Disease:
Neoplasms

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Gene ? Variant?
(147)
Alternate Names ? Chemicals ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
Translation
No VIP available CA No VIP available CYP2A6 *1A N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *4A N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *4C N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *7 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2A6 *9 N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *9A N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *10 N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *11 N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *18A N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *19 N/A N/A N/A
No VIP available CA No VIP available CYP2B6 *1 N/A N/A N/A
No VIP available CA No VIP available CYP2B6 *6 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C19 *1 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C19 *2A N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C19 *2B N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C19 *17 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C9 *1 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C9 *2 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C9 *3 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *1 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *1xN N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *2 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *3 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *4 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *6 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *10 N/A N/A N/A
No VIP available No VIP available No VIP available CYP3A4 *1A N/A N/A N/A
No VIP available No VIP available No VIP available CYP3A4 *1B N/A N/A N/A
No VIP available CA No VIP available CYP3A5 *1A N/A N/A N/A
No VIP available CA No VIP available CYP3A5 *3A N/A N/A N/A
No VIP available No VIP available No VIP available CYP3A5 *3C N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *1 N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *2A N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *4 N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *5 N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *6 N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *9A N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *13 N/A N/A N/A
No VIP available No VIP available No VIP available G6PD Mediterranean, Dallas, Panama' Sassari, Cagliari, Birmingham N/A N/A N/A
No VIP available No VIP available No VIP available GSTM1 non-null N/A N/A N/A
No VIP available CA No VIP available GSTT1 non-null N/A N/A N/A
No VIP available CA No VIP available GSTT1 null N/A N/A N/A
No VIP available No VIP available No VIP available HLA-A *02:01 N/A N/A N/A
No VIP available No VIP available No VIP available HLA-A *03:01:01:01 N/A N/A N/A
No VIP available No VIP available No VIP available PIK3CA H4 N/A N/A N/A
No VIP available No VIP available No VIP available PIK3CA H5 N/A N/A N/A
No VIP available No VIP available No VIP available SLCO1B1 *1 N/A N/A N/A
No VIP available No VIP available No VIP available SLCO1B1 *15 N/A N/A N/A
No VIP available No VIP available VA TPMT *1 N/A N/A N/A
No VIP available No VIP available VA TPMT *3A N/A N/A N/A
No VIP available No VIP available VA TPMT *3C N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *1 N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *6 N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *28 N/A N/A N/A
No VIP available CA No VIP available UGT1A1 *60 N/A N/A N/A
No VIP available No Clinical Annotations available VA
DPYD deficiency N/A N/A N/A
No VIP available No Clinical Annotations available VA
G6PD deficiency N/A N/A N/A
No VIP available No Clinical Annotations available VA
rs10144771 NC_000014.8:g.94778653A>G, NC_000014.9:g.94312316A>G, NG_011796.1:g.16036T>C, NM_001756.3:c.613+1720T>C, NT_187601.1:g.1426878A>G, rs60270135
A > G
SNP
No VIP available No Clinical Annotations available VA
rs10413396 NC_000019.10:g.44309549G>T, NC_000019.9:g.44813702G>T
G > T
SNP
No VIP available CA No Variant Annotations available
rs1042522 NC_000017.10:g.7579472G=, NC_000017.10:g.7579472G>C, NC_000017.10:g.7579472G>T, NC_000017.11:g.7676154G=, NC_000017.11:g.7676154G>C, NC_000017.11:g.7676154G>T, NG_017013.2:g.16397C=, NG_017013.2:g.16397C>A, NG_017013.2:g.16397C>G, NM_000546.5:c.215C=, NM_000546.5:c.215C>A, NM_000546.5:c.215C>G, NM_001126112.2:c.215C=, NM_001126112.2:c.215C>A, NM_001126112.2:c.215C>G, NM_001126113.2:c.215C=, NM_001126113.2:c.215C>A, NM_001126113.2:c.215C>G, NM_001126114.2:c.215C=, NM_001126114.2:c.215C>A, NM_001126114.2:c.215C>G, NM_001126115.1:c.-939C=, NM_001126115.1:c.-939C>A, NM_001126115.1:c.-939C>G, NM_001126116.1:c.-939C=, NM_001126116.1:c.-939C>A, NM_001126116.1:c.-939C>G, NM_001126117.1:c.-939C=, NM_001126117.1:c.-939C>A, NM_001126117.1:c.-939C>G, NM_001126118.1:c.98C=, NM_001126118.1:c.98C>A, NM_001126118.1:c.98C>G, NM_001276695.1:c.98C=, NM_001276695.1:c.98C>A, NM_001276695.1:c.98C>G, NM_001276696.1:c.98C=, NM_001276696.1:c.98C>A, NM_001276696.1:c.98C>G, NM_001276697.1:c.-1020C=, NM_001276697.1:c.-1020C>A, NM_001276697.1:c.-1020C>G, NM_001276698.1:c.-1020C=, NM_001276698.1:c.-1020C>A, NM_001276698.1:c.-1020C>G, NM_001276699.1:c.-1020C=, NM_001276699.1:c.-1020C>A, NM_001276699.1:c.-1020C>G, NM_001276760.1:c.98C=, NM_001276760.1:c.98C>A, NM_001276760.1:c.98C>G, NM_001276761.1:c.98C=, NM_001276761.1:c.98C>A, NM_001276761.1:c.98C>G, NP_000537.3:p.Pro72=, NP_000537.3:p.Pro72Arg, NP_000537.3:p.Pro72His, NP_001119584.1:p.Pro72=, NP_001119584.1:p.Pro72Arg, NP_001119584.1:p.Pro72His, NP_001119585.1:p.Pro72=, NP_001119585.1:p.Pro72Arg, NP_001119585.1:p.Pro72His, NP_001119586.1:p.Pro72=, NP_001119586.1:p.Pro72Arg, NP_001119586.1:p.Pro72His, NP_001119590.1:p.Pro33=, NP_001119590.1:p.Pro33Arg, NP_001119590.1:p.Pro33His, NP_001263624.1:p.Pro33=, NP_001263624.1:p.Pro33Arg, NP_001263624.1:p.Pro33His, NP_001263625.1:p.Pro33=, NP_001263625.1:p.Pro33Arg, NP_001263625.1:p.Pro33His, NP_001263689.1:p.Pro33=, NP_001263689.1:p.Pro33Arg, NP_001263689.1:p.Pro33His, NP_001263690.1:p.Pro33=, NP_001263690.1:p.Pro33Arg, NP_001263690.1:p.Pro33His, XM_005256778.1:c.176-21C=, XM_005256778.1:c.176-21C>A, XM_005256778.1:c.176-21C>G, XR_243565.1:n.354C=, XR_243565.1:n.354C>A, XR_243565.1:n.354C>G, XR_243566.1:n.354C=, XR_243566.1:n.354C>A, XR_243566.1:n.354C>G, rs17844988, rs17857747, rs17882155, rs2229076, rs3174747, rs4134781, rs60388830
G > C
SNP
P72R
No VIP available No Clinical Annotations available VA
rs1042597 NC_000002.11:g.234526871C>G, NC_000002.12:g.233618225C>G, NG_002601.2:g.33482C>G, NM_019076.4:c.518C>G, NP_061949.3:p.Ala173Gly, rs117092283, rs13387262, rs17862843, rs2071043, rs56696602
C > G
SNP
A173G
No VIP available No Clinical Annotations available VA
rs1042605 NC_000002.11:g.234527118A>G, NC_000002.12:g.233618472A>G, NG_002601.2:g.33729A>G, NM_019076.4:c.765A>G, NP_061949.3:p.Thr255=, rs17868307, rs58240369
A > G
SNP
T255T
No VIP available CA VA
rs10426377 NC_000019.10:g.48588977C>A, NC_000019.9:g.49092234C>A, NG_029063.1:g.41806C>A, NM_004605.2:c.378+1540C>A, NM_177973.1:c.423+1540C>A, XM_005259182.1:c.-228C>A, XM_005259182.2:c.-228C>A, rs61651031
C > A
SNP
No VIP available No Clinical Annotations available VA
rs10426628 NC_000019.10:g.48589173A>G, NC_000019.9:g.49092430A>G, NG_029063.1:g.42002A>G, NM_004605.2:c.378+1736A>G, NM_177973.1:c.423+1736A>G, XM_005259182.1:c.-32A>G, XM_005259182.2:c.-32A>G, rs57560171
A > G
SNP
No VIP available CA VA
rs1044457 NC_000001.10:g.47842777C>T, NC_000001.11:g.47377105C>T, NM_001136140.1:c.*360C>T, NM_016308.2:c.*360C>T, NR_046394.1:n.1119C>T, rs17378832, rs3184215, rs3767626
C > -
C > T
SNP
No VIP available CA VA
rs1045642 NC_000007.13:g.87138645A>G, NC_000007.14:g.87509329A>G, NG_011513.1:g.208920T>C, NM_000927.4:c.3435T>C, NP_000918.2:p.Ile1145=, rs10239679, rs11568726, rs117328163, rs17210003, rs2229108, rs386513066, rs60023214, rs9690664
A > G
SNP
I1145I
No VIP available CA VA
rs1048977 NC_000001.10:g.20945055C>T, NC_000001.11:g.20618562C>T, NM_001785.2:c.435C>T, NP_001776.1:p.Thr145=, rs17846527, rs17859600, rs3189038, rs57498302
C > T
SNP
T145T
No VIP available No Clinical Annotations available VA
rs10497346 NC_000002.11:g.169771196T>C, NC_000002.12:g.168914686T>C, NW_003315909.1:g.101313T>C
T > C
SNP
No VIP available CA No Variant Annotations available
rs1051266 NC_000021.8:g.46957794T>C, NC_000021.9:g.45537880T>C, NG_028278.1:g.9592A>G, NM_001205206.1:c.80A>G, NM_194255.2:c.80A>G, NP_001192135.1:p.His27Arg, NP_919231.1:p.His27Arg, XM_005261163.1:c.80A>G, XM_005261164.1:c.-279A>G, XM_005261164.2:c.-279A>G, XM_011529696.1:c.371A>G, XM_011529697.1:c.371A>G, XM_011529698.1:c.146A>G, XM_011529699.1:c.-1639A>G, XM_011529700.1:c.80A>G, XM_011529701.1:c.80A>G, XM_011529702.1:c.80A>G, XM_011529703.1:c.80A>G, XM_011529704.1:c.80A>G, XM_011529705.1:c.371A>G, XM_011529707.1:c.371A>G, XM_011529708.1:c.80A>G, XM_011529709.1:c.-279A>G, XM_011529710.1:c.-165-5732A>G, XP_005261220.1:p.His27Arg, XP_011527998.1:p.His124Arg, XP_011527999.1:p.His124Arg, XP_011528000.1:p.His49Arg, XP_011528002.1:p.His27Arg, XP_011528003.1:p.His27Arg, XP_011528004.1:p.His27Arg, XP_011528005.1:p.His27Arg, XP_011528006.1:p.His27Arg, XP_011528007.1:p.His124Arg, XP_011528009.1:p.His124Arg, XP_011528010.1:p.His27Arg, rs17844977, rs17857726, rs3171496, rs386514057, rs61510559
T > C
SNP
H27R
No VIP available CA VA
rs1051640 NC_000017.10:g.48768486A>G, NC_000017.11:g.50691125A>G, NM_003786.3:c.4509A>G, NP_003777.2:p.Glu1503=, XM_005257763.1:c.4317A>G, XM_005257763.2:c.4317A>G, XM_011525422.1:c.4422A>G, XM_011525423.1:c.4614A>G, XM_011525424.1:c.3834A>G, XM_011525425.1:c.3783A>G, XP_005257820.1:p.Glu1439=, XP_011523724.1:p.Glu1474=, XP_011523725.1:p.Glu1538=, XP_011523726.1:p.Glu1278=, XP_011523727.1:p.Glu1261=, XR_934586.1:n.4970A>G, rs17414117, rs17643255, rs3192040, rs57272614, rs60786737
A > G
SNP
E1503E
No VIP available CA VA
rs1056892 NC_000021.8:g.37518706G>A, NC_000021.9:g.36146408G>A, NM_001236.3:c.730G>A, NP_001227.1:p.Val244Met, NR_038892.1:n.93-53C>T, NR_038893.1:n.93-53C>T, NR_038894.1:n.93-53C>T, rs3171445, rs52816011, rs58776388
G > A
SNP
V244M
No VIP available No Clinical Annotations available VA
rs1058930 NC_000010.10:g.96818119G>C, NC_000010.11:g.95058362G>C, NG_007972.1:g.16136C>G, NM_000770.3:c.792C>G, NM_001198853.1:c.582C>G, NM_001198854.1:c.486C>G, NM_001198855.1:c.582C>G, NP_000761.3:p.Ile264Met, NP_001185782.1:p.Ile194Met, NP_001185783.1:p.Ile162Met, NP_001185784.1:p.Ile194Met, XR_246073.1:n.888C>G, XR_945610.1:n.888C>G, rs17420739, rs3199599, rs56489507, rs56929063
G > C
SNP
I264M
No VIP available CA No Variant Annotations available
rs1060896 NC_000015.10:g.45262069C>A, NC_000015.9:g.45554267C>A, NM_004212.3:c.225C>A, NP_004203.2:p.Ser75Arg, NR_120335.1:n.27-6071G>T, XM_011522198.1:c.225C>A, XM_011522199.1:c.225C>A, XM_011522200.1:c.225C>A, XM_011522201.1:c.225C>A, XP_011520500.1:p.Ser75Arg, XP_011520501.1:p.Ser75Arg, XP_011520502.1:p.Ser75Arg, XP_011520503.1:p.Ser75Arg, XR_243147.1:n.32-6071G>T, rs17215647, rs17532209, rs52828213, rs58568974
C > A
SNP
S75R
No VIP available No Clinical Annotations available VA
rs10815019 NC_000009.11:g.4547288A>G, NC_000009.12:g.4547288A>G, NG_017044.1:g.61862A>G, NM_004170.5:c.232+2581A>G, XM_011518007.1:c.301+2581A>G, XM_011518008.1:c.241+2581A>G, XM_011518009.1:c.172+2581A>G, XM_011518010.1:c.92-14161A>G, rs56618216, rs59895460
A > G
A > T
SNP
No VIP available No Clinical Annotations available VA
rs10841661 NC_000012.11:g.20984832C>T, NC_000012.12:g.20831898C>T, NG_032071.1:g.26195C>T, NM_019844.3:c.84+16076C>T, XM_005253347.1:c.84+16076C>T, rs60957758
C > T
SNP
No VIP available No Clinical Annotations available VA
rs10929302 NC_000002.11:g.234665782G>A, NC_000002.12:g.233757136G>A, NG_002601.2:g.172393G>A, NG_033238.1:g.1864G>A, NM_001072.3:c.862-9898G>A, NM_007120.2:c.868-9898G>A, NM_019075.2:c.856-9898G>A, NM_019076.4:c.856-9898G>A, NM_019077.2:c.856-9898G>A, NM_019078.1:c.868-9898G>A, NM_019093.2:c.868-9898G>A, NM_021027.2:c.856-9898G>A, NM_205862.1:c.61-9898G>A, NR_037694.1:n.-1791C>T, NR_037695.1:n.-1791C>T, NR_037696.1:n.-1791C>T, XR_241238.1:n.924-9898G>A, XR_241240.1:n.1023-9898G>A, XR_241241.1:n.942-9898G>A
G > A
SNP
No VIP available No Clinical Annotations available VA
rs10931910 NC_000002.11:g.201523736A>G, NC_000002.12:g.200659013A>G, NM_001159.3:c.3172-152A>G, XM_005246506.1:c.1840-152A>G, XM_011511062.1:c.3172-152A>G, XR_922913.1:n.3329-152A>G, rs13005946, rs59990000
A > G
SNP
No VIP available No Clinical Annotations available VA
rs11022922 NC_000011.10:g.2457965C>T, NC_000011.9:g.2479195C>T, NG_008935.1:g.17975C>T, NM_000218.2:c.386+12481C>T, rs60426613
C > T
SNP
No VIP available CA VA
rs11045585 NC_000012.11:g.21045694A>G, NC_000012.12:g.20892760A>G, NG_032071.1:g.87057A>G, NM_019844.3:c.1683-5676A>G, XM_005253347.1:c.1683-5676A>G
A > G
SNP
No VIP available No Clinical Annotations available VA
rs11046217 NC_000012.11:g.22017157G>C, NC_000012.12:g.21864223G>C, NG_012819.1:g.77472C>G, NM_005691.2:c.2237+216C>G, NM_005691.3:c.2237+216C>G, NM_020297.2:c.2237+216C>G, NM_020297.3:c.2237+216C>G, XM_005253284.1:c.2237+216C>G, XM_005253284.2:c.2237+216C>G, XM_005253285.1:c.2237+216C>G, XM_005253286.1:c.2237+216C>G, XM_005253286.2:c.2237+216C>G, XM_005253287.1:c.2237+216C>G, XM_005253287.3:c.2237+216C>G, XM_005253288.1:c.2237+216C>G, XM_005253288.2:c.2237+216C>G, XM_005253289.1:c.2199-1169C>G, XM_005253289.2:c.2199-1169C>G, XM_005253290.1:c.2199-3168C>G, XM_005253290.2:c.2199-3168C>G, XM_005253291.1:c.2237+216C>G, XM_006719025.2:c.2199-1169C>G, XM_011520545.1:c.2237+216C>G
G > C
SNP
No VIP available No Clinical Annotations available VA
rs11075646 NC_000016.10:g.66935273C>G, NC_000016.9:g.66969176C>G, NM_003869.5:c.-171C>G, NM_016062.3:c.-909G>C, NM_198061.2:c.-171C>G, NR_024525.2:n.-850G>C, NR_036684.1:n.803C>G, NR_046109.1:n.-850G>C, XM_011523421.1:c.-806C>G, rs16957087, rs60326948
C > -
C > G
SNP
No VIP available No Clinical Annotations available VA
rs1113129 NC_000010.10:g.96811045G>C, NC_000010.11:g.95051288G>C, NG_007972.1:g.23210C>G, NM_000770.3:c.820-5337C>G, NM_001198853.1:c.610-5337C>G, NM_001198854.1:c.514-5337C>G, NM_001198855.1:c.610-5337C>G, XR_246073.1:n.916-5337C>G, XR_945610.1:n.916-5337C>G, rs4488135
G > C
SNP
No VIP available CA VA
rs11141915 NC_000009.11:g.90235794A>C, NC_000009.12:g.87620879A>C, NG_029883.1:g.128039A>C, NM_001288729.1:c.284+15704A>C, NM_001288730.1:c.284+15704A>C, NM_001288731.1:c.284+15704A>C, NM_004938.3:c.284+15704A>C, XM_005251755.1:c.284+15704A>C, XM_005251756.1:c.284+15704A>C, XM_005251757.1:c.284+15704A>C, XM_005251757.2:c.284+15704A>C, rs36209074, rs58921402
A > C
SNP
No VIP available CA No Variant Annotations available
rs11211524 NC_000001.10:g.47833213A>C, NC_000001.11:g.47367541A>C, NM_001136140.1:c.172-5414A>C, NM_016308.2:c.172-928A>C, NR_046394.1:n.321-928A>C
A > C
SNP
No VIP available CA VA
rs1128503 NC_000007.13:g.87179601A>G, NC_000007.14:g.87550285A>G, NG_011513.1:g.167964T>C, NM_000927.4:c.1236T>C, NP_000918.2:p.Gly412=, rs116989428, rs17276907, rs2032587, rs2229105, rs28365046, rs386518005, rs58257317
A > G
SNP
G412G
No VIP available CA No Variant Annotations available
rs1138272 NC_000011.10:g.67586108C>T, NC_000011.9:g.67353579C>T, NG_012075.1:g.7514C>T, NM_000852.3:c.341C>T, NP_000843.1:p.Ala114Val, XM_005273958.1:c.338C>T, XP_005274015.1:p.Ala113Val, rs11553894, rs17434783, rs1799811, rs1804665, rs3202011, rs4134657, rs52800258, rs61323549
C > T
SNP
A114V
No VIP available CA VA
rs1142345 NC_000006.11:g.18130918T>C, NC_000006.12:g.18130687T>C, NG_012137.2:g.29457A>G, NM_000367.3:c.719A>G, NP_000358.1:p.Tyr240Cys, XM_011514839.1:c.674A>G, XM_011514840.1:c.650A>G, XP_011513141.1:p.Tyr225Cys, XP_011513142.1:p.Tyr217Cys, rs16880254, rs1801205, rs29001646, rs52798150, rs61510596
T > C
SNP
Y240C
No VIP available CA No Variant Annotations available
rs11479 NC_000022.10:g.50964236G>A, NC_000022.11:g.50525807G>A, NG_011860.1:g.9279C>T, NG_016235.1:g.5633C>T, NG_021419.1:g.22592G>A, NM_001113755.2:c.1412C>T, NM_001113756.2:c.1412C>T, NM_001169109.1:c.-14+439C>T, NM_001169110.1:c.-14+194C>T, NM_001169111.1:c.-379C>T, NM_001257988.1:c.1412C>T, NM_001257989.1:c.1427C>T, NM_001953.4:c.1412C>T, NM_005138.2:c.-349C>T, NP_001107227.1:p.Ser471Leu, NP_001107228.1:p.Ser471Leu, NP_001244917.1:p.Ser471Leu, NP_001244918.1:p.Ser476Leu, NP_001944.1:p.Ser471Leu, rs17846490, rs17859554, rs3202233, rs3829983
G > A
SNP
S471L
No VIP available CA VA
rs1149222 NC_000007.13:g.87073775G>T, NC_000007.14:g.87444459G>T, NG_007118.1:g.40974C>A, NM_000443.3:c.1119+403C>A, NM_018849.2:c.1119+403C>A, NM_018850.2:c.1119+403C>A, XM_011516308.1:c.1119+403C>A, XM_011516309.1:c.1119+403C>A, XM_011516310.1:c.1119+403C>A, XM_011516311.1:c.1119+403C>A, XM_011516312.1:c.1119+403C>A, XM_011516313.1:c.1119+403C>A, XM_011516314.1:c.1140+403C>A, XM_011516315.1:c.459+403C>A, XR_927478.1:n.1215+403C>A, rs10376488, rs1639242, rs17297653, rs60948017
G > T
SNP
No VIP available CA No Variant Annotations available
rs115232898 NC_000001.10:g.98165030T>C, NC_000001.11:g.97699474T>C, NG_008807.2:g.226586A>G, NM_000110.3:c.557A>G, NP_000101.2:p.Tyr186Cys, XM_005270561.1:c.446A>G, XM_005270562.1:c.557A>G, XM_005270562.3:c.557A>G, XM_005270563.1:c.557A>G, XM_005270564.1:c.557A>G, XM_006710397.2:c.557A>G, XP_005270618.1:p.Tyr149Cys, XP_005270619.1:p.Tyr186Cys, XP_005270619.2:p.Tyr186Cys, XP_005270620.1:p.Tyr186Cys, XP_005270621.1:p.Tyr186Cys, XP_006710460.1:p.Tyr186Cys, rs199469520
T > C
SNP
Y186C
No VIP available No Clinical Annotations available VA
rs115349832
A > C
A > G
SNP
No VIP available No Clinical Annotations available VA
rs11572080 NC_000010.10:g.96827030C>T, NC_000010.11:g.95067273C>T, NG_007972.1:g.7225G>A, NM_000770.3:c.416G>A, NM_001198853.1:c.206G>A, NM_001198854.1:c.110G>A, NM_001198855.1:c.206G>A, NP_000761.3:p.Arg139Lys, NP_001185782.1:p.Arg69Lys, NP_001185783.1:p.Arg37Lys, NP_001185784.1:p.Arg69Lys, XR_246073.1:n.512G>A, XR_945610.1:n.512G>A, rs60090616
C > T
SNP
R139K
No VIP available No Clinical Annotations available VA
rs11572103 NC_000010.10:g.96818106T>A, NC_000010.11:g.95058349T>A, NG_007972.1:g.16149A>T, NM_000770.3:c.805A>T, NM_001198853.1:c.595A>T, NM_001198854.1:c.499A>T, NM_001198855.1:c.595A>T, NP_000761.3:p.Ile269Phe, NP_001185782.1:p.Ile199Phe, NP_001185783.1:p.Ile167Phe, NP_001185784.1:p.Ile199Phe, XR_246073.1:n.901A>T, XR_945610.1:n.901A>T, rs52833642, rs58027822
T > A
SNP
I269F
No VIP available CA VA
rs11598702 NC_000010.10:g.104897985T>C, NC_000010.11:g.103138228T>C, NG_042272.1:g.60079A>G, NM_001134373.2:c.175+1178A>G, NM_012229.4:c.175+1178A>G, XM_005269632.1:c.175+1178A>G, XM_005269632.3:c.175+1178A>G, XM_005269633.1:c.175+1178A>G, XM_005269633.3:c.175+1178A>G, XM_005269634.1:c.175+1178A>G, XM_005269634.3:c.175+1178A>G, XM_005269635.1:c.175+1178A>G, XM_005269635.3:c.175+1178A>G, XM_005269636.1:c.175+1178A>G, XM_005269636.3:c.175+1178A>G, XM_005269637.1:c.88+1178A>G, XM_005269637.3:c.88+1178A>G, XM_005269638.1:c.79+1178A>G, XM_005269638.3:c.79+1178A>G, XM_005269639.1:c.88+1178A>G, XM_005269639.3:c.88+1178A>G, XM_005269640.1:c.-460+1178A>G, XM_005269640.3:c.-460+1178A>G, XM_005269641.1:c.-460+1178A>G, XM_005269641.3:c.-460+1178A>G, XM_005269642.1:c.-460+1178A>G, XM_005269642.3:c.-460+1178A>G, XM_005269643.1:c.-398-31522A>G, XM_005269643.3:c.-398-31522A>G, XM_005269644.1:c.-484+1178A>G, XM_005269644.3:c.-484+1178A>G, XM_005269645.1:c.-484+1178A>G, XM_005269645.3:c.-484+1178A>G, XM_005269646.1:c.-483-26423A>G, XM_005269646.3:c.-483-26423A>G, XM_006717721.2:c.-459-26423A>G, XM_006717722.2:c.-281+1178A>G, XM_006717723.2:c.-281+1178A>G, XM_006717724.2:c.-305+1178A>G, XM_011539534.1:c.175+1178A>G, XM_011539535.1:c.-1974A>G, XM_011539536.1:c.-43+1178A>G, XM_011539537.1:c.175+1178A>G, rs17728547, rs52826896, rs61084912
T > C
SNP
No VIP available CA VA
rs11615 NC_000019.10:g.45420395A>G, NC_000019.9:g.45923653A>G, NG_015839.2:g.63434T>C, NM_001166049.1:c.354T>C, NM_001983.3:c.354T>C, NM_202001.2:c.354T>C, NP_001159521.1:p.Asn118=, NP_001974.1:p.Asn118=, NP_973730.1:p.Asn118=, XM_005258634.1:c.354T>C, XM_005258635.1:c.354T>C, XM_005258635.2:c.354T>C, XM_005258636.1:c.354T>C, XM_005258636.3:c.354T>C, XM_005258637.1:c.354T>C, XM_005258638.1:c.138T>C, XM_011526610.1:c.354T>C, XP_005258691.1:p.Asn118=, XP_005258692.1:p.Asn118=, XP_005258693.1:p.Asn118=, XP_005258694.1:p.Asn118=, XP_005258695.1:p.Asn46=, XP_011524912.1:p.Asn118=, rs1130005, rs17285882, rs17359303, rs17845191, rs17858003, rs17859564, rs2228629, rs3177700, rs3188446, rs3752251, rs59923575
A > G
SNP
N118N
No VIP available No Clinical Annotations available VA
rs11671784 NC_000019.10:g.13836482G>A, NC_000019.9:g.13947296G>A, NR_029495.1:n.178C>T, NR_029497.1:n.-123C>T, NR_029501.1:n.36C>T, NR_036515.1:n.-193C>T
G > A
SNP
No VIP available No Clinical Annotations available VA
rs11692021 NC_000002.11:g.234591205T>C, NC_000002.12:g.233682559T>C, NG_002601.2:g.97816T>C, NM_019075.2:c.855+45182T>C, NM_019076.4:c.855+63997T>C, NM_019077.2:c.622T>C, NM_021027.2:c.855+9770T>C, NP_061950.2:p.Trp208Arg, XM_005246081.1:c.622T>C, XP_005246138.1:p.Trp208Arg, XR_241241.1:n.941+9770T>C, rs17863779, rs57605148
T > C
SNP
W208R
No VIP available CA VA
rs11719165 NC_000003.11:g.194586088T>C, NC_000003.12:g.194865359T>C, rs57619894
T > C
SNP
No VIP available CA VA
rs12046844 NC_000001.10:g.66238379G>A, NC_000001.11:g.65772696G>A, rs60665040
G > A
SNP
No VIP available No Clinical Annotations available VA
rs12059276 NC_000001.10:g.110273541C>T, NC_000001.11:g.109730919C>T, rs60940964
C > T
SNP
No VIP available No Clinical Annotations available VA
rs1214763 NC_000006.11:g.43360261T>C, NC_000006.12:g.43392523T>C, XR_926814.1:n.400+789T>C, XR_926815.1:n.400+789T>C, rs1772678, rs2153700, rs60427804
T > C
SNP
No VIP available CA VA
rs12201199 NC_000006.11:g.18139802A>T, NC_000006.12:g.18139571A>T, NG_012137.2:g.20573T>A, NM_000367.3:c.419+94T>A, XM_011514839.1:c.419+94T>A, XM_011514840.1:c.350+94T>A, rs58109747
A > T
SNP
No VIP available No Clinical Annotations available VA
rs12211463 NC_000006.11:g.93467158T>G, NC_000006.12:g.92757440T>G, rs59764123
T > G
SNP
No VIP available No Clinical Annotations available VA
rs12468274 NC_000002.11:g.234627914T>C, NC_000002.12:g.233719268T>C, NG_002601.2:g.134525T>C, NM_001072.3:c.861+25403T>C, NM_007120.2:c.448T>C, NM_019075.2:c.856-47766T>C, NM_019076.4:c.856-47766T>C, NM_019077.2:c.855+36476T>C, NM_019078.1:c.867+5410T>C, NM_021027.2:c.855+46479T>C, NM_205862.1:c.60+25403T>C, NP_009051.1:p.Leu150=, XR_241238.1:n.504T>C, XR_241240.1:n.1022+25403T>C, XR_241241.1:n.941+46479T>C
T > C
SNP
L150L
No VIP available No Clinical Annotations available VA
rs12658397 NC_000005.10:g.102415949T>C, NC_000005.9:g.101751653T>C, NM_001289002.1:c.1473-2806A>G, NM_001289004.1:c.1287-2806A>G, NM_001308014.1:c.714-2806A>G, NM_173488.4:c.1473-2806A>G, XM_005271873.1:c.1473-2806A>G, XM_005271874.1:c.1473-2806A>G, XM_005271874.2:c.1473-2806A>G, XM_005271875.1:c.1287-2806A>G, XM_005271876.1:c.1287-2806A>G, XM_005271877.1:c.714-2806A>G, XM_011543147.1:c.1368-2806A>G, XM_011543148.1:c.1236-2806A>G, XM_011543149.1:c.900-2806A>G, XM_011543150.1:c.744-2806A>G, XM_011543151.1:c.714-2806A>G, XM_011543152.1:c.714-2806A>G, XM_011543153.1:c.651-2806A>G, rs61168560
T > C
SNP
No VIP available CA No Variant Annotations available
rs12721627 NC_000007.13:g.99366093G>C, NC_000007.14:g.99768470G>C, NG_008421.1:g.20716C>G, NM_001202855.2:c.554C>G, NM_017460.5:c.554C>G, NP_001189784.1:p.Thr185Ser, NP_059488.2:p.Thr185Ser, XM_011515841.1:c.554C>G, XM_011515842.1:c.554C>G, XP_011514143.1:p.Thr185Ser, XP_011514144.1:p.Thr185Ser, rs28371754, rs56915287
G > C
SNP
T185S
No VIP available No Clinical Annotations available VA
rs12762549 NC_000010.10:g.101620771C>G, NC_000010.11:g.99861014C>G, rs61161342
C > G
SNP
No VIP available CA VA
rs12948783 NC_000017.10:g.74499400G>A, NC_000017.11:g.76503318G>A, NG_032852.1:g.3110C>T, NM_024599.5:c.-2185C>T, XM_005257669.1:c.-2602C>T, XM_005257669.2:c.-2602C>T, XM_005257670.1:c.-2185C>T, XM_005257671.1:c.-2286C>T, XM_011525250.1:c.-2286C>T, XM_011525251.1:c.-2127C>T, XM_011525252.1:c.-2185C>T, rs117129397, rs60624663
G > A
G > T
SNP
No VIP available CA No Variant Annotations available
rs13058338 NC_000022.10:g.37632770T>A, NC_000022.11:g.37236730T>A, NG_007288.1:g.12536A>T, NM_002872.3:c.108-3812A>T, NM_002872.4:c.108-3812A>T, XM_006724286.2:c.108-3812A>T, rs52805510
T > A
T > G
SNP
No VIP available No Clinical Annotations available VA
rs13401281 NC_000002.11:g.234628679T>G, NC_000002.12:g.233720033T>G, NG_002601.2:g.135290T>G, NM_001072.3:c.861+26168T>G, NM_007120.2:c.867+346T>G, NM_019075.2:c.856-47001T>G, NM_019076.4:c.856-47001T>G, NM_019077.2:c.855+37241T>G, NM_019078.1:c.867+6175T>G, NM_021027.2:c.856-47001T>G, NM_205862.1:c.60+26168T>G, XR_241238.1:n.923+346T>G, XR_241240.1:n.1022+26168T>G, XR_241241.1:n.942-47001T>G
T > G
SNP
No VIP available No Clinical Annotations available VA
rs13422094 NC_000002.11:g.22181114T>C, NC_000002.12:g.21958242T>C, XR_939813.1:n.185+6266T>C
T > C
SNP
No VIP available No Clinical Annotations available VA
rs1523127 NC_000003.11:g.119501039C>A, NC_000003.12:g.119782192C>A, NG_011856.1:g.6709C>A, NM_003889.3:c.-131C>A, NM_022002.2:c.-566C>A, NM_033013.2:c.-131C>A, XM_005247866.1:c.-296C>A, rs58645792
C > A
SNP
No VIP available No Clinical Annotations available VA
rs1523130 NC_000003.11:g.119499507T>C, NC_000003.12:g.119780660T>C, NG_011856.1:g.5177T>C, NM_003889.3:c.-1663T>C, NM_033013.2:c.-1663T>C, XM_005247866.1:c.-1828T>C, rs118196528, rs3814054, rs59854583, rs61314694
T > C
SNP
No VIP available No Clinical Annotations available VA
rs1551285 NC_000002.11:g.234529122A>C, NC_000002.12:g.233620476A>C, NG_002601.2:g.35733A>C, NM_019076.4:c.855+1914A>C, rs60826737
A > C
SNP
No VIP available No Clinical Annotations available VA
rs1617640 NC_000007.13:g.100317298C>A, NC_000007.14:g.100719675C>A, NG_021471.1:g.3876C>A, NM_000799.2:c.-1306C>A, XM_005250190.1:c.-1306C>A, rs10304599, rs10342152, rs57979509
C > A
SNP
No VIP available No Clinical Annotations available VA
rs165728 NC_000022.10:g.19957023C>T, NC_000022.11:g.19969500C>T, NG_011526.1:g.32761C>T, NG_023326.1:g.52287G>A, NM_000754.3:c.*764C>T, NM_001135161.1:c.*764C>T, NM_001135162.1:c.*764C>T, NM_001670.2:c.*1256G>A, NM_001670.2:c.*877+379G>A, NM_007310.2:c.*764C>T, XM_005261229.1:c.*764C>T, XM_005261242.1:c.2764-2291G>A, XM_005261243.1:c.*1256G>A, XM_005261243.3:c.*1256G>A, XM_005261244.1:c.*1217G>A, XM_005261244.3:c.*1217G>A, XM_006724243.1:c.2782-2291G>A, XM_006724245.2:c.*1217G>A, XM_006724246.2:c.2536-2291G>A, XM_006724247.2:c.*1256G>A, XM_006724248.2:c.*1256G>A, XM_011529886.1:c.*764C>T, XM_011530179.1:c.2749-2291G>A, XM_011530182.1:c.1348-2291G>A, XM_011530183.1:c.*1217G>A, XR_937863.1:n.4112G>A, rs59845570
C > T
SNP
No VIP available CA No Variant Annotations available
rs1695 NC_000011.10:g.67585218A>G, NC_000011.9:g.67352689A>G, NG_012075.1:g.6624A>G, NM_000852.3:c.313A>G, NP_000843.1:p.Ile105Val, XM_005273958.1:c.313A>G, XP_005274015.1:p.Ile105Val, rs1138257, rs11553891, rs17353321, rs17856342, rs2230827, rs4609, rs56971933, rs947894
A > G
SNP
I105V
No VIP available No Clinical Annotations available VA
rs17216177 NC_000010.10:g.101603522T>C, NC_000010.11:g.99843765T>C, NG_011798.1:g.66060T>C, NM_000392.4:c.3742-34T>C, XM_005269536.1:c.3463-34T>C, XM_006717630.2:c.3046-34T>C, XR_945604.1:n.3931-34T>C, XR_945605.1:n.3806-34T>C, rs45616434
T > C
SNP
No VIP available No Clinical Annotations available VA
rs17287570 NC_000016.10:g.16061246A=, NC_000016.10:g.16061246A>C, NC_000016.9:g.16155103A>C, NG_028268.1:g.116670A=, NG_028268.1:g.116670A>C, NM_004996.3:c.1677+4951A>C, NM_004996.3:c.1677+4951C>A, NT_187607.1:g.1719137C=, NT_187607.1:g.1719137C>A, XM_005255326.1:c.1677+4951A>C, XM_005255327.1:c.1551+4951A>C, XM_005255328.1:c.1539+4951A>C, XM_005255329.1:c.1677+4951A>C, XM_011522497.1:c.1653+4951A>C, XM_011522497.1:c.1653+4951C>A, XM_011522498.1:c.1731+4951A>C, XM_011522498.1:c.1731+4951C>A, rs57882411
A > C
SNP
No VIP available CA VA
rs1736557 NC_000001.10:g.171080080G>A, NC_000001.11:g.171110939G>A, NG_012690.1:g.25063G>A, NM_001002294.2:c.769G>A, NM_001319173.1:c.709G>A, NM_001319174.1:c.580G>A, NM_006894.4:c.769G>A, NM_006894.5:c.769G>A, NP_001002294.1:p.Val257Met, NP_001306102.1:p.Val237Met, NP_001306103.1:p.Val194Met, NP_008825.4:p.Val257Met, XM_005245043.1:c.709G>A, XM_005245044.1:c.580G>A, XM_011509345.1:c.709G>A, XM_011509346.1:c.709G>A, XP_005245100.1:p.Val237Met, XP_005245101.1:p.Val194Met, XP_011507647.1:p.Val237Met, XP_011507648.1:p.Val237Met, rs17845981, rs17858963, rs56477964, rs58508781
G > A
SNP
V257M
No VIP available CA VA
rs17376848 NC_000001.10:g.97915624A>G, NC_000001.11:g.97450068A>G, NG_008807.2:g.475992T>C, NM_000110.3:c.1896T>C, NP_000101.2:p.Phe632=, XM_005270561.1:c.1785T>C, XM_005270562.1:c.1680T>C, XM_005270562.3:c.1680T>C, XM_005270563.1:c.1896T>C, XM_006710397.2:c.1896T>C, XP_005270618.1:p.Phe595=, XP_005270619.1:p.Phe560=, XP_005270619.2:p.Phe560=, XP_005270620.1:p.Phe632=, XP_006710460.1:p.Phe632=, rs117467766, rs52815410, rs58485702
A > G
SNP
F632F
No VIP available No Clinical Annotations available VA
rs174699 NC_000022.10:g.19954458C>T, NC_000022.11:g.19966935C>T, NG_011526.1:g.30196C>T, NM_000754.3:c.616-1601C>T, NM_001135161.1:c.616-1601C>T, NM_001135162.1:c.616-1601C>T, NM_007310.2:c.466-1601C>T, XM_005261229.1:c.616-1601C>T, XM_005261242.1:c.*41G>A, XM_006724243.1:c.*41G>A, XM_006724246.2:c.*41G>A, XM_011529885.1:c.730-229C>T, XM_011529886.1:c.730-1601C>T, XM_011529887.1:c.616-229C>T, XM_011529888.1:c.616-229C>T, XM_011529889.1:c.616-229C>T, XM_011529890.1:c.616-229C>T, XM_011529891.1:c.616-229C>T, XM_011530179.1:c.*41G>A, XM_011530182.1:c.*41G>A, rs361592, rs59292400, rs59837580
C > T
SNP
No VIP available CA VA
rs17583889 NC_000002.11:g.138746039C>A, NC_000002.12:g.137988469C>A, NG_012966.1:g.29232C>A, NM_006895.2:c.191-12449C>A, XM_005263654.1:c.191-12449C>A, XM_011511063.1:c.89-12449C>A, XM_011511064.1:c.-188-12449C>A
C > A
SNP
No VIP available CA VA
rs17645700 NC_000002.11:g.138780932T>C, NC_000002.12:g.138023362T>C, XR_244863.1:n.579-15566A>G
T > C
SNP
No VIP available No Clinical Annotations available VA
rs17822471 NC_000016.10:g.48208468G>A, NC_000016.9:g.48242379G>A, NG_011522.1:g.31710C>T, NM_032583.3:c.1637C>T, NM_033151.3:c.1637C>T, NM_145186.2:c.1637C>T, NP_115972.2:p.Thr546Met, NP_149163.2:p.Thr546Met, NP_660187.1:p.Thr546Met, XM_005256208.1:c.1637C>T, XM_005256209.1:c.1637C>T, XM_005256210.1:c.1637C>T, XM_011523396.1:c.1439C>T, XM_011523397.1:c.680C>T, XP_005256265.1:p.Thr546Met, XP_005256266.1:p.Thr546Met, XP_005256267.1:p.Thr546Met, XP_011521698.1:p.Thr480Met, XP_011521699.1:p.Thr227Met, XR_243432.1:n.1742C>T, rs386492901, rs52810988, rs57560138
G > A
SNP
T546M
No VIP available No Clinical Annotations available VA
rs17822931 NC_000016.10:g.48224287C>T, NC_000016.9:g.48258198C>T, NG_011522.1:g.15891G>A, NM_032583.3:c.538G>A, NM_033151.3:c.538G>A, NM_145186.2:c.538G>A, NP_115972.2:p.Gly180Arg, NP_149163.2:p.Gly180Arg, NP_660187.1:p.Gly180Arg, XM_005256208.1:c.538G>A, XM_005256209.1:c.538G>A, XM_005256210.1:c.538G>A, XM_011523396.1:c.340G>A, XM_011523397.1:c.-1144G>A, XP_005256265.1:p.Gly180Arg, XP_005256266.1:p.Gly180Arg, XP_005256267.1:p.Gly180Arg, XP_011521698.1:p.Gly114Arg, XR_243432.1:n.643G>A, rs52813591, rs58140753
C > T
SNP
G180R
No VIP available CA VA
rs17863783 NC_000002.11:g.234602277G>T, NC_000002.12:g.233693631G>T, NG_002601.2:g.108888G>T, NM_001072.3:c.627G>T, NM_019075.2:c.855+56254G>T, NM_019076.4:c.856-73403G>T, NM_019077.2:c.855+10839G>T, NM_021027.2:c.855+20842G>T, NM_205862.1:c.-7-168G>T, NP_001063.2:p.Val209=, XR_241240.1:n.788G>T, XR_241241.1:n.941+20842G>T, rs60686635
G > T
SNP
V209V
No VIP available CA VA
rs17868320 NC_000002.11:g.234578428C>T, NC_000002.12:g.233669782C>T, NG_002601.2:g.85039C>T, NM_019075.2:c.855+32405C>T, NM_019076.4:c.855+51220C>T
C > T
SNP
No VIP available No Clinical Annotations available VA
rs17868323 NC_000002.11:g.234590970T>G, NC_000002.12:g.233682324T>G, NG_002601.2:g.97581T>G, NM_019075.2:c.855+44947T>G, NM_019076.4:c.855+63762T>G, NM_019077.2:c.387T>G, NM_021027.2:c.855+9535T>G, NP_061950.2:p.Asn129Lys, XM_005246081.1:c.387T>G, XP_005246138.1:p.Asn129Lys, XR_241241.1:n.941+9535T>G
T > G
SNP
N129K
No VIP available No Clinical Annotations available VA
rs1799782 NC_000019.10:g.43553422G>A, NC_000019.9:g.44057574G>A, NG_033799.1:g.27157C>T, NM_006297.2:c.580C>T, NP_006288.2:p.Arg194Trp, rs11553655, rs2229674, rs3213359, rs3826914, rs386545546
G > A
SNP
R194W
No VIP available CA No Variant Annotations available
rs1799793 NC_000019.10:g.45364001C>T, NC_000019.9:g.45867259C>T, NG_007067.2:g.11587G>A, NM_000400.3:c.934G>A, NM_001130867.1:c.862G>A, NP_000391.1:p.Asp312Asn, NP_001124339.1:p.Asp288Asn, XM_005258639.1:c.862G>A, XM_005258640.1:c.700G>A, XM_005258641.1:c.196G>A, XM_005258642.1:c.934G>A, XM_011526611.1:c.856G>A, XP_005258696.1:p.Asp288Asn, XP_005258697.1:p.Asp234Asn, XP_005258698.1:p.Asp66Asn, XP_005258699.1:p.Asp312Asn, XP_011524913.1:p.Asp286Asn, XR_935763.1:n.981G>A, rs3916814, rs58989209
C > T
SNP
D312N
No VIP available No Clinical Annotations available VA
rs1799971 NC_000006.11:g.154360797A>G, NC_000006.12:g.154039662A>G, NG_021208.1:g.34162A>G, NM_000914.4:c.118A>G, NM_001008503.2:c.118A>G, NM_001008504.3:c.118A>G, NM_001008505.2:c.118A>G, NM_001145279.3:c.397A>G, NM_001145280.3:c.-11+28644A>G, NM_001145281.2:c.47+29103A>G, NM_001145282.2:c.118A>G, NM_001145283.2:c.118A>G, NM_001145284.3:c.118A>G, NM_001145285.2:c.118A>G, NM_001145286.2:c.118A>G, NM_001285522.1:c.118A>G, NM_001285523.1:c.118A>G, NM_001285524.1:c.397A>G, NP_000905.3:p.Asn40Asp, NP_001008503.2:p.Asn40Asp, NP_001008504.2:p.Asn40Asp, NP_001008505.2:p.Asn40Asp, NP_001138751.1:p.Asn133Asp, NP_001138754.1:p.Asn40Asp, NP_001138755.1:p.Asn40Asp, NP_001138756.1:p.Asn40Asp, NP_001138757.1:p.Asn40Asp, NP_001138758.1:p.Asn40Asp, NP_001272451.1:p.Asn40Asp, NP_001272452.1:p.Asn40Asp, NP_001272453.1:p.Asn133Asp, NR_104348.1:n.252A>G, NR_104349.1:n.252A>G, NR_104350.1:n.252A>G, NR_104351.1:n.252A>G, XM_005267002.1:c.304A>G, XM_006715497.2:c.304A>G, XM_011535849.1:c.397A>G, XP_005267059.1:p.Asn102Asp, XP_006715560.1:p.Asn102Asp, XP_011534151.1:p.Asn133Asp, XR_245534.1:n.304A>G, XR_245535.1:n.304A>G, XR_245536.1:n.304A>G, XR_245537.1:n.304A>G, rs17181017, rs52818856, rs61596185
A > G
SNP
N40D
No VIP available CA No Variant Annotations available
rs1799983 NC_000007.13:g.150696111T>G, NC_000007.14:g.150999023T>G, NG_011992.1:g.12965T>G, NM_000603.4:c.894T>G, NM_001160109.1:c.894T>G, NM_001160110.1:c.894T>G, NM_001160111.1:c.894T>G, NP_000594.2:p.Asp298Glu, NP_001153581.1:p.Asp298Glu, NP_001153582.1:p.Asp298Glu, NP_001153583.1:p.Asp298Glu, XM_006716002.2:c.894T>G, XP_006716065.1:p.Asp298Glu, rs11266811, rs13238975, rs13305983, rs13308813, rs17173672, rs3730304, rs57135373
T > G
SNP
D298E
No VIP available CA VA
rs1800460 NC_000006.11:g.18139228C>T, NC_000006.12:g.18138997C>T, NG_012137.2:g.21147G>A, NM_000367.3:c.460G>A, NP_000358.1:p.Ala154Thr, XM_011514839.1:c.460G>A, XM_011514840.1:c.391G>A, XP_011513141.1:p.Ala154Thr, XP_011513142.1:p.Ala131Thr, rs11568060, rs16880273, rs386545583, rs57650974
C > T
SNP
A154T
No VIP available CA No Variant Annotations available
rs1800566 NC_000016.10:g.69711242G>A, NC_000016.9:g.69745145G>A, NG_011504.1:g.20389C>T, NM_000903.2:c.559C>T, NM_001025433.1:c.457C>T, NM_001025434.1:c.445C>T, NM_001286137.1:c.343C>T, NP_000894.1:p.Pro187Ser, NP_001020604.1:p.Pro153Ser, NP_001020605.1:p.Pro149Ser, NP_001273066.1:p.Pro115Ser, XM_005255830.1:c.343C>T, XP_005255887.1:p.Pro115Ser, rs4134727, rs4149351, rs57135274
G > A
SNP
P187S
No VIP available No Clinical Annotations available VA
rs1801030 NC_000016.10:g.28606164C>T, NC_000016.9:g.28617485C>T, NG_028128.1:g.22382G>A, NM_001055.3:c.667G>A, NM_001310136.1:c.121-139262G>A, NM_177529.2:c.667G>A, NM_177530.2:c.667G>A, NM_177534.2:c.667G>A, NM_177536.3:c.433G>A, NP_001046.2:p.Val223Met, NP_803565.1:p.Val223Met, NP_803566.1:p.Val223Met, NP_803878.1:p.Val223Met, NP_803880.1:p.Val145Met, XM_005255522.1:c.667G>A, XP_005255579.1:p.Val223Met, rs61167940, rs8054402
C > T
SNP
V223M
No VIP available CA VA
rs1801131 NC_000001.10:g.11854476T>G, NC_000001.11:g.11794419T>G, NG_013351.1:g.16685A>C, NM_005957.4:c.1286A>C, NP_005948.3:p.Glu429Ala, XM_005263458.1:c.1409A>C, XM_005263458.2:c.1409A>C, XM_005263459.1:c.1355A>C, XM_005263460.1:c.1286A>C, XM_005263460.3:c.1286A>C, XM_005263461.1:c.1286A>C, XM_005263461.3:c.1286A>C, XM_005263462.1:c.1286A>C, XM_005263462.3:c.1286A>C, XM_005263463.1:c.1040A>C, XM_005263463.2:c.1040A>C, XM_011541495.1:c.1406A>C, XM_011541496.1:c.1409A>C, XP_005263515.1:p.Glu470Ala, XP_005263516.1:p.Glu452Ala, XP_005263517.1:p.Glu429Ala, XP_005263518.1:p.Glu429Ala, XP_005263519.1:p.Glu429Ala, XP_005263520.1:p.Glu347Ala, XP_011539797.1:p.Glu469Ala, XP_011539798.1:p.Glu470Ala, rs17367365, rs17857426, rs4134712
T > G
SNP
E429A
No VIP available CA VA
rs1801133 NC_000001.10:g.11856378G>A, NC_000001.11:g.11796321G>A, NG_013351.1:g.14783C>T, NM_005957.4:c.665C>T, NP_005948.3:p.Ala222Val, XM_005263458.1:c.788C>T, XM_005263458.2:c.788C>T, XM_005263459.1:c.734C>T, XM_005263460.1:c.665C>T, XM_005263460.3:c.665C>T, XM_005263461.1:c.665C>T, XM_005263461.3:c.665C>T, XM_005263462.1:c.665C>T, XM_005263462.3:c.665C>T, XM_005263463.1:c.419C>T, XM_005263463.2:c.419C>T, XM_011541495.1:c.785C>T, XM_011541496.1:c.788C>T, XP_005263515.1:p.Ala263Val, XP_005263516.1:p.Ala245Val, XP_005263517.1:p.Ala222Val, XP_005263518.1:p.Ala222Val, XP_005263519.1:p.Ala222Val, XP_005263520.1:p.Ala140Val, XP_011539797.1:p.Ala262Val, XP_011539798.1:p.Ala263Val, rs386545618, rs4134713, rs59514310
G > A
SNP
A222V
No VIP available CA VA
rs1801158 NC_000001.10:g.97981421C>T, NC_000001.11:g.97515865C>T, NG_008807.2:g.410195G>A, NM_000110.3:c.1601G>A, NP_000101.2:p.Ser534Asn, XM_005270561.1:c.1490G>A, XM_005270562.1:c.1524+33695G>A, XM_005270562.3:c.1524+33695G>A, XM_005270563.1:c.1601G>A, XM_005270564.1:c.1601G>A, XM_006710397.2:c.1601G>A, XP_005270618.1:p.Ser497Asn, XP_005270620.1:p.Ser534Asn, XP_005270621.1:p.Ser534Asn, XP_006710460.1:p.Ser534Asn, rs199469539, rs52824375, rs59516208
C > T
SNP
S534N
No VIP available CA VA
rs1801159 NC_000001.10:g.97981395T>C, NC_000001.11:g.97515839T>C, NG_008807.2:g.410221A>G, NM_000110.3:c.1627A>G, NP_000101.2:p.Ile543Val, XM_005270561.1:c.1516A>G, XM_005270562.1:c.1524+33721A>G, XM_005270562.3:c.1524+33721A>G, XM_005270563.1:c.1627A>G, XM_005270564.1:c.1627A>G, XM_006710397.2:c.1627A>G, XP_005270618.1:p.Ile506Val, XP_005270620.1:p.Ile543Val, XP_005270621.1:p.Ile543Val, XP_006710460.1:p.Ile543Val, rs117999026, rs17116825, rs199469541, rs386545620, rs58945530
T > C
SNP
I543V
No VIP available CA VA
rs1801160 NC_000001.10:g.97770920C>T, NC_000001.11:g.97305364C>T, NG_008807.2:g.620696G>A, NM_000110.3:c.2194G>A, NP_000101.2:p.Val732Ile, NR_046590.1:n.129-825C>T, XM_005270561.1:c.2083G>A, XM_005270562.1:c.1978G>A, XM_005270562.3:c.1978G>A, XM_005270563.1:c.2194G>A, XM_006710397.2:c.2194G>A, XP_005270618.1:p.Val695Ile, XP_005270619.1:p.Val660Ile, XP_005270619.2:p.Val660Ile, XP_005270620.1:p.Val732Ile, XP_006710460.1:p.Val732Ile, rs12720467, rs12720468, rs199469554
C > T
SNP
V732I
No VIP available CA VA
rs1801265 NC_000001.10:g.98348885G=, NC_000001.10:g.98348885G>A, NC_000001.11:g.97883329A=, NC_000001.11:g.97883329A>G, NG_008807.2:g.42731T=, NG_008807.2:g.42731T>C, NM_000110.3:c.85T=, NM_000110.3:c.85T>C, NM_001160301.1:c.85T=, NM_001160301.1:c.85T>C, NP_000101.2:p.Cys29=, NP_000101.2:p.Cys29Arg, NP_001153773.1:p.Cys29=, NP_001153773.1:p.Cys29Arg, XM_005270561.1:c.39+37555C>T, XM_005270561.1:c.39+37555T>C, XM_005270562.1:c.85C=, XM_005270562.1:c.85C>T, XM_005270562.3:c.85T=, XM_005270562.3:c.85T>C, XM_005270563.1:c.85C=, XM_005270563.1:c.85C>T, XM_005270564.1:c.85C=, XM_005270564.1:c.85C>T, XM_006710397.2:c.85T=, XM_006710397.2:c.85T>C, XP_005270619.1:p.Arg29=, XP_005270619.1:p.Arg29Cys, XP_005270619.2:p.Cys29=, XP_005270619.2:p.Cys29Arg, XP_005270620.1:p.Arg29=, XP_005270620.1:p.Arg29Cys, XP_005270621.1:p.Arg29=, XP_005270621.1:p.Arg29Cys, XP_006710460.1:p.Cys29=, XP_006710460.1:p.Cys29Arg, rs199469510, rs3211355, rs52823090, rs57596852
G > A
SNP
C29R
No VIP available CA VA
rs183205964 NC_000018.10:g.657657G>C, NC_000018.9:g.657657G>C, NG_028255.1:g.5054G>C, NM_001012716.2:c.*34+185C>G, NM_001071.2:c.-86G>C, XM_005258137.1:c.-86G>C, XM_005258138.1:c.-86G>C
G > C
SNP
No VIP available CA No Variant Annotations available
rs183484 NC_000011.10:g.4119902C>A, NC_000011.9:g.4141132C>A, NG_027992.2:g.30209C>A, NM_001033.3:c.850C>A, NM_001033.4:c.850C>A, NM_001318064.1:c.559C>A, NM_001318065.1:c.-207C>A, NP_001024.1:p.Arg284=, NP_001304993.1:p.Arg187=, XM_005253058.1:c.607C>A, XM_005253059.1:c.559C>A, XM_011520277.1:c.559C>A, XM_011520278.1:c.184C>A, XM_011520279.1:c.-207C>A, XP_005253115.1:p.Arg203=, XP_005253116.1:p.Arg187=, XP_011518579.1:p.Arg187=, XP_011518580.1:p.Arg62=, rs17210748, rs1735058, rs17850105, rs2228122
C > A
SNP
R284R
No VIP available CA No Variant Annotations available
rs1883112 NC_000022.10:g.37256846G>A, NC_000022.11:g.36860804G>A, NG_023400.1:g.4817G>A, NM_000631.4:c.-368G>A, NM_013416.3:c.-368G>A, NT_187631.1:g.81598G>A, XM_011530198.1:c.-1851G>A, XM_011530199.1:c.-915G>A, rs13055287, rs34673077, rs61381844
G > A
SNP
No VIP available No Clinical Annotations available VA
rs1885301 NC_000010.10:g.101541053A>G, NC_000010.11:g.99781296A>G, NG_011798.1:g.3591A>G, NM_000392.4:c.-1549A>G, XM_005269536.1:c.-1549A>G, XM_006717631.2:c.-1549A>G, XM_011539291.1:c.-1549A>G, XR_945604.1:n.-1360A>G, XR_945605.1:n.-1358A>G, rs17216261, rs59934936
A > G
SNP
No VIP available CA VA
rs1901440 NC_000002.11:g.134437959C>A, NC_000002.12:g.133680388C>A, rs60584215
C > A
SNP
No VIP available No Clinical Annotations available VA
rs2010963 NC_000006.11:g.43738350C>G, NC_000006.12:g.43770613C>G, NG_008732.1:g.5398C>G, NM_001025366.2:c.-94C>G, NM_001025367.2:c.-94C>G, NM_001025368.2:c.-94C>G, NM_001025369.2:c.-94C>G, NM_001025370.2:c.-94C>G, NM_001033756.2:c.-94C>G, NM_001171622.1:c.-94C>G, NM_001171623.1:c.-634C>G, NM_001171624.1:c.-634C>G, NM_001171625.1:c.-634C>G, NM_001171626.1:c.-634C>G, NM_001171627.1:c.-634C>G, NM_001171628.1:c.-634C>G, NM_001171629.1:c.-634C>G, NM_001171630.1:c.-634C>G, NM_001204384.1:c.-634C>G, NM_001204385.1:c.-94C>G, NM_001287044.1:c.-1507C>G, NM_001317010.1:c.-634C>G, NM_003376.5:c.-94C>G, XM_005249363.1:c.-1507C>G
C > G
SNP
No VIP available No Clinical Annotations available VA
rs2011404 NC_000002.11:g.234627937T>C, NC_000002.12:g.233719291T>C, NG_002601.2:g.134548T>C, NM_001072.3:c.861+25426T>C, NM_007120.2:c.471T>C, NM_019075.2:c.856-47743T>C, NM_019076.4:c.856-47743T>C, NM_019077.2:c.855+36499T>C, NM_019078.1:c.867+5433T>C, NM_021027.2:c.855+46502T>C, NM_205862.1:c.60+25426T>C, NP_009051.1:p.Cys157=, XR_241238.1:n.527T>C, XR_241240.1:n.1022+25426T>C, XR_241241.1:n.941+46502T>C, rs17633274, rs17866660, rs56712128
T > C
SNP
C157C
No VIP available CA VA
rs2019604 NC_000016.10:g.89549357T>G, NC_000016.9:g.89615765T>G, NG_008082.1:g.45961T>G, NM_003119.3:c.1664-1137T>G, XM_005256320.1:c.-21+2427T>G, XM_006721264.2:c.1664-1137T>G, rs17783931, rs3888234, rs57996679, rs74251519
T > G
SNP
No VIP available No Clinical Annotations available VA
rs2020870 NC_000001.10:g.171154959A>G, NC_000001.11:g.171185820A>G, NM_001301347.1:c.-386+461A>G, NM_001460.4:c.107A>G, NP_001451.2:p.Asp36Gly, XM_005245039.1:c.107A>G, XP_005245096.1:p.Asp36Gly, XR_426768.2:n.224A>G, XR_921761.1:n.224A>G, XR_922278.1:n.508-17632T>C, rs2266712, rs52821140, rs58458262
A > G
SNP
D36G
No VIP available No Clinical Annotations available VA
rs2032582 NC_000007.13:g.87160618A>C, NC_000007.13:g.87160618A>T, NC_000007.14:g.87531302A>C, NC_000007.14:g.87531302A>T, NG_011513.1:g.186947T>A, NG_011513.1:g.186947T>G, NM_000927.4:c.2677T>A, NM_000927.4:c.2677T>G, NP_000918.2:p.Ser893Ala, NP_000918.2:p.Ser893Thr, rs10228331, rs2229106, rs386553610, rs57135550, rs9641018
A > C
SNP
S893A
No VIP available No Clinical Annotations available VA
rs2070474 NC_000022.10:g.24891292C>G, NC_000022.11:g.24495324C>G, NG_012858.1:g.5042C>G, NM_016327.2:c.-80C>G, NR_028483.2:n.-250G>C, NR_028484.2:n.-250G>C, XM_005261633.1:c.-112C>G, XM_011530222.1:c.-80C>G, XM_011530223.1:c.-80C>G, XM_011530224.1:c.-80C>G, XM_011530225.1:c.-522C>G, XR_244378.1:n.265C>G, XR_937867.1:n.858C>G, rs199469575
C > G
SNP
No VIP available No Clinical Annotations available VA
rs2072671 NC_000001.10:g.20915701A>C, NC_000001.11:g.20589208A>C, NM_001785.2:c.79A>C, NP_001776.1:p.Lys27Gln, rs57221291
A > C
SNP
K27Q
No VIP available CA VA
rs2075252 NC_000002.11:g.170010985T>C, NC_000002.12:g.169154475T>C, NG_012634.1:g.213138A>G, NM_004525.2:c.12280A>G, NP_004516.2:p.Lys4094Glu, XM_005246551.1:c.9991A>G, XM_011511183.1:c.12151A>G, XM_011511184.1:c.9991A>G, XP_005246608.1:p.Lys3331Glu, XP_011509485.1:p.Lys4051Glu, XP_011509486.1:p.Lys3331Glu, rs17848193, rs386556527, rs52808684, rs59573352
T > C
SNP
K4094E
No VIP available No Clinical Annotations available VA
rs2075507 NC_000022.10:g.19928092G>A, NC_000022.11:g.19940569G>A, NG_011526.1:g.3830G>A, NG_011835.1:g.6268C>T, NM_000754.3:c.-1420G>A, NM_001282512.1:c.103+1132C>T, NM_006440.3:c.103+1132C>T, NM_006440.4:c.103+1132C>T, XM_005261214.1:c.103+1132C>T, XM_005261216.1:c.103+1132C>T, XM_005261217.1:c.103+1132C>T, XM_005261229.1:c.-1714G>A, XM_011529887.1:c.-1420G>A, XM_011529890.1:c.-1714G>A, XM_011529891.1:c.-1992G>A, rs2097603, rs2234763, rs3937420, rs4646309
G > A
SNP
No VIP available CA VA
rs2108623 NC_000019.10:g.15906196G>A, NC_000019.9:g.16017006G>A, rs17454858, rs3947944, rs4429395, rs59294251
G > A
SNP
No VIP available No Clinical Annotations available VA
rs2180314 NC_000006.11:g.52617731C>G, NC_000006.12:g.52752933C>G, NG_029430.1:g.15631G>C, NM_000846.4:c.335G>C, NP_000837.3:p.Ser112Thr, XM_011514532.1:c.335G>C, XP_011512834.1:p.Ser112Thr, rs17605670, rs17849682, rs3178048, rs52806894, rs57248371
C > G
SNP
S112T
No VIP available CA No Variant Annotations available
rs2207396 NC_000006.11:g.152382382G>A, NC_000006.12:g.152061247G>A, NG_008493.1:g.375752G>A, NM_000125.3:c.1369+123G>A, NM_001122740.1:c.1369+123G>A, NM_001122741.1:c.1369+123G>A, NM_001122742.1:c.1369+123G>A, NM_001291230.1:c.1375+123G>A, NM_001291241.1:c.1366+123G>A, XM_005266856.1:c.1375+123G>A, XM_005266857.1:c.1366+123G>A, XM_006715374.2:c.1369+123G>A, XM_006715375.2:c.850+123G>A, XM_011535543.1:c.1369+123G>A, XM_011535544.1:c.1369+123G>A, XM_011535545.1:c.1369+123G>A, XM_011535546.1:c.1369+123G>A, XM_011535547.1:c.1369+123G>A, XM_011535548.1:c.850+123G>A, XM_011535549.1:c.640+123G>A, XR_943116.1:n.7257C>T, rs17847072, rs57792040
G > A
SNP
No VIP available CA VA
rs2227983 NC_000007.13:g.55229255G>A, NC_000007.14:g.55161562G>A, NG_007726.3:g.147531G>A, NM_005228.3:c.1562G>A, NM_201282.1:c.1562G>A, NM_201284.1:c.1562G>A, NP_005219.2:p.Arg521Lys, NP_958439.1:p.Arg521Lys, NP_958441.1:p.Arg521Lys, XM_005271746.1:c.1427G>A, XM_005271747.1:c.1403G>A, XM_005271748.1:c.1562G>A, XP_005271803.1:p.Arg476Lys, XP_005271804.1:p.Arg468Lys, XP_005271805.1:p.Arg521Lys, rs11543848, rs117960725, rs12234746, rs17336807, rs3752650
G > A
SNP
R521K
No VIP available CA No Variant Annotations available
rs2228001 NC_000003.11:g.14187449G>T, NC_000003.12:g.14145949G>T, NG_011763.1:g.37724C>A, NM_001145769.1:c.2704C>A, NM_004628.4:c.2815C>A, NP_001139241.1:p.Gln902Lys, NP_004619.3:p.Gln939Lys, NR_027299.1:n.2795C>A, rs17620623, rs17856505, rs3729583, rs60736379
G > T
SNP
Q902K
No VIP available No Clinical Annotations available VA
rs2228100 NC_000017.10:g.19642952G>C, NC_000017.11:g.19739639G>C, NG_012251.1:g.13795C>G, NM_000691.4:c.985C>G, NM_001135167.1:c.985C>G, NM_001135168.1:c.985C>G, NP_000682.3:p.Pro329Ala, NP_001128639.1:p.Pro329Ala, NP_001128640.1:p.Pro329Ala, XM_005256522.1:c.1336C>G, XM_005256523.1:c.1336C>G, XM_005256523.2:c.1336C>G, XM_005256524.1:c.1336C>G, XM_005256524.3:c.1336C>G, XM_005256525.1:c.1336C>G, XM_005256526.1:c.766C>G, XM_011523730.1:c.766C>G, XM_011523731.1:c.766C>G, XP_005256579.1:p.Pro446Ala, XP_005256580.1:p.Pro446Ala, XP_005256581.1:p.Pro446Ala, XP_005256582.1:p.Pro446Ala, XP_005256583.1:p.Pro256Ala, XP_011522032.1:p.Pro256Ala, XP_011522033.1:p.Pro256Ala, rs3744696, rs56956419
G > C
SNP
P329A
No VIP available CA VA
rs2228171 NC_000002.11:g.170053505C>T, NC_000002.12:g.169196995C>T, NG_012634.1:g.170618G>A, NM_004525.2:c.8614G>A, NP_004516.2:p.Ala2872Thr, XM_005246551.1:c.6325G>A, XM_005246552.1:c.8614G>A, XM_011511183.1:c.8614G>A, XM_011511184.1:c.6325G>A, XM_011511185.1:c.8614G>A, XP_005246608.1:p.Ala2109Thr, XP_005246609.1:p.Ala2872Thr, XP_011509485.1:p.Ala2872Thr, XP_011509486.1:p.Ala2109Thr, XP_011509487.1:p.Ala2872Thr, rs117432666, rs17848174, rs2302697, rs4668123, rs52816657, rs57579868
C > T
SNP
A2872T
No VIP available CA VA
rs2229774 NC_000012.11:g.53605545G>A, NC_000012.12:g.53211761G>A, NG_029822.1:g.25496C>T, NM_000966.5:c.1280C>T, NM_001042728.2:c.1247C>T, NM_001243730.1:c.1064C>T, NM_001243731.1:c.917C>T, NM_001243732.1:c.1214C>T, NP_000957.1:p.Ser427Leu, NP_001036193.1:p.Ser416Leu, NP_001230659.1:p.Ser355Leu, NP_001230660.1:p.Ser306Leu, NP_001230661.1:p.Ser405Leu, XM_005269054.1:c.1541C>T, XM_005269054.2:c.1541C>T, XM_005269055.1:c.1541C>T, XM_005269055.2:c.1541C>T, XM_005269056.1:c.1280C>T, XM_005269056.2:c.1280C>T, XM_005269057.1:c.1280C>T, XM_011538628.1:c.1064C>T, XP_005269111.1:p.Ser514Leu, XP_005269112.1:p.Ser514Leu, XP_005269113.1:p.Ser427Leu, XP_005269114.1:p.Ser427Leu, XP_011536930.1:p.Ser355Leu, rs116930311, rs61642612
G > A
SNP
S427L
No VIP available CA VA
rs2231142 NC_000004.11:g.89052323G>T, NC_000004.12:g.88131171G>T, NG_032067.2:g.105152C>A, NM_001257386.1:c.421C>A, NM_004827.2:c.421C>A, NP_001244315.1:p.Gln141Lys, NP_004818.2:p.Gln141Lys, XM_005263354.1:c.421C>A, XM_005263354.2:c.421C>A, XM_005263355.1:c.421C>A, XM_005263355.2:c.421C>A, XM_005263356.1:c.421C>A, XM_005263356.2:c.421C>A, XM_011532420.1:c.421C>A, XP_005263411.1:p.Gln141Lys, XP_005263412.1:p.Gln141Lys, XP_005263413.1:p.Gln141Lys, XP_011530722.1:p.Gln141Lys, rs12721641, rs28365035, rs3736117, rs52809243, rs58973676
G > T
SNP
Q141K
No VIP available No Clinical Annotations available VA
rs2232228 NC_000016.10:g.69109674A>G, NC_000016.9:g.69143577A>G, NM_001199280.1:c.279A>G, NM_005329.2:c.279A>G, NM_138612.2:c.279A>G, NP_001186209.1:p.Ala93=, NP_005320.2:p.Ala93=, NP_619515.1:p.Ala93=, XM_005255919.1:c.687A>G, XM_005255920.1:c.279A>G, XM_005255921.1:c.279A>G, XM_011523061.1:c.279A>G, XP_005255976.1:p.Ala229=, XP_005255977.1:p.Ala93=, XP_005255978.1:p.Ala93=, XP_011521363.1:p.Ala93=, rs17845662, rs17858598, rs3743679, rs61175697
A > G
SNP
A93A
No VIP available No Clinical Annotations available VA
rs2233302 NC_000005.10:g.151035537C>G, NC_000005.9:g.150415098C>G, NG_030590.1:g.57124G>C, NM_001252385.1:c.1521+45G>C, NM_001252386.1:c.1362+45G>C, NM_001252390.1:c.1521+45G>C, NM_001252391.1:c.1521+45G>C, NM_001252392.1:c.1521+45G>C, NM_001252393.1:c.1521+45G>C, NM_001258454.1:c.1521+45G>C, NM_001258455.1:c.1521+45G>C, NM_001258456.1:c.1521+45G>C, NM_006058.4:c.1521+45G>C, XM_005268355.1:c.1521+45G>C, XM_006714751.1:c.1521+45G>C, XM_006714752.1:c.1521+45G>C, XM_011537538.1:c.1521+45G>C
C > A
C > G
SNP
No VIP available CA No Variant Annotations available
rs2234693 NC_000006.11:g.152163335T>C, NC_000006.12:g.151842200T>C, NG_008493.1:g.156705T>C, NM_000125.3:c.453-397T>C, NM_001122740.1:c.453-397T>C, NM_001122741.1:c.453-397T>C, NM_001122742.1:c.453-397T>C, NM_001291230.1:c.453-397T>C, NM_001291241.1:c.453-397T>C, XM_005266856.1:c.453-397T>C, XM_005266857.1:c.453-397T>C, XM_006715374.2:c.453-397T>C, XM_006715375.2:c.-67-397T>C, XM_011535543.1:c.453-397T>C, XM_011535544.1:c.453-397T>C, XM_011535545.1:c.453-397T>C, XM_011535546.1:c.453-397T>C, XM_011535547.1:c.453-397T>C, XM_011535548.1:c.-67-397T>C, rs4134641, rs60769286
T > C
SNP
No VIP available CA VA
rs2235047 NC_000007.13:g.87138532A>C, NC_000007.14:g.87509216A>C, NG_011513.1:g.209033T>G, NM_000927.4:c.3489+59T>G, rs386562025, rs56488245, rs57169649, rs58701659
A > C
SNP
No VIP available No Clinical Annotations available VA
rs2236168 NC_000002.11:g.31607128T>C, NC_000002.12:g.31384262T>C, NG_008871.1:g.35484A>G, NM_000379.3:c.794-415A>G, XM_011533095.1:c.794-415A>G, XM_011533096.1:c.794-415A>G, rs4325801, rs56579209, rs59694787
T > C
SNP
No VIP available No Clinical Annotations available VA
rs2239393 NC_000022.10:g.19950428A>G, NC_000022.11:g.19962905A>G, NG_011526.1:g.26166A>G, NM_000754.3:c.289+90A>G, NM_001135161.1:c.289+90A>G, NM_001135162.1:c.289+90A>G, NM_007310.2:c.139+90A>G, NR_039918.1:n.-848A>G, XM_005261229.1:c.289+90A>G, XM_011529885.1:c.403+90A>G, XM_011529886.1:c.403+90A>G, XM_011529887.1:c.289+90A>G, XM_011529888.1:c.289+90A>G, XM_011529889.1:c.289+90A>G, XM_011529890.1:c.289+90A>G, XM_011529891.1:c.289+90A>G, rs58361251
A > G
SNP
No VIP available No Clinical Annotations available VA
rs2273697 NC_000010.10:g.101563815G>A, NC_000010.11:g.99804058G>A, NG_011798.1:g.26353G>A, NM_000392.4:c.1249G>A, NP_000383.1:p.Val417Ile, XM_005269536.1:c.1249G>A, XM_006717630.2:c.553G>A, XM_006717631.2:c.1249G>A, XM_011539291.1:c.1249G>A, XP_005269593.1:p.Val417Ile, XP_006717693.1:p.Val185Ile, XP_006717694.1:p.Val417Ile, XP_011537593.1:p.Val417Ile, XR_945604.1:n.1438G>A, XR_945605.1:n.1440G>A, rs17216184, rs60620335
G > A
SNP
V417I
No VIP available No Clinical Annotations available VA
rs2290271 NC_000015.10:g.84904404A>C, NC_000015.9:g.85447635A>C, NM_001287761.1:c.603+166A>C, NM_001287762.1:c.603+166A>C, NM_004213.4:c.603+166A>C, XM_005254988.1:c.603+166A>C, XM_005254989.1:c.603+166A>C, XM_005254990.1:c.603+166A>C, XM_005254991.1:c.603+166A>C, XM_005254992.1:c.576+166A>C, XM_005254993.1:c.603+166A>C, XM_005254994.1:c.369+166A>C, XM_005254995.1:c.603+166A>C, XM_011522203.1:c.603+166A>C, XM_011522204.1:c.603+166A>C, XM_011522205.1:c.603+166A>C, XM_011522206.1:c.603+166A>C, XM_011522207.1:c.603+166A>C, XM_011522208.1:c.576+166A>C, XM_011522209.1:c.603+166A>C, XM_011522210.1:c.603+166A>C, XM_011522211.1:c.369+166A>C, XM_011522212.1:c.603+166A>C, XM_011522213.1:c.603+166A>C, XM_011522214.1:c.603+166A>C, XM_011522215.1:c.603+166A>C, XM_011522216.1:c.369+166A>C, XM_011522217.1:c.603+166A>C, XM_011522218.1:c.603+166A>C, XR_931944.1:n.809+166A>C, XR_931945.1:n.809+166A>C, rs17608700, rs56963765
A > C
SNP
No VIP available CA VA
rs2291767 NC_000002.11:g.241080132T>C, NC_000002.12:g.240140715T>C, NM_148961.3:c.-214A>G
T > C
SNP
No VIP available No Clinical Annotations available VA
rs2293348 NC_000007.13:g.55266757C>T, NC_000007.14:g.55199064C>T, NG_007726.3:g.185033C>T, NM_005228.3:c.2848+201C>T, XM_005271746.1:c.2713+201C>T, XM_005271747.1:c.2689+201C>T, rs17337409, rs386564010, rs56649022, rs57162744
C > T
SNP
No VIP available No Clinical Annotations available VA
rs2294950 NC_000001.10:g.60314496T>G, NC_000001.11:g.59848824T>G, NM_015888.4:c.1132-249T>G, XM_005270922.1:c.1132-249T>G, XM_006710676.1:c.1132-249T>G, XM_011541562.1:c.1006-249T>G, XM_011541563.1:c.1132-249T>G, XR_246271.1:n.1328-249T>G, XR_246272.1:n.1328-249T>G, XR_946665.1:n.1328-249T>G
T > G
SNP
No VIP available CA VA
rs2297480 NC_000001.10:g.155279482T>G, NC_000001.11:g.155309691T>G, NG_045218.1:g.5944T>G, NM_001135821.1:c.-1-98T>G, NM_001135822.1:c.-1-373T>G, NM_001242824.1:c.-22-352T>G, NM_001242825.1:c.-175+726T>G, NM_002004.3:c.-1-98T>G, XM_005244962.1:c.-1-373T>G, XM_005244963.1:c.-22-352T>G, XM_005245266.1:c.-1000A>C, XM_005245266.3:c.-1000A>C, XM_011509639.1:c.-1000A>C, rs59477014
T > G
SNP
No VIP available CA VA
rs2297595 NC_000001.10:g.98165091T>C, NC_000001.11:g.97699535T>C, NG_008807.2:g.226525A>G, NM_000110.3:c.496A>G, NP_000101.2:p.Met166Val, XM_005270561.1:c.385A>G, XM_005270562.1:c.496A>G, XM_005270562.3:c.496A>G, XM_005270563.1:c.496A>G, XM_005270564.1:c.496A>G, XM_006710397.2:c.496A>G, XP_005270618.1:p.Met129Val, XP_005270619.1:p.Met166Val, XP_005270619.2:p.Met166Val, XP_005270620.1:p.Met166Val, XP_005270621.1:p.Met166Val, XP_006710460.1:p.Met166Val, rs118014431, rs199469517, rs52827192, rs61243782
T > C
SNP
M166V
No VIP available CA VA
rs2305364 NC_000015.10:g.84909044T>C, NC_000015.9:g.85452275T>C, NM_001287761.1:c.795+249T>C, NM_001287762.1:c.795+249T>C, NM_004213.4:c.795+249T>C, XM_005254988.1:c.795+249T>C, XM_005254989.1:c.795+249T>C, XM_005254990.1:c.795+249T>C, XM_005254991.1:c.795+249T>C, XM_005254992.1:c.768+249T>C, XM_005254993.1:c.717+3392T>C, XM_005254994.1:c.561+249T>C, XM_005254995.1:c.795+249T>C, XM_011522203.1:c.795+249T>C, XM_011522204.1:c.795+249T>C, XM_011522205.1:c.795+249T>C, XM_011522206.1:c.795+249T>C, XM_011522207.1:c.795+249T>C, XM_011522208.1:c.768+249T>C, XM_011522209.1:c.717+3392T>C, XM_011522210.1:c.795+249T>C, XM_011522211.1:c.561+249T>C, XM_011522212.1:c.795+249T>C, XM_011522213.1:c.795+249T>C, XM_011522214.1:c.795+249T>C, XM_011522215.1:c.795+249T>C, XM_011522216.1:c.561+249T>C, XM_011522217.1:c.795+249T>C, XM_011522218.1:c.795+249T>C, XR_931944.1:n.1001+249T>C, XR_931945.1:n.1001+249T>C
T > C
SNP
No VIP available No Clinical Annotations available VA
rs2306283 NC_000012.11:g.21329738A>G, NC_000012.12:g.21176804A>G, NG_011745.1:g.50611A>G, NM_006446.4:c.388A>G, NP_006437.3:p.Asn130Asp, rs17389242, rs52832430, rs60767041
A > G
SNP
N130D
No VIP available No Clinical Annotations available VA
rs2473967 NC_000006.11:g.113479335G>T, NC_000006.12:g.113158133G>T, rs74295796
G > T
SNP
No VIP available CA No Variant Annotations available
rs25487 NC_000019.10:g.43551574T>C, NC_000019.9:g.44055726T>C, NG_033799.1:g.29005A>G, NM_006297.2:c.1196A>G, NP_006288.2:p.Gln399Arg, rs11553658, rs17435395, rs3817410, rs386493716, rs57378728
T > C
SNP
Q399R
No VIP available No Clinical Annotations available VA
rs25489 NC_000019.10:g.43552260C>T, NC_000019.9:g.44056412C>T, NG_033799.1:g.28319G>A, NM_006297.2:c.839G>A, NP_006288.2:p.Arg280His, rs17435388, rs2229675, rs2307183
C > T
SNP
R280H
No VIP available No Clinical Annotations available VA
rs2600834 NC_000005.10:g.102269937T>C, NC_000005.9:g.101605641T>C, NM_180991.4:c.802+687A>G, XM_011543370.1:c.538+687A>G, XM_011543371.1:c.454+687A>G, XM_011543372.1:c.388+687A>G, rs10395200, rs58191158
T > C
SNP
No VIP available No Clinical Annotations available VA
rs2622604 NC_000004.11:g.89078924T>C, NC_000004.12:g.88157772T>C, NG_032067.2:g.78551A>G, NM_001257386.1:c.-19-17758A>G, NM_004827.2:c.-20+614A>G, XM_005263354.1:c.-20+805A>G, XM_005263354.2:c.-20+805A>G, XM_005263355.1:c.-19-17758A>G, XM_005263355.2:c.-19-17758A>G, XM_005263356.1:c.-20+614A>G, XM_005263356.2:c.-20+614A>G, XM_011532420.1:c.-19-17758A>G, rs61481684
T > A
T > C
SNP
No VIP available No Clinical Annotations available VA
rs2669429 NC_000008.10:g.105463690A>G, NC_000008.11:g.104451462A>G, NG_008840.1:g.20588T>C, NM_001385.2:c.265-58T>C, XM_005250818.1:c.265-58T>C, XM_005250818.2:c.265-58T>C, XM_005250819.1:c.265-58T>C, XM_006716518.2:c.265-3959T>C, XM_011516903.1:c.265-58T>C, XM_011516904.1:c.265-58T>C, rs17246278, rs199469604, rs3750186, rs60334774
A > G
SNP
No VIP available CA VA
rs2740574 NC_000007.13:g.99382096C>T, NC_000007.14:g.99784473C>T, NG_008421.1:g.4713G>A, NM_001202855.2:c.-392G>A, NM_017460.5:c.-392G>A, XM_011515841.1:c.-392G>A, XM_011515842.1:c.-392G>A, rs3176920, rs36231114, rs59393892
C > T
SNP
No VIP available No Clinical Annotations available VA
rs2804402 NC_000010.10:g.101541583A>G, NC_000010.11:g.99781826A>G, NG_011798.1:g.4121A>G, NM_000392.4:c.-1019A>G, XM_005269536.1:c.-1019A>G, XM_006717631.2:c.-1019A>G, XM_011539291.1:c.-1019A>G, XR_945604.1:n.-830A>G, XR_945605.1:n.-828A>G, rs17222526, rs60149027
A > G
SNP
No VIP available No Clinical Annotations available VA
rs2811178
T > C
SNP
No VIP available No Clinical Annotations available VA
rs2884129 NC_000010.10:g.17585149T>G, NC_000010.11:g.17543150T>G
T > G
SNP
No VIP available No Clinical Annotations available VA
rs2959023 NC_000008.10:g.105479149A>G, NC_000008.11:g.104466921A>G, NG_008840.1:g.5129T>C, NM_001385.2:c.-1T>C, XM_005250818.1:c.-1T>C, XM_005250818.2:c.-1T>C, XM_005250819.1:c.-1T>C, XM_006716518.2:c.-1T>C, XM_011516903.1:c.-1T>C, XM_011516904.1:c.-1T>C, XR_928507.1:n.112+934A>G, rs199469597, rs58165447
A > G
SNP
No VIP available CA VA
rs316019 NC_000006.11:g.160670282A>C, NC_000006.12:g.160249250A>C, NM_003058.3:c.808T>G, NP_003049.2:p.Ser270Ala, rs1755917, rs17846267, rs17859289, rs386580336, rs52803175, rs60007366, rs666224
A > C
SNP
S270A
No VIP available CA VA
rs3212986 NC_000019.10:g.45409478C>A, NC_000019.9:g.45912736C>A, NG_015839.2:g.74351G>T, NM_001166049.1:c.*197G>T, NM_001297590.1:c.1516C>A, NM_001983.3:c.*197G>T, NM_012099.1:c.1510C>A, NP_001284519.1:p.Gln506Lys, NP_036231.1:p.Gln504Lys, XM_005258425.1:c.1516C>A, XM_005258638.1:c.*197G>T, XP_005258482.1:p.Gln506Lys, rs386580934, rs60333438
C > A
C > T
SNP
Q506K
No VIP available CA VA
rs3215400 NC_000001.10:g.20915590delC, NC_000001.11:g.20589097delC, NM_001785.2:c.-33delC, rs139923988, rs35386716, rs373015145, rs373391994, rs57426563, rs71752362
C > -
indel
No VIP available CA VA
rs34489327
TTAAAG > -
unknown
No VIP available CA VA
rs35599367 NC_000007.13:g.99366316G>A, NC_000007.14:g.99768693G>A, NG_008421.1:g.20493C>T, NM_001202855.2:c.522-191C>T, NM_017460.5:c.522-191C>T, XM_011515841.1:c.522-191C>T, XM_011515842.1:c.522-191C>T, rs45581939, rs62471940
G > A
SNP
No VIP available No Clinical Annotations available VA
rs367619008
T > C
SNP
K63E
No VIP available No Clinical Annotations available VA
rs3730089 NC_000005.10:g.68292320G>A, NC_000005.9:g.67588148G>A, NG_012849.2:g.81565G>A, NM_001242466.1:c.-480G>A, NM_181504.3:c.168G>A, NM_181523.1:c.978G>A, NM_181523.2:c.978G>A, NM_181524.1:c.78G>A, NP_852556.2:p.Met56Ile, NP_852664.1:p.Met326Ile, NP_852665.1:p.Met26Ile, XM_005248542.1:c.978G>A, XM_005248542.2:c.978G>A, XM_011543493.1:c.651G>A, XP_005248599.1:p.Met326Ile, XP_011541795.1:p.Met217Ile, rs17847316, rs386584794, rs52830014
G > A
SNP
M56I
No VIP available No Clinical Annotations available VA
rs3740066 NC_000010.10:g.101604207C>T, NC_000010.11:g.99844450C>T, NG_011798.1:g.66745C>T, NM_000392.4:c.3972C>T, NP_000383.1:p.Ile1324=, XM_005269536.1:c.3693C>T, XM_006717630.2:c.3276C>T, XP_005269593.1:p.Ile1231=, XP_006717693.1:p.Ile1092=, XR_945604.1:n.4161C>T, XR_945605.1:n.4036C>T, rs12780340, rs17216303, rs59292214
C > T
SNP
I1324I
No VIP available CA VA
rs3750117 NC_000007.13:g.33060946A>G, NC_000007.14:g.33021334A>G, NG_015800.1:g.46464T>C, NM_001002009.2:c.276T>C, NM_001002010.2:c.393T>C, NM_001166118.2:c.240T>C, NM_016489.12:c.276T>C, NP_001002009.1:p.Tyr92=, NP_001002010.1:p.Tyr131=, NP_001159590.1:p.Tyr80=, NP_057573.2:p.Tyr92=, XM_011515409.1:c.240T>C, XP_011513711.1:p.Tyr80=, rs11547832, rs17851350, rs57965368
A > G
SNP
Y92Y
No VIP available No Clinical Annotations available VA
rs3755319 NC_000002.11:g.234667582A=, NC_000002.11:g.234667582A>C, NC_000002.12:g.233758936A=, NC_000002.12:g.233758936A>C, NG_002601.2:g.174193A=, NG_002601.2:g.174193A>C, NG_033238.1:g.3664A=, NG_033238.1:g.3664A>C, NM_000463.2:c.-1352A=, NM_000463.2:c.-1352A>C, NM_001072.3:c.862-8098A=, NM_001072.3:c.862-8098A>C, NM_007120.2:c.868-8098A=, NM_007120.2:c.868-8098A>C, NM_019075.2:c.856-8098A=, NM_019075.2:c.856-8098A>C, NM_019076.4:c.856-8098A=, NM_019076.4:c.856-8098A>C, NM_019077.2:c.856-8098A=, NM_019077.2:c.856-8098A>C, NM_019078.1:c.868-8098A=, NM_019078.1:c.868-8098A>C, NM_019093.2:c.868-8098A=, NM_019093.2:c.868-8098A>C, NM_021027.2:c.856-8098A=, NM_021027.2:c.856-8098A>C, NM_205862.1:c.61-8098A=, NM_205862.1:c.61-8098A>C, XR_241238.1:n.924-8098A=, XR_241238.1:n.924-8098A>C, XR_241239.1:n.-1330A=, XR_241239.1:n.-1330A>C, XR_241240.1:n.1023-8098A=, XR_241240.1:n.1023-8098A>C, XR_241241.1:n.942-8098A=, XR_241241.1:n.942-8098A>C, rs35208194, rs36208045, rs57256426
A > C
SNP
No VIP available No Clinical Annotations available VA
rs3760091 NC_000016.10:g.28609479C>G, NC_000016.9:g.28620800C>G, NG_028128.1:g.19067G>C, NM_001055.3:c.-5+452G>C, NM_001310136.1:c.121-142577G>C, NM_177529.2:c.-36+452G>C, NM_177530.2:c.-425G>C, NM_177534.2:c.-624G>C, NM_177536.3:c.139-2402G>C, XM_005255522.1:c.-5+452G>C, rs117385979, rs60448308
C > G
C > T
SNP
No VIP available No Clinical Annotations available VA
rs3813627 NC_000001.10:g.161195148G>T, NC_000001.11:g.161225358G>T, NG_012043.1:g.3271C>A, NM_001286373.1:c.-914G>T, NM_001286374.1:c.-914G>T, NM_001643.1:c.-1788C>A, NM_032174.5:c.-914G>T, NR_049819.1:n.-1828G>T, XM_005245536.1:c.-814G>T, XM_005245537.1:c.-914G>T, XM_005245538.1:c.-1005G>T, XM_006711572.1:c.-793G>T, XM_011510057.1:c.-793G>T
G > T
SNP
No VIP available No Clinical Annotations available VA
rs3813628 NC_000001.10:g.161196166A>C, NC_000001.11:g.161226376A>C, NG_012043.1:g.2253T>G, NM_001286373.1:c.-114A>C, NM_001286374.1:c.-114A>C, NM_032174.5:c.-114A>C, NR_049819.1:n.-810A>C, XM_005245536.1:c.-35-79A>C, XM_005245537.1:c.-114A>C, XM_005245538.1:c.-205A>C, XM_006711572.1:c.-14-100A>C, XM_011510057.1:c.-14-100A>C, rs57851595
A > C
SNP
No VIP available No Clinical Annotations available VA
rs3887137 NC_000009.11:g.107698612C>T, NC_000009.12:g.104936331C>T, XR_930204.1:n.952-2421C>T, rs57670930
C > T
SNP
No VIP available CA VA
rs3918290 NC_000001.10:g.97915614C>T, NC_000001.11:g.97450058C>T, NG_008807.2:g.476002G>A, NM_000110.3:c.1905+1G>A, XM_005270561.1:c.1794+1G>A, XM_005270562.1:c.1689+1G>A, XM_005270562.3:c.1689+1G>A, XM_005270563.1:c.1905+1G>A, XM_006710397.2:c.1905+1G>A, rs199469548, rs386589337
C > G
C > T
SNP
No VIP available No Clinical Annotations available VA
rs3918305 NC_000012.11:g.109331162C>T, NC_000012.12:g.108937386C>T, NM_018711.4:c.898-49G>A, rs59527033
C > T
SNP
No VIP available CA VA
rs4124874 NC_000002.11:g.234665659T>G, NC_000002.12:g.233757013T>G, NG_002601.2:g.172270T>G, NG_033238.1:g.1741T>G, NM_001072.3:c.862-10021T>G, NM_007120.2:c.868-10021T>G, NM_019075.2:c.856-10021T>G, NM_019076.4:c.856-10021T>G, NM_019077.2:c.856-10021T>G, NM_019078.1:c.868-10021T>G, NM_019093.2:c.868-10021T>G, NM_021027.2:c.856-10021T>G, NM_205862.1:c.61-10021T>G, NR_037694.1:n.-1668A>C, NR_037695.1:n.-1668A>C, NR_037696.1:n.-1668A>C, XR_241238.1:n.924-10021T>G, XR_241240.1:n.1023-10021T>G, XR_241241.1:n.942-10021T>G, rs57409706
T > G
SNP
No VIP available CA VA
rs4148323 NC_000002.11:g.234669144G>A, NC_000002.12:g.233760498G>A, NG_002601.2:g.175755G>A, NG_033238.1:g.5226G>A, NM_000463.2:c.211G>A, NM_001072.3:c.862-6536G>A, NM_007120.2:c.868-6536G>A, NM_019075.2:c.856-6536G>A, NM_019076.4:c.856-6536G>A, NM_019077.2:c.856-6536G>A, NM_019078.1:c.868-6536G>A, NM_019093.2:c.868-6536G>A, NM_021027.2:c.856-6536G>A, NM_205862.1:c.61-6536G>A, NP_000454.1:p.Gly71Arg, XR_241238.1:n.924-6536G>A, XR_241239.1:n.233G>A, XR_241240.1:n.1023-6536G>A, XR_241241.1:n.942-6536G>A, rs113525835, rs34360183, rs58105808, rs58585123
G > A
SNP
G71R
No VIP available CA VA
rs4148350 NC_000016.10:g.16076620G>T, NC_000016.9:g.16170477G>T, NG_028268.1:g.132044G>T, NM_004996.3:c.1988+219G>T, NT_187607.1:g.1734472G>T, XM_005255326.1:c.1988+219G>T, XM_005255327.1:c.1862+219G>T, XM_005255328.1:c.1850+219G>T, XM_005255329.1:c.1988+219G>T, XM_011522497.1:c.1964+219G>T, XM_011522498.1:c.1895+219G>T, rs587779726, rs60127316
G > T
SNP
No VIP available CA VA
rs4148808 NC_000007.13:g.87105795T>C, NC_000007.14:g.87476479T>C, NG_007118.1:g.8954A>G, NM_000443.3:c.-852A>G, NM_018849.2:c.-852A>G, NM_018850.2:c.-852A>G, XM_011516308.1:c.-715A>G, XM_011516309.1:c.-715A>G, XM_011516310.1:c.-715A>G, XM_011516311.1:c.-715A>G, XM_011516312.1:c.-715A>G, XM_011516313.1:c.-715A>G, XM_011516314.1:c.-332A>G, XR_927478.1:n.-619A>G, rs386591494, rs59666582
T > C
SNP
No VIP available CA VA
rs4149056 NC_000012.11:g.21331549T>C, NC_000012.12:g.21178615T>C, NG_011745.1:g.52422T>C, NM_006446.4:c.521T>C, NP_006437.3:p.Val174Ala, rs52816141, rs60037639
T > C
SNP
V174A
No VIP available No Clinical Annotations available VA
rs4149117 NC_000012.11:g.21011480T>G, NC_000012.12:g.20858546T>G, NG_032071.1:g.52843T>G, NM_019844.3:c.334T>G, NP_062818.1:p.Ser112Ala, XM_005253347.1:c.334T>G, XP_005253404.1:p.Ser112Ala, rs52800447, rs58702833
T > G
SNP
S112A
No VIP available No Clinical Annotations available VA
rs4149178 NC_000006.11:g.43272188A>G, NC_000006.12:g.43304450A>G, NM_006672.3:c.1586+206A>G, NM_153320.2:c.1592+206A>G, XM_005248823.1:c.1199+206A>G, XM_006714970.2:c.1601+206A>G, XM_006714971.2:c.1595+206A>G, XM_011514256.1:c.1778+206A>G, XM_011514257.1:c.1769+206A>G, XM_011514258.1:c.1676+206A>G, XM_011514260.1:c.1544+206A>G, XM_011514261.1:c.1208+206A>G, XM_011514263.1:c.1004+206A>G, XM_011514607.1:c.495+1769T>C, XM_011514608.1:c.495+1769T>C
A > G
SNP
No VIP available No Clinical Annotations available VA
rs42524 NC_000007.13:g.94043239C>G, NC_000007.14:g.94413927C>G, NG_007405.1:g.24367C>G, NM_000089.3:c.1645C>G, NP_000080.2:p.Pro549Ala, rs10383941, rs1136007, rs17857444, rs59646360
C > G
SNP
P549A
No VIP available CA VA
rs4261716 NC_000002.11:g.234593117G>T, NC_000002.12:g.233684471G>T, NG_002601.2:g.99728G>T, NM_019075.2:c.855+47094G>T, NM_019076.4:c.855+65909G>T, NM_019077.2:c.855+1679G>T, NM_021027.2:c.855+11682G>T, XM_005246081.1:c.855+1679G>T, XR_241241.1:n.941+11682G>T, rs17683792, rs58252906
G > T
SNP
No VIP available No Clinical Annotations available VA
rs4407290 NC_000002.11:g.31606670G>A, NC_000002.12:g.31383804G>A, NG_008871.1:g.35942C>T, NM_000379.3:c.837C>T, NP_000370.2:p.Val279=, XM_011533095.1:c.837C>T, XM_011533096.1:c.837C>T, XP_011531397.1:p.Val279=, XP_011531398.1:p.Val279=, rs17544440, rs57766493
G > A
SNP
V279V
No VIP available CA VA
rs45445694 NC_000018.10:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NC_000018.9:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NG_028255.1:g.5043_5070CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NM_001012716.2:c.*34+169_*34+196CGGGACGGAGGCAGGCCAAGTGGCGCGG[2][3][4][7][8][9], NM_001071.2:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258137.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258138.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9]
CCGCGC(CACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2
CCGCGC(CACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)4
CCGCGC(CACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)7
CCGCGC(CACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)8
CCGCGC(CACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)9
microsatellite
No VIP available No Clinical Annotations available VA
rs45589337 NC_000001.10:g.98144726T>C, NC_000001.11:g.97679170T>C, NG_008807.2:g.246890A>G, NM_000110.3:c.775A>G, NP_000101.2:p.Lys259Glu, XM_005270561.1:c.664A>G, XM_005270562.1:c.775A>G, XM_005270562.3:c.775A>G, XM_005270563.1:c.775A>G, XM_005270564.1:c.775A>G, XM_006710397.2:c.775A>G, XP_005270618.1:p.Lys222Glu, XP_005270619.1:p.Lys259Glu, XP_005270619.2:p.Lys259Glu, XP_005270620.1:p.Lys259Glu, XP_005270621.1:p.Lys259Glu, XP_006710460.1:p.Lys259Glu, rs59034382
T > C
SNP
K259E
No VIP available CA VA
rs4646316 NC_000022.10:g.19952132C>T, NC_000022.11:g.19964609C>T, NG_011526.1:g.27870C>T, NM_000754.3:c.615+310C>T, NM_001135161.1:c.615+310C>T, NM_001135162.1:c.615+310C>T, NM_007310.2:c.465+310C>T, XM_005261229.1:c.615+310C>T, XM_011529885.1:c.729+310C>T, XM_011529886.1:c.729+310C>T, XM_011529887.1:c.615+310C>T, XM_011529888.1:c.615+310C>T, XM_011529889.1:c.615+310C>T, XM_011529890.1:c.615+310C>T, XM_011529891.1:c.615+310C>T, rs58510682
C > T
SNP
No VIP available CA VA
rs4655226 NC_000001.10:g.20928284C>T, NC_000001.11:g.20601791C>T, NM_001785.2:c.155-3137C>T
C > T
SNP
No VIP available CA No Variant Annotations available
rs4673 NC_000016.10:g.88646828A>G, NC_000016.9:g.88713236A>G, NG_007291.1:g.9222T>C, NM_000101.2:c.214T>C, NM_000101.3:c.214T>C, NP_000092.2:p.Tyr72His, XM_011522905.1:c.214T>C, XP_011521207.1:p.Tyr72His, rs11266997, rs1130413, rs2228471, rs2242272, rs3189211, rs386594564, rs4782392, rs59455247
A > G
SNP
Y72H
No VIP available No Clinical Annotations available VA
rs4680 NC_000022.10:g.19951271G>A, NC_000022.11:g.19963748G>A, NG_011526.1:g.27009G>A, NM_000754.3:c.472G>A, NM_001135161.1:c.472G>A, NM_001135162.1:c.472G>A, NM_007310.2:c.322G>A, NP_000745.1:p.Val158Met, NP_001128633.1:p.Val158Met, NP_001128634.1:p.Val158Met, NP_009294.1:p.Val108Met, NR_039918.1:n.-5G>A, XM_005261229.1:c.472G>A, XM_011529885.1:c.586G>A, XM_011529886.1:c.586G>A, XM_011529887.1:c.472G>A, XM_011529888.1:c.472G>A, XM_011529889.1:c.472G>A, XM_011529890.1:c.472G>A, XM_011529891.1:c.472G>A, XP_005261286.1:p.Val158Met, XP_011528187.1:p.Val196Met, XP_011528188.1:p.Val196Met, XP_011528189.1:p.Val158Met, XP_011528190.1:p.Val158Met, XP_011528191.1:p.Val158Met, XP_011528192.1:p.Val158Met, XP_011528193.1:p.Val158Met, rs1131157, rs11544671, rs165688, rs17295216, rs17349704, rs17818178, rs17849308, rs17850006, rs2070104, rs3177905, rs3190784, rs3747070, rs58002978
G > A
SNP
V158M
No VIP available No Clinical Annotations available VA
rs4715354 NC_000006.11:g.52708797G>A, NC_000006.12:g.52843999G>A, NM_153699.1:c.-31+2057C>T, rs17268789, rs58826387
G > A
SNP
No VIP available No Clinical Annotations available VA
rs4818 NC_000022.10:g.19951207C>G, NC_000022.11:g.19963684C>G, NG_011526.1:g.26945C>G, NM_000754.3:c.408C>G, NM_001135161.1:c.408C>G, NM_001135162.1:c.408C>G, NM_007310.2:c.258C>G, NP_000745.1:p.Leu136=, NP_001128633.1:p.Leu136=, NP_001128634.1:p.Leu136=, NP_009294.1:p.Leu86=, NR_039918.1:n.-69C>G, XM_005261229.1:c.408C>G, XM_011529885.1:c.522C>G, XM_011529886.1:c.522C>G, XM_011529887.1:c.408C>G, XM_011529888.1:c.408C>G, XM_011529889.1:c.408C>G, XM_011529890.1:c.408C>G, XM_011529891.1:c.408C>G, XP_005261286.1:p.Leu136=, XP_011528187.1:p.Leu174=, XP_011528188.1:p.Leu174=, XP_011528189.1:p.Leu136=, XP_011528190.1:p.Leu136=, XP_011528191.1:p.Leu136=, XP_011528192.1:p.Leu136=, XP_011528193.1:p.Leu136=, rs117008153, rs17355478, rs17745510, rs17850822, rs2070103, rs3171583, rs3747069, rs57402237, rs712978
C > G
SNP
L136L
No VIP available No Clinical Annotations available VA
rs4834232 NC_000004.11:g.129024273C>T, NC_000004.12:g.128103118C>T, NM_001278604.1:c.814-4021C>T, NM_018078.3:c.814-4021C>T, NM_032239.3:c.814-4021C>T, NM_178043.2:c.814-4021C>T, XM_005263086.1:c.1417-4021C>T, XM_005263087.1:c.1417-4021C>T, XM_005263088.1:c.1417-4021C>T, XM_005263089.1:c.1273-4021C>T, XM_005263090.1:c.1417-4021C>T, XM_005263091.1:c.1417-4021C>T, XM_005263092.1:c.1417-4021C>T, XM_005263093.1:c.1417-4021C>T, XM_005263094.1:c.1417-4021C>T, XM_005263095.1:c.1417-4021C>T, XM_005263096.1:c.1417-4021C>T, XM_005263097.1:c.1417-4021C>T, XM_005263098.1:c.1417-4021C>T, XM_005263099.1:c.91-4021C>T, XM_005263100.1:c.91-4021C>T, XM_005263101.1:c.1417-4021C>T, XM_011532057.1:c.814-4021C>T, XM_011532058.1:c.814-4021C>T, XM_011532059.1:c.814-4021C>T, XM_011532060.1:c.814-4021C>T, XM_011532061.1:c.1276-4021C>T, XM_011532062.1:c.814-4021C>T, XM_011532063.1:c.814-4021C>T, XM_011532064.1:c.814-4021C>T, XM_011532065.1:c.1276-4021C>T, XM_011532066.1:c.814-4021C>T, XM_011532067.1:c.814-4021C>T, XM_011532068.1:c.673-4021C>T, XM_011532069.1:c.673-4021C>T, XM_011532070.1:c.814-4021C>T, XM_011532071.1:c.814-4021C>T, XM_011532072.1:c.814-4021C>T, XM_011532073.1:c.814-4021C>T, XM_011532074.1:c.814-4021C>T, XM_011532075.1:c.91-4021C>T, XM_011532076.1:c.91-4021C>T, XM_011532077.1:c.91-4021C>T, XM_011532078.1:c.814-4021C>T, XR_938753.1:n.891-4021C>T, XR_938754.1:n.891-4021C>T, XR_938755.1:n.891-4021C>T, XR_938756.1:n.891-4021C>T, XR_938757.1:n.891-4021C>T, XR_938758.1:n.891-4021C>T, XR_938759.1:n.891-4021C>T, XR_938760.1:n.891-4021C>T, XR_938761.1:n.891-4021C>T, XR_938762.1:n.891-4021C>T, rs17394472, rs59780448
C > T
SNP
No VIP available CA VA
rs4877847 NC_000009.11:g.86946417A>C, NC_000009.12:g.84331502A>C, NM_001199633.1:c.60+9072T>G, NM_022127.2:c.60+9072T>G, NR_037638.2:n.206+9072T>G, XM_011518905.1:c.60+9072T>G, XM_011518906.1:c.60+9072T>G, XM_011518907.1:c.-97-18048T>G, XM_011518909.1:c.60+9072T>G, XM_011518910.1:c.60+9072T>G, XR_929832.1:n.187+9072T>G
A > C
SNP
No VIP available No Clinical Annotations available VA
rs4982753 NC_000014.8:g.23814569C>T, NC_000014.9:g.23345360C>T, rs61203156
C > T
SNP
No VIP available CA VA
rs532545 NC_000001.10:g.20915172C>T, NC_000001.11:g.20588679C>T, NM_001785.2:c.-451C>T, rs2072669, rs386598350
C > T
SNP
No VIP available CA VA
rs55886062 NC_000001.10:g.97981343A>C, NC_000001.11:g.97515787A>C, NG_008807.2:g.410273T>G, NM_000110.3:c.1679T>G, NP_000101.2:p.Ile560Ser, XM_005270561.1:c.1568T>G, XM_005270562.1:c.1524+33773T>G, XM_005270562.3:c.1524+33773T>G, XM_005270563.1:c.1679T>G, XM_005270564.1:c.1679T>G, XM_006710397.2:c.1679T>G, XP_005270618.1:p.Ile523Ser, XP_005270620.1:p.Ile560Ser, XP_005270621.1:p.Ile560Ser, XP_006710460.1:p.Ile560Ser, rs199469542
A > C
SNP
I560S
No VIP available CA VA
rs56038477 NC_000001.10:g.98039419C>T, NC_000001.11:g.97573863C>T, NG_008807.2:g.352197G>A, NM_000110.3:c.1236G>A, NP_000101.2:p.Glu412=, XM_005270561.1:c.1125G>A, XM_005270562.1:c.1236G>A, XM_005270562.3:c.1236G>A, XM_005270563.1:c.1236G>A, XM_005270564.1:c.1236G>A, XM_006710397.2:c.1236G>A, XP_005270618.1:p.Glu375=, XP_005270619.1:p.Glu412=, XP_005270619.2:p.Glu412=, XP_005270620.1:p.Glu412=, XP_005270621.1:p.Glu412=, XP_006710460.1:p.Glu412=, rs199469533, rs61730901
C > T
SNP
E412E
No VIP available No Clinical Annotations available VA
rs56276561
C > T
SNP
No VIP available No Clinical Annotations available VA
rs56293913
A > G
SNP
No VIP available No Clinical Annotations available VA
rs5746849 NC_000022.10:g.19942997A>G, NC_000022.11:g.19955474A>G, NG_011526.1:g.18735A>G, NM_000754.3:c.-91-5725A>G, NM_001135161.1:c.-92+4422A>G, NM_001135162.1:c.-92+3820A>G, XM_005261229.1:c.-385-5725A>G, XM_011529887.1:c.-91-5725A>G, XM_011529888.1:c.-92+3820A>G, XM_011529889.1:c.-92+4422A>G, XM_011529890.1:c.-385-5725A>G, XM_011529891.1:c.-385-5725A>G, rs58299579
A > G
SNP
No VIP available CA VA
rs602950 NC_000001.10:g.20915531A>G, NC_000001.11:g.20589038A>G, NM_001785.2:c.-92A>G
A > G
SNP
No VIP available CA VA
rs60369023 NC_000001.10:g.20931474G>A, NC_000001.11:g.20604981G>A, NM_001785.2:c.208G>A, NP_001776.1:p.Ala70Thr
G > A
SNP
A70T
No VIP available No Clinical Annotations available VA
rs6151031 NC_000009.11:g.75568383_75568384insCTGGTGAGGAGAGAACC, NC_000009.12:g.72953467_72953468insCTGGTGAGGAGAGAACC, NG_012249.1:g.4586_4587insGGTTCTCTCCTCACCAG, NM_000689.4:c.-468_-467insGGTTCTCTCCTCACCAG, XM_005251800.1:c.-14-454_-14-453insGGTTCTCTCCTCACCAG, rs142856037
- > CTGGTGAGGAGAGAACC
indel
No VIP available No Clinical Annotations available VA
rs62298861 NC_000004.11:g.69963944A>G, NC_000004.12:g.69098226A>G, NM_001074.2:c.722-314A>G, XM_005265702.1:c.-26-314A>G, XM_005265702.2:c.-26-314A>G, XM_011532229.1:c.722-314A>G, XM_011532230.1:c.722-314A>G, XM_011532231.1:c.-26-314A>G
A > G
SNP
No VIP available No Clinical Annotations available VA
rs6269 NC_000022.10:g.19949952A>G, NC_000022.11:g.19962429A>G, NG_011526.1:g.25690A>G, NM_000754.3:c.1-98A>G, NM_001135161.1:c.1-98A>G, NM_001135162.1:c.1-98A>G, NM_007310.2:c.-248A>G, NR_039918.1:n.-1324A>G, XM_005261229.1:c.-98A>G, XM_011529885.1:c.115-98A>G, XM_011529886.1:c.115-98A>G, XM_011529887.1:c.1-98A>G, XM_011529888.1:c.1-98A>G, XM_011529889.1:c.1-98A>G, XM_011529890.1:c.-98A>G, XM_011529891.1:c.-98A>G, rs3827293
A > G
SNP
No VIP available CA VA
rs6431558 NC_000002.11:g.234529643C>T, NC_000002.12:g.233620997C>T, NG_002601.2:g.36254C>T, NM_019076.4:c.855+2435C>T, rs58319724
C > T
SNP
No VIP available CA No Variant Annotations available
rs662 NC_000007.13:g.94937446T>C, NC_000007.14:g.95308134T>C, NG_008779.1:g.21439A>G, NM_000446.5:c.575A>G, NP_000437.3:p.Gln192Arg, rs11567868, rs13306697, rs17773773, rs386603940, rs60480675
T > C
SNP
Q192R
No VIP available No Clinical Annotations available VA
rs6668296
C > T
SNP
No VIP available CA VA
rs67376798 NC_000001.10:g.97547947T>A, NC_000001.11:g.97082391T>A, NG_008807.2:g.843669A>T, NM_000110.3:c.2846A>T, NP_000101.2:p.Asp949Val, XM_005270561.1:c.2735A>T, XM_005270562.1:c.2630A>T, XM_005270562.3:c.2630A>T, XP_005270618.1:p.Asp912Val, XP_005270619.1:p.Asp877Val, XP_005270619.2:p.Asp877Val, rs199469564, rs386467430, rs67376799
T > A
SNP
D949V
No VIP available CA VA
rs6755571 NC_000002.11:g.234627536C>A, NC_000002.12:g.233718890C>A, NG_002601.2:g.134147C>A, NM_001072.3:c.861+25025C>A, NM_007120.2:c.70C>A, NM_019075.2:c.856-48144C>A, NM_019076.4:c.856-48144C>A, NM_019077.2:c.855+36098C>A, NM_019078.1:c.867+5032C>A, NM_021027.2:c.855+46101C>A, NM_205862.1:c.60+25025C>A, NP_009051.1:p.Pro24Thr, XR_241238.1:n.126C>A, XR_241240.1:n.1022+25025C>A, XR_241241.1:n.941+46101C>A, rs17864908, rs52805064, rs58561863
C > A
SNP
P24T
No VIP available No Clinical Annotations available VA
rs6759892 NC_000002.11:g.234601669T>G, NC_000002.12:g.233693023T>G, NG_002601.2:g.108280T>G, NM_001072.3:c.19T>G, NM_019075.2:c.855+55646T>G, NM_019076.4:c.856-74011T>G, NM_019077.2:c.855+10231T>G, NM_021027.2:c.855+20234T>G, NM_205862.1:c.-7-776T>G, NP_001063.2:p.Ser7Ala, XR_241240.1:n.180T>G, XR_241241.1:n.941+20234T>G, rs17670302, rs60624335
T > G
SNP
S7A
No VIP available CA VA
rs6785049 NC_000003.11:g.119533733G>A, NC_000003.12:g.119814886G>A, NG_011856.1:g.39403G>A, NM_003889.3:c.795-93G>A, NM_022002.2:c.912-93G>A, NM_033013.2:c.684-93G>A, XM_005247866.1:c.630-93G>A, rs58368790
G > A
SNP
No VIP available No Clinical Annotations available VA
rs6848982 NC_000004.11:g.128959213G>A, NC_000004.12:g.128038058G>A, NM_001319305.1:c.*2245G>A, NM_001319306.1:c.*2245G>A, NM_001319307.1:c.*2245G>A
G > A
SNP
No VIP available No Clinical Annotations available VA
rs7016778
A > T
SNP
No VIP available No Clinical Annotations available VA
rs7104613 NC_000011.10:g.14058384C>T, NC_000011.9:g.14079931C>T, NM_006108.3:c.479+16730C>T, NW_003871075.1:g.116468C>T, rs60203831
C > T
SNP
No VIP available CA VA
rs712829 NC_000007.13:g.55086755G>T, NC_000007.14:g.55019062G>T, NG_007726.3:g.5031G>T, NM_005228.3:c.-216G>T, NM_201282.1:c.-216G>T, NM_201283.1:c.-216G>T, NM_201284.1:c.-216G>T, XM_005271746.1:c.-216G>T, XM_005271748.1:c.-216G>T, rs17288931
G > T
SNP
No VIP available No Clinical Annotations available VA
rs7131224 NC_000011.10:g.24225985T>C, NC_000011.9:g.24247531T>C, rs111186995, rs58002303, rs58056067
T > C
SNP
No VIP available No Clinical Annotations available VA
rs717620 NC_000010.10:g.101542578C>T, NC_000010.11:g.99782821C>T, NG_011798.1:g.5116C>T, NM_000392.4:c.-24C>T, XM_005269536.1:c.-24C>T, XM_006717631.2:c.-24C>T, XM_011539291.1:c.-24C>T, XR_945604.1:n.166C>T, XR_945605.1:n.168C>T, rs17216163, rs386485129, rs58371376
C > T
SNP
No VIP available CA VA
rs7194667 NC_000016.10:g.48208987T>G, NC_000016.9:g.48242898T>G, NG_011522.1:g.31191A>C, NM_032583.3:c.1609-491A>C, NM_033151.3:c.1609-491A>C, NM_145186.2:c.1609-491A>C, XM_005256208.1:c.1609-491A>C, XM_005256209.1:c.1609-491A>C, XM_005256210.1:c.1609-491A>C, XM_011523396.1:c.1411-491A>C, XM_011523397.1:c.652-491A>C, XR_243432.1:n.1714-491A>C, rs61621252
T > G
SNP
No VIP available CA No Variant Annotations available
rs724710 NC_000002.11:g.111907691T>C, NC_000002.12:g.111150114T>C, NG_029006.1:g.34201T>C, NM_001204106.1:c.195T>C, NM_001204107.1:c.195T>C, NM_001204108.1:c.465T>C, NM_001204109.1:c.395-3666T>C, NM_001204110.1:c.195T>C, NM_001204111.1:c.215-14019T>C, NM_001204112.1:c.215-3666T>C, NM_006538.4:c.285T>C, NM_138621.4:c.465T>C, NM_138622.3:c.465T>C, NM_138623.3:c.285T>C, NM_138624.3:c.*90T>C, NM_138625.3:c.*83T>C, NM_138626.3:c.395-14019T>C, NM_138627.3:c.125-14019T>C, NM_207003.2:c.195T>C, NP_001191035.1:p.Ile65=, NP_001191036.1:p.Ile65=, NP_001191037.1:p.Ile155=, NP_001191039.1:p.Ile65=, NP_006529.1:p.Ile95=, NP_619527.1:p.Ile155=, NP_619528.1:p.Ile155=, NP_619529.1:p.Ile95=, NP_996886.1:p.Ile65=, XM_005263550.1:c.747T>C, XM_005263550.2:c.747T>C, XM_005263551.1:c.747T>C, XM_005263552.1:c.567T>C, XM_005263552.2:c.567T>C, XM_005263553.1:c.567T>C, XM_005263554.1:c.677-14019T>C, XM_005263555.1:c.477T>C, XM_005263555.2:c.477T>C, XM_005263556.1:c.465T>C, XM_005263556.2:c.465T>C, XM_005263557.1:c.465T>C, XM_005263557.3:c.465T>C, XM_005263559.1:c.477T>C, XM_005263560.1:c.497-14019T>C, XM_005263561.1:c.285T>C, XM_005263561.2:c.285T>C, XM_011510463.1:c.516T>C, XP_005263607.1:p.Ile249=, XP_005263608.1:p.Ile249=, XP_005263609.1:p.Ile189=, XP_005263610.1:p.Ile189=, XP_005263612.1:p.Ile159=, XP_005263613.1:p.Ile155=, XP_005263614.1:p.Ile155=, XP_005263616.1:p.Ile159=, XP_005263618.1:p.Ile95=, XP_011508765.1:p.Ile172=, XR_244801.1:n.806T>C, XR_244802.1:n.806T>C, XR_244802.2:n.806T>C, XR_244803.1:n.626T>C, XR_244804.1:n.536T>C, XR_244805.1:n.753T>C, XR_244806.1:n.753T>C, XR_244807.1:n.683-3666T>C, XR_244808.1:n.786T>C, XR_244809.1:n.573T>C, XR_244810.1:n.483T>C, XR_244811.1:n.503-3666T>C, XR_244812.1:n.483T>C, XR_922828.1:n.806T>C, XR_922829.1:n.806T>C, XR_922830.1:n.736-3666T>C, rs13033893, rs17551042, rs3761703, rs56505964, rs60076061
T > C
SNP
I65I
No VIP available No Clinical Annotations available VA
rs72549307 NC_000001.10:g.98164955T>C, NC_000001.11:g.97699399T>C, NG_008807.2:g.226661A>G, NM_000110.3:c.632A>G, NP_000101.2:p.Tyr211Cys, XM_005270561.1:c.521A>G, XM_005270562.1:c.632A>G, XM_005270562.3:c.632A>G, XM_005270563.1:c.632A>G, XM_005270564.1:c.632A>G, XM_006710397.2:c.632A>G, XP_005270618.1:p.Tyr174Cys, XP_005270619.1:p.Tyr211Cys, XP_005270619.2:p.Tyr211Cys, XP_005270620.1:p.Tyr211Cys, XP_005270621.1:p.Tyr211Cys, XP_006710460.1:p.Tyr211Cys
T > C
SNP
Y211C
No VIP available No Clinical Annotations available VA
rs7287550 NC_000022.10:g.19931976T>C, NC_000022.11:g.19944453T>C, NG_011526.1:g.7714T>C, NG_011835.1:g.2384A>G, NM_000754.3:c.-92+2556T>C, XM_005261229.1:c.-386+2556T>C, XM_011529887.1:c.-92+2556T>C, XM_011529890.1:c.-386+2556T>C, XM_011529891.1:c.-386+2278T>C
T > C
SNP
No VIP available No Clinical Annotations available VA
rs729147 NC_000004.11:g.100333267G>A, NC_000004.12:g.99412110G>A, NM_000673.4:c.*1038C>T, NM_001166504.1:c.*1038C>T, rs3805327, rs56638370, rs59352744
G > A
SNP
No VIP available CA VA
rs7319981 NC_000013.10:g.103723722G>A, NC_000013.11:g.103071372G>A, NG_016648.1:g.475C>T, rs56422021
G > A
SNP
No VIP available No Clinical Annotations available VA
rs73420732 NC_000007.13:g.55097762G>T, NC_000007.14:g.55030069G>T, NG_007726.3:g.16038G>T, NM_005228.3:c.88+10704G>T, NM_201282.1:c.88+10704G>T, NM_201283.1:c.88+10704G>T, NM_201284.1:c.88+10704G>T, XM_005271746.1:c.88+10704G>T, XM_005271748.1:c.88+10704G>T, XR_428151.2:n.681G>T
G > T
SNP
No VIP available No Clinical Annotations available VA
rs737866 NC_000022.10:g.19930109T>C, NC_000022.11:g.19942586T>C, NG_011526.1:g.5847T>C, NG_011835.1:g.4251A>G, NM_000754.3:c.-92+689T>C, NM_001282512.1:c.-783A>G, NM_006440.4:c.-783A>G, XM_005261214.1:c.-783A>G, XM_005261216.1:c.-783A>G, XM_005261217.1:c.-783A>G, XM_005261229.1:c.-386+689T>C, XM_011529887.1:c.-92+689T>C, XM_011529890.1:c.-386+689T>C, XM_011529891.1:c.-386+411T>C, rs17455584, rs386609683, rs60054527
T > C
SNP
No VIP available No Clinical Annotations available VA
rs740603 NC_000022.10:g.19945177A>G, NC_000022.11:g.19957654A>G, NG_011526.1:g.20915A>G, NM_000754.3:c.-91-3545A>G, NM_001135161.1:c.-91-3545A>G, NM_001135162.1:c.-91-3545A>G, XM_005261229.1:c.-385-3545A>G, XM_011529885.1:c.-331A>G, XM_011529886.1:c.-331A>G, XM_011529887.1:c.-91-3545A>G, XM_011529888.1:c.-91-3545A>G, XM_011529889.1:c.-91-3545A>G, XM_011529890.1:c.-385-3545A>G, XM_011529891.1:c.-385-3545A>G
A > G
SNP
No VIP available No Clinical Annotations available VA
rs750155 NC_000016.10:g.28609251C>T, NC_000016.9:g.28620572C>T, NG_028128.1:g.19295G>A, NM_001055.3:c.-4-392G>A, NM_001310136.1:c.121-142349G>A, NM_177529.2:c.-35-361G>A, NM_177530.2:c.-197G>A, NM_177534.2:c.-396G>A, NM_177536.3:c.139-2174G>A, XM_005255522.1:c.-4-392G>A
C > T
SNP
No VIP available CA VA
rs75017182 NC_000001.10:g.98045449G>C, NC_000001.11:g.97579893G>C, NG_008807.2:g.346167C>G, NM_000110.3:c.1129-5923C>G, XM_005270561.1:c.1018-5923C>G, XM_005270562.1:c.1129-5923C>G, XM_005270562.3:c.1129-5923C>G, XM_005270563.1:c.1129-5923C>G, XM_005270564.1:c.1129-5923C>G, XM_006710397.2:c.1129-5923C>G
G > C
SNP
No VIP available No Clinical Annotations available VA
rs7586110 NC_000002.11:g.234590527T>G, NC_000002.12:g.233681881T>G, NG_002601.2:g.97138T>G, NM_019075.2:c.855+44504T>G, NM_019076.4:c.855+63319T>G, NM_019077.2:c.-57T>G, NM_021027.2:c.855+9092T>G, XM_005246081.1:c.-57T>G, XR_241241.1:n.941+9092T>G, rs60348498
T > G
SNP
No VIP available CA No Variant Annotations available
rs760370 NC_000006.11:g.44200953A>G, NC_000006.12:g.44233216A>G, NG_042893.1:g.18712A>G, NM_001078174.1:c.1260-201A>G, NM_001078175.2:c.1260-201A>G, NM_001078176.2:c.1260-201A>G, NM_001078177.1:c.1260-201A>G, NM_001304462.1:c.1497-201A>G, NM_001304463.1:c.1386-201A>G, NM_001304465.1:c.1338-201A>G, NM_001304466.1:c.1335-201A>G, NM_004955.2:c.1260-201A>G, XM_005248875.1:c.1497-201A>G, XM_005248876.1:c.1389-201A>G, XM_005248876.3:c.1389-201A>G, XM_005248877.1:c.1386-201A>G, XM_005248878.1:c.1260-201A>G, XM_005248878.3:c.1260-201A>G, XM_005248879.1:c.1260-201A>G, XM_005248879.3:c.1260-201A>G, XM_005248880.1:c.1260-201A>G, XM_005248880.3:c.1260-201A>G, XM_005248881.1:c.1260-201A>G, XM_005248881.3:c.1260-201A>G, XM_005248882.1:c.1260-201A>G, XM_005248882.3:c.1260-201A>G, XM_011514341.1:c.1500-201A>G, rs59700015
A > G
SNP
No VIP available No Clinical Annotations available VA
rs7668258 NC_000004.11:g.69962078T>C, NC_000004.12:g.69096360T>C, NM_001074.2:c.-161T>C, XM_005265702.1:c.-26-2180T>C, XM_005265702.2:c.-26-2180T>C, XM_011532229.1:c.-161T>C, XM_011532230.1:c.-161T>C, XM_011532231.1:c.-26-2180T>C, rs17551675, rs60174701
T > C
SNP
No VIP available No Clinical Annotations available VA
rs768172 NC_000007.13:g.95805703A>T, NC_000007.14:g.96176391A>T, NG_012247.1:g.150757T>A, NM_001160210.1:c.1181-4867T>A, NM_014251.2:c.1178-4867T>A, NR_027662.1:n.1253-4867T>A, XM_006715831.2:c.1211-4867T>A, XM_011515727.1:c.1211-4867T>A, XM_011515728.1:c.326-4867T>A, rs118193516, rs59685268
A > T
SNP
No VIP available No Clinical Annotations available VA
rs770063251 NC_000008.10:g.105436493C>T, NC_000008.11:g.104424265C>T, NG_008840.1:g.47785G>A, NM_001385.2:c.1217G>A, NP_001376.1:p.Trp406Ter, XM_005250818.1:c.1217G>A, XM_005250818.2:c.1217G>A, XM_005250819.1:c.1217G>A, XM_006716518.2:c.1058G>A, XM_011516903.1:c.1217G>A, XM_011516904.1:c.1217G>A, XP_005250875.1:p.Trp406Ter, XP_005250876.1:p.Trp406Ter, XP_006716581.1:p.Trp353Ter, XP_011515205.1:p.Trp406Ter, XP_011515206.1:p.Trp406Ter
C > T
SNP
W406*
No VIP available No Clinical Annotations available VA
rs7746993 NC_000006.11:g.52714137C>A, NC_000006.12:g.52849339C>A, NG_029175.2:g.21120G>T, rs59957668
C > A
SNP
No VIP available No Clinical Annotations available VA
rs7754103 NC_000006.11:g.160061090C>T, NC_000006.12:g.159640058C>T, rs57022833
C > T
SNP
No VIP available No Clinical Annotations available VA
rs7757130 NC_000006.11:g.113317262C>A, NC_000006.12:g.112996060C>A, XR_942887.1:n.973-1377C>A
C > A
SNP
No VIP available No Clinical Annotations available VA
rs776746 NC_000007.13:g.99270539C>T, NC_000007.14:g.99672916T>C, NG_007938.1:g.12083G=, NG_007938.1:g.12083G>A, NM_000777.4:c.219-237A>G, NM_000777.4:c.219-237G>A, NM_001190484.2:c.219-237A>G, NM_001190484.2:c.219-237G>A, NM_001291829.1:c.-253-1A>G, NM_001291829.1:c.-253-1G>A, NM_001291830.1:c.189-237A>G, NM_001291830.1:c.189-237G>A, NR_033807.2:n.717-1A>G, NR_033807.2:n.717-1G>A, NR_033808.1:n.689-1G>A, NR_033809.1:n.581-237G>A, NR_033810.1:n.689-1G>A, NR_033811.1:n.321-1G>A, NR_033812.1:n.321-1G>A, XM_005250169.1:c.189-237G>A, XM_005250170.1:c.-357-1G>A, XM_005250171.1:c.-253-1G>A, XM_005250172.1:c.-254G>A, XM_005250173.1:c.-331-237G>A, XM_005250198.1:c.806-4288C>T, XM_006715859.2:c.219-237A>G, XM_011515843.1:c.-254A>G, XM_011515844.1:c.-229-237A>G, XM_011515845.1:c.-463-1A>G, XM_011515846.1:c.-331-237A>G, XM_011515847.1:c.-571-1A>G, XR_927383.1:n.344-237A>G, XR_927402.1:n.1466+48736T>C, rs10361242, rs11266830, rs386613022, rs58244770
C > T
SNP
No VIP available CA VA
rs7853758 NC_000009.11:g.86900926G>A, NC_000009.12:g.84286011G>A, NM_001199633.1:c.1381C>T, NM_022127.2:c.1381C>T, NP_001186562.1:p.Leu461=, NP_071410.1:p.Leu461=, NR_037638.2:n.1703C>T, XM_011518905.1:c.1465C>T, XM_011518906.1:c.1465C>T, XM_011518907.1:c.1132C>T, XM_011518908.1:c.742C>T, XP_011517207.1:p.Leu489=, XP_011517208.1:p.Leu489=, XP_011517209.1:p.Leu378=, XP_011517210.1:p.Leu248=, XR_929832.1:n.1572C>T, XR_930033.1:n.88-3031G>A, rs59483082, rs59559753
G > A
SNP
L461L
No VIP available CA No Variant Annotations available
rs7867504 NC_000009.11:g.86920236T>C, NC_000009.12:g.84305321T>C, NM_001199633.1:c.267A>G, NM_022127.2:c.267A>G, NP_001186562.1:p.Thr89=, NP_071410.1:p.Thr89=, NR_037638.2:n.589A>G, XM_011518905.1:c.419-2932A>G, XM_011518906.1:c.419-2932A>G, XM_011518907.1:c.86-2932A>G, XM_011518909.1:c.419-2932A>G, XM_011518910.1:c.419-2932A>G, XR_929832.1:n.546-2932A>G, rs386613708, rs60110305
T > -
T > C
SNP
T89T
No VIP available No Clinical Annotations available VA
rs7977213 NC_000012.11:g.20980800G>C, NC_000012.12:g.20827866G>C, NG_032071.1:g.22163G>C, NM_019844.3:c.84+12044G>C, XM_005253347.1:c.84+12044G>C, rs11502664, rs58558915
G > C
SNP
No VIP available No Clinical Annotations available VA
rs8001466 NC_000013.10:g.99355601G>C, NC_000013.11:g.98703347G>C, NG_017032.1:g.54329C>G, NM_005073.3:c.1417-818C>G
G > C
SNP
No VIP available No Clinical Annotations available VA
rs8056100 NC_000016.10:g.48226719G>A, NC_000016.9:g.48260630G>A, NG_011522.1:g.13459C>T, NM_032583.3:c.395+1087C>T, NM_033151.3:c.395+1087C>T, NM_145186.2:c.395+1087C>T, XM_005256208.1:c.395+1087C>T, XM_005256209.1:c.395+1087C>T, XM_005256210.1:c.395+1087C>T, XM_011523396.1:c.197+1087C>T, XR_243432.1:n.500+1087C>T, rs58118497
G > A
SNP
No VIP available CA VA
rs8175347
(TA)6 > (TA)5
(TA)6 > (TA)7
(TA)6 > (TA)8
microsatellite
No VIP available No Clinical Annotations available VA
rs8187710 NC_000010.10:g.101611294G>A, NC_000010.11:g.99851537G>A, NG_011798.1:g.73832G>A, NM_000392.4:c.4544G>A, NP_000383.1:p.Cys1515Tyr, XM_005269536.1:c.4265G>A, XM_006717630.2:c.3848G>A, XP_005269593.1:p.Cys1422Tyr, XP_006717693.1:p.Cys1283Tyr, XR_945605.1:n.4608G>A, rs17222568, rs52804507, rs58135906
G > A
SNP
C1515Y
No VIP available No Clinical Annotations available VA
rs8192924 NC_000016.10:g.66940496G>A, NC_000016.9:g.66974399G>A, NM_003869.5:c.809G>A, NM_198061.2:c.809G>A, NP_003860.2:p.Arg270His, NP_932327.1:p.Arg270His, NR_036684.1:n.2047G>A, XM_011523421.1:c.338G>A, XP_011521723.1:p.Arg113His
G > -
G > A
SNP
R270H
No VIP available CA No Variant Annotations available
rs861539 NC_000014.8:g.104165753G>A, NC_000014.9:g.103699416G>A, NG_011516.1:g.21071C>T, NG_012307.1:g.75229G>A, NM_001100118.1:c.722C>T, NM_001100119.1:c.722C>T, NM_001130107.1:c.1782-1239G>A, NM_005432.3:c.722C>T, NM_182923.3:c.1651-1239G>A, NP_001093588.1:p.Thr241Met, NP_001093589.1:p.Thr241Met, NP_005423.1:p.Thr241Met, XM_005267599.1:c.1924-1239G>A, XM_005267600.1:c.*17-1239G>A, XM_005267602.1:c.1897-1239G>A, XM_005267603.1:c.*17-1239G>A, XM_005267604.1:c.1857-1239G>A, XM_005267605.1:c.1849-1239G>A, XM_005267606.1:c.*17-1239G>A, XM_005267607.1:c.1830-1239G>A, XM_005267608.1:c.1825-1239G>A, XM_005267609.1:c.1822-1239G>A, XM_005267610.1:c.*46-1239G>A, XM_005267612.1:c.*17-1239G>A, XM_005267613.1:c.1758-1239G>A, XM_005267614.1:c.1755-1239G>A, XM_005267615.1:c.1726-1239G>A, XM_005267616.1:c.*17-1239G>A, XM_005267617.1:c.1699-1239G>A, XM_005267618.1:c.*17-1239G>A, XM_005267624.1:c.1624-1239G>A, XM_005268045.1:c.722C>T, XM_005268046.1:c.722C>T, XM_005268047.1:c.722C>T, XM_011537138.1:c.722C>T, XP_005268102.1:p.Thr241Met, XP_005268103.1:p.Thr241Met, XP_005268104.1:p.Thr241Met, XP_011535440.1:p.Thr241Met, rs1734804, rs17435402, rs17850783, rs3212111, rs56934996
G > A
SNP
T241M
No VIP available No Clinical Annotations available VA
rs871514 NC_000002.11:g.234628529T>C, NC_000002.12:g.233719883T>C, NG_002601.2:g.135140T>C, NM_001072.3:c.861+26018T>C, NM_007120.2:c.867+196T>C, NM_019075.2:c.856-47151T>C, NM_019076.4:c.856-47151T>C, NM_019077.2:c.855+37091T>C, NM_019078.1:c.867+6025T>C, NM_021027.2:c.855+47094T>C, NM_205862.1:c.60+26018T>C, XR_241238.1:n.923+196T>C, XR_241240.1:n.1022+26018T>C, XR_241241.1:n.941+47094T>C, rs386618255, rs58866400, rs61099298
T > C
SNP
No VIP available CA VA
rs885004 NC_000009.11:g.86909550G>A, NC_000009.12:g.84294635G>A, NM_001199633.1:c.862-360C>T, NM_022127.2:c.862-360C>T, NR_037638.2:n.1184-360C>T, XM_011518905.1:c.946-360C>T, XM_011518906.1:c.946-360C>T, XM_011518907.1:c.613-360C>T, XM_011518908.1:c.223-360C>T, XM_011518909.1:c.946-360C>T, XM_011518910.1:c.946-360C>T, XR_929832.1:n.1073-360C>T, rs59238422
G > A
SNP
No VIP available CA VA
rs895819 NC_000019.10:g.13836478T>C, NC_000019.9:g.13947292T>C, NR_029495.1:n.182A>G, NR_029497.1:n.-119A>G, NR_029501.1:n.40A>G, NR_036515.1:n.-189A>G, rs117072305, rs61371382
T > C
SNP
No VIP available CA VA
rs9024 NC_000021.8:g.37445313G>A, NC_000021.9:g.36073015G>A, NM_001286789.1:c.*1076G>A, NM_001757.3:c.*133G>A, NR_040084.1:n.377+1866C>T, XM_005261073.1:c.*1076G>A, rs17228577, rs3171443, rs61389789
G > A
SNP
No VIP available No Clinical Annotations available VA
rs9282861 NC_000016.10:g.28606193C>T, NC_000016.9:g.28617514C>T, NG_028128.1:g.22353G>A, NM_001055.3:c.638G>A, NM_001310136.1:c.121-139291G>A, NM_177529.2:c.638G>A, NM_177530.2:c.638G>A, NM_177534.2:c.638G>A, NM_177536.3:c.404G>A, NP_001046.2:p.Arg213His, NP_803565.1:p.Arg213His, NP_803566.1:p.Arg213His, NP_803878.1:p.Arg213His, NP_803880.1:p.Arg135His, XM_005255522.1:c.638G>A, XP_005255579.1:p.Arg213His, rs17844870, rs17857585
C > T
SNP
R213H
No VIP available CA VA
rs9332377 NC_000022.10:g.19955692C>T, NC_000022.11:g.19968169C>T, NG_011526.1:g.31430C>T, NG_023326.1:g.53618G>A, NM_000754.3:c.616-367C>T, NM_001135161.1:c.616-367C>T, NM_001135162.1:c.616-367C>T, NM_007310.2:c.466-367C>T, XM_005261229.1:c.616-367C>T, XM_005261242.1:c.2764-960G>A, XM_006724243.1:c.2782-960G>A, XM_006724246.2:c.2536-960G>A, XM_011529885.1:c.*742C>T, XM_011529886.1:c.730-367C>T, XM_011529887.1:c.*742C>T, XM_011529888.1:c.*742C>T, XM_011529889.1:c.*742C>T, XM_011529890.1:c.*742C>T, XM_011529891.1:c.*742C>T, XM_011530179.1:c.2749-960G>A, XM_011530182.1:c.1348-960G>A, rs60676269
C > T
SNP
No VIP available CA No Variant Annotations available
rs9340799 NC_000006.11:g.152163381A>G, NC_000006.12:g.151842246A>G, NG_008493.1:g.156751A>G, NM_000125.3:c.453-351A>G, NM_001122740.1:c.453-351A>G, NM_001122741.1:c.453-351A>G, NM_001122742.1:c.453-351A>G, NM_001291230.1:c.453-351A>G, NM_001291241.1:c.453-351A>G, XM_005266856.1:c.453-351A>G, XM_005266857.1:c.453-351A>G, XM_006715374.2:c.453-351A>G, XM_006715375.2:c.-67-351A>G, XM_011535543.1:c.453-351A>G, XM_011535544.1:c.453-351A>G, XM_011535545.1:c.453-351A>G, XM_011535546.1:c.453-351A>G, XM_011535547.1:c.453-351A>G, XM_011535548.1:c.-67-351A>G, rs17208058, rs59875577
A > G
SNP
No VIP available CA VA
rs9351963 NC_000006.11:g.73749861A>C, NC_000006.12:g.73040138A>C, NM_001160130.1:c.490-1798A>C, NM_001160132.1:c.490-1798A>C, NM_001160133.1:c.490-1798A>C, NM_001160134.1:c.490-1798A>C, NM_019842.3:c.490-1798A>C, XM_005248734.1:c.-9-1798A>C, XM_011535944.1:c.490-1798A>C
A > C
SNP
No VIP available CA VA
rs9514091 NC_000013.10:g.103714254G>A, NC_000013.11:g.103061904G>A, NG_016648.1:g.9943C>T, NM_000452.2:c.378-3522C>T, rs57163569
G > A
SNP
No VIP available CA No Variant Annotations available
rs9561778 NC_000013.10:g.95713715G>T, NC_000013.11:g.95061461G>T, NM_001301829.1:c.3225+1243C>A, NM_005845.4:c.3366+1243C>A, XM_005254025.1:c.3237+1243C>A, XM_005254025.2:c.3237+1243C>A, XM_005254026.1:c.3225+1243C>A, XM_005254027.1:c.3141+1243C>A, XM_006719914.1:c.3276+1243C>A, XM_011521047.1:c.2817+1243C>A, rs17234943
G > A
G > T
SNP
No VIP available No Clinical Annotations available VA
rs9657362 NC_000008.10:g.1833801G>C, NC_000008.11:g.1885635G>C, NG_008480.1:g.66653G>C, NM_001308152.1:c.996G>C, NM_001308153.1:c.1185G>C, NM_014629.2:c.1110G>C, NM_014629.3:c.1110G>C, NP_001295081.1:p.Leu332Phe, NP_001295082.1:p.Leu395Phe, NP_055444.2:p.Leu370Phe, NT_187576.1:g.69011G>C, XM_005266039.1:c.1182G>C, XM_005266040.1:c.1185G>C, XM_005266040.3:c.1185G>C, XM_005266041.1:c.1113G>C, XM_005266041.2:c.1113G>C, XM_005266042.1:c.996G>C, XM_006725106.2:c.1185G>C, XM_006725107.2:c.1113G>C, XM_006725111.1:c.996G>C, XM_011534766.1:c.1113G>C, XM_011534767.1:c.993G>C, XM_011534768.1:c.1113G>C, XM_011534769.1:c.1068G>C, XM_011534770.1:c.1113G>C, XM_011546563.1:c.1113G>C, XM_011546564.1:c.993G>C, XM_011546565.1:c.1113G>C, XM_011546566.1:c.1068G>C, XM_011546567.1:c.1113G>C, XP_005266096.1:p.Leu394Phe, XP_005266097.1:p.Leu395Phe, XP_005266098.1:p.Leu371Phe, XP_005266099.1:p.Leu332Phe, XP_006725169.1:p.Leu395Phe, XP_006725170.1:p.Leu371Phe, XP_006725174.1:p.Leu332Phe, XP_011533068.1:p.Leu371Phe, XP_011533069.1:p.Leu331Phe, XP_011533070.1:p.Leu371Phe, XP_011533071.1:p.Leu356Phe, XP_011533072.1:p.Leu371Phe, XP_011544865.1:p.Leu371Phe, XP_011544866.1:p.Leu331Phe, XP_011544867.1:p.Leu371Phe, XP_011544868.1:p.Leu356Phe, XP_011544869.1:p.Leu371Phe, rs52817136, rs57380468
G > C
SNP
L332F
No VIP available CA No Variant Annotations available
rs9679162 NC_000002.11:g.31247514G>T, NC_000002.12:g.31024648G>T, NM_001253826.1:c.315-58346C>A, NM_001253827.1:c.70-31641C>A, NM_024572.3:c.130-31641C>A, NR_045602.1:n.903-31641C>A, XM_005264559.1:c.25-31641C>A, XM_011533104.1:c.448-31641C>A, XM_011533105.1:c.70-31641C>A, XM_011533106.1:c.43-31641C>A, rs56573917, rs57478659, rs60984987
G > T
SNP
No VIP available CA VA
rs9936750 NC_000016.10:g.55137962T>C, NC_000016.9:g.55171874T>C, rs17210912, rs61515867
T > C
SNP
No VIP available CA No Variant Annotations available
rs9937 NC_000011.10:g.4138227A>G, NC_000011.9:g.4159457A>G, NG_027992.2:g.48534A>G, NM_001033.3:c.2223A>G, NM_001033.4:c.2223A>G, NM_001318064.1:c.1932A>G, NM_001318065.1:c.1209A>G, NP_001024.1:p.Thr741=, NP_001304993.1:p.Thr644=, NP_001304994.1:p.Thr403=, XM_005253058.1:c.1980A>G, XM_005253059.1:c.1932A>G, XM_011520277.1:c.1932A>G, XM_011520278.1:c.1557A>G, XM_011520279.1:c.1209A>G, XP_005253115.1:p.Thr660=, XP_005253116.1:p.Thr644=, XP_011518579.1:p.Thr644=, XP_011518580.1:p.Thr519=, XP_011518581.1:p.Thr403=, rs1042857, rs17295553, rs17349998, rs17398272, rs17850106, rs2228120, rs3177016, rs59628733
A > G
SNP
T741T
No VIP available CA No Variant Annotations available
rs9981861 NC_000021.8:g.41415044T>C, NC_000021.9:g.40043117T>C, NM_001271534.1:c.5384-444A>G, NM_001389.3:c.5384-444A>G, NR_073202.1:n.5645-444A>G, XM_011529481.1:c.3020-444A>G, rs57793011
T > C
SNP
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 147

Overview

Alternate Names: 
Synonym
Benign Neoplasm; Benign Neoplasms; Cancer; Cancers; Neoplasm; Neoplasm, Benign; Neoplasms NOS; Neoplasms, Benign; Tumor; Tumors; Tumour
PharmGKB Accession Id: PA445062
External Vocabularies

PharmGKB Curated Pathways

Pathways created internally by PharmGKB based primarily on literature evidence.

Curated Information ?

EvidenceGene
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ABCA1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ABCB1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABCB10
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ABCB11
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ABCB4
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ABCC1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ABCC10
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ABCC11
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ABCC2
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ABCC3
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
ABCC4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABCC5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABCC6
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ABCC9
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABCG1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ABCG2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABL1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABL2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ACE
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ADH7
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ADM
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
AGPAT2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
AHR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
AKR1A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
AKT1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
AKT2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
AKT3
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ALDH1A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ALDH2
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ALDH3A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ALK
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
AOX1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ARHGEF10
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ARVCF
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
AS3MT
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ATP7A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ATP7B
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
AURKA
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BAK1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BCHE
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BCL2L1
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
BCL2L11
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BCR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BMPR2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BRAF
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BRCA1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BRCA2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BRD4
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
C18orf56
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CBR1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CBR3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CBS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CCND1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CCNE1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CCR4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CD274
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CD3D
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CD3E
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CD3G
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CDA
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CDC5L
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CDK2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CDK4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CDK6
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CDKN1A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CDKN1B
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CDKN2A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CES1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CES2
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CMPK1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
COL1A2
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
COMT
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CPS1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CRK
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CRP
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CSF1R
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CSK
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CTNNB1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CTNND1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CXCL8
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CXCR1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CXCR2
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
CYBA
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYBB
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP19A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP1A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP1A2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP1B1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2A13
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CYP2A6
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CYP2B6
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2C18
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CYP2C19
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CYP2C8
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CYP2C9
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CYP2D6
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2E1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2F1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2G1P
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CYP2J2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2S1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CYP3A
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CYP3A4
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CYP3A5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP4B1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CYP4F2
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
DAPK1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DCK
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DCTD
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DDIT3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DHFR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DKC1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DNMT1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
DPYD
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
DPYS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DRD2
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
DSCAM
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
EGF
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
EGFR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
EML4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
EPC2
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
EPO
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ERBB2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ERBB4
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ERCC1
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
ERCC2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ERCC4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ERCC5
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
ESR1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FCGR2A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FCGR3A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FCGRT
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
FDPS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FEZ1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FFAR2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FGF2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FGFR1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FLT1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FLT3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FLT4
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
FMO2
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
FMO3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FOLH1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FOXO1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FRS2
G6PD
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GABPA
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
GALNT14
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GATA4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GJB2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GNB3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GNMT
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GPX1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
GPX3
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
GSTA2
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
GSTA5
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
GSTM1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
GSTM3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTO1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTO2
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
GSTP1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
GSTT1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTT2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTT2B
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTZ1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
HAS3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HDAC3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HEY1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HIF1A
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
HLA-A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HMGCR
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
HNMT
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HOXC10
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HRAS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HSP90AA1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HTR2B
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ICAM1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IGF1R
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IGFBP3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IL1B
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IQGAP2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ITGAV
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ITGB5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
JUP
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KCNE1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KCNE2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KCNH2
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
KCNQ1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
KCNQ5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KDR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KIT
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KLF2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KLK15
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KMT2A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KRAS
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
LARP1B
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
LDLR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
LGALS1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
LILRA3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
LMNA
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
LRP2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAP2K1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAP2K2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAP2K3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAP2K4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAP2K5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAP2K6
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAP2K7
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAPK1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAPK10
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAPK11
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAPK12
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAPK13
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAPK14
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAPK3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAPK4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAPK6
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAPK7
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAPK8
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAPK9
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAX
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MCL1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MDM2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MDM4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MET
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MGMT
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
MIR27A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MITF
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MKI67
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MLH1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MSH2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MSI1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MT-ND6
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MTHFD1
MTHFR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MTOR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MTR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MTRR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MYC
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NAT1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NAT2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NATP
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
NCF4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NDOR1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NOS2
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
NOS3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NOTCH1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NOTCH2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NOTCH3
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
NQO1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
NR1I2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NRAS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NRP1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NT5C
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NT5C1A
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
NT5C2
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
NT5C3A
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
OPRK1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
OPRM1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
OTOS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
P2RY1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
P2RY12
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PAPD7
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PARP1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PDCD1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PDGFRB
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PEMT
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PGR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PIGF
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PIK3C2A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PIK3C2B
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
PIK3CA
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
PIK3R1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PIK3R5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCB1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCB2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCB3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCB4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCD1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCD3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCD4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCE1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCG1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCG2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCH1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCH2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCL1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCL2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PLCZ1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PML
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PNMT
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
PON1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PPARGC1A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PPP1R15A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PRKCB
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PROM1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PSMC1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PSPH
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PTCH1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PTEN
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PTGS1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
PTGS2
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
RAC2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
RAF1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
RALBP1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
RARA
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
RARG
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
RET
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
RHBDF2
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
RRM1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SCN5A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SDHB
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SDHD
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SEPT14
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SERPINA3
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SERPINA6
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SHC1
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
SHMT1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SLC10A2
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SLC15A1
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
SLC19A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SLC1A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC22A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SLC22A17
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SLC22A2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC22A3
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SLC22A7
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SLC25A13
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC26A4
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SLC28A1
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
SLC28A2
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SLC28A3
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
SLC29A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC29A2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC6A4
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SLCO1B1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SLCO1B3
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SLCO4C1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SLCO6A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SMO
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SMPD1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SMYD3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SOD1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SOD2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SP1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SPG7
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SRC
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ST14
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
STAT3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
STK11
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SULT1A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SULT1A2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SULT1E1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SULT2B1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TDP1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TIMP3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TK2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TLR5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TMCC1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TNFSF9
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
TOMM40L
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TOP1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TOP2A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TOP2B
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
TP53
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TPH2
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
TPMT
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TPT1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
TXNRD2
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
TYMP
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
TYMS
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UGT1A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
UGT1A10
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UGT1A4
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UGT1A6
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
UGT1A7
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UGT1A8
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UGT1A9
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
UGT2B10
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
UGT2B15
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
UGT2B7
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
UMPS
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
UPB1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
VEGFA
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
VEGFB
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
WNT5B
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
XDH
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
XPA
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
XPC
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
XRCC1
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
XRCC3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
YAP1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
YY1AP1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ZNF706

Curated Information ?