
The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Gene ? Variant?
Alternate Names ? Drugs ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
No VIP available No VIP available No VIP available CYP2A6 *1A N/A N/A N/A
No VIP available No VIP available No VIP available CYP2A6 *4A N/A N/A N/A
No VIP available No VIP available No VIP available CYP2A6 *7 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2A6 *9A N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C19 *1 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C19 *2A N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C19 *2B N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C19 *17 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *1 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *1xN N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *2 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *3 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *4 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *6 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *10 N/A N/A N/A
No VIP available No VIP available No VIP available CYP3A4 *1A N/A N/A N/A
No VIP available No VIP available No VIP available CYP3A4 *1B N/A N/A N/A
No VIP available CA No VIP available CYP3A5 *1A N/A N/A N/A
No VIP available CA No VIP available CYP3A5 *3A N/A N/A N/A
No VIP available No VIP available No VIP available CYP3A5 *3C N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *1 N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *5 N/A N/A N/A
No VIP available No VIP available No VIP available G6PD Mediterranean, Dallas, Panama' Sassari, Cagliari, Birmingham N/A N/A N/A
No VIP available No VIP available No VIP available GSTM1 non-null N/A N/A N/A
No VIP available CA No VIP available GSTT1 non-null N/A N/A N/A
No VIP available CA No VIP available GSTT1 null N/A N/A N/A
No VIP available No VIP available No VIP available HLA-A *02:01 N/A N/A N/A
No VIP available No VIP available No VIP available HLA-A *03:01:01:01 N/A N/A N/A
No VIP available No VIP available No VIP available PIK3CA H4 N/A N/A N/A
No VIP available No VIP available No VIP available PIK3CA H5 N/A N/A N/A
No VIP available No VIP available No VIP available SLCO1B1 *1 N/A N/A N/A
No VIP available No VIP available No VIP available SLCO1B1 *15 N/A N/A N/A
No VIP available No VIP available VA TPMT *1 N/A N/A N/A
No VIP available No VIP available VA TPMT *3A N/A N/A N/A
No VIP available No VIP available VA TPMT *3C N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *1 N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *6 N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *28 N/A N/A N/A
No VIP available CA No VIP available UGT1A1 *60 N/A N/A N/A
No VIP available No Clinical Annotations available VA
G6PD deficiency N/A N/A N/A
No VIP available No Clinical Annotations available VA
rs10413396 17081920G>T, 44813702G>T
G > T
Not Available
No VIP available CA No Variant Annotations available
rs1042522 -278-661C>G, 16397C>G, 215C>G, 7182846G>C, 7579472G>C, 98C>G, P53:Arg72Pro, Pro33Arg, Pro72Arg, R72P, TP53 Arg72Pro, mRNA 412C>G, p.Pro72Arg, p52 codon 72
G > C
5' Flanking
No VIP available No Clinical Annotations available VA
rs1042597 234526871C>G, 234526871C>T, 33482C>G, 33482C>T, 473130C>G, 473130C>T, 518C>G, 518C>T, Ala173Gly, Ala173Val, UGT1A8*2
C > G
C > T
No VIP available No Clinical Annotations available VA
rs1042605 234527118A>G, 33729A>G, 473377A>G, 765A>G, Thr255=, UGT1A8*1
A > G
No VIP available CA VA
rs10426377 21360452C>A, 378+1540C>A, 41806C>A, 423+1540C>A, 49092234C>A
C > A
No VIP available No Clinical Annotations available VA
rs1044457 *360C>T, 1119C>T, 17814695C>T, 47842777C>T
C > T
Not Available
No VIP available CA VA
rs1045642 208920T>A, 208920T>C, 25171488A>G, 25171488A>T, 3435T>A, 3435T>C, 87138645A>G, 87138645A>T, ABCB1*6, ABCB1: 3435C>T, ABCB1: C3435T, ABCB1: c.3435C>T, ABCB1:3435C>T, Ile1145=, Ile1145Ile, MDR1 3435C>T, MDR1 C3435T, PGP C3435T, c.3435C>T, mRNA 3853C>T
A > T
A > G
No VIP available CA VA
rs1048977 20618562C>T, 20945055C>T, 435C>T, CDA:435C>T, T145T, Thr145=, mRNA 614C>T
C > T
No VIP available CA VA
rs1051640 14042638A>G, 4509A>G, 48768486A>G, Glu1503=
A > G
No VIP available CA VA
rs1056892 23180577G>A, 37518706G>A, 730G>A, 93-53C>T, CBR3 730G>A, CBR3 V244M, CBR3:Val244Met, Val244Met
G > A
No VIP available No Clinical Annotations available VA
rs1058930 16136C>G, 47622583G>C, 486C>G, 582C>G, 792C>G, 96818119G>C, C792G, CYP2C8: I264M, Ile162Met, Ile194Met, Ile264Met
G > C
No VIP available No Clinical Annotations available VA
rs10815019 232+2581A>G, 4537288A>G, 4547288A>G, 61862A>G
A > G
No VIP available No Clinical Annotations available VA
rs10841661 13744956C>T, 20984832C>T, 26195C>T, 84+16076C>T
C > T
No VIP available No Clinical Annotations available VA
rs10929302 -1791C>T, 172393G>A, 234665782G>A, 61-9898G>A, 612041G>A, 856-9898G>A, 862-9898G>A, 868-9898G>A, UGT1A1*93, UGT1A1:-3156G>A, UGT1A1:G-3156A
G > A
5' Flanking
No VIP available No Clinical Annotations available VA
rs10931910 201523736A>G, 3172-152A>G, 51733154A>G
A > G
No VIP available No Clinical Annotations available VA
rs11022922 17975C>T, 2419195C>T, 2479195C>T, 386+12481C>T
C > T
No VIP available CA VA
rs11045585 13805818A>G, 1683-5676A>G, 21045694A>G, 87057A>G
A > G
No VIP available No Clinical Annotations available VA
rs11075646 -171C>G, -850G>C, -909G>C, 20583375C>G, 66969176C>G, 803C>G
C > G
Not Available
No VIP available No Clinical Annotations available VA
rs1113129 23210C>G, 47615509G>C, 514-5337C>G, 610-5337C>G, 820-5337C>G, 96811045G>C, CYP2C8-HapC, Haplotype low act, rs1113129 G>C
G > C
No VIP available CA VA
rs11141915 128039A>C, 19400326A>C, 284+15704A>C, 90235794A>C
A > C
No VIP available CA No Variant Annotations available
rs11211524 172-5414A>C, 172-928A>C, 17805131A>C, 321-928A>C, 47833213A>C
A > C
No VIP available No Clinical Annotations available VA
rs1128503 1236T>C, 167964T>C, 87179601A>G, 87550285A>G, ABCB1 1236C>T, ABCB1*8, ABCB1: c.1236T>C, ABCB1:1236C>T, ABCB1:1236T>C, Gly412=, Gly412Gly, mRNA 1654T>C, p.Gly412Gly
A > G
No VIP available CA No Variant Annotations available
rs1138272 12659374C>T, 341C>T, 67353579C>T, 7514C>T, A114V, Ala114Val, GSTP1: A114V, GSTP1: C341T
C > T
No VIP available CA VA
rs1142345 18070918T>C, 18130918T>C, 29457A>G, 719A>G, TPMT*3C, Tyr240Cys
T > C
No VIP available CA No Variant Annotations available
rs11479 -14+194C>A, -14+194C>G, -14+194C>T, -14+439C>A, -14+439C>G, -14+439C>T, -349C>A, -349C>G, -349C>T, -379C>A, -379C>G, -379C>T, 1412C>A, 1412C>G, 1412C>T, 1427C>A, 1427C>G, 1427C>T, 22592G>A, 22592G>C, 22592G>T, 50525807G>A, 50525807G>C, 50525807G>T, 50964236G>A, 50964236G>C, 50964236G>T, 5633C>A, 5633C>G, 5633C>T, 9279C>A, 9279C>G, 9279C>T, Ser471Leu, Ser471Ter, Ser471Trp, Ser476Leu, Ser476Ter, Ser476Trp
G > A
G > T
G > C
5' Flanking
No VIP available No Clinical Annotations available VA
rs1149222 1119+403C>A, 25106618G>T, 40974C>A, 87073775G>T
G > T
No VIP available No Clinical Annotations available VA
rs11572080 110G>A, 206G>A, 416G>A, 47631494C>T, 7225G>A, 96827030C>T, Arg139Lys, Arg37Lys, Arg69Lys, CYP2C8*3, CYP2C8: R139K, G416A, R139K, rs11572080 G>A
C > T
No VIP available No Clinical Annotations available VA
rs11572103 16149A>T, 47622570T>A, 499A>T, 595A>T, 805A>T, 96818106T>A, A805T, CYP2C8*2, CYP2C8: I269F, Ile167Phe, Ile199Phe, Ile269Phe
T > A
No VIP available CA VA
rs11598702 104897985T>C, 175+1178A>G, 55702449T>C
T > C
No VIP available CA VA
rs11615 18191871A>G, 354T>C, 45923653A>G, 63434T>C, Asn118=, ERCC1:19007T>C, ERCC1:Asn118Asn
A > G
No VIP available No Clinical Annotations available VA
rs11692021 234591205T>C, 537464T>C, 622T>C, 855+45182T>C, 855+63997T>C, 855+9770T>C, 97816T>C, Trp208Arg
T > C
No VIP available CA VA
rs11719165 194586088T>C, 538837T>C
T > C
Not Available
No VIP available CA VA
rs12046844 36210297G>A, 66238379G>A
G > A
Not Available
No VIP available CA VA
rs12201199 18079802A>T, 18139802A>T, 20573T>A, 419+94T>A, TPMT:rs12201199 A/T
A > T
No VIP available No Clinical Annotations available VA
rs12211463 31586992T>G, 93467158T>G
T > G
Not Available
No VIP available No Clinical Annotations available VA
rs12468274 134525T>C, 234627914T>C, 448T>C, 574173T>C, 60+25403T>C, 855+36476T>C, 855+46479T>C, 856-47766T>C, 861+25403T>C, 867+5410T>C, Leu150=
T > C
No VIP available CA No Variant Annotations available
rs12721627 20716C>G, 37398936G>C, 554C>G, 99366093G>C, CYP3A4*16, CYP3A4*16A, CYP3A4:185 Thr>Ser, CYP3A4:554C>G, CYP3A4:658 C>G, CYP3A4:T185S, CYP3A4:Thr185Ser, Thr185Ser
G > C
No VIP available No Clinical Annotations available VA
rs12762549 101620771C>G, 52425235C>G
C > G
Not Available
No VIP available CA VA
rs12948783 -2185C>A, -2185C>T, 3110C>A, 3110C>T, 39773552G>A, 39773552G>T, 74499400G>A, 74499400G>T
G > A
G > T
5' Flanking
No VIP available No Clinical Annotations available VA
rs13401281 135290T>G, 234628679T>G, 574938T>G, 60+26168T>G, 855+37241T>G, 856-47001T>G, 861+26168T>G, 867+346T>G, 867+6175T>G
T > G
No VIP available No Clinical Annotations available VA
rs13422094 1003001T>C, 22181114T>C
T > C
Not Available
No VIP available No Clinical Annotations available VA
rs1551285 234529122A>C, 35733A>C, 475381A>C, 855+1914A>C
A > C
No VIP available No Clinical Annotations available VA
rs1617640 -1306C>A, 100317298C>A, 38350141C>A, 3876C>A
C > A
5' Flanking
No VIP available No Clinical Annotations available VA
rs165728 *764C>T, *877+379G>A, 19957023C>T, 3109173C>T, 32761C>T, 52287G>A
C > T
3' UTR
No VIP available CA No Variant Annotations available
rs1695 12658484A>G, 313A>G, 6624A>G, 67352689A>G, GSTP1*2, GSTP1*B, GSTP1: I105V, GSTP1:A313G, GSTP1:I105V, GSTP1:Ile105Val, Ile105Val, Part of haplotypes GSTP1*B and GSTP1*C, rs1695:A>G
A > G
No VIP available No Clinical Annotations available VA
rs17216177 -34T>C, 101603522T>C, 3742-34T>C, 52407986T>C, 66060T>C
T > C
No VIP available No Clinical Annotations available VA
rs17287570 116670A>C, 16095103A>C, 16155103A>C, 1677+4951A>C
A > C
No VIP available CA VA
rs1736557 171080080G>A, 22568722G>A, 25063G>A, 769G>A, Val257Met
G > A
No VIP available No Clinical Annotations available VA
rs174699 19954458C>T, 30196C>T, 3106608C>T, 466-1601C>T, 616-1601C>T
C > T
No VIP available CA VA
rs17583889 138746039C>A, 191-12449C>A, 28494702C>A, 29232C>A
C > A
No VIP available No Clinical Annotations available VA
rs17645700 138780932T>C, 28529595T>C
T > C
Not Available
No VIP available No Clinical Annotations available VA
rs17863783 -7-168G>T, 108888G>T, 234602277G>T, 548536G>T, 627G>T, 855+10839G>T, 855+20842G>T, 855+56254G>T, 856-73403G>T, Val209=
G > T
No VIP available CA VA
rs17868320 234578428C>T, 524687C>T, 85039C>T, 855+32405C>T, 855+51220C>T
C > T
No VIP available No Clinical Annotations available VA
rs17868323 234590970T>G, 387T>G, 537229T>G, 855+44947T>G, 855+63762T>G, 855+9535T>G, 97581T>G, Asn129Lys, UGT1A7:N129K, rs17868323
T > G
No VIP available No Clinical Annotations available VA
rs1799782 16325792G>A, 44057574G>A, 580C>T, Arg194Trp
G > A
No VIP available CA No Variant Annotations available
rs1799793 11587G>A, 18135477C>T, 45867259C>T, 862G>A, 934G>A, Asp288Asn, Asp312Asn, XPD Asp312Asn, XPD:Asp312Asn
C > T
No VIP available No Clinical Annotations available VA
rs1799971 -11+28644A>G, 118A>G, 154360797A>G, 34162A>G, 397A>G, 47+29103A>G, 58530254A>G, Asn133Asp, Asn40Asp, OPRM1: A118G
A > G
No VIP available CA No Variant Annotations available
rs1799983 11291734T>G, 12965T>G, 150696111T>G, 894T>G, Asp298Glu, NOS3:894G>T
T > G
No VIP available CA VA
rs1800460 18079228C>T, 18139228C>T, 21147G>A, 460G>A, Ala154Thr, TPMT*3B
C > T
No VIP available CA No Variant Annotations available
rs1800566 20389C>T, 23359344G>A, 445C>T, 457C>T, 559C>T, 69745145G>A, NQO1*2, NQO1:C609T, NQO1:P187S, NQO1:c.558C>T, Pro149Ser, Pro153Ser, Pro187Ser, rs1800566 C>T
G > A
No VIP available No Clinical Annotations available VA
rs1801030 22382G>A, 28606164C>T, 28617485C>T, 433G>A, 667G>A, SULT1A1*3, SULT1A1:667A>G, SULT1A1:Met223Val, Val145Met, Val223Met
C > T
No VIP available CA VA
rs1801131 1040A>C, 11208431T>G, 11794419T>G, 1286A>C, 1409A>C, 16685A>C, A1298C, Glu347Ala, Glu429Ala, Glu470Ala, MTHFR:1298A>C
T > G
Not Available
No VIP available CA VA
rs1801133 11210333G>A, 11796321G>A, 14783C>T, 419C>T, 665C>T, 677C>T, 788C>T, A222V, Ala140Val, Ala222Val, Ala263Val, C677T, MTHFR: c.677C>T, MTHFR:667C>T, p.A222V
G > A
Not Available
No VIP available CA VA
rs1801158 1490G>A, 1524+33695G>A, 1601G>A, 410195G>A, 97515865C>T, 97981421C>T, Ser497Asn, Ser534Asn
C > T
Not Available
No VIP available CA VA
rs1801159 1516A>G, 1524+33721A>G, 1627A>G, 410221A>G, 97515839T>C, 97981395T>C, DPYD*5, DPYD:A1627G, DPYD:I543V, Ile506Val, Ile543Val
T > C
No VIP available CA VA
rs1801160 129-825C>T, 2194G>A, 620696G>A, 67742838C>T, 97770920C>T, Val732Ile
C > T
No VIP available CA VA
rs1801265 39+37555C>T, 39+37555T>C, 42731T=, 42731T>C, 85C=, 85C>T, 85T=, 85T>C, 97883329A=, 97883329A>G, 98348885G=, 98348885G>A, Arg29=, Arg29Cys, Cys29=, Cys29Arg, DPYD*9A, DPYD:C29R, DYPD:T85C
A > G
No VIP available No Clinical Annotations available VA
rs1885301 -1358A>G, -1360A>G, -1549A>G, -1549G>A, 101541053A>G, 3591A>G, 99781296A>G
A > G
5' Flanking
No VIP available CA VA
rs1901440 134437959C>A, 24186622C>A
C > A
Not Available
No VIP available CA No Variant Annotations available
rs1979277 1303C>T, 1420C>T, 17835470G>A, 18232096G>A, 39761C>T, Leu435Phe, Leu474Phe, SHMT1 L435F
G > A
No VIP available No Clinical Annotations available VA
rs2011404 1022+25426T>C, 1022+25426T>G, 134548T>C, 134548T>G, 233719291T>C, 233719291T>G, 234627937T>C, 234627937T>G, 471T>C, 471T>G, 527T>C, 527T>G, 60+25426T>C, 60+25426T>G, 855+36499T>C, 855+36499T>G, 855+46502T>C, 855+46502T>G, 856-47743T>C, 856-47743T>G, 861+25426T>C, 861+25426T>G, 867+5433T>C, 867+5433T>G, 941+46502T>C, 941+46502T>G, Cys157=, Cys157Trp
T > G
T > C
No VIP available No Clinical Annotations available VA
rs2019604 1176382T>G, 1664-1137T>G, 45961T>G, 89615765T>G
T > G
No VIP available No Clinical Annotations available VA
rs2020870 107A>G, 171154959A>G, 22643601A>G, Asp36Gly
A > G
No VIP available No Clinical Annotations available VA
rs2032582 186947T>A, 186947T>G, 2677A, 2677G, 2677T, 2677T>A, 2677T>G, 3095G>T/A, 87160618A>C, 87160618A>T, 87531302A>C, 87531302A>T, 893 Ala, 893 Ser, 893 Thr, ABCB1*7, ABCB1: 2677G>T/A, ABCB1: 2677T/A>G, ABCB1: A893S, ABCB1: G2677T/A, ABCB1: c.2677G>T/A, ABCB1:2677G>A/T, ABCB1:2677G>T/A, ABCB1:A893T, Ala893Ser/Thr, MDR1, MDR1 G2677T/A, Ser893Ala, Ser893Thr, mRNA 3095G>T/A, p.Ala893Ser/Thr
A > T
A > C
No VIP available No Clinical Annotations available VA
rs2070474 -80C>G, 1-509G>C, 24891292C>G, 4281861C>G, 5042C>G
C > G
5' UTR
No VIP available No Clinical Annotations available VA
rs2072671 20589208A>C, 20915701A>C, 79A>C, CDA: c.79A>C, CDA:79A>C, K27Q, Lys27Gln, p.Lys27Gln
A > C
No VIP available CA VA
rs2075252 12280A>G, 170010985T>C, 20220403T>C, 213138A>G, Lys4094Glu
T > C
No VIP available No Clinical Annotations available VA
rs2075507 -1420G>A, 103+1132C>T, 19928092G>A, 3080242G>A, 3830G>A, 6268C>T
G > A
No VIP available CA No Variant Annotations available
rs2207396 1369+123G>A, 152382382G>A, 375752G>A, 56551839G>A
G > A
No VIP available CA VA
rs2227983 147531G>A, 147531G>C, 147531G>T, 1562G>A, 1562G>C, 1562G>T, 4818624G>A, 4818624G>C, 4818624G>T, 55229255G>A, 55229255G>C, 55229255G>T, Arg521Lys, Arg521Met, Arg521Thr, EGFR: 497G/A, EGFR:1562G>A, EGFR:R497K, R497K, R521K
G > A
G > T
G > C
No VIP available CA No Variant Annotations available
rs2228001 14127449G>T, 14187449G>T, 2704C>A, 2795C>A, 2815C>A, 37724C>A, Gln902Lys, Gln939Lys, XPC Lys939Gln, XPC:Lys939Gln, rs2228001:A>C
G > T
Not Available
No VIP available No Clinical Annotations available VA
rs2228100 13795C>G, 19246326G>C, 19642952G>C, 985C>G, ALDH3A1*2, C985G, Pro329Ala
G > C
No VIP available No Clinical Annotations available VA
rs2228171 170053505C>A, 170053505C>G, 170053505C>T, 170618G>A, 170618G>C, 170618G>T, 20262923C>A, 20262923C>G, 20262923C>T, 8614G>A, 8614G>C, 8614G>T, Ala2872Pro, Ala2872Ser, Ala2872Thr
C > G
C > T
C > A
No VIP available CA VA
rs2229774 1064C>T, 1214C>T, 1247C>T, 1280C>T, 15748851G>A, 25496C>T, 53605545G>A, 917C>T, Ser306Leu, Ser355Leu, Ser405Leu, Ser416Leu, Ser427Leu
C > G
C > A
No VIP available No Clinical Annotations available VA
rs2231142 13600044G>T, 32689C>A, 421C>A, 89052323G>T, ABCG2: Q141K, ABCG2:421C>A, ABCG2:Q141K, ABCG2:c.421C>A, Gln141Lys, rs2231142
G > T
No VIP available No Clinical Annotations available VA
rs2232228 22757776A>G, 279A>G, 69143577A>G, Ala93=
A > G
No VIP available CA No Variant Annotations available
rs2234693 152163335T>C, 156705T>C, 453-397T>C, 56332792T>C, ESR1:PvuII, ESR1:c.454-397T>C, ESR1:rs2234693
T > C
No VIP available No Clinical Annotations available VA
rs2235047 209033T>G, 25171375A>C, 3489+59T>G, 87138532A>C
A > C
No VIP available No Clinical Annotations available VA
rs2239393 -848A>G, 139+90A>G, 19950428A>G, 26166A>G, 289+90A>G, 3102578A>G
A > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs2273697 101563815G>A, 1249G>A, 1438G>A, 1440G>A, 26353G>A, 553G>A, 99804058G>A, ABCC2: c.1249G>A, ABCC2:1249G>A, ABCC2:V417I, ABCC2:c.1249G>A, Val185Ile, Val417Ile, p.V417I
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs2290271 413162A>C, 603+166A>C, 85447635A>C
A > C
No VIP available CA VA
rs2291767 -214A>G, 241080132T>C, 271000T>C
T > C
5' Flanking
No VIP available CA VA
rs2297480 -1-373T>G, -1-98T>G, -175+726T>G, -22-352T>G, 155279482T>G, 6768124T>G
T > G
No VIP available CA VA
rs2297595 226525A>G, 496A>G, 68137009T>C, 98165091T>C, DPYD:496A>G, DPYD:Met166Val, Met166Val
T > C
No VIP available No Clinical Annotations available VA
rs2305364 417802T>C, 795+249T>C, 85452275T>C
T > C
No VIP available No Clinical Annotations available VA
rs2306283 14089862A>G, 21329738A>G, 388A>G, 50611A>G, Asn130Asp, SLCO1B1*1B
A > G
No VIP available No Clinical Annotations available VA
rs2473967 113479335G>T, 17648792G>T
G > T
Not Available
No VIP available CA No Variant Annotations available
rs25487 1196A>G, 16323944T>C, 44055726T>C, Gln399Arg, XRCC1 Arg399Gln, XRCC1:Arg399Gln
T > C
No VIP available No Clinical Annotations available VA
rs25489 16324630C>T, 44056412C>T, 839G>A, Arg280His
C > T
No VIP available No Clinical Annotations available VA
rs2622604 -19-17758A>G, -20+614A>G, 13626645T>C, 6088A>G, 89078924T>C, ABCG2 SNP in intron 1, rs2622604 C>T
T > C
No VIP available No Clinical Annotations available VA
rs2669429 105463690A>G, 18737239A>G, 20588T>C, 265-58T>C
A > G
No VIP available CA VA
rs2740574 -392G>A, 4713G>A, 5'-flanking region -392A>G, 99382096C>T, 99784473C>T, CYP3A4*1B, CYP3A4-V, CYP3A4:-392A>G
C > T
5' Flanking
No VIP available No Clinical Annotations available VA
rs2804402 -1019A>G, 101541583A>G, 4121A>G, 52346047A>G, ABCC2: ¿1019a>G
A > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs2884129 17525149T>G, 17585149T>G
T > G
Not Available
No VIP available CA VA
rs316019 160670282A>C, 64839739A>C, 808T>G, SLC22A2: A270S, SLC22A2: Ala270Ser, Ser270Ala
A > C
No VIP available CA VA
rs3212986 *197G>T, 1510C>A, 18180954C>A, 45912736C>A, 74351G>T, ERCC1 C8092A, ERCC1:8090C>A, ERCC1:8092C>A, Gln504Lys
C > A
3' UTR
No VIP available CA VA
rs3215400 -33delC, 20589097delC, 20915590delC
C > -
5' UTR
No VIP available No Clinical Annotations available VA
rs34489327 *145-370delT, *145-370delTinsCTTTAA, *449delA, *449delAinsTTAAAG, *859delT, *859delTinsCTTTAA, 20843delA, 20843delAinsTTAAAG, 6-basepair 3'UTR repeat, 663446delA, 663446delAinsTTAAAG, 673446delA, 673446delAinsTTAAAG, TYMS:-TTAAAG, TYMS:1494del, TYMS:1494del TTAAAG, ttaaag
T > -
3' UTR
No VIP available CA VA
rs34743033 28-bp tandem repeats, CCGCGCCACTTGGCCTGCCTCCGTCCCG, TSER*2, TSER*3, TYMS: 28 bp tandem repeat, TYMS: 2R, TYMS: TSER *2/*3, TYMS:TSER 28-basepair 5'UTR enhancer region repeat
Not Available
No VIP available CA VA
rs35599367 20493C>T, 37399159G>A, 522-191C>T, 99366316G>A, CYP3A4*22
G > A
No VIP available No Clinical Annotations available VA
rs3740066 101604207C>T, 3972C>T, 52408671C>T, 66745C>T, ABCC2:3972C>T, I1324I, Ile1324=
C > T
No VIP available No Clinical Annotations available VA
rs3750117 240T>C, 276T>C, 33050946A>G, 33060946A>G, 393T>C, 46464T>C, Tyr131=, Tyr80=, Tyr92=
A > G
No VIP available No Clinical Annotations available VA
rs3755319 -1352A>C, 174193A>C, 234667582A>C, 61-8098A>C, 613841A>C, 856-8098A>C, 862-8098A>C, 868-8098A>C, UGT1A1(-1352)A>C
A > C
No VIP available No Clinical Annotations available VA
rs3760091 -36+452G>A, -36+452G>C, -425G>A, -425G>C, -5+452G>A, -5+452G>C, -624G>A, -624G>C, 139-2402G>A, 139-2402G>C, 19067G>A, 19067G>C, 28560800C>G, 28560800C>T, 28620800C>G, 28620800C>T, SULT1A1: -624G>C
C > G
C > T
5' Flanking
No VIP available No Clinical Annotations available VA
rs3813627 -1788C>A, -1828G>T, -914G>T, 12683790G>T, 161195148G>T, 3271C>A
G > T
5' Flanking
No VIP available No Clinical Annotations available VA
rs3813628 -114A>C, -810A>C, 12684808A>C, 161196166A>C, 2253T>G
A > C
5' UTR
No VIP available CA VA
rs3918290 1905+1G>A, 476002G>A, 67887532C>T, 97915614C>T, DPYD*2A, DPYD:67887533 G>A, DPYD:IVS14 + 1G>A
C > T
No VIP available No Clinical Annotations available VA
rs3918305 109331162C>T, 71474468C>T
C > T
Not Available
No VIP available CA VA
rs4124874 -1668A>C, 172270T>G, 234665659T>G, 61-10021T>G, 611918T>G, 856-10021T>G, 862-10021T>G, 868-10021T>G, UGT1A1*60, UGT1A1:-3263T>G, UGT1A1:-3279T>G
T > G
5' Flanking
No VIP available CA VA
rs4148323 175755G>A, 211G>A, 234669144G>A, 61-6536G>A, 615403G>A, 856-6536G>A, 862-6536G>A, 868-6536G>A, Gly71Arg, UGT1A1*6, UGT1A1: G71R, UGT1A1:211G>A, UGT1A1:G211A, UGT1A1:Gly71Arg
G > A
No VIP available No Clinical Annotations available VA
rs4148350 132044G>T, 16110477G>T, 16170477G>T, 1988+219G>T
G > T
No VIP available No Clinical Annotations available VA
rs4148808 -852A>G, 25138638T>C, 87105795T>C, 8954A>G
T > C
5' Flanking
No VIP available CA VA
rs4149056 14091673T>C, 21331549T>C, 521T>C, 52422T>C, SLCO1B1*5, Val174Ala
T > C
No VIP available No Clinical Annotations available VA
rs4261716 234593117G>T, 539376G>T, 855+11682G>T, 855+1679G>T, 855+47094G>T, 855+65909G>T, 99728G>T
G > T
No VIP available CA No Variant Annotations available
rs4492666 171+1057A>C, 17772763A>C, 320+1057A>C, 47800845A>C
A > C
No VIP available CA VA
rs4646316 19952132C>T, 27870C>T, 3104282C>T, 465+310C>T, 615+310C>T
C > T
No VIP available No Clinical Annotations available VA
rs4655226 155-3137C>T, 20928284C>T, 7608372C>T
C > T
No VIP available No Clinical Annotations available VA
rs4680 -5G>A, 19951271G>A, 19963748G>A, 27009G>A, 322G>A, 472G>A, 586G>A, COMP: Val158Met, COMT:Val108Met, Val108Met, Val158Met, Val196Met
G > A
No VIP available No Clinical Annotations available VA
rs4715354 -31+2057C>T, 52648797G>A, 52708797G>A
G > A
No VIP available No Clinical Annotations available VA
rs4818 -69C>G, 19951207C>G, 19963684C>G, 258C>G, 26945C>G, 408C>G, 522C>G, COMT: Leu136Leu, Leu136=, Leu174=, Leu86=
C > G
C > T
No VIP available No Clinical Annotations available VA
rs4834232 129024273C>T, 53571994C>T, 814-4021C>T
C > T
No VIP available No Clinical Annotations available VA
rs4877847 16110949A>C, 206+9072T>G, 60+9072T>G, 86946417A>C
A > C
No VIP available CA VA
rs532545 -451C>T, 20588679C>T, 20915172C>T, CDA: promoter -451C>T
C > T
5' Flanking
No VIP available CA VA
rs55886062 1679T>G, 410273T>G, 67953261A>C, 97981343A>C, Ile560Ser
A > T
A > C
No VIP available No Clinical Annotations available VA
rs56038477 1236G>A, 352197G>A, 68011337C>T, 98039419C>T, Glu412=
C > T
No VIP available No Clinical Annotations available VA
rs5746849 -91-5725A>G, -92+3820A>G, -92+4422A>G, 18735A>G, 19942997A>G, 3095147A>G
A > G
No VIP available CA VA
rs602950 -92A>G, 20589038A>G, 20915531A>G
A > G
5' UTR
No VIP available CA VA
rs60369023 208G>A, 20931474G>A, 7611562G>A, A70T, Ala70Thr, CDA: c.208G>A, CDA:208G>A, p.Ala70Thr
G > A
No VIP available No Clinical Annotations available VA
rs6151031 -468_-467insGGTTCTCTCCTCACCAG, 4586_4587insGGTTCTCTCCTCACCAG, 4732915_4732916insCTGGTGAGGAGAGAACC, 75568383_75568384insCTGGTGAGGAGAGAACC, ALDH1A1*2
5' Flanking
No VIP available No Clinical Annotations available VA
rs62298861 10174611A>G, 69963944A>G, 722-314A>G
A > G
No VIP available No Clinical Annotations available VA
rs6269 -1324A>G, -248A>G, -98A>G, 1-98A>G, 115-98A>G, 19949952A>G, 19962429A>G, 25690A>G
A > G
5' UTR
No VIP available CA VA
rs6431558 234529643C>T, 36254C>T, 475902C>T, 855+2435C>T
C > T
No VIP available CA No Variant Annotations available
rs662 21439A>G, 32970289T>C, 575A>G, 94937446T>C, Gln192Arg
T > C
No VIP available CA VA
rs67376798 2846A>T, 67519865T>A, 843669A>T, 97547947T>A, Asp949Val
T > A
No VIP available CA VA
rs6755571 134147C>A, 234627536C>A, 573795C>A, 60+25025C>A, 70C>A, 855+36098C>A, 855+46101C>A, 856-48144C>A, 861+25025C>A, 867+5032C>A, Pro24Thr
C > A
No VIP available No Clinical Annotations available VA
rs6759892 -7-776T>G, 108280T>G, 19T>G, 234601669T>G, 547928T>G, 855+10231T>G, 855+20234T>G, 855+55646T>G, 856-74011T>G, Ser7Ala
T > G
No VIP available No Clinical Annotations available VA
rs6848982 128959213G>A, 53506934G>A
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs7104613 116468C>T, 14019931C>T, 14079931C>T, 479+16730C>T
C > T
Not Available
No VIP available CA VA
rs712829 -216G>T, 216G>T, 4676124G>T, 5031G>T, 55086755G>T, EGFR:-216G>T
G > T
5' UTR
No VIP available No Clinical Annotations available VA
rs7131224 24187531T>C, 24247531T>C
T > C
Not Available
No VIP available No Clinical Annotations available VA
rs717620 -24C>T, 101542578C>T, 5116C>T, 52347042C>T, ABCC2: 5'UTR, ABCC2:(-24)C>T, mRNA 118C>T
C > T
5' UTR
No VIP available CA VA
rs7194667 1609-491A>C, 1857097T>G, 31191A>C, 48242898T>G
T > G
No VIP available CA No Variant Annotations available
rs724710 *83T>C, *90T>C, 111907691T>C, 125-14019T>C, 1656354T>C, 195T>C, 215-14019T>C, 215-3666T>C, 285T>C, 34201T>C, 395-14019T>C, 395-3666T>C, 465T>C, Ile155=, Ile65=, Ile95=
T > C
3' UTR
No VIP available No Clinical Annotations available VA
rs7287550 -92+2556T>C, 19931976T>C, 2384A>G, 3084126T>C, 7714T>C
T > C
No VIP available No Clinical Annotations available VA
rs729147 *1038C>T, 100333267G>A, 24880988G>A
G > A
3' Flanking
No VIP available CA VA
rs7319981 103723722G>A, 16813398G>A, 475C>T
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs737866 -783A>G, -92+689T>C, 19930109T>C, 3082259T>C, 4251A>G, 5847T>C
T > C
5' Flanking
No VIP available No Clinical Annotations available VA
rs740603 -91-3545A>G, 19945177A>G, 20915A>G, 3097327A>G
A > G
No VIP available No Clinical Annotations available VA
rs750155 -197G>A, -35-361G>A, -396G>A, -4-392G>A, 139-2174G>A, 19295G>A, 28560572C>T, 28620572C>T, SULT1A1: -396 G>A
C > T
5' UTR
No VIP available CA VA
rs75017182 1129-5923C>G, 346167C>G, 68017367G>C, 98045449G>C
G > C
No VIP available No Clinical Annotations available VA
rs7586110 -57, -57T>G, 234590527T>G, 536786T>G, 855+44504T>G, 855+63319T>G, 855+9092T>G, 97138T>G, T>G, UGT1A7:, UGT1A7:-57T>G, rs7586110
T > G
No VIP available CA No Variant Annotations available
rs760370 1260-201A>G, 1335-201A>G, 1338-201A>G, 1386-201A>G, 1389-201A>G, 1497-201A>G, 1500-201A>G, 44200953A>G, 44233216A>G
A > G
No VIP available No Clinical Annotations available VA
rs7668258 -161T>C, 10172745T>C, 69962078T>C
T > C
5' Flanking
No VIP available No Clinical Annotations available VA
rs768172 1178-4867T>A, 1181-4867T>A, 1253-4867T>A, 150757T>A, 33838546A>T, 95805703A>T
A > T
No VIP available No Clinical Annotations available VA
rs7746993 21121G>T, 52654137C>A, 52714137C>A
C > A
Not Available
No VIP available No Clinical Annotations available VA
rs7757130 113317262C>A, 17486719C>A
C > A
Not Available
No VIP available No Clinical Annotations available VA
rs776746 -229-237G>A, -253-1G>A, -254A=, -254A>G, -254G>A, -331-237G>A, -357-1G>A, -463-1G>A, -571-1G>A, 12083G>A, 1466+48736C>T, 189-237G>A, 219-237G>A, 321-1G>A, 344-237G>A, 581-237G>A, 689-1G>A, 717-1G>A, 806-4288C>T, 99270539C>T, 99672916T=, 99672916T>C, CYP3A5*1, CYP3A5*3, CYP3A5*3C, CYP3A5:6986A>G, g.6986A>G, intron 3 splicing defect, rs776746 A>G
T > C
No VIP available CA VA
rs7853758 1381C>T, 16065458G>A, 1703C>T, 86900926G>A, Leu461=
G > A
Not Available
No VIP available CA No Variant Annotations available
rs7867504 16084768T>C, 267A>G, 589A>G, 86920236T>C, Thr89=
T > C
Not Available
No VIP available No Clinical Annotations available VA
rs7977213 13740924G>C, 20980800G>C, 22163G>C, 84+12044G>C
G > C
No VIP available CA VA
rs8175347 233760235_233760236TA[5][6][7][8], 5-TA insertion in promoter, 7-TA insertion in promoter, 8-TA insertion in promoter, UGT1A1*28, UGT1A1*36, UGT1A1*37, microsatellite, short tandem repeat
(TA)6 > (TA)8
(TA)6 > (TA)5
(TA)6 > (TA)7
Not Available
No VIP available No Clinical Annotations available VA
rs8187710 101611294G>A, 4544G>A, 52415758G>A, 73832G>A, ABCC2 rs8187710, Cys1515Tyr, MRP2 Cys1515Tyr
G > A
No VIP available No Clinical Annotations available VA
rs8192924 2047G>A, 20588598G>A, 66974399G>A, 809G>A, Arg270His
G > A
Not Available
No VIP available CA No Variant Annotations available
rs861539 104165753G>A, 1651-1239G>A, 1782-1239G>A, 21071C>T, 722C>T, 75229G>A, 85165753G>A, Thr241Met
G > A
No VIP available No Clinical Annotations available VA
rs871514 135140T>C, 234628529T>C, 574788T>C, 60+26018T>C, 855+37091T>C, 855+47094T>C, 856-47151T>C, 861+26018T>C, 867+196T>C, 867+6025T>C
T > C
No VIP available CA VA
rs885004 1184-360C>T, 16074082G>A, 862-360C>T, 86909550G>A
G > A
No VIP available CA VA
rs9024 *133G>A, 23107184G>A, 37445313G>A, 377+1866C>T, CBR1:1096G>A
G > A
3' UTR
No VIP available No Clinical Annotations available VA
rs9282861 22353G>A, 28606193C>T, 28617514C>T, 404G>A, 638G>A, Arg135His, Arg213His, SULT1A1*2, SULT1A1:638G>A:SULT1A1:Arg213His
C > T
No VIP available CA VA
rs9332377 19955692C>T, 3107842C>T, 31430C>T, 466-367C>T, 53618G>A, 616-367C>T, COMT:rs9332377 A/G
C > T
No VIP available CA No Variant Annotations available
rs9340799 152163381A>G, 156751A>G, 453-351A>G, 56332838A>G, ESR1:XbaI, ESR1:c.454-351A>G, ESR1:rs9340799
A > G
No VIP available CA VA
rs9351963 11869695A>C, 490-1798A>C, 73749861A>C
A > C
No VIP available CA VA
rs9514091 103714254G>A, 16803930G>A, 378-3522C>T, 9943C>T
G > A
No VIP available CA No Variant Annotations available
rs9561778 3366+1243C>A, 8803391G>T, 95713715G>T, NM_005845.3:c.3366+1243G>T
G > A
G > T
No VIP available CA No Variant Annotations available
rs9679162 10069401G>T, 130-31641C>A, 31247514G>T, 315-58346C>A, 70-31641C>A, 903-31641C>A
G > T
No VIP available CA VA
rs9936750 55171874T>C, 8786073T>C
T > C
Not Available
No VIP available CA No Variant Annotations available
rs9981861 27076915T>C, 41415044T>C, 5384-444A>G, 5645-444A>G
T > C
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 144


Alternate Names: 
Benign Neoplasm; Benign Neoplasms; Cancer; Cancers; Neoplasm; Neoplasm, Benign; Neoplasms NOS; Neoplasms, Benign; Tumor; Tumors; Tumour
PharmGKB Accession Id: PA445062
External Vocabularies
  • MeSH: Neoplasms (D009369)
  • SnoMedCT: Neoplasm (108369006)
  • SnoMedCT: Unspecified nature neoplasm (189525008)
  • SnoMedCT: Neoplasm of unspecified nature (189526009)
  • SnoMedCT: Neoplasm of unspecified nature NOS (189541009)
  • SnoMedCT: Neoplasms NOS (190230000)
  • UMLS: C0027651 (C0027651)
  • MedDRA: Neoplasm (10028980)
  • NDFRT: Neoplasms [Disease/Finding] (N0000002128)

PharmGKB Curated Pathways

Pathways created internally by PharmGKB based primarily on literature evidence.

External Pathways

Links to non-PharmGKB pathways.

PharmGKB contains no links to external pathways for this disease. To report a pathway, click here.

Curated Information ?

Curated Information ?

Evidence Drug
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
arsenic trioxide
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
conjugated estrogens
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available DL CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
folic acid
No Dosing Guideline available DL CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
methylene blue
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available DL CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
valproic acid
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available

Relationships from National Drug File - Reference Terminology (NDF-RT)

May Treat
Contraindicated With
No related diseases are available

Publications related to Neoplasms: 522

No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A coding variant in RARG confers susceptibility to anthracycline-induced cardiotoxicity in childhood cancer. Nature genetics. 2015. Aminkeng Folefac, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genotype-phenotype correlations in 5-fluorouracil metabolism: a candidate DPYD haplotype to improve toxicity prediction. The pharmacogenomics journal. 2015. Gentile G, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Deciphering Signaling Pathway Networks to Understand the Molecular Mechanisms of Metformin Action. PLoS computational biology. 2015. Sun Jingchun, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cancer pharmacogenomics: implications on ethnic diversity and drug response. Pharmacogenetics and genomics. 2015. Patel Jai N. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
DPD and UGT1A1 deficiency in colorectal cancer patients receiving triplet chemotherapy with fluoropyrimidines, oxaliplatin and irinotecan. British journal of clinical pharmacology. 2015. Falvella Felicia Stefania, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The Hippo effector YAP promotes resistance to RAF- and MEK-targeted cancer therapies. Nature genetics. 2015. Lin Luping, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic variability of DNA repair mechanisms and glutathione-S-transferase genes influences treatment outcome in osteosarcoma. Cancer epidemiology. 2015. Goričar Katja, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Validating drug repurposing signals using electronic health records: a case study of metformin associated with reduced cancer mortality. Journal of the American Medical Informatics Association : JAMIA. 2015. Xu Hua, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Relationship between UGT1A1*6/*28 polymorphisms and severe toxicities in Chinese patients with pancreatic or biliary tract cancer treated with irinotecan-containing regimens. Drug design, development and therapy. 2015. Yang Chen, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
DPYD Variants as Predictors of 5-fluorouracil Toxicity in Adjuvant Colon Cancer Treatment (NCCTG N0147). Journal of the National Cancer Institute. 2014. Lee Adam M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Copy number variability analysis of pharmacogenes in patients with lymphoma, leukemia, hepatocellular, and lung carcinoma using The Cancer Genome Atlas data. Pharmacogenetics and genomics. 2014. Kim In-Wha, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of the DNA repair pathways in advanced non-small cell lung cancer patients treated with platinum-based chemotherapy. Cancer letters. 2014. Sullivan Ivana, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
MTHFR-1298 A>C (rs1801131) is a predictor of survival in two cohorts of stage II/III colorectal cancer patients treated with adjuvant fluoropyrimidine chemotherapy with or without oxaliplatin. The pharmacogenomics journal. 2014. Cecchin E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genetic markers of cisplatin-induced hearing loss in children. Clinical pharmacology and therapeutics. 2014. Carleton B C, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variation in Otos is associated with cisplatin-induced ototoxicity. Pharmacogenomics. 2014. Spracklen Timothy F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Characterisation of the clinical pharmacokinetics of actinomycin D and the influence of ABCB1 pharmacogenetic variation on actinomycin D disposition in children with cancer. Clinical pharmacokinetics. 2014. Hill Christopher R, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Is there a role for the MTHFR 677C>T and 1298A>C polymorphisms in methotrexate-induced liver toxicity?. Pharmacogenomics. 2014. te Loo D Maroeska W M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
UGT1A1 *6 polymorphism predicts outcome in elderly patients with relapsed or refractory diffuse large B-cell lymphoma treated with carboplatin, dexamethasone, etoposide and irinotecan. Annals of hematology. 2014. Yamasaki Satoshi, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Dose-Finding and Pharmacokinetic Study to Optimize the Dosing of Irinotecan According to the UGT1A1 Genotype of Patients With Cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2014. Innocenti Federico, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PharmGKB summary: very important pharmacogene information for N-acetyltransferase 2. Pharmacogenetics and genomics. 2014. McDonagh Ellen M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Voriconazole plasma concentrations in immunocompromised pediatric patients vary by CYP2C19 diplotypes. Pharmacogenomics. 2014. Hicks J Kevin, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Comparative Functional Analysis of DPYD Variants of Potential Clinical Relevance to Dihydropyrimidine Dehydrogenase Activity. Cancer research. 2014. Offer Steven M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Associations between UGT1A1*6 or UGT1A1*6/*28 polymorphisms and irinotecan-induced neutropenia in Asian cancer patients. Cancer chemotherapy and pharmacology. 2014. Han Fei-fei, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Conventional dosing of anticancer agents: precisely wrong or just inaccurate?. Clinical pharmacology and therapeutics. 2014. Bins S, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The role of IVS14+1 G > A genotype detection in the dihydropyrimidine dehydrogenase gene and pharmacokinetic monitoring of 5-fluorouracil in the individualized adjustment of 5-fluorouracil for patients with local advanced and metastatic colorectal cancer: a preliminary report. European review for medical and pharmacological sciences. 2014. Cai X, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The effect of the UGT1A1*28 allele on survival after irinotecan-based chemotherapy: a collaborative meta-analysis. The pharmacogenomics journal. 2014. Dias M M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UGT1A1*6 polymorphisms are correlated with irinotecan-induced toxicity: a system review and meta-analysis in Asians. Cancer chemotherapy and pharmacology. 2014. Cheng Lei, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms of SLC28A3, SLC29A1 and RRM1 predict clinical outcome in patients with metastatic breast cancer receiving gemcitabine plus paclitaxel chemotherapy. European journal of cancer (Oxford, England : 1990). 2014. Lee Soo-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic Markers of Toxicity From Capecitabine and Other Fluorouracil-Based Regimens: Investigation in the QUASAR2 Study, Systematic Review, and Meta-Analysis. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2014. Rosmarin Dan, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genome-Wide Meta-Analysis of Homocysteine and Methionine Metabolism Identifies Five One Carbon Metabolism Loci and a Novel Association of ALDH1L1 with Ischemic Stroke. PLoS genetics. 2014. Williams Stephen R, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Identification of genetic variants associated with capecitabine-induced hand-foot syndrome through integration of patient and cell line genomic analyses. Pharmacogenetics and genomics. 2014. Wheeler Heather E, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The association of UGT1A1*6 and UGT1A1*28 with irinotecan-induced neutropenia in Asians: a meta-analysis. Biomarkers : biochemical indicators of exposure, response, and susceptibility to chemicals. 2014. Chen Yi-Jing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Phase I Dose-Escalation Study of Onartuzumab as a Single Agent and in Combination with Bevacizumab in Patients with Advanced Solid Malignancies. Clinical cancer research : an official journal of the American Association for Cancer Research. 2014. Salgia Ravi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PharmGKB summary: ifosfamide pathways, pharmacokinetics and pharmacodynamics. Pharmacogenetics and genomics. 2014. Lowenberg Daniella, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenomic assessment of cisplatin-based chemotherapy outcomes in ovarian cancer. Pharmacogenomics. 2014. Khrunin Andrey V, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
SLC28A3 genotype and gemcitabine rate of infusion affect dFdCTP metabolite disposition in patients with solid tumours. British journal of cancer. 2014. Khatri A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Hyaluronan Synthase 3 Variant and Anthracycline-Related Cardiomyopathy: A Report From the Children's Oncology Group. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2014. Wang Xuexia, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacokinetics, safety, and efficacy of FOLFIRI plus bevacizumab in Japanese colorectal cancer patients with UGT1A1 gene polymorphisms. Journal of clinical pharmacology. 2014. Suenaga Mitsukuni, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Clinical Observations on Associations Between the UGT1A1 Genotype and Severe Toxicity of Irinotecan. Asian Pacific journal of cancer prevention : APJCP. 2014. Lu Yan-Yan, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of DNA repair gene polymorphisms in non-small-cell lung carcinoma patients on platinum-based chemotherapy. Genetics and molecular research : GMR. 2014. Zhang L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gene-centric meta-analyses for central adiposity traits in up to 57,412 individuals of European descent confirm known loci and reveal several novel associations. Human molecular genetics. 2013. Yoneyama Sachiko, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Clinical significance of UGT1A1 gene polymorphisms on irinotecan-based regimens as the treatment in metastatic colorectal cancer. OncoTargets and therapy. 2014. Li Minmin, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
A pharmacogenetic study of aldehyde oxidase I in patients treated with XK469. Pharmacogenetics and genomics. 2013. Ramírez Jacqueline, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Exploratory analysis of 1936 SNPs in ADME genes for association with busulfan clearance in adult hematopoietic stem cell recipients. Pharmacogenetics and genomics. 2013. Ten Brink Marloes H, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Application of a combination of a knowledge-based algorithm and 2-stage screening to hypothesis-free genomic data on irinotecan-treated patients for identification of a candidate single nucleotide polymorphism related to an adverse effect. PloS one. 2014. Takahashi Hiro, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
ERCC1 Cys8092Ala and XRCC1 Arg399Gln polymorphisms predict progression-free survival after curative radiotherapy for nasopharyngeal carcinoma. PloS one. 2014. Jin Hekun, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Oxidative stress-related genetic polymorphisms are associated with the prognosis of metastatic gastric cancer patients treated with epirubicin, oxaliplatin and 5-Fluorouracil combination chemotherapy. PloS one. 2014. Geng Ruixuan, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thymidylate synthase genotype-directed chemotherapy for patients with gastric and gastroesophageal junction cancers. PloS one. 2014. Goff Laura W, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
CYP3A5*3 and bilirubin predict midazolam population pharmacokinetics in Asian cancer patients. Journal of clinical pharmacology. 2013. Seng Kok-Yong, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinical Implementation of Germline Cancer Pharmacogenetic Variants during the Next-Generation Sequencing Era. Clinical pharmacology and therapeutics. 2013. Gillis Nancy K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The integrated landscape of driver genomic alterations in glioblastoma. Nature genetics. 2013. Frattini Veronique, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
VEGF pathway polymorphisms as prognostic and pharmacogenetic factors in cancer: a 2013 update. Pharmacogenomics. 2013. Eng Lawson, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Potential of dihydropyrimidine dehydrogenase genotypes in personalizing 5-fluorouracil therapy among colorectal cancer patients. Therapeutic drug monitoring. 2013. Teh Lay Kek, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
S-1 plus irinotecan and oxaliplatin for the first-line treatment of patients with metastatic colorectal cancer: a prospective phase II study and pharmacogenetic analysis. British journal of cancer. 2013. Kim S Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Tumour heterogeneity in the clinic. Nature. 2013. Bedard Philippe L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Emerging landscape of oncogenic signatures across human cancers. Nature genetics. 2013. Ciriello Giovanni, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ABCC11/MRP8 polymorphisms affect 5-fluorouracil-induced severe toxicity and hepatic expression. Pharmacogenomics. 2013. Magdy Tarek, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphism of TS 3'-UTR predicts survival of Chinese advanced gastric cancer patients receiving first-line capecitabine plus paclitaxel. Clinical & translational oncology : official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico. 2013. Gao J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Replication of TPMT and ABCC3 Genetic Variants Highly Associated With Cisplatin-Induced Hearing Loss in Children. Clinical pharmacology and therapeutics. 2013. Pussegoda K, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The Role of Inherited TPMT and COMT Genetic Variation in Cisplatin-Induced Ototoxicity in Children With Cancer. Clinical pharmacology and therapeutics. 2013. Yang J J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
ERCC1 C8092A (rs3212986) polymorphism as a predictive marker in esophageal cancer patients treated with cisplatin/5-FU-based neoadjuvant therapy. Pharmacogenetics and genomics. 2013. Rumiato Enrica, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
DPYD IVS14+1G>A and 2846A>T genotyping for the prediction of severe fluoropyrimidine-related toxicity: a meta-analysis. Pharmacogenomics. 2013. Terrazzino Salvatore, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Intergenic polymorphisms in the amphiregulin gene region as biomarkers in metastatic colorectal cancer patients treated with anti-EGFR plus irinotecan. The pharmacogenomics journal. 2013. Sebio A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic variants in the DPYD, TYMS, CDA and MTHFR genes are clinically significant predictors of fluoropyrimidine toxicity. British journal of cancer. 2013. Loganayagam A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Use of pharmacogenetics for predicting cancer prognosis and treatment exposure, response and toxicity. Journal of human genetics. 2013. Hertz Daniel L, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Cisplatin-induced ototoxicity in pediatric solid tumors: the role of glutathione S-transferases and megalin genetic polymorphisms. Journal of pediatric hematology/oncology. 2013. Choeyprasert Worawut, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Preclinical discovery of candidate genes to guide pharmacogenetics during phase I development: the example of the novel anticancer agent ABT-751. Pharmacogenetics and genomics. 2013. Innocenti Federico, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
CDA gene polymorphisms and enzyme activity: genotype-phenotype relationship in an Italian-Caucasian population. Pharmacogenomics. 2013. Carpi Francesco M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The role of the MTHFR 677C>T polymorphism in methotrexate-induced liver toxicity: a meta-analysis in patients with cancer. The pharmacogenomics journal. 2013. Hagleitner M M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic analysis of adjuvant FOLFOX for Korean patients with colon cancer. Cancer chemotherapy and pharmacology. 2013. Lee Kyung-Hun, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A DPYD Variant (Y186C) in Individuals of African Ancestry Is Associated With Reduced DPD Enzyme Activity. Clinical pharmacology and therapeutics. 2013. Offer S M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Fluoropyrimidine toxicity in patients with dihydropyrimidine dehydrogenase splice site variant: the need for further revision of dose and schedule. Internal and emergency medicine. 2013. Magnani Elena, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Refining the UGT1A haplotype associated with irinotecan-induced hematological toxicity in metastatic colorectal cancer patients treated with 5-fluorouracil/irinotecan-based regimens. The Journal of pharmacology and experimental therapeutics. 2013. Lévesque Eric, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association of UGT1A1*28 polymorphisms with irinotecan-induced toxicities in colorectal cancer: a meta-analysis in Caucasians. The pharmacogenomics journal. 2013. Liu X, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
MTHFR polymorphisms and capecitabine-induced toxicity in patients with metastatic colorectal cancer. Pharmacogenetics and genomics. 2013. van Huis-Tanja Lieke H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics and pharmacogenomics: a bridge to individualized cancer therapy. Pharmacogenomics. 2013. Weng Liming, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinically relevant cancer biomarkers and pharmacogenetic assays. Journal of oncology pharmacy practice : official publication of the International Society of Oncology Pharmacy Practitioners. 2013. Patel Jai N, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CYP3A4 intron 6 C>T SNP (CYP3A4*22) encodes lower CYP3A4 activity in cancer patients, as measured with probes midazolam and erythromycin. Pharmacogenomics. 2013. Elens Laure, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics as a risk mitigation strategy for chemotherapeutic cardiotoxicity. Pharmacogenomics. 2013. Jensen Brian C, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Dihydropyrimidine Dehydrogenase Gene (DPYD) Polymorphism among Caucasian and non-Caucasian Patients with 5-FU- and Capecitabine-related Toxicity Using Full Sequencing of DPYD. Cancer genomics & proteomics. 2013. Saif Muhammad Wasif. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A single nucleotide polymorphism in cBIM is associated with a slower achievement of major molecular response in chronic myeloid leukaemia treated with imatinib. PloS one. 2013. Augis Vanessa, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Evaluating predictive pharmacogenetic signatures of adverse events in colorectal cancer patients treated with fluoropyrimidines. PloS one. 2013. Jennings Barbara A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Indications of clinical and genetic predictors for aromatase inhibitors related musculoskeletal adverse events in Chinese Han women with breast cancer. PloS one. 2013. Wang Jingxuan, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
XRCC3 Thr241Met polymorphism and clinical outcomes of NSCLC patients receiving platinum-based chemotherapy: a systematic review and meta-analysis. PloS one. 2013. Shen Xiao-yong, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
OATP1B1 Polymorphism as a Determinant of Erythromycin Disposition. Clinical pharmacology and therapeutics. 2012. Lancaster C S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cancer pharmacogenomics: strategies and challenges. Nature reviews. Genetics. 2012. Wheeler Heather E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The relationship of polymorphisms in ABCC2 and SLCO1B3 with docetaxel pharmacokinetics and neutropenia: CALGB 60805 (Alliance). Pharmacogenetics and genomics. 2012. Lewis Lionel D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
HLA polymorphisms influence the development of skin rash arising from treatment with EGF receptor inhibitors. Pharmacogenomics. 2012. Fuerst Daniel, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Contribution of the beta-ureidopropionase (UPB1) gene alterations to the development of fluoropyrimidine-related toxicity. Pharmacological reports : PR. 2012. Fidlerova Julie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
High incidence of severe neutropenia after gemcitabine-based chemotherapy in Chinese cancer patients with CDA 79A>C mutation. Clinica chimica acta; international journal of clinical chemistry. 2012. Xu Jialin, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Phase I Studies of Sirolimus Alone or in Combination with Pharmacokinetic Modulators in Advanced Cancer Patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2012. Cohen Ezra E W, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PharmGKB summary: very important pharmacogene information for GSTT1. Pharmacogenetics and genomics. 2012. Thorn Caroline F, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic variants of thiopurine and folate metabolic pathways determine 6-MP-mediated hematological toxicity in childhood ALL. Pharmacogenomics. 2012. Dorababu Patchva, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pathway-based pharmacogenomics of gemcitabine pharmacokinetics in patients with solid tumors. Pharmacogenomics. 2012. Mitra Amit K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Exposure to nicotine and carcinogens among Southwestern Alaskan Native cigarette smokers and smokeless tobacco users. Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology. 2012. Benowitz Neal L, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Impact of the UGT1A1*28 allele on response to irinotecan: a systematic review and meta-analysis. Pharmacogenomics. 2012. Dias Mafalda M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Phase I study of saracatinib (AZD0530) in combination with paclitaxel and/or carboplatin in patients with solid tumours. British journal of cancer. 2012. Kaye S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Associations Between ABCC2 Polymorphisms and Cisplatin Disposition and Efficacy. Clinical pharmacology and therapeutics. 2012. Sprowl J A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PharmGKB summary: very important pharmacogene information for cytochrome P-450, family 2, subfamily A, polypeptide 6. Pharmacogenetics and genomics. 2012. McDonagh Ellen M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association between polymorphisms of ERCC1 and survival in epithelial ovarian cancer patients with chemotherapy. Pharmacogenomics. 2012. Yan Li, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms in key methotrexate pathway genes are associated with response to treatment in rheumatoid arthritis patients. The pharmacogenomics journal. 2012. Owen S A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Mortality After Incident Cancer in People With and Without Type 2 Diabetes: Impact of metformin on survival. Diabetes care. 2012. Currie Craig J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Cytidine deaminase genetic variants influence RNA expression and cytarabine cytotoxicity in acute myeloid leukemia. Pharmacogenomics. 2012. Abraham Ajay, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Resumption of high-dose methotrexate after acute kidney injury and glucarpidase use in pediatric oncology patients. Cancer. 2012. Christensen Anthony M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Do CYP2D6 genotypes reflect oxycodone requirements for cancer patients treated for cancer pain? A cross-sectional multicentre study. European journal of clinical pharmacology. 2012. Andreassen Trine Naalsund, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A genome-wide association study identifies four genetic markers for hematological toxicities in cancer patients receiving gemcitabine therapy. Pharmacogenetics and genomics. 2012. Kiyotani Kazuma, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
PharmGKB summary: very important pharmacogene information for G6PD. Pharmacogenetics and genomics. 2012. McDonagh Ellen M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genomic approach towards personalized anticancer drug therapy. Pharmacogenomics. 2012. Midorikawa Yutaka, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of drugs withdrawn from the market. Pharmacogenomics. 2012. Zhang Wei, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenomics of cisplatin-based chemotherapy in ovarian cancer patients of different ethnic origins. Pharmacogenomics. 2012. Khrunin Andrey, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Arylamine N-acetyltransferase 1: a novel drug target in cancer development. Pharmacological reviews. 2012. Butcher Neville J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic and epigenetic regulation of the organic cation transporter 3, SLC22A3. The pharmacogenomics journal. 2012. Chen L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic profiling of CD133 is associated with response rate (RR) and progression-free survival (PFS) in patients with metastatic colorectal cancer (mCRC), treated with bevacizumab-based chemotherapy. The pharmacogenomics journal. 2012. Pohl A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Arylamine N-acetyltransferases--from drug metabolism and pharmacogenetics to identification of novel targets for pharmacological intervention. Advances in pharmacology (San Diego, Calif.). 2012. Sim Edith, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic variants of CYP2D6 gene and cancer risk: a HuGE systematic review and meta-analysis. Asian Pacific journal of cancer prevention : APJCP. 2012. Zhou Li-Ping, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Two minor NQO1 and NQO2 alleles predict poor response of breast cancer patients to adjuvant doxorubicin and cyclophosphamide therapy. Pharmacogenetics and genomics. 2011. Jamieson David, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association between DNA-repair polymorphisms and survival in pancreatic cancer patients treated with combination chemotherapy. Pharmacogenomics. 2011. Giovannetti Elisa, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Early Sorafenib-Induced Toxicity Is Associated with Drug Exposure and UGTIA9 Genetic Polymorphism in Patients with Solid Tumors: A Preliminary Study. PloS one. 2012. Boudou-Rouquette Pascaline, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Meta-analysis on pharmacogenetics of platinum-based chemotherapy in non small cell lung cancer (NSCLC) patients. PloS one. 2012. Yin Ji-Ye, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DNA-damage response gene polymorphisms and therapeutic outcomes in ovarian cancer. The pharmacogenomics journal. 2011. Caiola E, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic predictors for EGFR-inhibitor-associated skin toxicity. The pharmacogenomics journal. 2011. Parmar S, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Methylenetetrahydrofolate reductase genetic polymorphisms and toxicity to 5-FU-based chemoradiation in rectal cancer. British journal of cancer. 2011. Thomas F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Single nucleotide polymorphisms of ABCC5 and ABCG1 transporter genes correlate to irinotecan-associated gastrointestinal toxicity in colorectal cancer patients: A DMET microarray profiling study. Cancer biology & therapy. 2011. Di Martino Maria Teresa, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Population pharmacokinetics and pharmacogenetics of vincristine in paediatric patients treated for solid tumour diseases. Cancer chemotherapy and pharmacology. 2011. Guilhaumou Romain, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Anthracycline-Related Cardiomyopathy After Childhood Cancer: Role of Polymorphisms in Carbonyl Reductase Genes--A report From the Children's Oncology Group. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2011. Blanco Javier G, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
A randomized trial of a single-dose rasburicase versus five-daily doses in patients at risk for tumor lysis syndrome. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO. 2011. Vadhan-Raj S, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Influence of SLCO1B3 Haplotype-tag SNPs on Docetaxel Disposition in Chinese Nasopharyngeal Cancer Patients. British journal of clinical pharmacology. 2011. Chew Sin-Chi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Association of ABCB1, 5-HT3B receptor and CYP2D6 genetic polymorphisms with ondansetron and metoclopramide antiemetic response in Indonesian cancer patients treated with highly emetogenic chemotherapy. Japanese journal of clinical oncology. 2011. Perwitasari Dyah A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenomic Prediction of Anthracycline-Induced Cardiotoxicity in Children. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2011. Visscher Henk, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of Oxaliplatin as Adjuvant Treatment in Colon Carcinoma: Are Single Nucleotide Polymorphisms in GSTP1, ERCC1, and ERCC2 Good Predictive Markers?. Molecular diagnosis & therapy. 2011. Fariña Sarasqueta Arantza, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic analyses of cisplatin-induced nephrotoxicity indicate a renoprotective effect of ERCC1 polymorphisms. Pharmacogenomics. 2011. Tzvetkov Mladen V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomic characterization of US FDA-approved cytotoxic drugs. Pharmacogenomics. 2011. Peters Eric J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Differential effect of polymorphisms of CMPK1 and RRM1 on survival in advanced non-small cell lung cancer patients treated with gemcitabine or taxane/cisplatinum. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2011. Ryu Jeong-Seon, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Copy number variation in glutathione-S-transferase T1 and M1 predicts incidence and 5-year survival from prostate and bladder cancer, and incidence of corpus uteri cancer in the general population. The pharmacogenomics journal. 2011. Nørskov M S, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Nucleotide excision repair gene variants and association with survival in osteosarcoma patients treated with neoadjuvant chemotherapy. The pharmacogenomics journal. 2011. Biason P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Vascular endothelial growth factor polymorphisms and clinical outcome in colorectal cancer patients treated with irinotecan-based chemotherapy and bevacizumab. The pharmacogenomics journal. 2011. Koutras A K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Mathematical modeling predicts the effect of folate deficiency and excess on cancer related biomarkers. Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology. 2011. Neuhouser Marian L, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Multiple Loci modulate opioid therapy response for cancer pain. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Galvan Antonella, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic effects and modifiers of radiotherapy and chemotherapy on survival in pancreatic cancer. Pancreas. 2011. Zeng Hongmei, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
GALNT14 SNP as a potential predictor of response to combination chemotherapy using 5-FU, mitoxantrone and cisplatin in advanced HCC. Pharmacogenomics. 2011. Liang Kung-Hao, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics of cisplatin-induced ototoxicity. Pharmacogenomics. 2011. Mukherjea Debashree, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TS and ERCC-1 mRNA expressions and clinical outcome in patients with metastatic colon cancer in CONFIRM-1 and -2 clinical trials. The pharmacogenomics journal. 2011. Grimminger P P, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The NQO1*2/*2 polymorphism is associated with poor overall survival in patients following resection of stages II and IIIa non-small cell lung cancer. Oncology reports. 2011. Kolesar Jill M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Relationship between single nucleotide polymorphisms and haplotypes in DPYD and toxicity and efficacy of capecitabine in advanced colorectal cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Deenen Maarten J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Caffeine activates tumor suppressor PTEN in sarcoma cells. International journal of oncology. 2011. Miwa Shinji, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genotoxic effects of doxorubicin in cultured human lymphocytes with different glutathione S-transferase genotypes. Mutation research. 2011. Ramos D L, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Estrogen receptor alpha single nucleotide polymorphism modifies the risk of azoospermia in childhood cancer survivors. Pharmacogenetics and genomics. 2011. Romerius Patrik, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cytidine deaminase single-nucleotide polymorphism is predictive of toxicity from gemcitabine in patients with pancreatic cancer: RTOG 9704. The pharmacogenomics journal. 2011. Farrell J J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Two drug interaction studies of sirolimus in combination with sorafenib or sunitinib in patients with advanced malignancies. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Gangadhar Tara C, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Variability in transport and biotransformation of cytarabine is associated with its toxicity in peripheral blood mononuclear cells. Pharmacogenomics. 2011. Parmar Sumit, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics and cancer stem cells: a changing landscape?. Trends in pharmacological sciences. 2011. Crea Francesco, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics of the RNA world: structural RNA polymorphisms in drug therapy. Clinical pharmacology and therapeutics. 2011. Sadee W, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A phase I study of sirolimus and bevacizumab in patients with advanced malignancies. European journal of cancer (Oxford, England : 1990). 2011. Cohen E E W, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Phase II trial of pemetrexed and bevacizumab in patients with recurrent or metastatic head and neck cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2011. Argiris Athanassios, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
p53 regulates biosynthesis through direct inactivation of glucose-6-phosphate dehydrogenase. Nature cell biology. 2011. Jiang Peng, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Associations of various gene polymorphisms with toxicity in colorectal cancer patients receiving oral uracil and tegafur plus leucovorin: a prospective study. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO. 2011. Tsunoda A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Phase II study of S-1 combined with oxaliplatin as therapy for patients with metastatic biliary tract cancer: influence of the CYP2A6 polymorphism on pharmacokinetics and clinical activity. British journal of cancer. 2011. Kim K-p, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A POLYMORPHISM IN THE CYTIDINE DEAMINASE PROMOTER PREDICTS SEVERE CAPECITABINE-INDUCED HAND-FOOT SYNDROME. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Caronia Daniela, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic Tailoring of Irinotecan-based First-line Chemotherapy in Metastatic Colorectal Cancer: Results of a Pilot Study. Anticancer research. 2011. Freyer Gilles, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Associations between gene polymorphisms of thymidylate synthase with its protein expression and chemosensitivity to 5-fluorouracil in pancreatic carcinoma cells. Chinese medical journal. 2011. Zhang Qiang, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genome-wide association study on overall survival of advanced non-small cell lung cancer patients treated with carboplatin and paclitaxel. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2011. Sato Yasunori, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Multiple genetic polymorphisms in the prediction of clinical outcome of metastatic colorectal cancer patients treated with first-line FOLFOX-4 chemotherapy. Pharmacogenetics and genomics. 2011. Huang Ming-Yii, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Phase II study of preoperative radiation plus concurrent daily tegafur-uracil (UFT) with leucovorin for locally advanced rectal cancer. BMC cancer. 2011. Cellier Patrice, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gemcitabine and platinum pathway pharmacogenetics in Asian breast cancer patients. Cancer genomics & proteomics. 2011. Wong Andrea Li-Ann, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetics of bisphosphonate-associated osteonecrosis of the jaw. Frontiers in bioscience (Elite edition). 2011. Marini Francesca, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
X-Ray Cross-Complementing Group 1 and Thymidylate Synthase Polymorphisms Might Predict Response to Chemoradiotherapy in Rectal Cancer Patients. International journal of radiation oncology, biology, physics. 2010. Lamas Maria J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Use of epidermal growth factor receptor mutation analysis in patients with advanced non-small-cell lung cancer to determine erlotinib use as first-line therapy. PLoS currents. 2011. Ishibe Naoko, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
ABCB1 gene polymorphisms are associated with adverse reactions in fluoropyrimidine-treated colorectal cancer patients. Pharmacogenomics. 2010. Gonzalez-Haba Eva, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Gemcitabine metabolic and transporter gene polymorphisms are associated with drug toxicity and efficacy in patients with locally advanced pancreatic cancer. Cancer. 2010. Tanaka Motofumi, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Value of gene polymorphisms as markers of 5-FU therapy response in stage III colon carcinoma: a pilot study. Cancer chemotherapy and pharmacology. 2010. Fariña-Sarasqueta Arantza, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thymidylate synthase germline polymorphisms in rectal cancer patients treated with neoadjuvant chemoradiotherapy based on 5-fluorouracil. Journal of cancer research and clinical oncology. 2010. Páez David, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
PharmGKB summary: very important pharmacogene information for PTGS2. Pharmacogenetics and genomics. 2010. Thorn Caroline F, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Distribution of TYMS, MTHFR, p53 and MDR1 gene polymorphisms in patients with breast cancer treated with neoadjuvant chemotherapy. Cancer epidemiology. 2010. Henríquez-Hernández Luis Alberto, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thymidylate Synthase Gene Polymorphism Affects the Response to Preoperative 5-Fluorouracil Chemoradiation Therapy in Patients With Rectal Cancer. International journal of radiation oncology, biology, physics. 2010. Hur Hyuk, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Nucleotide excision repair gene polymorphisms may predict acute toxicity in patients treated with chemoradiotherapy for bladder cancer. Pharmacogenomics. 2010. Sakano Shigeru, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A phase I/II and pharmacogenomic study of pemetrexed and cisplatin in patients with unresectable, advanced gastric carcinoma. Anti-cancer drugs. 2010. Chen Jen-Shi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Host genetic variants in the IGF binding protein-3 impact on survival of patients with advanced gastric cancer treated with palliative chemotherapy. Pharmacogenomics. 2010. Graziano Francesco, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Association of carboxylesterase 1A genotypes with irinotecan pharmacokinetics in Japanese cancer patients. British journal of clinical pharmacology. 2010. Sai Kimie, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Dose-dependent association between UGT1A1*28 genotype and irinotecan-induced neutropenia: low doses also increase risk. Clinical cancer research : an official journal of the American Association for Cancer Research. 2010. Hu Zhe-Yi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Glutathione S-transferase polymorphisms in osteosarcoma patients. Pharmacogenetics and genomics. 2010. Salinas-Souza Carolina, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Can the 2-(13)C-uracil breath test be used to predict the effect of the antitumor drug S-1?. Cancer chemotherapy and pharmacology. 2010. Ishii Yukimoto, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Dose-dependent association between UGT1A1*28 polymorphism and irinotecan-induced diarrhoea: a meta-analysis. European journal of cancer (Oxford, England : 1990). 2010. Hu Zhe-Yi, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic predictors of adverse events and response to chemotherapy in metastatic colorectal cancer: results from North American Gastrointestinal Intergroup Trial N9741. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2010. McLeod Howard L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gene-environment interactions associated with CYP1A1 MspI and GST polymorphisms and the risk of upper aerodigestive tract cancers in an Indian population. Journal of cancer research and clinical oncology. 2010. Sam Soya Sisy, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphisms within the folate pathway predict folate concentrations but are not associated with disease activity in rheumatoid arthritis patients on methotrexate. Pharmacogenetics and genomics. 2010. Stamp Lisa K, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Investigation of IVS14 + 1G > A polymorphism of DPYD gene in a group of Bosnian patients treated with 5-Fluorouracil and capecitabine. Bosnian journal of basic medical sciences / Udru¿enje basi¿nih mediciniskih znanosti = Association of Basic Medical Sciences. 2010. Ceri¿ Timur, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Targeted cancer therapies in the twenty-first century: lessons from imatinib. Clinical pharmacology and therapeutics. 2010. Stegmeier F, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic assessment of toxicity and outcome in patients with metastatic colorectal cancer treated with LV5FU2, FOLFOX, and FOLFIRI: FFCD 2000-05. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2010. Boige Valérie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Vascular endothelial growth factor pathway. Pharmacogenetics and genomics. 2010. Maitland Michael L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Metabolic genes in cancer: their roles in tumor progression and clinical implications. Biochimica et biophysica acta. 2010. Furuta Eiji, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A dosing/cross-development study of the multikinase inhibitor sorafenib in patients with pulmonary arterial hypertension. Clinical pharmacology and therapeutics. 2010. Gomberg-Maitland M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Polymorphisms in cytochromes P450 2C8 and 3A5 are associated with paclitaxel neurotoxicity. The pharmacogenomics journal. 2010. Leskelä S, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms and the efficacy and toxicity of cisplatin-based chemotherapy in ovarian cancer patients. The pharmacogenomics journal. 2010. Khrunin A V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HEY1 Leu94Met gene polymorphism dramatically modifies its biological functions. Oncogene. 2010. Villaronga M A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Promoter methylation and large intragenic rearrangements of DPYD are not implicated in severe toxicity to 5-fluorouracil-based chemotherapy in gastrointestinal cancer patients. BMC cancer. 2010. Savva-Bordalo Joana, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic polymorphisms associated with 5-Fluorouracil-induced neurotoxicity. Chemotherapy. 2010. Kim Suk-Ran, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Molecular and therapeutic potential and toxicity of valproic acid. Journal of biomedicine & biotechnology. 2010. Chateauvieux Sébastien, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Novel histone deacetylase inhibitors in clinical trials as anti-cancer agents. Journal of hematology & oncology. 2010. Tan Jiahuai, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variants in TPMT and COMT are associated with hearing loss in children receiving cisplatin chemotherapy. Nature genetics. 2009. Ross Colin J D, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Variants in the dihydropyrimidine dehydrogenase, methylenetetrahydrofolate reductase and thymidylate synthase genes predict early toxicity of 5-fluorouracil in colorectal cancer patients. The Journal of international medical research. 2010. Kristensen M H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Evolving novel anti-HER2 strategies. The lancet oncology. 2009. Jones Kellie L, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association of molecular markers with toxicity outcomes in a randomized trial of chemotherapy for advanced colorectal cancer: the FOCUS trial. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2009. Braun Michael S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Ambulatory monitoring detects sorafenib-induced blood pressure elevations on the first day of treatment. Clinical cancer research : an official journal of the American Association for Cancer Research. 2009. Maitland Michael L, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Contribution of organic cation transporter 2 (OCT2) to cisplatin-induced nephrotoxicity. Clinical pharmacology and therapeutics. 2009. Filipski K K, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association study of genetic polymorphism in ABCC4 with cyclophosphamide-induced adverse drug reactions in breast cancer patients. Journal of human genetics. 2009. Low Siew-Kee, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Single nucleotide polymorphism in ABCG2 is associated with irinotecan-induced severe myelosuppression. Journal of human genetics. 2009. Cha Pei-Chieng, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A frequent kinase domain mutation that changes the interaction between PI3Kalpha and the membrane. Proceedings of the National Academy of Sciences of the United States of America. 2009. Mandelker Diana, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Smoothened mutation confers resistance to a Hedgehog pathway inhibitor in medulloblastoma. Science (New York, N.Y.). 2009. Yauch Robert L, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Common variations in ERCC2 are associated with response to cisplatin chemotherapy and clinical outcome in osteosarcoma patients. The pharmacogenomics journal. 2009. Caronia D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Association of folate-pathway gene polymorphisms with the risk of prostate cancer: a population-based nested case-control study, systematic review, and meta-analysis. Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology. 2009. Collin Simon M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Activation of the PI3K pathway in cancer through inhibition of PTEN by exchange factor P-REX2a. Science (New York, N.Y.). 2009. Fine Barry, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Mechanisms and kinetics of human arylamine N-acetyltransferase 1 inhibition by disulfiram. The FEBS journal. 2009. Malka Florence, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Thiopurine methyltransferase genetics is not a major risk factor for secondary malignant neoplasms after treatment of childhood acute lymphoblastic leukemia on Berlin-Frankfurt-Münster protocols. Blood. 2009. Stanulla Martin, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Nitric oxide synthase variants and disease-free survival among treated and untreated breast cancer patients in a Southwest Oncology Group clinical trial. Clinical cancer research : an official journal of the American Association for Cancer Research. 2009. Choi Ji-Yeob, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A highly annotated whole-genome sequence of a Korean individual. Nature. 2009. Kim Jong-Il, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Cisplatin pharmacogenetics, DNA repair polymorphisms, and esophageal cancer outcomes. Pharmacogenetics and genomics. 2009. Bradbury Penelope A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
TP53 codon 72 polymorphism associated with prognosis in patients with advanced gastric cancer treated with paclitaxel and cisplatin. Cancer chemotherapy and pharmacology. 2009. Kim Jong Gwang, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Etoposide pathway. Pharmacogenetics and genomics. 2009. Yang Jun, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Association of CYP2A6 polymorphisms with S-1 plus docetaxel therapy outcomes in metastatic gastric cancer. Pharmacogenomics. 2009. Kong Sun-Young, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacodynamic genes do not influence risk of neutropenia in cancer patients treated with moderately high-dose irinotecan. Pharmacogenomics. 2009. Hoskins Janelle M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic analyses of a phase III trial in metastatic gastroesophageal adenocarcinoma with fluorouracil and leucovorin plus either oxaliplatin or cisplatin: a study of the arbeitsgemeinschaft internistische onkologie. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2009. Goekkurt Eray, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Dihydropyrimidine dehydrogenase gene variation and severe 5-fluorouracil toxicity: a haplotype assessment. Pharmacogenomics. 2009. Amstutz Ursula, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Predictors of survival and toxicity in patients on adjuvant therapy with 5-fluorouracil for colorectal cancer. British journal of cancer. 2009. Gusella M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
C677T and A1298C MTHFR polymorphisms, a challenge for antifolate and fluoropyrimidine-based therapy personalisation. European journal of cancer (Oxford, England : 1990). 2009. De Mattia Elena, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms affecting clinical outcomes in epithelial ovarian cancer patients treated with taxanes and platinum compounds: a Korean population-based study. Gynecologic oncology. 2009. Kim Hee Seung, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Linkage disequilibrium between two high-frequency deletion polymorphisms: implications for association studies involving the glutathione-S transferase (GST) genes. PLoS genetics. 2009. Zhao Yongzhong, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
UGT1A1*28 genotype predicts gastrointestinal toxicity in patients treated with intermediate-dose irinotecan. Pharmacogenomics. 2009. Ferraldeschi Roberta, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Methotrexate in pediatric osteosarcoma: response and toxicity in relation to genetic polymorphisms and dihydrofolate reductase and reduced folate carrier 1 expression. The Journal of pediatrics. 2009. Patiño-García Ana, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Coffee intake, variants in genes involved in caffeine metabolism, and the risk of epithelial ovarian cancer. Cancer causes & control : CCC. 2009. Kotsopoulos Joanne, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UGT1A1*6 polymorphism is most predictive of severe neutropenia induced by irinotecan in Japanese cancer patients. International journal of clinical oncology / Japan Society of Clinical Oncology. 2009. Onoue Masahide, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Randomized phase II and pharmacogenetic study of pemetrexed compared with pemetrexed plus carboplatin in pretreated patients with advanced non-small-cell lung cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2009. Smit Egbert F, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
DNA repair gene polymorphisms predict favorable clinical outcome in advanced non-small-cell lung cancer. Clinical lung cancer. 2009. Kalikaki Aristea, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Personalized cancer therapy gets closer. Nature. 2009. Hayden Erika Check. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association of the ABCB1 gene polymorphisms 2677G>T/A and 3435C>T with clinical outcomes of paclitaxel monotherapy in metastatic breast cancer patients. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO. 2009. Chang H, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic pathway analysis of docetaxel elimination. Clinical pharmacology and therapeutics. 2009. Baker S D, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphisms of drug-metabolizing enzymes (GST, CYP2B6 and CYP3A) affect the pharmacokinetics of thiotepa and tepa. British journal of clinical pharmacology. 2009. Ekhart Corine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
An EORTC phase I study of Bortezomib in combination with oxaliplatin, leucovorin and 5-fluorouracil in patients with advanced colorectal cancer. European journal of cancer (Oxford, England : 1990). 2009. Caponigro F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Functional polymorphisms in the BRCA1 promoter influence transcription and are associated with decreased risk for breast cancer in Chinese women. Journal of medical genetics. 2009. Chan K Y-K, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Integrated pharmacogenetic prediction of irinotecan pharmacokinetics and toxicity in patients with advanced non-small cell lung cancer. Lung cancer (Amsterdam, Netherlands). 2009. Han Ji-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Platinum neurotoxicity pharmacogenetics. Molecular cancer therapeutics. 2009. McWhinney Sarah R, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Measurements of EGFR expression on circulating tumor cells are reproducible over time in metastatic breast cancer patients. Pharmacogenomics. 2009. Payne Rachel E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
[A severe G6PD deficiency revealed during a chemotherapy protocol including rasburicase]. Annales de biologie clinique. 2009. Joly P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms of copper- and platinum drug-efflux transporters ATP7A and ATP7B in Japanese cancer patients. Drug metabolism and pharmacokinetics. 2009. Fukushima-Uesaka Hiromi, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Influence of dihydropyrimidine dehydrogenase gene (DPYD) coding sequence variants on the development of fluoropyrimidine-related toxicity in patients with high-grade toxicity and patients with excellent tolerance of fluoropyrimidine-based chemotherapy. Neoplasma. 2009. Kleibl Z, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Clinical significance of UDP-glucuronosyltransferase 1A1*6 for toxicities of combination chemotherapy with irinotecan and cisplatin in gynecologic cancers: a prospective multi-institutional study. Oncology. 2009. Takano Masashi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Dynamic proteomics of individual cancer cells in response to a drug. Science (New York, N.Y.). 2008. Cohen A A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Predictive Factors for Response and Toxicity in Chemotherapy: Pharmacogenomics. Seminars in colon & rectal surgery. 2008. Sanoff Hanna K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Arylamine N-acetyltransferases: structural and functional implications of polymorphisms. Toxicology. 2008. Sim Edith, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Cisplatin plus weekly CPT-11/docetaxel in advanced esophagogastric cancer: a phase I study with pharmacogenetic assessment of XPD, XRCC3 and UGT1A1 polymorphisms. Cancer chemotherapy and pharmacology. 2008. Font Albert, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Polymorphisms and clinical outcome in recurrent ovarian cancer treated with cyclophosphamide and bevacizumab. Clinical cancer research : an official journal of the American Association for Cancer Research. 2008. Schultheis Anne M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Population pharmacokinetics and pharmacogenetics of imatinib in children and adults. Clinical cancer research : an official journal of the American Association for Cancer Research. 2008. Petain Aurélie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Relations between polymorphisms in drug-metabolising enzymes and toxicity of chemotherapy with cyclophosphamide, thiotepa and carboplatin. Pharmacogenetics and genomics. 2008. Ekhart Corine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Update on the pharmacogenetics of NATs: structural considerations. Pharmacogenomics. 2008. Stanley Lesley A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Case-control study and meta-analysis of SULT1A1 Arg213His polymorphism for gene, ethnicity and environment interaction for cancer risk. British journal of cancer. 2008. Kotnis A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacokinetic and pharmacogenetic determinants of the activity and toxicity of irinotecan in metastatic colorectal cancer patients. British journal of cancer. 2008. Rouits E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Irinotecan and uridine diphosphate glucuronosyltransferase 1A1 pharmacogenetics: to test or not to test, that is the question. Cancer. 2008. Deeken John F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CBR1 and CBR3 pharmacogenetics and their influence on doxorubicin disposition in Asian breast cancer patients. Cancer science. 2008. Lal Suman, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
An overview of cancer multidrug resistance: a still unsolved problem. Cellular and molecular life sciences : CMLS. 2008. Lage H. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Prognostic role of p53 codon 72 polymorphism in gastric cancer patients treated with fluorouracil-based adjuvant chemotherapy. Journal of cancer research and clinical oncology. 2008. Huang Zhao-Hui, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic pathway analysis of irinotecan. Clinical pharmacology and therapeutics. 2008. Rosner G L, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphisms in folate-related genes: association with side effects of high-dose methotrexate in childhood acute lymphoblastic leukemia. Leukemia : official journal of the Leukemia Society of America, Leukemia Research Fund, U.K. 2008. Huang L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Germline mutations and variants in the succinate dehydrogenase genes in Cowden and Cowden-like syndromes. American journal of human genetics. 2008. Ni Ying, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABCB1 genetic polymorphism influences the pharmacology of the new pyrrolobenzodiazepine derivative SJG-136. The pharmacogenomics journal. 2008. Aird R E, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic profiling in patients with advanced colorectal cancer treated with first-line FOLFIRI chemotherapy. The pharmacogenomics journal. 2008. Ruzzo A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The influence of fluorouracil outcome parameters on tolerance and efficacy in patients with advanced colorectal cancer. The pharmacogenomics journal. 2008. Capitain O, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
UGT1A1*28 genotype and irinotecan dosage in patients with metastatic colorectal cancer: a Dutch Colorectal Cancer Group study. British journal of cancer. 2008. Kweekel D M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Transporter-mediated protection against thiopurine-induced hematopoietic toxicity. Cancer research. 2008. Krishnamurthy Partha, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Structure/function evaluations of single nucleotide polymorphisms in human N-acetyltransferase 2. Current drug metabolism. 2008. Walraven Jason M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
NAD(P)H:quinone oxidoreductase 1 NQO1*2 genotype (P187S) is a strong prognostic and predictive factor in breast cancer. Nature genetics. 2008. Fagerholm Rainer, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Capecitabine: an overview of the side effects and their management. Anti-cancer drugs. 2008. Saif Muhammad Wasif, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms in the carbonyl reductase 3 gene CBR3 and the NAD(P)H:quinone oxidoreductase 1 gene NQO1 in patients who developed anthracycline-related congestive heart failure after childhood cancer. Cancer. 2008. Blanco Javier G, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Glutathione s-transferase p1: gene sequence variation and functional genomic studies. Cancer research. 2008. Moyer Ann M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP450 pharmacogenetics for personalizing cancer therapy. Drug resistance updates : reviews and commentaries in antimicrobial and anticancer chemotherapy. 2008. van Schaik Ron H N. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Analysis of the DPYD gene implicated in 5-fluorouracil catabolism in Chinese cancer patients. Journal of clinical pharmacy and therapeutics. 2008. He Y-F, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacokinetics of 5-fluorouracil in patients heterozygous for the IVS14+1G > A mutation in the dihydropyrimidine dehydrogenase gene. Nucleosides, nucleotides & nucleic acids. 2008. van Kuilenburg A B P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Influence of UGT1A9 intronic I399C>T polymorphism on SN-38 glucuronidation in Asian cancer patients. The pharmacogenomics journal. 2008. Sandanaraj E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2C19 pharmacogenetics in advanced cancer: compromised function independent of genotype. British journal of cancer. 2008. Helsby N A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
UGT1A1*28 polymorphism predicts irinotecan-induced severe toxicities without affecting treatment outcome and survival in patients with metastatic colorectal carcinoma. Cancer. 2008. Liu Chun-Yu, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association of genetic polymorphisms in SLCO1B3 and ABCC2 with docetaxel-induced leukopenia. Cancer science. 2008. Kiyotani Kazuma, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CYP2A6 and the plasma level of 5-chloro-2, 4-dihydroxypyridine are determinants of the pharmacokinetic variability of tegafur and 5-fluorouracil, respectively, in Japanese patients with cancer given S-1. Cancer science. 2008. Fujita Ken-ichi, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A carboxylesterase 2 gene polymorphism as predictor of capecitabine on response and time to progression. Current drug metabolism. 2008. Ribelles N, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Management of cancer pain: basic principles and neuropathic cancer pain. European journal of cancer (Oxford, England : 1990). 2008. Laird B, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Knockdown of RNA binding protein musashi-1 leads to tumor regression in vivo. Gastroenterology. 2008. Sureban Sripathi M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
First-line gefitinib in patients with advanced non-small-cell lung cancer harboring somatic EGFR mutations. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2008. Sequist Lecia V, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Role of genetic and nongenetic factors for fluorouracil treatment-related severe toxicity: a prospective clinical trial by the German 5-FU Toxicity Study Group. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2008. Schwab Matthias, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ROS-generating mitochondrial DNA mutations can regulate tumor cell metastasis. Science (New York, N.Y.). 2008. Ishikawa Kaori, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Current developments in opioid therapy for management of cancer pain. The Clinical journal of pain. 2008. de Leon-Casasola Oscar A. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Influence of ABCB1 and ABCG2 polymorphisms on doxorubicin disposition in Asian breast cancer patients. Cancer science. 2008. Lal Suman, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Association of ABCB1/MDR1 and OPRM1 gene polymorphisms with morphine pain relief. Clinical pharmacology and therapeutics. 2008. Campa D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Discovery of genetic profiles impacting response to chemotherapy: application to gemcitabine. Human mutation. 2008. Jarjanazi Hamdi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The cancer biomarker problem. Nature. 2008. Sawyers Charles L. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Tumour maintenance is mediated by eNOS. Nature. 2008. Lim Kian-Huat, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
An agonist of toll-like receptor 5 has radioprotective activity in mouse and primate models. Science (New York, N.Y.). 2008. Burdelya Lyudmila G, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Common polymorphisms in the folate pathway predict efficacy of combination regimens containing methotrexate and sulfasalazine in early rheumatoid arthritis. The Journal of rheumatology. 2008. James Heather M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Epidermal growth factor receptor polymorphisms and clinical outcomes in non-small-cell lung cancer patients treated with gefitinib. The pharmacogenomics journal. 2008. Liu G, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Gilbert's Syndrome and irinotecan toxicity: combination with UDP-glucuronosyltransferase 1A7 variants increases risk. Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology. 2008. Lankisch Tim O, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Correlation of CDA, ERCC1, and XPD polymorphisms with response and survival in gemcitabine/cisplatin-treated advanced non-small cell lung cancer patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2008. Tibaldi Carmelo, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenomic and pharmacokinetic determinants of erlotinib toxicity. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2008. Rudin Charles M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genome-wide association studies: progress and potential for drug discovery and development. Nature reviews. Drug discovery. 2008. Kingsmore Stephen F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Identification of a prevalent functional missense polymorphism in the UGT2B10 gene and its association with UGT2B10 inactivation against tobacco-specific nitrosamines. Pharmacogenetics and genomics. 2008. Chen Gang, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
An oncogene-induced DNA damage model for cancer development. Science (New York, N.Y.). 2008. Halazonetis Thanos D, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thymidylate synthase and methylenetetrahydrofolate reductase gene polymorphisms and toxicity to capecitabine in advanced colorectal cancer patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2008. Sharma Rohini, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Megalin genetic polymorphisms and individual sensitivity to the ototoxic effect of cisplatin. The pharmacogenomics journal. 2008. Riedemann L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of EGFR and VEGF inhibition. Drug discovery today. 2007. Pander Jan, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Impact of EGFR gene polymorphisms on anticancer drug cytotoxicity in vitro. Molecular diagnosis & therapy. 2008. Puyo Stéphane, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genetic variation in the catechol-O-methyltransferase (COMT) gene and morphine requirements in cancer patients with pain. Molecular pain. 2008. Rakvåg Trude T, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
5-Fluorouracil toxicity-attributable IVS14 + 1G > A mutation of the dihydropyrimidine dehydrogenase gene in Polish colorectal cancer patients. Pharmacological reports : PR. 2008. Sulzyc-Bielicka Violetta, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Influence of cytochrome P450 polymorphisms on drug therapies: pharmacogenetic, pharmacoepigenetic and clinical aspects. Pharmacology & therapeutics. 2007. Ingelman-Sundberg Magnus, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Strong association of a common dihydropyrimidine dehydrogenase gene polymorphism with fluoropyrimidine-related toxicity in cancer patients. PloS one. 2008. Gross Eva, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The structure of a human p110alpha/p85alpha complex elucidates the effects of oncogenic PI3Kalpha mutations. Science (New York, N.Y.). 2007. Huang Chuan-Hsiang, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Relationship of EGFR mutations, expression, amplification, and polymorphisms to epidermal growth factor receptor inhibitors in the NCI60 cell lines. Clinical cancer research : an official journal of the American Association for Cancer Research. 2007. Liu Wanqing, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Toxic death case in a patient undergoing gemcitabine-based chemotherapy in relation with cytidine deaminase downregulation. Pharmacogenetics and genomics. 2007. Mercier Cédric, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Network analysis of oncogenic Ras activation in cancer. Science (New York, N.Y.). 2007. Stites Edward C, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
DPYD*2A mutation: the most common mutation associated with DPD deficiency. Cancer chemotherapy and pharmacology. 2007. Saif M W, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Role of UGT1A1*6, UGT1A1*28 and ABCG2 c.421C>A polymorphisms in irinotecan-induced neutropenia in Asian cancer patients. Cancer science. 2007. Jada Srinivasa Rao, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UGT1A1*28 genotype and irinotecan-induced neutropenia: dose matters. Journal of the National Cancer Institute. 2007. Hoskins Janelle M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms of folate metabolic enzymes and toxicities of high dose methotrexate in children with acute lymphoblastic leukemia. Annals of hematology. 2007. Pakakasama Samart, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Dihydropyrimidine dehydrogenase activity and the IVS14+1G>A mutation in patients developing 5FU-related toxicity. British journal of clinical pharmacology. 2007. Magné Nicolas, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphisms in folate, pyrimidine, and purine metabolism are associated with efficacy and toxicity of methotrexate in psoriasis. The Journal of investigative dermatology. 2007. Campalani Emanuela, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics of gemcitabine: can genetic studies lead to tailor-made therapy?. British journal of cancer. 2007. Ueno H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Recent development in pharmacogenomics: from candidate genes to genome-wide association studies. Expert review of molecular diagnostics. 2007. Grant Struan F A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2C8 haplotype structures and their influence on pharmacokinetics of paclitaxel in a Japanese population. Pharmacogenetics and genomics. 2007. Saito Yoshiro, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Mapping genes that contribute to daunorubicin-induced cytotoxicity. Cancer research. 2007. Duan Shiwei, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
UGT1A1 polymorphism can predict hematologic toxicity in patients treated with irinotecan. Clinical cancer research : an official journal of the American Association for Cancer Research. 2007. Côté Jean-François, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UGT1A1 promoter genotype correlates with SN-38 pharmacokinetics, but not severe toxicity in patients receiving low-dose irinotecan. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2007. Stewart Clinton F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gender-specific differences in expression in human lymphoblastoid cell lines. Pharmacogenetics and genomics. 2007. Zhang Wei, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A genome-wide approach to identify genetic variants that contribute to etoposide-induced cytotoxicity. Proceedings of the National Academy of Sciences of the United States of America. 2007. Huang R Stephanie, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
5-Fluorouracil-related severe toxicity: a comparison of different methods for the pretherapeutic detection of dihydropyrimidine dehydrogenase deficiency. Cancer letters. 2007. Boisdron-Celle M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GADD153 mediates celecoxib-induced apoptosis in cervical cancer cells. Carcinogenesis. 2007. Kim Su-Hyeong, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic profiling in patients with advanced colorectal cancer treated with first-line FOLFOX-4 chemotherapy. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2007. Ruzzo Annamaria, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Association of variant ABCG2 and the pharmacokinetics of epidermal growth factor receptor tyrosine kinase inhibitors in cancer patients. Cancer biology & therapy. 2007. Li Jing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Profile of polymorphisms of drug-metabolising enzymes and the risk of therapy-related leukaemia. British journal of haematology. 2007. Bolufer Pascual, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Cisplatin-induced long-term hearing impairment is associated with specific glutathione s-transferase genotypes in testicular cancer survivors. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2007. Oldenburg Jan, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphisms in the thymidylate synthase and dihydropyrimidine dehydrogenase genes predict response and toxicity to capecitabine-raltitrexed in colorectal cancer. Oncology reports. 2007. Salgado Josefa, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Irinotecan-induced diarrhea: functional significance of the polymorphic ABCC2 transporter protein. Clinical pharmacology and therapeutics. 2007. de Jong F A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacokinetics of gemcitabine in Japanese cancer patients: the impact of a cytidine deaminase polymorphism. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2007. Sugiyama Emiko, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Effect of population and gender on chemotherapeutic agent-induced cytotoxicity. Molecular cancer therapeutics. 2007. Huang Rong Stephanie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Response to treatment and survival of patients with non-small cell lung cancer undergoing somatic EGFR mutation testing. The oncologist. 2007. Sequist Lecia V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of anthracyclines in the era of targeted therapy. Cardiovascular toxicology. 2007. Cortés-Funes Hernán, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Demystifying the ACE polymorphism: from genetics to biology. Current pharmaceutical design. 2007. Castellon Raquel, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
XRCC1 R399Q polymorphism is associated with response to platinum-based neoadjuvant chemotherapy in bulky cervical cancer. Gynecologic oncology. 2006. Chung Hyun Hoon, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
DPYD*5 gene mutation contributes to the reduced DPYD enzyme activity and chemotherapeutic toxicity of 5-FU: results from genotyping study on 75 gastric carcinoma and colon carcinoma patients. Medical oncology (Northwood, London, England). 2007. Zhang Hong, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Adding pharmacogenetics information to drug labels: lessons learned. Pharmacogenetics and genomics. 2006. Haga Susanne B, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cytosine arabinoside-metabolizing enzyme genes are underexpressed in children with MLL gene-rearranged acute lymphoblastic leukemia. Brazilian journal of medical and biological research = Revista brasileira de pesquisas médicas e biológicas / Sociedade Brasileira de Biofísica ... [et al.]. 2006. Mata J F, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of ABCB1 genotypes with paclitaxel-mediated peripheral neuropathy and neutropenia. European journal of cancer (Oxford, England : 1990). 2006. Sissung Tristan M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Clinical relevance of different dihydropyrimidine dehydrogenase gene single nucleotide polymorphisms on 5-fluorouracil tolerance. Molecular cancer therapeutics. 2006. Morel Alain, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Activation of coupled Ah receptor and Nrf2 gene batteries by dietary phytochemicals in relation to chemoprevention. Biochemical pharmacology. 2006. Köhle Christoph, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of capecitabine in advanced breast cancer patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2006. Largillier Rémy, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Estrogen sulfation genes, hormone replacement therapy, and endometrial cancer risk. Journal of the National Cancer Institute. 2006. Rebbeck Timothy R, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Glutathione-S-transferase P1 isoenzyme polymorphisms, platinum-based chemotherapy, and non-small cell lung cancer. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2006. Booton Richard, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Prophylaxis of irinotecan-induced diarrhea with neomycin and potential role for UGT1A1*28 genotype screening: a double-blind, randomized, placebo-controlled study. The oncologist. 2006. de Jong Floris A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Impact of the haplotype CYP3A4*16B harboring the Thr185Ser substitution on paclitaxel metabolism in Japanese patients with cancer. Clinical pharmacology and therapeutics. 2006. Nakajima Yukiko, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Orotate phosphoribosyltransferase gene polymorphism predicts toxicity in patients treated with bolus 5-fluorouracil regimen. Clinical cancer research : an official journal of the American Association for Cancer Research. 2006. Ichikawa Wataru, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Glutathione S-transferase omega 1 and omega 2 pharmacogenomics. Drug metabolism and disposition: the biological fate of chemicals. 2006. Mukherjee Baidehi, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available