Disease:
Neoplasms

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Gene ? Variant?
(147)
Alternate Names ? Chemicals ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
Translation
No VIP available CA No VIP available CYP2A6 *1A N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *4A N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *4C N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *7 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2A6 *9 N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *9A N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *10 N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *11 N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *18A N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *19 N/A N/A N/A
No VIP available CA No VIP available CYP2B6 *1 N/A N/A N/A
No VIP available CA No VIP available CYP2B6 *6 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C19 *1 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C19 *2A N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C19 *2B N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C19 *17 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C9 *1 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C9 *2 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C9 *3 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *1 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *1xN N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *2 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *3 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *4 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *6 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *10 N/A N/A N/A
No VIP available No VIP available No VIP available CYP3A4 *1A N/A N/A N/A
No VIP available No VIP available No VIP available CYP3A4 *1B N/A N/A N/A
No VIP available CA No VIP available CYP3A5 *1A N/A N/A N/A
No VIP available CA No VIP available CYP3A5 *3A N/A N/A N/A
No VIP available No VIP available No VIP available CYP3A5 *3C N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *1 N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *2A N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *4 N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *5 N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *6 N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *9A N/A N/A N/A
No VIP available No VIP available No VIP available G6PD Mediterranean, Dallas, Panama' Sassari, Cagliari, Birmingham N/A N/A N/A
No VIP available No VIP available No VIP available GSTM1 non-null N/A N/A N/A
No VIP available CA No VIP available GSTT1 non-null N/A N/A N/A
No VIP available CA No VIP available GSTT1 null N/A N/A N/A
No VIP available No VIP available No VIP available HLA-A *02:01 N/A N/A N/A
No VIP available No VIP available No VIP available HLA-A *03:01:01:01 N/A N/A N/A
No VIP available No VIP available No VIP available PIK3CA H4 N/A N/A N/A
No VIP available No VIP available No VIP available PIK3CA H5 N/A N/A N/A
No VIP available No VIP available No VIP available SLCO1B1 *1 N/A N/A N/A
No VIP available No VIP available No VIP available SLCO1B1 *15 N/A N/A N/A
No VIP available No VIP available VA TPMT *1 N/A N/A N/A
No VIP available No VIP available VA TPMT *3A N/A N/A N/A
No VIP available No VIP available VA TPMT *3C N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *1 N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *6 N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *28 N/A N/A N/A
No VIP available CA No VIP available UGT1A1 *60 N/A N/A N/A
No VIP available No Clinical Annotations available DPYD deficiency
DPYD deficiency N/A N/A N/A
No VIP available No Clinical Annotations available VA
G6PD deficiency N/A N/A N/A
No VIP available No Clinical Annotations available VA
rs10144771 16036T>C, 613+1720T>C, 75778653A>G, 94778653A>G
A > G
Intronic
No VIP available No Clinical Annotations available VA
rs10413396 17081920G>T, 44813702G>T
G > T
Not Available
No VIP available CA No Variant Annotations available
rs1042522 -278-661C>G, 16397C>G, 215C>G, 7182846G>C, 7579472G>C, 98C>G, P53:Arg72Pro, Pro33Arg, Pro72Arg, R72P, TP53 Arg72Pro, mRNA 412C>G, p.Pro72Arg, p52 codon 72
G > C
5' Flanking
Pro33Arg
No VIP available No Clinical Annotations available VA
rs1042597 234526871C>G, 234526871C>T, 33482C>G, 33482C>T, 473130C>G, 473130C>T, 518C>G, 518C>T, Ala173Gly, Ala173Val, UGT1A8*2
C > G
C > T
Missense
Ala173Val
Ala173Gly
No VIP available No Clinical Annotations available VA
rs1042605 234527118A>G, 33729A>G, 473377A>G, 765A>G, Thr255=, UGT1A8*1
A > G
Synonymous
Thr255Thr
No VIP available CA VA
rs10426377 21360452C>A, 378+1540C>A, 41806C>A, 423+1540C>A, 49092234C>A
C > A
Intronic
No VIP available No Clinical Annotations available VA
rs10426628 21360648A>G, 378+1736A>G, 42002A>G, 423+1736A>G, 49092430A>G
A > G
Intronic
No VIP available CA VA
rs1044457 *360C>T, 1119C>T, 17814695C>T, 47842777C>T
C > T
Not Available
No VIP available CA VA
rs1045642 208920T>A, 208920T>C, 25171488A>G, 25171488A>T, 3435T>A, 3435T>C, 87138645A>G, 87138645A>T, ABCB1*6, ABCB1: 3435C>T, ABCB1: C3435T, ABCB1: c.3435C>T, ABCB1:3435C>T, Ile1145=, Ile1145Ile, MDR1 3435C>T, MDR1 C3435T, PGP C3435T, c.3435C>T, mRNA 3853C>T
A > T
A > G
Synonymous
Ile1145Ile
No VIP available CA VA
rs1048977 20618562C>T, 20945055C>T, 435C>T, CDA:435C>T, T145T, Thr145=, mRNA 614C>T
C > T
Synonymous
Thr145Thr
No VIP available No Clinical Annotations available VA
rs10497346 101313T>C, 169771196T>C, 19980614T>C
T > C
Not Available
No VIP available CA VA
rs1051640 14042638A>G, 4509A>G, 48768486A>G, Glu1503=
A > G
Synonymous
Glu1503Glu
No VIP available CA VA
rs1056892 23180577G>A, 37518706G>A, 730G>A, 93-53C>T, CBR3 730G>A, CBR3 V244M, CBR3:Val244Met, Val244Met
G > A
Intronic
Val244Met
No VIP available No Clinical Annotations available VA
rs1058930 16136C>G, 47622583G>C, 486C>G, 582C>G, 792C>G, 96818119G>C, C792G, CYP2C8: I264M, Ile162Met, Ile194Met, Ile264Met
G > C
Missense
Ile194Met
No VIP available CA No Variant Annotations available
rs1060896 16344824C>A, 225A>C, 225C>A, 45554267C>A, R75S, SLC28A2:283A>C, Ser75Arg, mRNA 284A>C
C > A
Missense
Ser75Arg
No VIP available No Clinical Annotations available VA
rs10815019 232+2581A>G, 4537288A>G, 4547288A>G, 61862A>G
A > G
Intronic
No VIP available No Clinical Annotations available VA
rs10841661 13744956C>T, 20984832C>T, 26195C>T, 84+16076C>T
C > T
Intronic
No VIP available No Clinical Annotations available VA
rs10929302 -1791C>T, 172393G>A, 234665782G>A, 61-9898G>A, 612041G>A, 856-9898G>A, 862-9898G>A, 868-9898G>A, UGT1A1*93, UGT1A1:-3156G>A, UGT1A1:G-3156A
G > A
5' Flanking
No VIP available No Clinical Annotations available VA
rs10931910 201523736A>G, 3172-152A>G, 51733154A>G
A > G
Intronic
No VIP available No Clinical Annotations available VA
rs11022922 17975C>T, 2419195C>T, 2479195C>T, 386+12481C>T
C > T
Intronic
No VIP available CA VA
rs11045585 13805818A>G, 1683-5676A>G, 21045694A>G, 87057A>G
A > G
Intronic
No VIP available No Clinical Annotations available VA
rs11046217 14777281G>C, 22017157G>C, 2237+216C>G, 77472C>G
G > C
Intronic
No VIP available No Clinical Annotations available VA
rs11075646 -171C>G, -850G>C, -909G>C, 20583375C>G, 66969176C>G, 803C>G
C > G
Not Available
No VIP available No Clinical Annotations available VA
rs1113129 23210C>G, 47615509G>C, 514-5337C>G, 610-5337C>G, 820-5337C>G, 96811045G>C, CYP2C8-HapC, Haplotype low act, rs1113129 G>C
G > C
Intronic
No VIP available CA VA
rs11141915 128039A>C, 19400326A>C, 284+15704A>C, 90235794A>C
A > C
Intronic
No VIP available CA No Variant Annotations available
rs11211524 172-5414A>C, 172-928A>C, 17805131A>C, 321-928A>C, 47833213A>C
A > C
Intronic
No VIP available CA VA
rs1128503 1236T>C, 167964T>C, 87179601A>G, 87550285A>G, ABCB1 1236C>T, ABCB1*8, ABCB1: c.1236T>C, ABCB1:1236C>T, ABCB1:1236T>C, Gly412=, Gly412Gly, mRNA 1654T>C, p.Gly412Gly
A > G
Synonymous
Gly412Gly
No VIP available CA No Variant Annotations available
rs1138272 12659374C>T, 341C>T, 67353579C>T, 7514C>T, A114V, Ala114Val, GSTP1: A114V, GSTP1: C341T
C > T
Missense
Ala114Val
No VIP available CA VA
rs1142345 18070918T>C, 18130918T>C, 29457A>G, 719A>G, TPMT*3C, Tyr240Cys
T > C
Missense
Tyr240Cys
No VIP available CA No Variant Annotations available
rs11479 -14+194C>A, -14+194C>G, -14+194C>T, -14+439C>A, -14+439C>G, -14+439C>T, -349C>A, -349C>G, -349C>T, -379C>A, -379C>G, -379C>T, 1412C>A, 1412C>G, 1412C>T, 1427C>A, 1427C>G, 1427C>T, 22592G>A, 22592G>C, 22592G>T, 50525807G>A, 50525807G>C, 50525807G>T, 50964236G>A, 50964236G>C, 50964236G>T, 5633C>A, 5633C>G, 5633C>T, 9279C>A, 9279C>G, 9279C>T, Ser471Leu, Ser471Ter, Ser471Trp, Ser476Leu, Ser476Ter, Ser476Trp
G > A
G > T
G > C
5' Flanking
Ser471Trp
Ser471Leu
Ser471null
No VIP available No Clinical Annotations available VA
rs1149222 1119+403C>A, 25106618G>T, 40974C>A, 87073775G>T
G > T
Intronic
No VIP available CA No Variant Annotations available
rs115232898 226586A>G, 557A>G, 68136948T>C, 98165030T>C, Tyr186Cys, Y186C, c.557A>G
T > C
Missense
Tyr186Cys
No VIP available No Clinical Annotations available VA
rs11572080 110G>A, 206G>A, 416G>A, 47631494C>T, 7225G>A, 96827030C>T, Arg139Lys, Arg37Lys, Arg69Lys, CYP2C8*3, CYP2C8: R139K, G416A, R139K, rs11572080 G>A
C > T
Missense
Arg69Lys
No VIP available No Clinical Annotations available VA
rs11572103 16149A>T, 47622570T>A, 499A>T, 595A>T, 805A>T, 96818106T>A, A805T, CYP2C8*2, CYP2C8: I269F, Ile167Phe, Ile199Phe, Ile269Phe
T > A
Missense
Ile199Phe
No VIP available CA VA
rs11598702 104897985T>C, 175+1178A>G, 55702449T>C
T > C
Intronic
No VIP available CA VA
rs11615 18191871A>G, 354T>C, 45923653A>G, 63434T>C, Asn118=, ERCC1:19007T>C, ERCC1:Asn118Asn
A > G
Synonymous
Asn118Asn
No VIP available No Clinical Annotations available VA
rs11692021 234591205T>C, 537464T>C, 622T>C, 855+45182T>C, 855+63997T>C, 855+9770T>C, 97816T>C, Trp208Arg
T > C
Intronic
Trp208Arg
No VIP available CA VA
rs11719165 194586088T>C, 538837T>C
T > C
Not Available
No VIP available CA VA
rs12046844 36210297G>A, 66238379G>A
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs12059276 110273541C>T, 80245459C>T
C > T
Not Available
No VIP available No Clinical Annotations available VA
rs1214763 43300261T>C, 43360261T>C
T > C
Not Available
No VIP available CA VA
rs12201199 18079802A>T, 18139802A>T, 20573T>A, 419+94T>A, TPMT:rs12201199 A/T
A > T
Intronic
No VIP available No Clinical Annotations available VA
rs12211463 31586992T>G, 93467158T>G
T > G
Not Available
No VIP available No Clinical Annotations available VA
rs12468274 134525T>C, 234627914T>C, 448T>C, 574173T>C, 60+25403T>C, 855+36476T>C, 855+46479T>C, 856-47766T>C, 861+25403T>C, 867+5410T>C, Leu150=
T > C
Intronic
Leu150Leu
No VIP available No Clinical Annotations available VA
rs12658397 10065525T>C, 101751653T>C, 1473-2806A>G
T > C
Intronic
No VIP available CA No Variant Annotations available
rs12721627 20716C>G, 37398936G>C, 554C>G, 99366093G>C, CYP3A4*16, CYP3A4*16A, CYP3A4:185 Thr>Ser, CYP3A4:554C>G, CYP3A4:658 C>G, CYP3A4:T185S, CYP3A4:Thr185Ser, Thr185Ser
G > C
Missense
Thr185Ser
No VIP available No Clinical Annotations available VA
rs12762549 101620771C>G, 52425235C>G
C > G
Not Available
No VIP available CA VA
rs12948783 -2185C>A, -2185C>T, 3110C>A, 3110C>T, 39773552G>A, 39773552G>T, 74499400G>A, 74499400G>T
G > A
G > T
5' Flanking
No VIP available No Clinical Annotations available VA
rs13401281 135290T>G, 234628679T>G, 574938T>G, 60+26168T>G, 855+37241T>G, 856-47001T>G, 861+26168T>G, 867+346T>G, 867+6175T>G
T > G
Intronic
No VIP available No Clinical Annotations available VA
rs13422094 1003001T>C, 22181114T>C
T > C
Not Available
No VIP available No Clinical Annotations available VA
rs1523127 -131C>A, -566C>A, 119501039C>A, 25996185C>A, 6709C>A
C > A
5' Flanking
No VIP available No Clinical Annotations available VA
rs1523130 -1663T>C, 119499507T>C, 25994653T>C, 5177T>C
T > C
5' UTR
No VIP available No Clinical Annotations available VA
rs1551285 234529122A>C, 35733A>C, 475381A>C, 855+1914A>C
A > C
Intronic
No VIP available No Clinical Annotations available VA
rs1617640 -1306C>A, 100317298C>A, 38350141C>A, 3876C>A
C > A
5' Flanking
No VIP available No Clinical Annotations available VA
rs165728 *764C>T, *877+379G>A, 19957023C>T, 3109173C>T, 32761C>T, 52287G>A
C > T
3' UTR
No VIP available CA No Variant Annotations available
rs1695 12658484A>G, 313A>G, 6624A>G, 67352689A>G, GSTP1*2, GSTP1*B, GSTP1: I105V, GSTP1:A313G, GSTP1:I105V, GSTP1:Ile105Val, Ile105Val, Part of haplotypes GSTP1*B and GSTP1*C, rs1695:A>G
A > G
Missense
Ile105Val
No VIP available No Clinical Annotations available VA
rs17216177 -34T>C, 101603522T>C, 3742-34T>C, 52407986T>C, 66060T>C
T > C
Intronic
No VIP available No Clinical Annotations available VA
rs17287570 116670A>C, 16095103A>C, 16155103A>C, 1677+4951A>C
A > C
Intronic
No VIP available CA VA
rs1736557 171080080G>A, 22568722G>A, 25063G>A, 769G>A, Val257Met
G > A
Missense
Val257Met
No VIP available CA VA
rs17376848 1896T>C, 475992T>C, 67887542A>G, 97915624A>G, Phe632=, Phe632Phe
A > G
Synonymous
Phe632Phe
No VIP available No Clinical Annotations available VA
rs174699 19954458C>T, 30196C>T, 3106608C>T, 466-1601C>T, 616-1601C>T
C > T
Intronic
No VIP available CA VA
rs17583889 138746039C>A, 191-12449C>A, 28494702C>A, 29232C>A
C > A
Intronic
No VIP available No Clinical Annotations available VA
rs17645700 138780932T>C, 28529595T>C
T > C
Not Available
No VIP available No Clinical Annotations available VA
rs17822471 1637C>T, 1856578G>A, 31710C>T, 48242379G>A, Thr546Met
G > A
Missense
Thr546Met
No VIP available No Clinical Annotations available VA
rs17822931 15891G>A, 1872397C>T, 48258198C>T, 538G>A, Gly180Arg
G > T
G > C
Missense
Gly180Arg
No VIP available No Clinical Annotations available VA
rs17863783 -7-168G>T, 108888G>T, 234602277G>T, 548536G>T, 627G>T, 855+10839G>T, 855+20842G>T, 855+56254G>T, 856-73403G>T, Val209=
G > T
Intronic
Val209Val
No VIP available CA VA
rs17868320 234578428C>T, 524687C>T, 85039C>T, 855+32405C>T, 855+51220C>T
C > T
Intronic
No VIP available No Clinical Annotations available VA
rs17868323 234590970T>G, 387T>G, 537229T>G, 855+44947T>G, 855+63762T>G, 855+9535T>G, 97581T>G, Asn129Lys, UGT1A7:N129K, rs17868323
T > G
Intronic
Asn129Lys
No VIP available No Clinical Annotations available VA
rs1799782 16325792G>A, 44057574G>A, 580C>T, Arg194Trp
G > A
Missense
Arg194Trp
No VIP available CA No Variant Annotations available
rs1799793 11587G>A, 18135477C>T, 45867259C>T, 862G>A, 934G>A, Asp288Asn, Asp312Asn, XPD Asp312Asn, XPD:Asp312Asn
C > T
Missense
Asp288Asn
No VIP available No Clinical Annotations available VA
rs1799971 -11+28644A>G, 118A>G, 154360797A>G, 34162A>G, 397A>G, 47+29103A>G, 58530254A>G, Asn133Asp, Asn40Asp, OPRM1: A118G
A > G
Missense
Asn40Asp
No VIP available CA No Variant Annotations available
rs1799983 11291734T>G, 12965T>G, 150696111T>G, 894T>G, Asp298Glu, NOS3:894G>T
T > G
Missense
Asp298Glu
No VIP available CA VA
rs1800460 18079228C>T, 18139228C>T, 21147G>A, 460G>A, Ala154Thr, TPMT*3B
C > T
Missense
Ala154Thr
No VIP available CA No Variant Annotations available
rs1800566 20389C>T, 23359344G>A, 445C>T, 457C>T, 559C>T, 69745145G>A, NQO1*2, NQO1:C609T, NQO1:P187S, NQO1:c.558C>T, Pro149Ser, Pro153Ser, Pro187Ser, rs1800566 C>T
G > A
Missense
Pro149Ser
No VIP available No Clinical Annotations available VA
rs1801030 22382G>A, 28606164C>T, 28617485C>T, 433G>A, 667G>A, SULT1A1*3, SULT1A1:667A>G, SULT1A1:Met223Val, Val145Met, Val223Met
C > T
Missense
Val145Met
No VIP available CA VA
rs1801131 1040A>C, 11208431T>G, 11794419T>G, 1286A>C, 1409A>C, 16685A>C, A1298C, Glu347Ala, Glu429Ala, Glu470Ala, MTHFR:1298A>C
T > G
Not Available
Glu347Ala
No VIP available CA VA
rs1801133 11210333G>A, 11796321G>A, 14783C>T, 419C>T, 665C>T, 677C>T, 788C>T, A222V, Ala140Val, Ala222Val, Ala263Val, C677T, MTHFR: c.677C>T, MTHFR:667C>T, p.A222V
G > A
Not Available
Ala140Val
No VIP available CA VA
rs1801158 1490G>A, 1524+33695G>A, 1601G>A, 410195G>A, 97515865C>T, 97981421C>T, Ser497Asn, Ser534Asn
C > T
Not Available
Ser534Asn
No VIP available CA VA
rs1801159 1516A>G, 1524+33721A>G, 1627A>G, 410221A>G, 97515839T>C, 97981395T>C, DPYD*5, DPYD:A1627G, DPYD:I543V, Ile506Val, Ile543Val
T > C
Missense
Ile543Val
No VIP available CA VA
rs1801160 129-825C>T, 2194G>A, 620696G>A, 67742838C>T, 97770920C>T, Val732Ile
C > T
Missense
Val732Ile
No VIP available CA VA
rs1801265 39+37555C>T, 39+37555T>C, 42731T=, 42731T>C, 85C=, 85C>T, 85T=, 85T>C, 97883329A=, 97883329A>G, 98348885G=, 98348885G>A, Arg29=, Arg29Cys, Cys29=, Cys29Arg, DPYD*9A, DPYD:C29R, DYPD:T85C
A > G
Missense
Cys29Arg
No VIP available CA VA
rs183205964 *34+185C>G, -86G>C, 5054G>C, 647657G>C, 657657G>C
G > C
5' UTR
No VIP available CA No Variant Annotations available
rs183484 30209C>A, 4081132C>A, 4141132C>A, 850C>A, Arg284=
C > A
Synonymous
Arg284Arg
No VIP available No Clinical Annotations available VA
rs1885301 -1358A>G, -1360A>G, -1549A>G, -1549G>A, 101541053A>G, 3591A>G, 99781296A>G
A > G
5' Flanking
No VIP available CA VA
rs1901440 134437959C>A, 24186622C>A
C > A
Not Available
No VIP available No Clinical Annotations available VA
rs2010963 -634C>G, -94C>G, 43678350C>G, 43738350C>G, 5398C>G, VEGF-A 405 G/C, VEGFA:405G>C, VEGFA:C405G
C > G
5' UTR
No VIP available No Clinical Annotations available VA
rs2011404 1022+25426T>C, 1022+25426T>G, 134548T>C, 134548T>G, 233719291T>C, 233719291T>G, 234627937T>C, 234627937T>G, 471T>C, 471T>G, 527T>C, 527T>G, 60+25426T>C, 60+25426T>G, 855+36499T>C, 855+36499T>G, 855+46502T>C, 855+46502T>G, 856-47743T>C, 856-47743T>G, 861+25426T>C, 861+25426T>G, 867+5433T>C, 867+5433T>G, 941+46502T>C, 941+46502T>G, Cys157=, Cys157Trp
T > G
T > C
Intronic
Cys157Cys
Cys157Trp
No VIP available No Clinical Annotations available VA
rs2019604 1176382T>G, 1664-1137T>G, 45961T>G, 89615765T>G
T > G
Intronic
No VIP available No Clinical Annotations available VA
rs2020870 107A>G, 171154959A>G, 22643601A>G, Asp36Gly
A > G
Missense
Asp36Gly
No VIP available No Clinical Annotations available VA
rs2032582 186947T>A, 186947T>G, 2677A, 2677G, 2677T, 2677T>A, 2677T>G, 3095G>T/A, 87160618A>C, 87160618A>T, 87531302A>C, 87531302A>T, 893 Ala, 893 Ser, 893 Thr, ABCB1*7, ABCB1: 2677G>T/A, ABCB1: 2677T/A>G, ABCB1: A893S, ABCB1: G2677T/A, ABCB1: c.2677G>T/A, ABCB1:2677G>A/T, ABCB1:2677G>T/A, ABCB1:A893T, Ala893Ser/Thr, MDR1, MDR1 G2677T/A, Ser893Ala, Ser893Thr, mRNA 3095G>T/A, p.Ala893Ser/Thr
A > T
A > C
Missense
Ser893Ala
Ser893Thr
No VIP available No Clinical Annotations available VA
rs2070474 -80C>G, 1-509G>C, 24891292C>G, 4281861C>G, 5042C>G
C > G
5' UTR
No VIP available No Clinical Annotations available VA
rs2072671 20589208A>C, 20915701A>C, 79A>C, CDA: c.79A>C, CDA:79A>C, K27Q, Lys27Gln, p.Lys27Gln
A > C
Missense
Lys27Gln
No VIP available CA VA
rs2075252 12280A>G, 170010985T>C, 20220403T>C, 213138A>G, Lys4094Glu
T > C
Missense
Lys4094Glu
No VIP available No Clinical Annotations available VA
rs2075507 -1420G>A, 103+1132C>T, 19928092G>A, 3080242G>A, 3830G>A, 6268C>T
G > A
Intronic
No VIP available No Clinical Annotations available VA
rs2180314 15631G>C, 335G>C, 52557731C>G, 52617731C>G, Ser112Thr
C > G
Missense
Ser112Thr
No VIP available CA No Variant Annotations available
rs2207396 1369+123G>A, 152382382G>A, 375752G>A, 56551839G>A
G > A
Intronic
No VIP available CA VA
rs2227983 147531G>A, 147531G>C, 147531G>T, 1562G>A, 1562G>C, 1562G>T, 4818624G>A, 4818624G>C, 4818624G>T, 55229255G>A, 55229255G>C, 55229255G>T, Arg521Lys, Arg521Met, Arg521Thr, EGFR: 497G/A, EGFR:1562G>A, EGFR:R497K, R497K, R521K
G > A
G > T
G > C
Missense
Arg521Thr
Arg521Lys
Arg521Met
No VIP available CA No Variant Annotations available
rs2228001 14127449G>T, 14187449G>T, 2704C>A, 2795C>A, 2815C>A, 37724C>A, Gln902Lys, Gln939Lys, XPC Lys939Gln, XPC:Lys939Gln, rs2228001:A>C
G > T
Not Available
Gln902Lys
No VIP available No Clinical Annotations available VA
rs2228100 13795C>G, 19246326G>C, 19642952G>C, 985C>G, ALDH3A1*2, C985G, Pro329Ala
G > C
Missense
Pro329Ala
No VIP available No Clinical Annotations available VA
rs2228171 170053505C>A, 170053505C>G, 170053505C>T, 170618G>A, 170618G>C, 170618G>T, 20262923C>A, 20262923C>G, 20262923C>T, 8614G>A, 8614G>C, 8614G>T, Ala2872Pro, Ala2872Ser, Ala2872Thr
C > G
C > T
C > A
Missense
Ala2872Ser
Ala2872Pro
Ala2872Thr
No VIP available CA VA
rs2229774 1064C>T, 1214C>T, 1247C>T, 1280C>T, 15748851G>A, 25496C>T, 53605545G>A, 917C>T, Ser306Leu, Ser355Leu, Ser405Leu, Ser416Leu, Ser427Leu
C > G
C > A
Missense
Ser405Leu
No VIP available CA VA
rs2231142 13600044G>T, 32689C>A, 421C>A, 89052323G>T, ABCG2: Q141K, ABCG2:421C>A, ABCG2:Q141K, ABCG2:c.421C>A, Gln141Lys, rs2231142
G > T
Missense
Gln141Lys
No VIP available No Clinical Annotations available VA
rs2232228 22757776A>G, 279A>G, 69143577A>G, Ala93=
A > G
Synonymous
Ala93Ala
No VIP available No Clinical Annotations available VA
rs2233302 11578025C>G, 1362+45G>C, 150415098C>G, 1521+45G>C, 57124G>C
C > G
Intronic
No VIP available CA No Variant Annotations available
rs2234693 152163335T>C, 156705T>C, 453-397T>C, 56332792T>C, ESR1:PvuII, ESR1:c.454-397T>C, ESR1:rs2234693
T > C
Intronic
No VIP available No Clinical Annotations available VA
rs2235047 209033T>G, 25171375A>C, 3489+59T>G, 87138532A>C
A > C
Intronic
No VIP available No Clinical Annotations available VA
rs2236168 10429015T>C, 31607128T>C, 35484A>G, 794-415A>G
T > C
Intronic
No VIP available No Clinical Annotations available VA
rs2239393 -848A>G, 139+90A>G, 19950428A>G, 26166A>G, 289+90A>G, 3102578A>G
A > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs2273697 101563815G>A, 1249G>A, 1438G>A, 1440G>A, 26353G>A, 553G>A, 99804058G>A, ABCC2: c.1249G>A, ABCC2:1249G>A, ABCC2:V417I, ABCC2:c.1249G>A, Val185Ile, Val417Ile, p.V417I
G > A
Not Available
Val417Ile
No VIP available No Clinical Annotations available VA
rs2290271 413162A>C, 603+166A>C, 85447635A>C
A > C
Intronic
No VIP available CA VA
rs2291767 -214A>G, 241080132T>C, 271000T>C
T > C
5' Flanking
No VIP available No Clinical Annotations available VA
rs2293348 185033C>T, 2848+201C>T, 4856126C>T, 55266757C>T
C > T
Intronic
No VIP available No Clinical Annotations available VA
rs2294950 1132-249T>G, 30286414T>G, 60314496T>G
T > G
Not Available
No VIP available CA VA
rs2297480 -1-373T>G, -1-98T>G, -175+726T>G, -22-352T>G, 155279482T>G, 6768124T>G
T > G
Intronic
No VIP available CA VA
rs2297595 226525A>G, 496A>G, 68137009T>C, 98165091T>C, DPYD:496A>G, DPYD:Met166Val, Met166Val
T > C
Missense
Met166Val
No VIP available No Clinical Annotations available VA
rs2305364 417802T>C, 795+249T>C, 85452275T>C
T > C
Intronic
No VIP available No Clinical Annotations available VA
rs2306283 14089862A>G, 21329738A>G, 388A>G, 50611A>G, Asn130Asp, SLCO1B1*1B
A > G
Missense
Asn130Asp
No VIP available No Clinical Annotations available VA
rs2473967 113479335G>T, 17648792G>T
G > T
Not Available
No VIP available CA No Variant Annotations available
rs25487 1196A>G, 16323944T>C, 44055726T>C, Gln399Arg, XRCC1 Arg399Gln, XRCC1:Arg399Gln
T > C
Missense
Gln399Arg
No VIP available No Clinical Annotations available VA
rs25489 16324630C>T, 44056412C>T, 839G>A, Arg280His
C > T
Missense
Arg280His
No VIP available No Clinical Annotations available VA
rs2600834 101605641T>C, 802+687A>G, 9919513T>C
T > C
Intronic
No VIP available No Clinical Annotations available VA
rs2622604 -19-17758A>G, -20+614A>G, 13626645T>C, 6088A>G, 89078924T>C, ABCG2 SNP in intron 1, rs2622604 C>T
T > C
Intronic
No VIP available No Clinical Annotations available VA
rs2669429 105463690A>G, 18737239A>G, 20588T>C, 265-58T>C
A > G
Intronic
No VIP available CA VA
rs2740574 -392G>A, 4713G>A, 5'-flanking region -392A>G, 99382096C>T, 99784473C>T, CYP3A4*1B, CYP3A4-V, CYP3A4:-392A>G
C > T
5' Flanking
No VIP available No Clinical Annotations available VA
rs2804402 -1019A>G, 101541583A>G, 4121A>G, 52346047A>G, ABCC2: ¿1019a>G
A > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs2884129 17525149T>G, 17585149T>G
T > G
Not Available
No VIP available CA VA
rs316019 160670282A>C, 64839739A>C, 808T>G, SLC22A2: A270S, SLC22A2: Ala270Ser, Ser270Ala
A > C
Missense
Ser270Ala
No VIP available CA VA
rs3212986 *197G>T, 1510C>A, 18180954C>A, 45912736C>A, 74351G>T, ERCC1 C8092A, ERCC1:8090C>A, ERCC1:8092C>A, Gln504Lys
C > A
3' UTR
Gln504Lys
No VIP available CA VA
rs3215400 -33delC, 20589097delC, 20915590delC
C > -
5' UTR
No VIP available CA VA
rs34489327 *145-370delT, *145-370delTinsCTTTAA, *449delA, *449delAinsTTAAAG, *859delT, *859delTinsCTTTAA, 20843delA, 20843delAinsTTAAAG, 6-basepair 3'UTR repeat, 663446delA, 663446delAinsTTAAAG, 673446delA, 673446delAinsTTAAAG, TYMS:-TTAAAG, TYMS:1494del, TYMS:1494del TTAAAG, ttaaag
T > -
T > TTAAAG
3' UTR
No VIP available CA VA
rs34743033 28-bp tandem repeats, CCGCGCCACTTGGCCTGCCTCCGTCCCG, TSER*2, TSER*3, TYMS: 28 bp tandem repeat, TYMS: 2R, TYMS: TSER *2/*3, TYMS:TSER 28-basepair 5'UTR enhancer region repeat
CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC > CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC
CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC > CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC
CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC > CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC
Not Available
No VIP available CA VA
rs35599367 20493C>T, 37399159G>A, 522-191C>T, 99366316G>A, CYP3A4*22
G > A
Intronic
No VIP available No Clinical Annotations available VA
rs3730089 -232-248G>A, 168G>A, 18182507G>A, 67588148G>A, 78G>A, 81565G>A, 978G>A, Met26Ile, Met326Ile, Met56Ile
G > A
Missense
Met326Ile
No VIP available No Clinical Annotations available VA
rs3740066 101604207C>T, 3972C>T, 52408671C>T, 66745C>T, ABCC2:3972C>T, I1324I, Ile1324=
C > T
Synonymous
Ile1324Ile
No VIP available CA VA
rs3750117 240T>C, 276T>C, 33050946A>G, 33060946A>G, 393T>C, 46464T>C, Tyr131=, Tyr80=, Tyr92=
A > G
Synonymous
Tyr80Tyr
No VIP available No Clinical Annotations available VA
rs3755319 -1352A>C, 174193A>C, 234667582A>C, 61-8098A>C, 613841A>C, 856-8098A>C, 862-8098A>C, 868-8098A>C, UGT1A1(-1352)A>C
A > C
Intronic
No VIP available No Clinical Annotations available VA
rs3760091 -36+452G>A, -36+452G>C, -425G>A, -425G>C, -5+452G>A, -5+452G>C, -624G>A, -624G>C, 139-2402G>A, 139-2402G>C, 19067G>A, 19067G>C, 28560800C>G, 28560800C>T, 28620800C>G, 28620800C>T, SULT1A1: -624G>C
C > G
C > T
5' Flanking
No VIP available No Clinical Annotations available VA
rs3813627 -1788C>A, -1828G>T, -914G>T, 12683790G>T, 161195148G>T, 3271C>A
G > T
5' Flanking
No VIP available No Clinical Annotations available VA
rs3813628 -114A>C, -810A>C, 12684808A>C, 161196166A>C, 2253T>G
A > C
5' UTR
No VIP available No Clinical Annotations available VA
rs3887137 107698612C>T, 36863144C>T
C > T
Not Available
No VIP available CA VA
rs3918290 1905+1G>A, 476002G>A, 67887532C>T, 97915614C>T, DPYD*2A, DPYD:67887533 G>A, DPYD:IVS14 + 1G>A
C > T
Donor
No VIP available No Clinical Annotations available VA
rs3918305 109331162C>T, 71474468C>T
C > T
Not Available
No VIP available CA VA
rs4124874 -1668A>C, 172270T>G, 234665659T>G, 61-10021T>G, 611918T>G, 856-10021T>G, 862-10021T>G, 868-10021T>G, UGT1A1*60, UGT1A1:-3263T>G, UGT1A1:-3279T>G
T > G
5' Flanking
No VIP available CA VA
rs4148323 175755G>A, 211G>A, 234669144G>A, 61-6536G>A, 615403G>A, 856-6536G>A, 862-6536G>A, 868-6536G>A, Gly71Arg, UGT1A1*6, UGT1A1: G71R, UGT1A1:211G>A, UGT1A1:G211A, UGT1A1:Gly71Arg
G > A
Intronic
Gly71Arg
No VIP available No Clinical Annotations available VA
rs4148350 132044G>T, 16110477G>T, 16170477G>T, 1988+219G>T
G > T
Intronic
No VIP available No Clinical Annotations available VA
rs4148808 -852A>G, 25138638T>C, 87105795T>C, 8954A>G
T > C
5' Flanking
No VIP available CA VA
rs4149056 14091673T>C, 21331549T>C, 521T>C, 52422T>C, SLCO1B1*5, Val174Ala
T > C
Missense
Val174Ala
No VIP available No Clinical Annotations available VA
rs4149117 13771604T>G, 21011480T>G, 334T>G, 52843T>G, SCLO1B3: exon 4 c.334T>G, Ser112Ala, mRNA 460T>G, p.Ser112Ala
T > G
Missense
Ser112Ala
No VIP available No Clinical Annotations available VA
rs4149178 43212188A>G, 43272188A>G
A > G
Not Available
No VIP available No Clinical Annotations available VA
rs42524 1645C>G, 24367C>G, 32076082C>G, 94043239C>G, Pro549Ala
C > G
Missense
Pro549Ala
No VIP available No Clinical Annotations available VA
rs4261716 234593117G>T, 539376G>T, 855+11682G>T, 855+1679G>T, 855+47094G>T, 855+65909G>T, 99728G>T
G > T
Intronic
No VIP available No Clinical Annotations available VA
rs4407290 10428557G>A, 31606670G>A, 35942C>T, 837C>T, Val279=
G > A
Synonymous
Val279Val
No VIP available CA VA
rs4646316 19952132C>T, 27870C>T, 3104282C>T, 465+310C>T, 615+310C>T
C > T
Intronic
No VIP available CA VA
rs4655226 155-3137C>T, 20928284C>T, 7608372C>T
C > T
Intronic
No VIP available No Clinical Annotations available VA
rs4680 -5G>A, 19951271G>A, 19963748G>A, 27009G>A, 322G>A, 472G>A, 586G>A, COMP: Val158Met, COMT:Val108Met, Val108Met, Val158Met, Val196Met
G > A
Missense
Val158Met
No VIP available No Clinical Annotations available VA
rs4715354 -31+2057C>T, 52648797G>A, 52708797G>A
G > A
Intronic
No VIP available No Clinical Annotations available VA
rs4818 -69C>G, 19951207C>G, 19963684C>G, 258C>G, 26945C>G, 408C>G, 522C>G, COMT: Leu136Leu, Leu136=, Leu174=, Leu86=
C > G
C > T
Synonymous
Leu136Leu
No VIP available No Clinical Annotations available VA
rs4834232 129024273C>T, 53571994C>T, 814-4021C>T
C > T
Intronic
No VIP available No Clinical Annotations available VA
rs4877847 16110949A>C, 206+9072T>G, 60+9072T>G, 86946417A>C
A > C
Intronic
No VIP available No Clinical Annotations available VA
rs4982753 23814569C>T, 4814569C>T
C > T
Not Available
No VIP available CA VA
rs532545 -451C>T, 20588679C>T, 20915172C>T, CDA: promoter -451C>T
C > T
5' Flanking
No VIP available CA VA
rs55886062 1679T>G, 410273T>G, 67953261A>C, 97981343A>C, Ile560Ser
A > T
A > C
Missense
Ile560Asn
Ile560Ser
No VIP available CA VA
rs56038477 1236G>A, 352197G>A, 68011337C>T, 98039419C>T, Glu412=
C > T
Synonymous
Glu412Glu
No VIP available No Clinical Annotations available VA
rs5746849 -91-5725A>G, -92+3820A>G, -92+4422A>G, 18735A>G, 19942997A>G, 3095147A>G
A > G
Intronic
No VIP available CA VA
rs602950 -92A>G, 20589038A>G, 20915531A>G
A > G
5' UTR
No VIP available CA VA
rs60369023 208G>A, 20931474G>A, 7611562G>A, A70T, Ala70Thr, CDA: c.208G>A, CDA:208G>A, p.Ala70Thr
G > A
Missense
Ala70Thr
No VIP available No Clinical Annotations available VA
rs6151031 -468_-467insGGTTCTCTCCTCACCAG, 4586_4587insGGTTCTCTCCTCACCAG, 4732915_4732916insCTGGTGAGGAGAGAACC, 75568383_75568384insCTGGTGAGGAGAGAACC, ALDH1A1*2
- > CTGGTGAGGAGAGAACC
5' Flanking
No VIP available No Clinical Annotations available VA
rs62298861 10174611A>G, 69963944A>G, 722-314A>G
A > G
Intronic
No VIP available No Clinical Annotations available VA
rs6269 -1324A>G, -248A>G, -98A>G, 1-98A>G, 115-98A>G, 19949952A>G, 19962429A>G, 25690A>G
A > G
5' UTR
No VIP available CA VA
rs6431558 234529643C>T, 36254C>T, 475902C>T, 855+2435C>T
C > T
Intronic
No VIP available CA No Variant Annotations available
rs662 21439A>G, 32970289T>C, 575A>G, 94937446T>C, Gln192Arg
T > C
Missense
Gln192Arg
No VIP available CA VA
rs67376798 2846A>T, 67519865T>A, 843669A>T, 97547947T>A, Asp949Val
T > A
Missense
Asp949Val
No VIP available CA VA
rs6755571 134147C>A, 234627536C>A, 573795C>A, 60+25025C>A, 70C>A, 855+36098C>A, 855+46101C>A, 856-48144C>A, 861+25025C>A, 867+5032C>A, Pro24Thr
C > A
Intronic
Pro24Thr
No VIP available No Clinical Annotations available VA
rs6759892 -7-776T>G, 108280T>G, 19T>G, 234601669T>G, 547928T>G, 855+10231T>G, 855+20234T>G, 855+55646T>G, 856-74011T>G, Ser7Ala
T > G
Intronic
Ser7Ala
No VIP available CA VA
rs6785049 119533733G>A, 26028879G>A, 39403G>A, 684-93G>A, 795-93G>A, 912-93G>A
G > A
Intronic
No VIP available No Clinical Annotations available VA
rs6848982 128959213G>A, 53506934G>A
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs7104613 116468C>T, 14019931C>T, 14079931C>T, 479+16730C>T
C > T
Not Available
No VIP available CA VA
rs712829 -216G>T, 216G>T, 4676124G>T, 5031G>T, 55086755G>T, EGFR:-216G>T
G > T
5' UTR
No VIP available No Clinical Annotations available VA
rs7131224 24187531T>C, 24247531T>C
T > C
Not Available
No VIP available No Clinical Annotations available VA
rs717620 -24C>T, 101542578C>T, 5116C>T, 52347042C>T, ABCC2: 5'UTR, ABCC2:(-24)C>T, mRNA 118C>T
C > T
5' UTR
No VIP available CA VA
rs7194667 1609-491A>C, 1857097T>G, 31191A>C, 48242898T>G
T > G
Intronic
No VIP available CA No Variant Annotations available
rs724710 *83T>C, *90T>C, 111907691T>C, 125-14019T>C, 1656354T>C, 195T>C, 215-14019T>C, 215-3666T>C, 285T>C, 34201T>C, 395-14019T>C, 395-3666T>C, 465T>C, Ile155=, Ile65=, Ile95=
T > C
3' UTR
Ile95Ile
No VIP available No Clinical Annotations available VA
rs7287550 -92+2556T>C, 19931976T>C, 2384A>G, 3084126T>C, 7714T>C
T > C
Intronic
No VIP available No Clinical Annotations available VA
rs729147 *1038C>T, 100333267G>A, 24880988G>A
G > A
3' Flanking
No VIP available CA VA
rs7319981 103723722G>A, 16813398G>A, 475C>T
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs73420732 16038G>T, 4687131G>T, 55097762G>T, 88+10704G>T
G > T
Intronic
No VIP available No Clinical Annotations available VA
rs737866 -783A>G, -92+689T>C, 19930109T>C, 3082259T>C, 4251A>G, 5847T>C
T > C
5' Flanking
No VIP available No Clinical Annotations available VA
rs740603 -91-3545A>G, 19945177A>G, 20915A>G, 3097327A>G
A > G
Intronic
No VIP available No Clinical Annotations available VA
rs750155 -197G>A, -35-361G>A, -396G>A, -4-392G>A, 139-2174G>A, 19295G>A, 28560572C>T, 28620572C>T, SULT1A1: -396 G>A
C > T
5' UTR
No VIP available CA VA
rs75017182 1129-5923C>G, 346167C>G, 68017367G>C, 98045449G>C
G > C
Intronic
No VIP available No Clinical Annotations available VA
rs7586110 -57, -57T>G, 234590527T>G, 536786T>G, 855+44504T>G, 855+63319T>G, 855+9092T>G, 97138T>G, T>G, UGT1A7:, UGT1A7:-57T>G, rs7586110
T > G
Intronic
No VIP available CA No Variant Annotations available
rs760370 1260-201A>G, 1335-201A>G, 1338-201A>G, 1386-201A>G, 1389-201A>G, 1497-201A>G, 1500-201A>G, 44200953A>G, 44233216A>G
A > G
Intronic
No VIP available No Clinical Annotations available VA
rs7668258 -161T>C, 10172745T>C, 69962078T>C
T > C
5' Flanking
No VIP available No Clinical Annotations available VA
rs768172 1178-4867T>A, 1181-4867T>A, 1253-4867T>A, 150757T>A, 33838546A>T, 95805703A>T
A > T
Intronic
No VIP available No Clinical Annotations available VA
rs7746993 21121G>T, 52654137C>A, 52714137C>A
C > A
Not Available
No VIP available No Clinical Annotations available VA
rs7754103 160061090C>T, 64230547C>T
C > T
Not Available
No VIP available No Clinical Annotations available VA
rs7757130 113317262C>A, 17486719C>A
C > A
Not Available
No VIP available No Clinical Annotations available VA
rs776746 -229-237G>A, -253-1G>A, -254A=, -254A>G, -254G>A, -331-237G>A, -357-1G>A, -463-1G>A, -571-1G>A, 12083G>A, 1466+48736C>T, 189-237G>A, 219-237G>A, 321-1G>A, 344-237G>A, 581-237G>A, 689-1G>A, 717-1G>A, 806-4288C>T, 99270539C>T, 99672916T=, 99672916T>C, CYP3A5*1, CYP3A5*3, CYP3A5*3C, CYP3A5:6986A>G, g.6986A>G, intron 3 splicing defect, rs776746 A>G
T > C
Intronic
No VIP available CA VA
rs7853758 1381C>T, 16065458G>A, 1703C>T, 86900926G>A, Leu461=
G > A
Not Available
Leu461Leu
No VIP available CA No Variant Annotations available
rs7867504 16084768T>C, 267A>G, 589A>G, 86920236T>C, Thr89=
T > C
Not Available
Thr89Thr
No VIP available No Clinical Annotations available VA
rs7977213 13740924G>C, 20980800G>C, 22163G>C, 84+12044G>C
G > C
Intronic
No VIP available No Clinical Annotations available VA
rs8001466 12445277G>C, 1417-818C>G, 54329C>G, 99355601G>C
G > C
Intronic
No VIP available No Clinical Annotations available VA
rs8056100 13459C>T, 1874829G>A, 395+1087C>T, 48260630G>A
G > A
Intronic
No VIP available CA VA
rs8175347 233760235_233760236TA[5][6][7][8], 5-TA insertion in promoter, 7-TA insertion in promoter, 8-TA insertion in promoter, UGT1A1*28, UGT1A1*36, UGT1A1*37, microsatellite, short tandem repeat
(TA)6 > (TA)8
(TA)6 > (TA)5
(TA)6 > (TA)7
Not Available
No VIP available No Clinical Annotations available VA
rs8187710 101611294G>A, 4544G>A, 52415758G>A, 73832G>A, ABCC2 rs8187710, Cys1515Tyr, MRP2 Cys1515Tyr
G > A
Missense
Cys1515Tyr
No VIP available No Clinical Annotations available VA
rs8192924 2047G>A, 20588598G>A, 66974399G>A, 809G>A, Arg270His
G > A
Not Available
Arg270His
No VIP available CA No Variant Annotations available
rs861539 104165753G>A, 1651-1239G>A, 1782-1239G>A, 21071C>T, 722C>T, 75229G>A, 85165753G>A, Thr241Met
G > A
Intronic
Thr241Met
No VIP available No Clinical Annotations available VA
rs871514 135140T>C, 234628529T>C, 574788T>C, 60+26018T>C, 855+37091T>C, 855+47094T>C, 856-47151T>C, 861+26018T>C, 867+196T>C, 867+6025T>C
T > C
Intronic
No VIP available CA VA
rs885004 1184-360C>T, 16074082G>A, 862-360C>T, 86909550G>A
G > A
Intronic
No VIP available CA VA
rs9024 *133G>A, 23107184G>A, 37445313G>A, 377+1866C>T, CBR1:1096G>A
G > A
3' UTR
No VIP available No Clinical Annotations available VA
rs9282861 22353G>A, 28606193C>T, 28617514C>T, 404G>A, 638G>A, Arg135His, Arg213His, SULT1A1*2, SULT1A1:638G>A:SULT1A1:Arg213His
C > T
Missense
Arg135His
No VIP available CA VA
rs9332377 19955692C>T, 3107842C>T, 31430C>T, 466-367C>T, 53618G>A, 616-367C>T, COMT:rs9332377 A/G
C > T
Intronic
No VIP available CA No Variant Annotations available
rs9340799 152163381A>G, 156751A>G, 453-351A>G, 56332838A>G, ESR1:XbaI, ESR1:c.454-351A>G, ESR1:rs9340799
A > G
Intronic
No VIP available CA VA
rs9351963 11869695A>C, 490-1798A>C, 73749861A>C
A > C
Intronic
No VIP available CA VA
rs9514091 103714254G>A, 16803930G>A, 378-3522C>T, 9943C>T
G > A
Intronic
No VIP available CA No Variant Annotations available
rs9561778 3366+1243C>A, 8803391G>T, 95713715G>T, NM_005845.3:c.3366+1243G>T
G > A
G > T
Intronic
No VIP available CA No Variant Annotations available
rs9679162 10069401G>T, 130-31641C>A, 31247514G>T, 315-58346C>A, 70-31641C>A, 903-31641C>A
G > T
Intronic
No VIP available CA VA
rs9936750 55171874T>C, 8786073T>C
T > C
Not Available
No VIP available CA No Variant Annotations available
rs9937 2223A>G, 4099457A>G, 4159457A>G, 48534A>G, RRM1:2455A>G, Thr741=, rs3177016
A > G
Synonymous
Thr741Thr
No VIP available CA No Variant Annotations available
rs9981861 27076915T>C, 41415044T>C, 5384-444A>G, 5645-444A>G
T > C
Intronic
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 147

Overview

Alternate Names: 
Synonym
Benign Neoplasm; Benign Neoplasms; Cancer; Cancers; Neoplasm; Neoplasm, Benign; Neoplasms NOS; Neoplasms, Benign; Tumor; Tumors; Tumour
PharmGKB Accession Id: PA445062
External Vocabularies

PharmGKB Curated Pathways

Pathways created internally by PharmGKB based primarily on literature evidence.

External Pathways

Links to non-PharmGKB pathways.

PharmGKB contains no links to external pathways for this disease. To report a pathway, click here.

Curated Information ?

EvidenceGene
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ABCA1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ABCB1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABCB10
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ABCB11
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ABCB4
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ABCC1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ABCC10
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ABCC11
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ABCC2
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ABCC3
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
ABCC4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABCC5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABCC6
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ABCC9
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABCG1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ABCG2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABL1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABL2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ACE
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ADH7
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ADM
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
AGPAT2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
AHR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
AKR1A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
AKT1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
AKT2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
AKT3
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ALDH1A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ALDH2
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ALDH3A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ALK
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
AOX1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ARVCF
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
AS3MT
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ATP7A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ATP7B
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
AURKA
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BAK1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BCHE
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BCL2L1
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
BCL2L11
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BCR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BMPR2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BRAF
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BRCA1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BRCA2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BRD4
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
C18orf56
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CBR1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CBR3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CBS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CCND1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CCNE1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CCR4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CD274
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CD3D
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CD3E
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CD3G
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CDA
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CDC5L
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CDK2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CDK4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CDK6
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CDKN1A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CDKN1B
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CDKN2A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CES1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CES2
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CMPK1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
COL1A2
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
COMT
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CPS1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CRK
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CRP
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CSF1R
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CSK
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CTNNB1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CTNND1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CXCL8
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CXCR1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CXCR2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYBB
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP19A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP1A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP1A2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP1B1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2A13
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CYP2A6
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CYP2B6
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2C18
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CYP2C19
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CYP2C8
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CYP2C9
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CYP2D6
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2E1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2F1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2G1P
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CYP2J2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2S1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CYP3A
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CYP3A4
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CYP3A5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP4B1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
DAPK1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DCK
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DCTD
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DDIT3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DHFR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DKC1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DNMT1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
DPYD
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
DPYS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DRD2
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
DSCAM
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
EGF
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
EGFR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
EML4
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ENOSF1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
EPC2
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
EPO
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ERBB2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ERBB4
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ERCC1
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
ERCC2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ERCC4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ERCC5
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
ESR1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FCGR2A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FCGR3A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FCGRT
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
FDPS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FEZ1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FFAR2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FGF2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FGFR1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FLT1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FLT3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FLT4
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
FMO2
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
FMO3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FOLH1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FOXO1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FRS2
G6PD
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GABPA
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
GALNT14
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GATA4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GJB2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GNB3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GNMT
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GPX1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
GPX3
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
GSTA2
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
GSTA5
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
GSTM1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
GSTM3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTO1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTO2
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
GSTP1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
GSTT1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTT2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTT2B
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTZ1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
HAS3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HDAC3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HEY1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HIF1A
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
HLA-A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HMGCR
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
HNMT
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HOXC10
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HRAS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HSP90AA1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HTR2B
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ICAM1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IGF1R
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IGFBP3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IL1B
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IQGAP2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ITGAV
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ITGB5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
JUP
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KCNE1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KCNE2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KCNH2
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
KCNQ1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
KCNQ5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KDR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KIT
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KLF2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KLK15
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KMT2A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KRAS
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
LARP1B
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
LDLR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
LGALS1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
LILRA3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
LMNA
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
LRP2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAP2K1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAP2K2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAP2K3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAP2K4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAP2K5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAP2K6
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAP2K7
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAPK1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAPK10
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAPK11
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAPK12
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAPK13
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAPK14
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAPK3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAPK4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAPK6
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAPK7
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAPK8
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAPK9
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAX
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MCL1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MDM2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MDM4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MET
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MGMT
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MITF
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MKI67
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MLH1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MSH2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MSI1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MT-ND6
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MTHFD1
MTHFR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MTOR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MTR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MTRR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MYC
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NAT1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NAT2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NATP
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NCF4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NDOR1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NOS2
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
NOS3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NOTCH1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NOTCH2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NOTCH3
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
NQO1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
NR1I2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NRAS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NRP1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NT5C
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NT5C1A
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
NT5C2
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
NT5C3A
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
OPRM1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
OTOS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
P2RY1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
P2RY12
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PAPD7
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PARP1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PDCD1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PDGFRB
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PEMT
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PGR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PIGF
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PIK3C2A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PIK3C2B
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
PIK3CA
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
PIK3R1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PIK3R5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCB1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCB2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCB3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCB4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCD1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCD3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCD4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCE1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCG1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCG2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCH1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCH2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCL1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCL2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCZ1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PML
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PNMT
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
PON1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PPARGC1A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PPP1R15A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PRKCB
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PROM1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PSMC1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PSPH
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PTCH1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PTEN
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PTGS1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
PTGS2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
RAF1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
RALBP1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
RARA
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
RARG
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
RET
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
RHBDF2
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
RRM1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SCN5A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SDHB
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SDHD
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SEPT14
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SERPINA3
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SERPINA6
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SHC1
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
SHMT1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SLC10A2
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SLC15A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC19A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SLC1A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC22A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SLC22A17
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SLC22A2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC22A3
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SLC22A7
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SLC25A13
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC26A4
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SLC28A1
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
SLC28A2
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SLC28A3
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
SLC29A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC29A2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC6A4
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SLCO1B1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SLCO1B3
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SLCO4C1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SLCO6A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SMO
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SMPD1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SMYD3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SOD1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SOD2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SP1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SPG7
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SRC
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ST14
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
STAT3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
STK11
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SULT1A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SULT1A2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SULT1E1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SULT2B1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TDP1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TIMP3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TK2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TLR5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TMCC1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TNFSF9
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
TOMM40L
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TOP1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TOP2A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TOP2B
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
TP53
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TPH2
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
TPMT
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TPT1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
TXNRD2
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
TYMP
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
TYMS
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UGT1A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
UGT1A10
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UGT1A4
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
UGT1A6
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
UGT1A7
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UGT1A8
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
UGT1A9
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
UGT2B10
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
UGT2B15
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
UGT2B7
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
UMPS
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
UPB1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
VEGFA
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
VEGFB
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
WNT5B
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
XDH
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
XPA
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
XPC
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
XRCC1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
YAP1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
YY1AP1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ZNF706

Curated Information ?

Evidence Drug
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
2-methoxyestradiol
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
3,4-methylenedioxymethamphetamine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
3,5-dimethyl-2-(3-pyridyl)thiazolidin-4-one
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
abacavir
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ABT-751
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
acetylcysteine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
afatinib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
alosetron
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
alvespimycin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
aminophenazone
No Dosing Guideline available DL CA No Variant Annotation available No VIP available No VIP available
anastrozole
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
arsenic trioxide
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
artemisinin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
asparaginase
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
astemizole
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
atezolizumab
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
axitinib
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
azacitidine
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
azathioprine
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
belinostat
No Dosing Guideline available DL CA No Variant Annotation available No VIP available No VIP available
bevacizumab
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
bilirubin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Biricodar
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
bleomycin
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
bortezomib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
brivanib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BSI-201
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
busulfan
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
caffeine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
calcein
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
camptothecin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
canertinib
No Dosing Guideline available DL CA VA No VIP available No VIP available
capecitabine
No Dosing Guideline available DL CA VA No VIP available No VIP available
carboplatin
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
carmustine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CBLB502
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
celecoxib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
cerivastatin
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
cetuximab
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
cilengitide
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
cisapride
No Dosing Guideline available DL CA VA No VIP available No VIP available
cisplatin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
citalopram
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
cladribine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
clofibrate
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
clomipramine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
clopidogrel
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
clotrimazole
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
conjugated estrogens
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
coumarin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
crizotinib
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
cyanocobalamin
No Dosing Guideline available DL CA VA No VIP available No VIP available
cyclophosphamide
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
cyclosporine
No Dosing Guideline available DL CA No Variant Annotation available No VIP available No VIP available
cytarabine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
dabrafenib
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
dactinomycin
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
dasatinib
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
daunorubicin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
debrisoquine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
deferoxamine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
dexamethasone
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
dexfenfluramine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
dexrazoxane
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
diflomotecan
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
difluorodeoxyuridine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
disulfiram
No Dosing Guideline available DL CA VA No VIP available No VIP available
docetaxel
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
doxorubicin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ebselen
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
efavirenz
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
EKB-569
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
epinephrine
No Dosing Guideline available DL CA No Variant Annotation available No VIP available No VIP available
epirubicin
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
epoprostenol
No Dosing Guideline available DL CA VA No VIP available No VIP available
erlotinib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ertumaxomab
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
erythromycin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ethacrynic acid
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ethinyl estradiol
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
etoposide
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
everolimus
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
fenfluramine
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
fentanyl
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
flavopiridol
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
floxuridine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
fludarabine
No Dosing Guideline available DL CA VA No VIP available No VIP available
fluorouracil
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
fluphenazine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
flurazepam
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
folic acid
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
furazolidone
No Dosing Guideline available DL CA No Variant Annotation available No VIP available No VIP available
gefitinib
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
geldanamycin
No Dosing Guideline available DL CA VA No VIP available No VIP available
gemcitabine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
genistein
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Glucarpidase
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
grapefruit juice
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GW2016
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
haloperidol
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
homoharringtonine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
hydralazine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
hydroxyurea
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
idarubicin
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ifosfamide
No Dosing Guideline available DL CA VA No VIP available No VIP available
imatinib
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
indomethacin
No Dosing Guideline available DL CA VA No VIP available No VIP available
irinotecan
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
isoniazid
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ketamine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ketoconazole
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
l-methionine
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
lapatinib
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
letrozole
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
leucovorin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
lidocaine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
lurbinectedin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
maytansine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
mephenytoin
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
mercaptopurine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
mesna
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
metformin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
methadone
No Dosing Guideline available DL CA VA No VIP available No VIP available
methotrexate
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
methylcholanthrene
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
methylene blue
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
metoclopramide
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
midazolam
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
mitomycin
No Dosing Guideline available DL CA No Variant Annotation available No VIP available No VIP available
mitoxantrone
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MK-571
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
morphine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
naltrexone
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
neratinib
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
nicotine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
nitrofurantoin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
nivolumab
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
nsc697887
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
O6-(4-Bromothenyl)guanine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Olaparib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
onartuzumab
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ondansetron
No Dosing Guideline available DL CA VA No VIP available No VIP available
oxaliplatin
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
oxycodone
No Dosing Guideline available DL CA VA No VIP available No VIP available
paclitaxel
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
panitumumab
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
pazopanib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
pembrolizumab
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
pemetrexed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
perifosine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
pertuzumab
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
phenazopyridine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
phenelzine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
phenobarbital
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
phenytoin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
pilocarpine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
pimecrolimus
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
platinum
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
pravastatin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
prednisone
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
primaquine
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
probenecid
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
procainamide
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
raltitrexed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
rasburicase
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
reserpine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ridaforolimus
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
rifampin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
rituximab
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
rofecoxib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
rosiglitazone
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
s 1 (combination)
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
saquinavir
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Saracatinib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
semaxanib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
sertindole
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
sertraline
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
sibutramine
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
sildenafil
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
sirolimus
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SJG-136
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SN-38
No Dosing Guideline available DL CA VA No VIP available No VIP available
sorafenib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
sulfacetamide
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
sulfadiazine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
sulfamethazine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
sulfamethizole
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
sulfamethoxazole
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
sulfanilamide
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
sulfasalazine
No Dosing Guideline available DL CA VA No VIP available No VIP available
sunitinib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
tacrolimus
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
tamoxifen
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
tanespimycin
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
tegafur
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
telcyta
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
temozolomide
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
temsirolimus
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
teniposide
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
terfenadine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
terodiline
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
testosterone
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
thalidomide
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
thioguanine
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
thiotepa