_005267618.1:c.*17-1239G>A, XM_005267624.1:c.1624-1239G>A, XM_005268045.1:c.722C>T, XM_005268046.1:c.722C>T, XM_005268047.1:c.722C>T, XM_011537138.1:c.722C>T, XP_005268102.1:p.Thr241Met, XP_005268103.1:p.Thr241Met, XP_005268104.1:p.Thr241Met, XP_011535440.1:p.Thr241Met, rs1734804, rs17435402, rs17850783, rs3212111, rs56934996
G > A
No VIP available CA VA
rs885036 NC_000002.11:g.99304794A>G, NC_000002.12:g.98688331A>G, NM_012214.2:c.95-9860T>C, XM_005263866.1:c.95-9860T>C, XM_005263867.1:c.-637-9860T>C, rs17448475, rs60397503
A > G
No VIP available No Clinical Annotations available VA
rs895819 NC_000019.10:g.13836478T>C, NC_000019.9:g.13947292T>C, NR_029495.1:n.182A>G, NR_029497.1:n.-119A>G, NR_029501.1:n.40A>G, NR_036515.1:n.-189A>G, rs117072305, rs61371382
T > C
No VIP available No Clinical Annotations available VA
rs929446 NC_000004.11:g.110883344C>T, NC_000004.12:g.109962188C>T, NG_011441.1:g.54305C>T, NM_001178130.2:c.1312+203C>T, NM_001178131.2:c.1186+203C>T, NM_001963.5:c.1312+203C>T, XM_005262796.1:c.1312+203C>T, XM_005262796.2:c.1312+203C>T, XM_005262797.1:c.1186+203C>T, XM_005262797.2:c.1186+203C>T, XM_005262798.1:c.1312+203C>T, XM_005262798.2:c.1312+203C>T, XM_005262799.1:c.1312+203C>T, XM_005262800.1:c.1312+203C>T, XM_005262800.2:c.1312+203C>T, XM_005262801.1:c.1312+203C>T, XM_005262801.2:c.1312+203C>T, XM_005262802.1:c.1312+203C>T, XM_005262802.2:c.1312+203C>T, XM_006714124.2:c.1312+203C>T, XM_011531707.1:c.1201+203C>T, XM_011531708.1:c.1312+203C>T, XM_011531709.1:c.1312+203C>T, XR_427532.2:n.1765+203C>T, XR_938699.1:n.1765+203C>T, rs61627853
C > T
No VIP available CA VA
rs9344 NC_000011.10:g.69648142G>A, NC_000011.9:g.69462910G>A, NG_007375.1:g.12038G>A, NM_053056.2:c.723G>A, NP_444284.1:p.Pro241=, XM_006718653.2:c.747G>A, XP_006718716.1:p.Pro249=, rs1131451, rs11557586, rs17295377, rs17349816, rs17359282, rs17852153, rs2227951, rs3191361, rs59807553, rs603965
G > A
No VIP available CA VA
rs9380142 NC_000006.11:g.29798794A=, NC_000006.11:g.29798794A>G, NC_000006.12:g.29831017A=, NC_000006.12:g.29831017A>G, NG_029039.1:g.9039A=, NG_029039.1:g.9039A>G, NM_002127.5:c.*278A=, NM_002127.5:c.*278A>G, NT_113891.3:g.1314593A=, NT_113891.3:g.1314593A>G, NT_167244.2:g.1096643A=, NT_167244.2:g.1096643A>G, NT_167245.1:g.1099415G=, NT_167245.1:g.1099415G>A, NT_167245.2:g.1093830G=, NT_167245.2:g.1093830G>A, NT_167246.1:g.1099123A=, NT_167246.1:g.1099123A>G, NT_167246.2:g.1093503A=, NT_167246.2:g.1093503A>G, NT_167247.1:g.1099073G=, NT_167247.1:g.1099073G>A, NT_167247.2:g.1093488G=, NT_167247.2:g.1093488G>A, NT_167248.2:g.1093797A=, NT_167248.2:g.1093797A>G, NT_167249.2:g.1137062A=, NT_167249.2:g.1137062A>G, XM_005249055.1:c.*278A=, XM_005249055.1:c.*278A>G, XM_005249056.1:c.*278A>G, XM_005249056.1:c.*278G>A, XM_005249057.1:c.*493A>G, XM_005249057.1:c.*493G>A, XM_005249058.1:c.*278A=, XM_005249058.1:c.*278A>G, XM_005272810.1:c.*292A=, XM_005272810.1:c.*292A>G, XM_005274964.1:c.*278G=, XM_005274964.1:c.*278G>A, XM_005274965.1:c.*278G=, XM_005274965.1:c.*278G>A, XM_005274966.1:c.*493A>G, XM_005274966.1:c.*493G>A, XM_005274967.1:c.*278G=, XM_005274967.1:c.*278G>A, XM_005275119.1:c.*278A=, XM_005275119.1:c.*278A>G, XM_005275120.1:c.*278A>G, XM_005275120.1:c.*278G>A, XM_005275121.1:c.*493A>G, XM_005275121.1:c.*493G>A, XM_005275122.1:c.*278A>G, XM_005275122.1:c.*278G>A, XM_005275246.1:c.*278G=, XM_005275246.1:c.*278G>A, XM_005275247.1:c.*278G=, XM_005275247.1:c.*278G>A, XM_005275248.1:c.*493A>G, XM_005275248.1:c.*493G>A, XM_005275249.1:c.*278G=, XM_005275249.1:c.*278G>A, XM_005275394.1:c.*292A=, XM_005275394.1:c.*292A>G, XM_005275549.1:c.*292A=, XM_005275549.1:c.*292A>G, XM_005275550.1:c.*292A>G, XM_005275550.1:c.*292G>A, XM_005275551.1:c.*507A>G, XM_005275551.1:c.*507G>A, XM_005275552.1:c.*292A=, XM_005275552.1:c.*292A>G, XM_011547651.1:c.*278G=, XM_011547651.1:c.*278G>A, XM_011547882.1:c.*278A=, XM_011547882.1:c.*278A>G, XM_011548048.1:c.*278G=, XM_011548048.1:c.*278G>A, XM_011548236.1:c.*292A=, XM_011548236.1:c.*292A>G, XM_011548237.1:c.*292A=, XM_011548237.1:c.*292A>G, XM_011548430.1:c.*292A=, XM_011548430.1:c.*292A>G, XM_011548431.1:c.*292A=, XM_011548431.1:c.*292A>G, XR_241896.1:n.1904A>G, XR_241896.1:n.1904G>A, XR_246963.1:n.1838A>G, XR_246963.1:n.1838G>A, XR_247353.1:n.1904A>G, XR_247353.1:n.1904G>A, XR_247370.1:n.1904A=, XR_247370.1:n.1904A>G, XR_247389.1:n.1904A>G, XR_247389.1:n.1904G>A, XR_247402.1:n.1838A>G, XR_247402.1:n.1838G>A, XR_247423.1:n.1896A>G, XR_247423.1:n.1896G>A, rs114317070, rs117803891, rs17185503, rs60341608
A > G
No VIP available CA VA
rs9996584 NC_000004.11:g.75421961A>G, NC_000004.12:g.74556244A>G, NW_003571035.1:g.39752A>G
A > G
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 147


Alternate Names: 
Cancer, Colorectal; Cancers, Colorectal; Carcinoma, Colorectal; Carcinomas, Colorectal; Colorectal Cancer; Colorectal Cancers; Colorectal Carcinoma; Colorectal Carcinomas; Colorectal Neoplasm; Colorectal Tumor; Colorectal Tumors; Neoplasm of large intestine; Neoplasm, Colorectal; Neoplasms, Colorectal; Tumor of large intestine; Tumor, Colorectal; Tumors, Colorectal; Tumour of large intestine
PharmGKB Accession Id: PA446108
External Vocabularies

Curated Information ?

No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available

Curated Information ?

Evidence Drug
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
arsenic trioxide
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
folic acid
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
gemtuzumab ozogamicin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
mycophenolate mofetil
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
peginterferon alfa-2b
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
s 1 (combination)
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
valproic acid
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available

Relationships from National Drug File - Reference Terminology (NDF-RT)

May Treat
No related diseases are available

Publications related to Colorectal Neoplasms: 300

No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacogenetic and ethnicity influence on oxaliplatin therapy for colorectal cancer: a meta-analysis. Pharmacogenomics. 2016. Shahnam Adel, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic predictors of toxicity to platinum based chemotherapy in non-small cell lung cancer patients. Pharmacological research. 2016. Pérez-Ramírez Cristina, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Meta-analysis comparing the efficacy of anti-EGFR monoclonal antibody therapy between KRAS G13D and other KRAS mutant metastatic colorectal cancer tumours. European journal of cancer (Oxford, England : 1990). 2016. Rowland Andrew, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Lethal 5-fluorouracil toxicity in a colorectal patient with severe dihydropyrimidine dehydrogenase (DPD) deficiency. International journal of colorectal disease. 2016. Dhelens Carole, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
High Resectability Rate of Initially Unresectable Colorectal Liver Metastases After UGT1A1-Adapted High-Dose Irinotecan Combined with LV5FU2 and Cetuximab: A Multicenter Phase II Study (ERBIFORT). Annals of surgical oncology. 2016. Phelip Jean Marc, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Improvement of a predictive model in ovarian cancer patients submitted to platinum-based chemotherapy: implications of a GST activity profile. European journal of clinical pharmacology. 2016. Pereira Deolinda, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
DPYD Genotyping to Predict Adverse Events Following Treatment With Flourouracil-Based Adjuvant Chemotherapy in Patients With Stage III Colon Cancer: A Secondary Analysis of the PETACC-8 Randomized Clinical Trial. JAMA oncology. 2016. Boige Valérie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Correlation of UGT1A1(*)28 and (*)6 polymorphisms with irinotecan-induced neutropenia in Thai colorectal cancer patients. Drug metabolism and pharmacokinetics. 2015. Atasilp Chalirmporn, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BRAF in metastatic colorectal cancer: the future starts now. Pharmacogenomics. 2015. Orlandi Armando. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Significant effect of VEGFA polymorphisms on the clinical outcome of metastatic colorectal cancer patients treated with FOLFIRI-cetuximab. Pharmacogenomics. 2015. Rollin Jérôme, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Prognostic utility of molecular factors by age at diagnosis of colorectal cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2015. McCleary Nadine J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Extended RAS Gene Mutation Testing in Metastatic Colorectal Carcinoma to Predict Response to Anti-Epidermal Growth Factor Receptor Monoclonal Antibody Therapy: American Society of Clinical Oncology Provisional Clinical Opinion Update 2015. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2015. Allegra Carmen J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Phase II study of single-agent cetuximab in KRAS G13D mutant metastatic colorectal cancer. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO. 2015. Schirripa M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Beating the odds: efficacy and toxicity of DPD-driven adaptive dosing of 5-FU in patients with digestive cancer. British journal of clinical pharmacology. 2015. Launay Manon, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Cetuximab treatment for metastatic colorectal cancer with KRAS p.G13D mutations improves progression-free survival. Molecular and clinical oncology. 2015. Osumi Hiroki, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ABCC5 and ABCG1 polymorphisms predict irinotecan-induced severe toxicity in metastatic colorectal cancer patients. Pharmacogenetics and genomics. 2015. Chen Sylvia, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
First-in-human, phase I study of elisidepsin (PM02734) administered as a 30-min or as a 3-hour intravenous infusion every three weeks in patients with advanced solid tumors. Investigational new drugs. 2015. Ratain Mark J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Next-Generation Sequencing Panels for the Diagnosis of Colorectal Cancer and Polyposis Syndromes: A Cost-Effectiveness Analysis. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2015. Gallego Carlos J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
DPD and UGT1A1 deficiency in colorectal cancer patients receiving triplet chemotherapy with fluoropyrimidines, oxaliplatin and irinotecan. British journal of clinical pharmacology. 2015. Falvella Felicia Stefania, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of Aspirin and NSAID Use With Risk of Colorectal Cancer According to Genetic Variants. JAMA. 2015. Nan Hongmei, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Fluorouracil, leucovorin, and irinotecan plus cetuximab treatment and RAS mutations in colorectal cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2015. Van Cutsem Eric, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Clinical validation study of genetic markers for capecitabine efficacy in metastatic colorectal cancer patients. Pharmacogenetics and genomics. 2015. van Huis-Tanja Lieke H, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A novel UGT1 marker associated with better tolerance against irinotecan-induced severe neutropenia in metastatic colorectal cancer patients. The pharmacogenomics journal. 2015. Chen S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Germline TYMS genotype is highly predictive in patients with metastatic gastrointestinal malignancies receiving capecitabine-based chemotherapy. Cancer chemotherapy and pharmacology. 2015. Joerger M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genes involved in pericyte-driven tumor maturation predict treatment benefit of first-line FOLFIRI plus bevacizumab in patients with metastatic colorectal cancer. The pharmacogenomics journal. 2015. Volz N B, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Evaluation of association studies and meta-analyses of MTHFR gene polymorphisms in colorectal cancer. Pharmacogenomics. 2015. Haerian Batoul Sadat, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic markers of recurrence in colorectal cancer. Pharmacogenomics. 2015. Smolle Maria Anna, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Molecular biomarkers in colorectal carcinoma. Pharmacogenomics. 2015. Puerta-García Elena, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association between Polymorphisms in Vascular Endothelial Growth Factor Gene and Response to Chemotherapies in Colorectal Cancer: A Meta-Analysis. PloS one. 2015. Wang Lei, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GATA2 rs2335052 Polymorphism Predicts the Survival of Patients with Colorectal Cancer. PloS one. 2015. Liu Xijuan, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genome Wide Association Study for Predictors of Progression Free Survival in Patients on Capecitabine, Oxaliplatin, Bevacizumab and Cetuximab in First-Line Therapy of Metastatic Colorectal Cancer. PloS one. 2015. Pander Jan, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Glutathione S-Transferase Gene Polymorphisms and Treatment Outcome in Cervical Cancer Patients under Concomitant Chemoradiation. PloS one. 2015. Abbas Mohammad, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
HLA-G 3'UTR Polymorphisms Impact the Prognosis of Stage II-III CRC Patients in Fluoropyrimidine-Based Treatment. PloS one. 2015. Garziera Marica, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
A Phase I Study of UGT1A1 * 28/ * 6 Genotype-Directed Dosing of Irinotecan (CPT-11) in Korean Patients with Metastatic Colorectal Cancer Receiving FOLFIRI. Oncology. 2014. Kim Kyu-Pyo, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of the DNA repair pathways in advanced non-small cell lung cancer patients treated with platinum-based chemotherapy. Cancer letters. 2014. Sullivan Ivana, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
MTHFR-1298 A>C (rs1801131) is a predictor of survival in two cohorts of stage II/III colorectal cancer patients treated with adjuvant fluoropyrimidine chemotherapy with or without oxaliplatin. The pharmacogenomics journal. 2014. Cecchin E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
A let-7 microRNA-binding site polymorphism in KRAS predicts improved outcome in patients with metastatic colorectal cancer treated with salvage cetuximab/panitumumab monotherapy. Clinical cancer research : an official journal of the American Association for Cancer Research. 2014. Saridaki Zenia, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Regorafenib (BAY 73-4506): antitumor and antimetastatic activities in preclinical models of colorectal cancer. International journal of cancer. Journal international du cancer. 2014. Schmieder Roberta, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A community-based multicenter trial of pharmacokinetically guided 5-fluorouracil dosing for personalized colorectal cancer therapy. The oncologist. 2014. Patel Jai N, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Prospective study of EGFR intron 1 (CA)n repeats variants as predictors of benefit from cetuximab and irinotecan in chemo-refractory metastatic colorectal cancer (mCRC) patients. The pharmacogenomics journal. 2014. Loupakis F, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variants in the glutathione S-transferase genes and survival in colorectal cancer patients after chemotherapy and differences according to treatment with oxaliplatin. Pharmacogenetics and genomics. 2014. Kap Elisabeth J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic research in partnership with American Indian and Alaska Native communities. Pharmacogenomics. 2014. Woodahl Erica L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
UGT1A1*28 polymorphisms: a potential pharmacological biomarker of irinotecan-based chemotherapies in colorectal cancer. Pharmacogenomics. 2014. Liu Xiang, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
X-ray repair cross-complementing 1 polymorphism and prognosis of platinum-based chemotherapy in gastric and colorectal cancer: a meta-analysis. Journal of gastroenterology and hepatology. 2014. Wu Hongju, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The role of IVS14+1 G > A genotype detection in the dihydropyrimidine dehydrogenase gene and pharmacokinetic monitoring of 5-fluorouracil in the individualized adjustment of 5-fluorouracil for patients with local advanced and metastatic colorectal cancer: a preliminary report. European review for medical and pharmacological sciences. 2014. Cai X, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A candidate gene study of capecitabine-related toxicity in colorectal cancer identifies new toxicity variants at DPYD and a putative role for ENOSF1 rather than TYMS. Gut. 2014. Rosmarin Dan, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genetic Markers of Toxicity From Capecitabine and Other Fluorouracil-Based Regimens: Investigation in the QUASAR2 Study, Systematic Review, and Meta-Analysis. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2014. Rosmarin Dan, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacokinetics, safety, and efficacy of FOLFIRI plus bevacizumab in Japanese colorectal cancer patients with UGT1A1 gene polymorphisms. Journal of clinical pharmacology. 2014. Suenaga Mitsukuni, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of single nucleotide polymorphisms in MTHFR and ABCG2 with the different efficacy of first-line chemotherapy in metastatic colorectal cancer. Medical oncology (Northwood, London, England). 2014. Zhao Jing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Prognostic advantage of irinotecan dose escalation according to uridine diphosphate glucuronosyltransferase 1A1 (UGT1A1) genotyping in patients with metastatic colorectal cancer treated with bevacizumab combined with 5-fluorouracil/leucovorin with irinotecan in a first-line setting. Translational research : the journal of laboratory and clinical medicine. 2014. Lu Chien-Yu, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of DNA repair gene polymorphisms in non-small-cell lung carcinoma patients on platinum-based chemotherapy. Genetics and molecular research : GMR. 2014. Zhang L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Clinical significance of UGT1A1 gene polymorphisms on irinotecan-based regimens as the treatment in metastatic colorectal cancer. OncoTargets and therapy. 2014. Li Minmin, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The involvement of Kras gene 3'-UTR polymorphisms in risk of cancer and influence on patient response to anti-EGFR therapy in metastatic colorectal cancer: a meta-analysis. OncoTargets and therapy. 2014. Ying Hou-Qun, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
ERCC1 Cys8092Ala and XRCC1 Arg399Gln polymorphisms predict progression-free survival after curative radiotherapy for nasopharyngeal carcinoma. PloS one. 2014. Jin Hekun, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic diversity of the KIR/HLA system and outcome of patients with metastatic colorectal cancer treated with chemotherapy. PloS one. 2014. De Re Valli, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Germline variation in colorectal risk Loci does not influence treatment effect or survival in metastatic colorectal cancer. PloS one. 2014. Sanoff Hanna K, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thymidylate synthase genotype-directed chemotherapy for patients with gastric and gastroesophageal junction cancers. PloS one. 2014. Goff Laura W, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Germline Variants and Advanced Colorectal Adenomas: Adenoma Prevention with Celecoxib Trial Genome-wide Association Study. Clinical cancer research : an official journal of the American Association for Cancer Research. 2013. Wang Jiping, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Excision Repair Cross-Complementation group 1 (ERCC1) C118T SNP does not affect cellular response to oxaliplatin. Mutation research. 2013. van Huis-Tanja Lieke H, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetics of ABC and SLC transporters in metastatic colorectal cancer patients receiving first-line FOLFIRI treatment. Pharmacogenetics and genomics. 2013. De Mattia Elena, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Potential of dihydropyrimidine dehydrogenase genotypes in personalizing 5-fluorouracil therapy among colorectal cancer patients. Therapeutic drug monitoring. 2013. Teh Lay Kek, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
S-1 plus irinotecan and oxaliplatin for the first-line treatment of patients with metastatic colorectal cancer: a prospective phase II study and pharmacogenetic analysis. British journal of cancer. 2013. Kim S Y, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphism of TS 3'-UTR predicts survival of Chinese advanced gastric cancer patients receiving first-line capecitabine plus paclitaxel. Clinical & translational oncology : official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico. 2013. Gao J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
PharmGKB summary: very important pharmacogene information for the epidermal growth factor receptor. Pharmacogenetics and genomics. 2013. Hodoglugil Ugur, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Intergenic polymorphisms in the amphiregulin gene region as biomarkers in metastatic colorectal cancer patients treated with anti-EGFR plus irinotecan. The pharmacogenomics journal. 2013. Sebio A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ACMG recommendations for reporting of incidental findings in clinical exome and genome sequencing. Genetics in medicine : official journal of the American College of Medical Genetics. 2013. Green Robert C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Recommendations from the EGAPP Working Group: can testing of tumor tissue for mutations in EGFR pathway downstream effector genes in patients with metastatic colorectal cancer improve health outcomes by guiding decisions regarding anti-EGFR therapy?. Genetics in medicine : official journal of the American College of Medical Genetics. 2013. Evaluation of Genomic Applications in Practice and Prevention (EGAPP) Working Group. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic variants in the DPYD, TYMS, CDA and MTHFR genes are clinically significant predictors of fluoropyrimidine toxicity. British journal of cancer. 2013. Loganayagam A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Impact of genetic polymorphisms on adenoma recurrence and toxicity in a COX2 inhibitor (celecoxib) trial: results from a pilot study. Pharmacogenetics and genomics. 2013. Kraus Sarah, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of ABCB1 genetic polymorphisms with susceptibility to colorectal cancer and therapeutic prognosis. Pharmacogenomics. 2013. Wu Huizhe, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Gender-specific profiling in SCN1A polymorphisms and time-to-recurrence in patients with stage II/III colorectal cancer treated with adjuvant 5-fluoruracil chemotherapy. The pharmacogenomics journal. 2013. Benhaim L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Implications of Genome-Wide Association Studies in Cancer Therapeutics. British journal of clinical pharmacology. 2013. Patel Jai N, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Challenges in pharmacogenetics. European journal of clinical pharmacology. 2013. Cascorbi Ingolf, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic analysis of adjuvant FOLFOX for Korean patients with colon cancer. Cancer chemotherapy and pharmacology. 2013. Lee Kyung-Hun, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Exome Re-Sequencing Identifies Potential Tumor Suppressor Genes that Predispose to Colorectal Cancer. Human mutation. 2013. Smith Christopher G, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Refining the UGT1A haplotype associated with irinotecan-induced hematological toxicity in metastatic colorectal cancer patients treated with 5-fluorouracil/irinotecan-based regimens. The Journal of pharmacology and experimental therapeutics. 2013. Lévesque Eric, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The LCS6 polymorphism in the binding site of let-7 microRNA to the KRAS 3'-untranslated region: its role in the efficacy of anti-EGFR-based therapy in metastatic colorectal cancer patients. Pharmacogenetics and genomics. 2013. Sebio Ana, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Association of UGT1A1*28 polymorphisms with irinotecan-induced toxicities in colorectal cancer: a meta-analysis in Caucasians. The pharmacogenomics journal. 2013. Liu X, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
MTHFR polymorphisms and capecitabine-induced toxicity in patients with metastatic colorectal cancer. Pharmacogenetics and genomics. 2013. van Huis-Tanja Lieke H, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association between KRAS codon 13 mutations and clinical response to anti-EGFR treatment in patients with metastatic colorectal cancer: results from a meta-analysis. Cancer chemotherapy and pharmacology. 2013. Chen Jian, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Role of immunoglobulin G fragment C receptor polymorphism-mediated antibody-dependant cellular cytotoxicity in colorectal cancer treated with cetuximab therapy. The pharmacogenomics journal. 2013. Negri F V, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Influence of KRAS p.G13D mutation in patients with metastatic colorectal cancer treated with cetuximab. Clinical colorectal cancer. 2012. Gajate Pablo, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Clinical outcome of Japanese metastatic colorectal cancer patients harbouring the KRAS p.G13D mutation treated with cetuximab + irinotecan. Japanese journal of clinical oncology. 2012. Bando Hideaki, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A Novel Fully Automated Molecular Diagnostic System (AMDS) for Colorectal Cancer Mutation Detection. PloS one. 2013. Kitano Shiro, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Evaluating predictive pharmacogenetic signatures of adverse events in colorectal cancer patients treated with fluoropyrimidines. PloS one. 2013. Jennings Barbara A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SLCO1B1 and SLC19A1 Gene Variants and Irinotecan-Induced Rapid Response and Survival: A Prospective Multicenter Pharmacogenetics Study of Metastatic Colorectal Cancer. PloS one. 2013. Huang Liu, et al. PubMed
Association of KRAS G13D tumor mutations with outcome in patients with metastatic colorectal cancer treated with first-line chemotherapy with or without cetuximab. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2012. Tejpar Sabine, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A prospective validation pharmacogenomic study in the adjuvant setting of colorectal cancer patients treated with the 5-fluorouracil/leucovorin/oxaliplatin (FOLFOX4) regimen. The pharmacogenomics journal. 2012. Cecchin E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Effect of genetic polymorphisms on therapeutic response and clinical outcomes in pancreatic cancer patients treated with gemcitabine. Pharmacogenomics. 2012. Woo Hye In, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic variants of thiopurine and folate metabolic pathways determine 6-MP-mediated hematological toxicity in childhood ALL. Pharmacogenomics. 2012. Dorababu Patchva, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics and pharmacogenomics: role of mutational analysis in anti-cancer targeted therapy. The pharmacogenomics journal. 2012. Savonarola A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Intratumoral expression profiling of genes involved in angiogenesis in colorectal cancer patients treated with chemotherapy plus the VEGFR inhibitor PTK787/ZK 222584 (vatalanib). The pharmacogenomics journal. 2012. Wilson P M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Multifactorial pharmacogenetic analysis in colorectal cancer patients receiving 5-fluorouracil-based therapy together with cetuximab-irinotecan. British journal of clinical pharmacology. 2012. Etienne-Grimaldi Marie-Christine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Absence of transcriptomic signature of response to chemotherapy in metastatic colorectal carcinoma patients. Pharmacogenomics. 2012. Laroche-Clary Audrey, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association between polymorphisms of ERCC1 and survival in epithelial ovarian cancer patients with chemotherapy. Pharmacogenomics. 2012. Yan Li, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms in key methotrexate pathway genes are associated with response to treatment in rheumatoid arthritis patients. The pharmacogenomics journal. 2012. Owen S A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenomics in colorectal cancer: a genome-wide association study to predict toxicity after 5-fluorouracil or FOLFOX administration. The pharmacogenomics journal. 2012. Fernandez-Rozadilla C, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Impact of SHMT1 polymorphism on the clinical outcome of patients with metastatic colorectal cancer treated with first-line FOLFIRI+bevacizumab. Pharmacogenetics and genomics. 2012. Budai Barna, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Combinatorial therapies to overcome B-RAF inhibitor resistance in melanomas. Pharmacogenomics. 2012. Lo Roger S. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genomic approach towards personalized anticancer drug therapy. Pharmacogenomics. 2012. Midorikawa Yutaka, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenomics of cisplatin-based chemotherapy in ovarian cancer patients of different ethnic origins. Pharmacogenomics. 2012. Khrunin Andrey, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacogenetic profiling of CD133 is associated with response rate (RR) and progression-free survival (PFS) in patients with metastatic colorectal cancer (mCRC), treated with bevacizumab-based chemotherapy. The pharmacogenomics journal. 2012. Pohl A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Development of molecular biomarkers in individualized treatment of colorectal cancer. Clinical colorectal cancer. 2011. De Mattos-Arruda Leticia, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association between DNA-repair polymorphisms and survival in pancreatic cancer patients treated with combination chemotherapy. Pharmacogenomics. 2011. Giovannetti Elisa, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Association of eleven common, low-penetrance colorectal cancer susceptibility genetic variants at six risk Loci with clinical outcome. PloS one. 2012. Hoskins Janelle M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Meta-analysis on pharmacogenetics of platinum-based chemotherapy in non small cell lung cancer (NSCLC) patients. PloS one. 2012. Yin Ji-Ye, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Modeling the 5-fluorouracil area under the curve versus dose relationship to develop a pharmacokinetic dosing algorithm for colorectal cancer patients receiving FOLFOX6. The oncologist. 2012. Kaldate Rajesh R, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic predictors for EGFR-inhibitor-associated skin toxicity. The pharmacogenomics journal. 2011. Parmar S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Potential responders to FOLFOX therapy for colorectal cancer by Random Forests analysis. British journal of cancer. 2011. Tsuji S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Single nucleotide polymorphisms of ABCC5 and ABCG1 transporter genes correlate to irinotecan-associated gastrointestinal toxicity in colorectal cancer patients: A DMET microarray profiling study. Cancer biology & therapy. 2011. Di Martino Maria Teresa, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of Oxaliplatin as Adjuvant Treatment in Colon Carcinoma: Are Single Nucleotide Polymorphisms in GSTP1, ERCC1, and ERCC2 Good Predictive Markers?. Molecular diagnosis & therapy. 2011. Fariña Sarasqueta Arantza, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic analyses of cisplatin-induced nephrotoxicity indicate a renoprotective effect of ERCC1 polymorphisms. Pharmacogenomics. 2011. Tzvetkov Mladen V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Somatic deletions of genes regulating MSH2 protein stability cause DNA mismatch repair deficiency and drug resistance in human leukemia cells. Nature medicine. 2011. Diouf Barthelemy, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The association of polymorphisms in 5-fluorouracil metabolism genes with outcome in adjuvant treatment of colorectal cancer. Pharmacogenomics. 2011. Afzal Shoaib, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thymidylate synthase expression and genotype have no major impact on the clinical outcome of colorectal cancer patients treated with 5-fluorouracil. Pharmacological research : the official journal of the Italian Pharmacological Society. 2011. Vignoli Marina, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Nucleotide excision repair gene variants and association with survival in osteosarcoma patients treated with neoadjuvant chemotherapy. The pharmacogenomics journal. 2011. Biason P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Vascular endothelial growth factor polymorphisms and clinical outcome in colorectal cancer patients treated with irinotecan-based chemotherapy and bevacizumab. The pharmacogenomics journal. 2011. Koutras A K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TS and ERCC-1 mRNA expressions and clinical outcome in patients with metastatic colon cancer in CONFIRM-1 and -2 clinical trials. The pharmacogenomics journal. 2011. Grimminger P P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
A genotype-directed phase I-IV dose-finding study of irinotecan in combination with fluorouracil/leucovorin as first-line treatment in advanced colorectal cancer. British journal of cancer. 2011. Marcuello E, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
EGF61 polymorphism predicts complete pathologic response to cetuximab-based chemoradiation independent of KRAS status in locally advanced rectal cancer patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Hu-Lieskovan Siwen, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
VEGF -460T ¿ C polymorphism and its association with VEGF expression and outcome to FOLFOX-4 treatment in patients with colorectal carcinoma. The pharmacogen