
The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Gene ? Variant?
Alternate Names ? Chemicals ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
No VIP available CA No VIP available CYP2A6 *1A N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *4A N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *4C N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *7 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2A6 *9 N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *9A N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *10 N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *11 N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *18A N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *19 N/A N/A N/A
No VIP available CA No VIP available CYP2B6 *1 N/A N/A N/A
No VIP available CA No VIP available CYP2B6 *6 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C19 *1 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C19 *2A N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C19 *2B N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C19 *17 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C9 *1 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C9 *2 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C9 *3 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *1 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *1xN N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *2 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *3 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *4 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *6 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *10 N/A N/A N/A
No VIP available No VIP available No VIP available CYP3A4 *1A N/A N/A N/A
No VIP available No VIP available No VIP available CYP3A4 *1B N/A N/A N/A
No VIP available CA No VIP available CYP3A5 *1A N/A N/A N/A
No VIP available CA No VIP available CYP3A5 *3A N/A N/A N/A
No VIP available No VIP available No VIP available CYP3A5 *3C N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *1 N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *2A N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *4 N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *5 N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *6 N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *9A N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *13 N/A N/A N/A
No VIP available No VIP available No VIP available G6PD Mediterranean, Dallas, Panama' Sassari, Cagliari, Birmingham N/A N/A N/A
No VIP available CA No VIP available GSTM1 non-null N/A N/A N/A
No VIP available CA No VIP available GSTM1 null N/A N/A N/A
No VIP available CA No VIP available GSTT1 non-null N/A N/A N/A
No VIP available CA No VIP available GSTT1 null N/A N/A N/A
No VIP available No VIP available No VIP available HLA-A *02:01 N/A N/A N/A
No VIP available No VIP available No VIP available HLA-A *03:01:01:01 N/A N/A N/A
No VIP available No VIP available No VIP available PIK3CA H4 N/A N/A N/A
No VIP available No VIP available No VIP available PIK3CA H5 N/A N/A N/A
No VIP available No VIP available No VIP available SLCO1B1 *1 N/A N/A N/A
No VIP available No VIP available No VIP available SLCO1B1 *15 N/A N/A N/A
No VIP available No VIP available VA TPMT *1 N/A N/A N/A
No VIP available No VIP available VA TPMT *3A N/A N/A N/A
No VIP available No VIP available VA TPMT *3C N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *1 N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *6 N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *28 N/A N/A N/A
No VIP available CA No VIP available UGT1A1 *60 N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *93 N/A N/A N/A
No VIP available No Clinical Annotations available VA
rs10144771 NC_000014.8:g.94778653A>G, NC_000014.9:g.94312316A>G, NG_011796.1:g.16036T>C, NM_001756.3:c.613+1720T>C, NT_187601.1:g.1426878A>G, rs60270135
A > G
No VIP available No Clinical Annotations available VA
rs10413396 NC_000019.10:g.44309549G>T, NC_000019.9:g.44813702G>T
G > T
No VIP available CA No Variant Annotations available
rs1042522 NC_000017.10:g.7579472G=, NC_000017.10:g.7579472G>C, NC_000017.10:g.7579472G>T, NC_000017.11:g.7676154G=, NC_000017.11:g.7676154G>C, NC_000017.11:g.7676154G>T, NG_017013.2:g.16397C=, NG_017013.2:g.16397C>A, NG_017013.2:g.16397C>G, NM_000546.5:c.215C=, NM_000546.5:c.215C>A, NM_000546.5:c.215C>G, NM_001126112.2:c.215C=, NM_001126112.2:c.215C>A, NM_001126112.2:c.215C>G, NM_001126113.2:c.215C=, NM_001126113.2:c.215C>A, NM_001126113.2:c.215C>G, NM_001126114.2:c.215C=, NM_001126114.2:c.215C>A, NM_001126114.2:c.215C>G, NM_001126115.1:c.-939C=, NM_001126115.1:c.-939C>A, NM_001126115.1:c.-939C>G, NM_001126116.1:c.-939C=, NM_001126116.1:c.-939C>A, NM_001126116.1:c.-939C>G, NM_001126117.1:c.-939C=, NM_001126117.1:c.-939C>A, NM_001126117.1:c.-939C>G, NM_001126118.1:c.98C=, NM_001126118.1:c.98C>A, NM_001126118.1:c.98C>G, NM_001276695.1:c.98C=, NM_001276695.1:c.98C>A, NM_001276695.1:c.98C>G, NM_001276696.1:c.98C=, NM_001276696.1:c.98C>A, NM_001276696.1:c.98C>G, NM_001276697.1:c.-1020C=, NM_001276697.1:c.-1020C>A, NM_001276697.1:c.-1020C>G, NM_001276698.1:c.-1020C=, NM_001276698.1:c.-1020C>A, NM_001276698.1:c.-1020C>G, NM_001276699.1:c.-1020C=, NM_001276699.1:c.-1020C>A, NM_001276699.1:c.-1020C>G, NM_001276760.1:c.98C=, NM_001276760.1:c.98C>A, NM_001276760.1:c.98C>G, NM_001276761.1:c.98C=, NM_001276761.1:c.98C>A, NM_001276761.1:c.98C>G, NP_000537.3:p.Pro72=, NP_000537.3:p.Pro72Arg, NP_000537.3:p.Pro72His, NP_001119584.1:p.Pro72=, NP_001119584.1:p.Pro72Arg, NP_001119584.1:p.Pro72His, NP_001119585.1:p.Pro72=, NP_001119585.1:p.Pro72Arg, NP_001119585.1:p.Pro72His, NP_001119586.1:p.Pro72=, NP_001119586.1:p.Pro72Arg, NP_001119586.1:p.Pro72His, NP_001119590.1:p.Pro33=, NP_001119590.1:p.Pro33Arg, NP_001119590.1:p.Pro33His, NP_001263624.1:p.Pro33=, NP_001263624.1:p.Pro33Arg, NP_001263624.1:p.Pro33His, NP_001263625.1:p.Pro33=, NP_001263625.1:p.Pro33Arg, NP_001263625.1:p.Pro33His, NP_001263689.1:p.Pro33=, NP_001263689.1:p.Pro33Arg, NP_001263689.1:p.Pro33His, NP_001263690.1:p.Pro33=, NP_001263690.1:p.Pro33Arg, NP_001263690.1:p.Pro33His, XM_005256778.1:c.176-21C=, XM_005256778.1:c.176-21C>A, XM_005256778.1:c.176-21C>G, XR_243565.1:n.354C=, XR_243565.1:n.354C>A, XR_243565.1:n.354C>G, XR_243566.1:n.354C=, XR_243566.1:n.354C>A, XR_243566.1:n.354C>G, rs17844988, rs17857747, rs17882155, rs2229076, rs3174747, rs4134781, rs60388830
G > C
No VIP available No Clinical Annotations available VA
rs1042597 NC_000002.11:g.234526871C>G, NC_000002.12:g.233618225C>G, NG_002601.2:g.33482C>G, NM_019076.4:c.518C>G, NP_061949.3:p.Ala173Gly, rs117092283, rs13387262, rs17862843, rs2071043, rs56696602
C > G
No VIP available No Clinical Annotations available VA
rs1042605 NC_000002.11:g.234527118A>G, NC_000002.12:g.233618472A>G, NG_002601.2:g.33729A>G, NM_019076.4:c.765A>G, NP_061949.3:p.Thr255=, rs17868307, rs58240369
A > G
No VIP available CA VA
rs10426377 NC_000019.10:g.48588977C>A, NC_000019.9:g.49092234C>A, NG_029063.1:g.41806C>A, NM_004605.2:c.378+1540C>A, NM_177973.1:c.423+1540C>A, XM_005259182.1:c.-228C>A, XM_005259182.2:c.-228C>A, rs61651031
C > A
No VIP available No Clinical Annotations available VA
rs10426628 NC_000019.10:g.48589173A>G, NC_000019.9:g.49092430A>G, NG_029063.1:g.42002A>G, NM_004605.2:c.378+1736A>G, NM_177973.1:c.423+1736A>G, XM_005259182.1:c.-32A>G, XM_005259182.2:c.-32A>G, rs57560171
A > G
No VIP available CA VA
rs1044457 NC_000001.10:g.47842777C>T, NC_000001.11:g.47377105C>T, NM_001136140.1:c.*360C>T, NM_016308.2:c.*360C>T, NR_046394.1:n.1119C>T, rs17378832, rs3184215, rs3767626
C > -
C > T
No VIP available CA VA
rs1045642 NC_000007.13:g.87138645A>G, NC_000007.14:g.87509329A>G, NG_011513.1:g.208920T>C, NM_000927.4:c.3435T>C, NP_000918.2:p.Ile1145=, rs10239679, rs11568726, rs117328163, rs17210003, rs2229108, rs386513066, rs60023214, rs9690664
A > G
No VIP available CA VA
rs1048977 NC_000001.10:g.20945055C>T, NC_000001.11:g.20618562C>T, NM_001785.2:c.435C>T, NP_001776.1:p.Thr145=, rs17846527, rs17859600, rs3189038, rs57498302
C > T
No VIP available No Clinical Annotations available VA
rs10497346 NC_000002.11:g.169771196T>C, NC_000002.12:g.168914686T>C, NW_003315909.1:g.101313T>C
T > C
No VIP available CA No Variant Annotations available
rs1051266 NC_000021.8:g.46957794T>C, NC_000021.9:g.45537880T>C, NG_028278.1:g.9592A>G, NM_001205206.1:c.80A>G, NM_194255.2:c.80A>G, NP_001192135.1:p.His27Arg, NP_919231.1:p.His27Arg, XM_005261163.1:c.80A>G, XM_005261164.1:c.-279A>G, XM_005261164.2:c.-279A>G, XM_011529696.1:c.371A>G, XM_011529697.1:c.371A>G, XM_011529698.1:c.146A>G, XM_011529699.1:c.-1639A>G, XM_011529700.1:c.80A>G, XM_011529701.1:c.80A>G, XM_011529702.1:c.80A>G, XM_011529703.1:c.80A>G, XM_011529704.1:c.80A>G, XM_011529705.1:c.371A>G, XM_011529707.1:c.371A>G, XM_011529708.1:c.80A>G, XM_011529709.1:c.-279A>G, XM_011529710.1:c.-165-5732A>G, XP_005261220.1:p.His27Arg, XP_011527998.1:p.His124Arg, XP_011527999.1:p.His124Arg, XP_011528000.1:p.His49Arg, XP_011528002.1:p.His27Arg, XP_011528003.1:p.His27Arg, XP_011528004.1:p.His27Arg, XP_011528005.1:p.His27Arg, XP_011528006.1:p.His27Arg, XP_011528007.1:p.His124Arg, XP_011528009.1:p.His124Arg, XP_011528010.1:p.His27Arg, rs17844977, rs17857726, rs3171496, rs386514057, rs61510559
T > C
No VIP available CA VA
rs1051640 NC_000017.10:g.48768486A>G, NC_000017.11:g.50691125A>G, NM_003786.3:c.4509A>G, NP_003777.2:p.Glu1503=, XM_005257763.1:c.4317A>G, XM_005257763.2:c.4317A>G, XM_011525422.1:c.4422A>G, XM_011525423.1:c.4614A>G, XM_011525424.1:c.3834A>G, XM_011525425.1:c.3783A>G, XP_005257820.1:p.Glu1439=, XP_011523724.1:p.Glu1474=, XP_011523725.1:p.Glu1538=, XP_011523726.1:p.Glu1278=, XP_011523727.1:p.Glu1261=, XR_934586.1:n.4970A>G, rs17414117, rs17643255, rs3192040, rs57272614, rs60786737
A > G
No VIP available CA VA
rs1056892 NC_000021.8:g.37518706G>A, NC_000021.9:g.36146408G>A, NM_001236.3:c.730G>A, NP_001227.1:p.Val244Met, NR_038892.1:n.93-53C>T, NR_038893.1:n.93-53C>T, NR_038894.1:n.93-53C>T, rs3171445, rs52816011, rs58776388
G > A
No VIP available No Clinical Annotations available VA
rs1058930 NC_000010.10:g.96818119G>C, NC_000010.11:g.95058362G>C, NG_007972.1:g.16136C>G, NM_000770.3:c.792C>G, NM_001198853.1:c.582C>G, NM_001198854.1:c.486C>G, NM_001198855.1:c.582C>G, NP_000761.3:p.Ile264Met, NP_001185782.1:p.Ile194Met, NP_001185783.1:p.Ile162Met, NP_001185784.1:p.Ile194Met, XR_246073.1:n.888C>G, XR_945610.1:n.888C>G, rs17420739, rs3199599, rs56489507, rs56929063
G > C
No VIP available CA No Variant Annotations available
rs1060896 NC_000015.10:g.45262069C>A, NC_000015.9:g.45554267C>A, NM_004212.3:c.225C>A, NP_004203.2:p.Ser75Arg, NR_120335.1:n.27-6071G>T, XM_011522198.1:c.225C>A, XM_011522199.1:c.225C>A, XM_011522200.1:c.225C>A, XM_011522201.1:c.225C>A, XP_011520500.1:p.Ser75Arg, XP_011520501.1:p.Ser75Arg, XP_011520502.1:p.Ser75Arg, XP_011520503.1:p.Ser75Arg, XR_243147.1:n.32-6071G>T, rs17215647, rs17532209, rs52828213, rs58568974
C > A
No VIP available No Clinical Annotations available VA
rs10815019 NC_000009.11:g.4547288A>G, NC_000009.12:g.4547288A>G, NG_017044.1:g.61862A>G, NM_004170.5:c.232+2581A>G, XM_011518007.1:c.301+2581A>G, XM_011518008.1:c.241+2581A>G, XM_011518009.1:c.172+2581A>G, XM_011518010.1:c.92-14161A>G, rs56618216, rs59895460
A > G
A > T
No VIP available No Clinical Annotations available VA
rs10841661 NC_000012.11:g.20984832C>T, NC_000012.12:g.20831898C>T, NG_032071.1:g.26195C>T, NM_019844.3:c.84+16076C>T, XM_005253347.1:c.84+16076C>T, rs60957758
C > T
No VIP available No Clinical Annotations available VA
rs10929302 NC_000002.11:g.234665782G>A, NC_000002.12:g.233757136G>A, NG_002601.2:g.172393G>A, NG_033238.1:g.1864G>A, NM_001072.3:c.862-9898G>A, NM_007120.2:c.868-9898G>A, NM_019075.2:c.856-9898G>A, NM_019076.4:c.856-9898G>A, NM_019077.2:c.856-9898G>A, NM_019078.1:c.868-9898G>A, NM_019093.2:c.868-9898G>A, NM_021027.2:c.856-9898G>A, NM_205862.1:c.61-9898G>A, NR_037694.1:n.-1791C>T, NR_037695.1:n.-1791C>T, NR_037696.1:n.-1791C>T, XR_241238.1:n.924-9898G>A, XR_241240.1:n.1023-9898G>A, XR_241241.1:n.942-9898G>A
G > A
No VIP available No Clinical Annotations available VA
rs10931910 NC_000002.11:g.201523736A>G, NC_000002.12:g.200659013A>G, NM_001159.3:c.3172-152A>G, XM_005246506.1:c.1840-152A>G, XM_011511062.1:c.3172-152A>G, XR_922913.1:n.3329-152A>G, rs13005946, rs59990000
A > G
No VIP available No Clinical Annotations available VA
G > T
No VIP available No Clinical Annotations available VA
rs11022922 NC_000011.10:g.2457965C>T, NC_000011.9:g.2479195C>T, NG_008935.1:g.17975C>T, NM_000218.2:c.386+12481C>T, rs60426613
C > T
No VIP available CA VA
rs11045585 NC_000012.11:g.21045694A>G, NC_000012.12:g.20892760A>G, NG_032071.1:g.87057A>G, NM_019844.3:c.1683-5676A>G, XM_005253347.1:c.1683-5676A>G
A > G
No VIP available No Clinical Annotations available VA
rs11046217 NC_000012.11:g.22017157G>C, NC_000012.12:g.21864223G>C, NG_012819.1:g.77472C>G, NM_005691.2:c.2237+216C>G, NM_005691.3:c.2237+216C>G, NM_020297.2:c.2237+216C>G, NM_020297.3:c.2237+216C>G, XM_005253284.1:c.2237+216C>G, XM_005253284.2:c.2237+216C>G, XM_005253285.1:c.2237+216C>G, XM_005253286.1:c.2237+216C>G, XM_005253286.2:c.2237+216C>G, XM_005253287.1:c.2237+216C>G, XM_005253287.3:c.2237+216C>G, XM_005253288.1:c.2237+216C>G, XM_005253288.2:c.2237+216C>G, XM_005253289.1:c.2199-1169C>G, XM_005253289.2:c.2199-1169C>G, XM_005253290.1:c.2199-3168C>G, XM_005253290.2:c.2199-3168C>G, XM_005253291.1:c.2237+216C>G, XM_006719025.2:c.2199-1169C>G, XM_011520545.1:c.2237+216C>G
G > C
No VIP available No Clinical Annotations available VA
rs11075646 NC_000016.10:g.66935273C>G, NC_000016.9:g.66969176C>G, NM_003869.5:c.-171C>G, NM_016062.3:c.-909G>C, NM_198061.2:c.-171C>G, NR_024525.2:n.-850G>C, NR_036684.1:n.803C>G, NR_046109.1:n.-850G>C, XM_011523421.1:c.-806C>G, rs16957087, rs60326948
C > -
C > G
No VIP available No Clinical Annotations available VA
rs1113129 NC_000010.10:g.96811045G>C, NC_000010.11:g.95051288G>C, NG_007972.1:g.23210C>G, NM_000770.3:c.820-5337C>G, NM_001198853.1:c.610-5337C>G, NM_001198854.1:c.514-5337C>G, NM_001198855.1:c.610-5337C>G, XR_246073.1:n.916-5337C>G, XR_945610.1:n.916-5337C>G, rs4488135
G > C
No VIP available CA VA
rs11141915 NC_000009.11:g.90235794A>C, NC_000009.12:g.87620879A>C, NG_029883.1:g.128039A>C, NM_001288729.1:c.284+15704A>C, NM_001288730.1:c.284+15704A>C, NM_001288731.1:c.284+15704A>C, NM_004938.3:c.284+15704A>C, XM_005251755.1:c.284+15704A>C, XM_005251756.1:c.284+15704A>C, XM_005251757.1:c.284+15704A>C, XM_005251757.2:c.284+15704A>C, rs36209074, rs58921402
A > C
No VIP available CA No Variant Annotations available
rs11211524 NC_000001.10:g.47833213A>C, NC_000001.11:g.47367541A>C, NM_001136140.1:c.172-5414A>C, NM_016308.2:c.172-928A>C, NR_046394.1:n.321-928A>C
A > C
No VIP available CA VA
rs1128503 NC_000007.13:g.87179601A>G, NC_000007.14:g.87550285A>G, NG_011513.1:g.167964T>C, NM_000927.4:c.1236T>C, NP_000918.2:p.Gly412=, rs116989428, rs17276907, rs2032587, rs2229105, rs28365046, rs386518005, rs58257317
A > G
No VIP available CA No Variant Annotations available
rs1138272 NC_000011.10:g.67586108C>T, NC_000011.9:g.67353579C>T, NG_012075.1:g.7514C>T, NM_000852.3:c.341C>T, NP_000843.1:p.Ala114Val, XM_005273958.1:c.338C>T, XP_005274015.1:p.Ala113Val, rs11553894, rs17434783, rs1799811, rs1804665, rs3202011, rs4134657, rs52800258, rs61323549
C > T
No VIP available CA VA
rs1142345 NC_000006.11:g.18130918T>C, NC_000006.12:g.18130687T>C, NG_012137.2:g.29457A>G, NM_000367.3:c.719A>G, NP_000358.1:p.Tyr240Cys, XM_011514839.1:c.674A>G, XM_011514840.1:c.650A>G, XP_011513141.1:p.Tyr225Cys, XP_011513142.1:p.Tyr217Cys, rs16880254, rs1801205, rs29001646, rs52798150, rs61510596
T > C
No VIP available CA No Variant Annotations available
rs11479 NC_000022.10:g.50964236G>A, NC_000022.11:g.50525807G>A, NG_011860.1:g.9279C>T, NG_016235.1:g.5633C>T, NG_021419.1:g.22592G>A, NM_001113755.2:c.1412C>T, NM_001113756.2:c.1412C>T, NM_001169109.1:c.-14+439C>T, NM_001169110.1:c.-14+194C>T, NM_001169111.1:c.-379C>T, NM_001257988.1:c.1412C>T, NM_001257989.1:c.1427C>T, NM_001953.4:c.1412C>T, NM_005138.2:c.-349C>T, NP_001107227.1:p.Ser471Leu, NP_001107228.1:p.Ser471Leu, NP_001244917.1:p.Ser471Leu, NP_001244918.1:p.Ser476Leu, NP_001944.1:p.Ser471Leu, rs17846490, rs17859554, rs3202233, rs3829983
G > A
No VIP available CA VA
rs1149222 NC_000007.13:g.87073775G>T, NC_000007.14:g.87444459G>T, NG_007118.1:g.40974C>A, NM_000443.3:c.1119+403C>A, NM_018849.2:c.1119+403C>A, NM_018850.2:c.1119+403C>A, XM_011516308.1:c.1119+403C>A, XM_011516309.1:c.1119+403C>A, XM_011516310.1:c.1119+403C>A, XM_011516311.1:c.1119+403C>A, XM_011516312.1:c.1119+403C>A, XM_011516313.1:c.1119+403C>A, XM_011516314.1:c.1140+403C>A, XM_011516315.1:c.459+403C>A, XR_927478.1:n.1215+403C>A, rs10376488, rs1639242, rs17297653, rs60948017
G > T
No VIP available CA No Variant Annotations available
rs115232898 NC_000001.10:g.98165030T>C, NC_000001.11:g.97699474T>C, NG_008807.2:g.226586A>G, NM_000110.3:c.557A>G, NP_000101.2:p.Tyr186Cys, XM_005270561.1:c.446A>G, XM_005270562.1:c.557A>G, XM_005270562.3:c.557A>G, XM_005270563.1:c.557A>G, XM_005270564.1:c.557A>G, XM_006710397.2:c.557A>G, XP_005270618.1:p.Tyr149Cys, XP_005270619.1:p.Tyr186Cys, XP_005270619.2:p.Tyr186Cys, XP_005270620.1:p.Tyr186Cys, XP_005270621.1:p.Tyr186Cys, XP_006710460.1:p.Tyr186Cys, rs199469520
T > C
No VIP available No Clinical Annotations available VA
A > C
A > G
No VIP available No Clinical Annotations available VA
rs11572080 NC_000010.10:g.96827030C>T, NC_000010.11:g.95067273C>T, NG_007972.1:g.7225G>A, NM_000770.3:c.416G>A, NM_001198853.1:c.206G>A, NM_001198854.1:c.110G>A, NM_001198855.1:c.206G>A, NP_000761.3:p.Arg139Lys, NP_001185782.1:p.Arg69Lys, NP_001185783.1:p.Arg37Lys, NP_001185784.1:p.Arg69Lys, XR_246073.1:n.512G>A, XR_945610.1:n.512G>A, rs60090616
C > T
No VIP available No Clinical Annotations available VA
rs11572103 NC_000010.10:g.96818106T>A, NC_000010.11:g.95058349T>A, NG_007972.1:g.16149A>T, NM_000770.3:c.805A>T, NM_001198853.1:c.595A>T, NM_001198854.1:c.499A>T, NM_001198855.1:c.595A>T, NP_000761.3:p.Ile269Phe, NP_001185782.1:p.Ile199Phe, NP_001185783.1:p.Ile167Phe, NP_001185784.1:p.Ile199Phe, XR_246073.1:n.901A>T, XR_945610.1:n.901A>T, rs52833642, rs58027822
T > A
No VIP available CA VA
rs11598702 NC_000010.10:g.104897985T>C, NC_000010.11:g.103138228T>C, NG_042272.1:g.60079A>G, NM_001134373.2:c.175+1178A>G, NM_012229.4:c.175+1178A>G, XM_005269632.1:c.175+1178A>G, XM_005269632.3:c.175+1178A>G, XM_005269633.1:c.175+1178A>G, XM_005269633.3:c.175+1178A>G, XM_005269634.1:c.175+1178A>G, XM_005269634.3:c.175+1178A>G, XM_005269635.1:c.175+1178A>G, XM_005269635.3:c.175+1178A>G, XM_005269636.1:c.175+1178A>G, XM_005269636.3:c.175+1178A>G, XM_005269637.1:c.88+1178A>G, XM_005269637.3:c.88+1178A>G, XM_005269638.1:c.79+1178A>G, XM_005269638.3:c.79+1178A>G, XM_005269639.1:c.88+1178A>G, XM_005269639.3:c.88+1178A>G, XM_005269640.1:c.-460+1178A>G, XM_005269640.3:c.-460+1178A>G, XM_005269641.1:c.-460+1178A>G, XM_005269641.3:c.-460+1178A>G, XM_005269642.1:c.-460+1178A>G, XM_005269642.3:c.-460+1178A>G, XM_005269643.1:c.-398-31522A>G, XM_005269643.3:c.-398-31522A>G, XM_005269644.1:c.-484+1178A>G, XM_005269644.3:c.-484+1178A>G, XM_005269645.1:c.-484+1178A>G, XM_005269645.3:c.-484+1178A>G, XM_005269646.1:c.-483-26423A>G, XM_005269646.3:c.-483-26423A>G, XM_006717721.2:c.-459-26423A>G, XM_006717722.2:c.-281+1178A>G, XM_006717723.2:c.-281+1178A>G, XM_006717724.2:c.-305+1178A>G, XM_011539534.1:c.175+1178A>G, XM_011539535.1:c.-1974A>G, XM_011539536.1:c.-43+1178A>G, XM_011539537.1:c.175+1178A>G, rs17728547, rs52826896, rs61084912
T > C
No VIP available CA VA
rs11615 NC_000019.10:g.45420395A>G, NC_000019.9:g.45923653A>G, NG_015839.2:g.63434T>C, NM_001166049.1:c.354T>C, NM_001983.3:c.354T>C, NM_202001.2:c.354T>C, NP_001159521.1:p.Asn118=, NP_001974.1:p.Asn118=, NP_973730.1:p.Asn118=, XM_005258634.1:c.354T>C, XM_005258635.1:c.354T>C, XM_005258635.2:c.354T>C, XM_005258636.1:c.354T>C, XM_005258636.3:c.354T>C, XM_005258637.1:c.354T>C, XM_005258638.1:c.138T>C, XM_011526610.1:c.354T>C, XP_005258691.1:p.Asn118=, XP_005258692.1:p.Asn118=, XP_005258693.1:p.Asn118=, XP_005258694.1:p.Asn118=, XP_005258695.1:p.Asn46=, XP_011524912.1:p.Asn118=, rs1130005, rs17285882, rs17359303, rs17845191, rs17858003, rs17859564, rs2228629, rs3177700, rs3188446, rs3752251, rs59923575
A > G
No VIP available No Clinical Annotations available VA
A > T
No VIP available No Clinical Annotations available VA
rs11671784 NC_000019.10:g.13836482G>A, NC_000019.9:g.13947296G>A, NR_029495.1:n.178C>T, NR_029497.1:n.-123C>T, NR_029501.1:n.36C>T, NR_036515.1:n.-193C>T
G > A
No VIP available No Clinical Annotations available VA
rs11692021 NC_000002.11:g.234591205T>C, NC_000002.12:g.233682559T>C, NG_002601.2:g.97816T>C, NM_019075.2:c.855+45182T>C, NM_019076.4:c.855+63997T>C, NM_019077.2:c.622T>C, NM_021027.2:c.855+9770T>C, NP_061950.2:p.Trp208Arg, XM_005246081.1:c.622T>C, XP_005246138.1:p.Trp208Arg, XR_241241.1:n.941+9770T>C, rs17863779, rs57605148
T > C
No VIP available CA VA
rs11719165 NC_000003.11:g.194586088T>C, NC_000003.12:g.194865359T>C, rs57619894
T > C
No VIP available CA VA
rs12046844 NC_000001.10:g.66238379G>A, NC_000001.11:g.65772696G>A, rs60665040
G > A
No VIP available No Clinical Annotations available VA
rs12059276 NC_000001.10:g.110273541C>T, NC_000001.11:g.109730919C>T, rs60940964
C > T
No VIP available No Clinical Annotations available VA
rs1214763 NC_000006.11:g.43360261T>C, NC_000006.12:g.43392523T>C, XR_926814.1:n.400+789T>C, XR_926815.1:n.400+789T>C, rs1772678, rs2153700, rs60427804
T > C
No VIP available CA VA
rs12201199 NC_000006.11:g.18139802A>T, NC_000006.12:g.18139571A>T, NG_012137.2:g.20573T>A, NM_000367.3:c.419+94T>A, XM_011514839.1:c.419+94T>A, XM_011514840.1:c.350+94T>A, rs58109747
A > T
No VIP available No Clinical Annotations available VA
rs12211463 NC_000006.11:g.93467158T>G, NC_000006.12:g.92757440T>G, rs59764123
T > G
No VIP available No Clinical Annotations available VA
rs12468274 NC_000002.11:g.234627914T>C, NC_000002.12:g.233719268T>C, NG_002601.2:g.134525T>C, NM_001072.3:c.861+25403T>C, NM_007120.2:c.448T>C, NM_019075.2:c.856-47766T>C, NM_019076.4:c.856-47766T>C, NM_019077.2:c.855+36476T>C, NM_019078.1:c.867+5410T>C, NM_021027.2:c.855+46479T>C, NM_205862.1:c.60+25403T>C, NP_009051.1:p.Leu150=, XR_241238.1:n.504T>C, XR_241240.1:n.1022+25403T>C, XR_241241.1:n.941+46479T>C
T > C
No VIP available No Clinical Annotations available VA
rs12658397 NC_000005.10:g.102415949T>C, NC_000005.9:g.101751653T>C, NM_001289002.1:c.1473-2806A>G, NM_001289004.1:c.1287-2806A>G, NM_001308014.1:c.714-2806A>G, NM_173488.4:c.1473-2806A>G, XM_005271873.1:c.1473-2806A>G, XM_005271874.1:c.1473-2806A>G, XM_005271874.2:c.1473-2806A>G, XM_005271875.1:c.1287-2806A>G, XM_005271876.1:c.1287-2806A>G, XM_005271877.1:c.714-2806A>G, XM_011543147.1:c.1368-2806A>G, XM_011543148.1:c.1236-2806A>G, XM_011543149.1:c.900-2806A>G, XM_011543150.1:c.744-2806A>G, XM_011543151.1:c.714-2806A>G, XM_011543152.1:c.714-2806A>G, XM_011543153.1:c.651-2806A>G, rs61168560
T > C
No VIP available CA No Variant Annotations available
rs12721627 NC_000007.13:g.99366093G>C, NC_000007.14:g.99768470G>C, NG_008421.1:g.20716C>G, NM_001202855.2:c.554C>G, NM_017460.5:c.554C>G, NP_001189784.1:p.Thr185Ser, NP_059488.2:p.Thr185Ser, XM_011515841.1:c.554C>G, XM_011515842.1:c.554C>G, XP_011514143.1:p.Thr185Ser, XP_011514144.1:p.Thr185Ser, rs28371754, rs56915287
G > C
No VIP available No Clinical Annotations available VA
rs12762549 NC_000010.10:g.101620771C>G, NC_000010.11:g.99861014C>G, rs61161342
C > G
No VIP available CA VA
rs12948783 NC_000017.10:g.74499400G>A, NC_000017.11:g.76503318G>A, NG_032852.1:g.3110C>T, NM_024599.5:c.-2185C>T, XM_005257669.1:c.-2602C>T, XM_005257669.2:c.-2602C>T, XM_005257670.1:c.-2185C>T, XM_005257671.1:c.-2286C>T, XM_011525250.1:c.-2286C>T, XM_011525251.1:c.-2127C>T, XM_011525252.1:c.-2185C>T, rs117129397, rs60624663
G > A
G > T
No VIP available CA No Variant Annotations available
rs13058338 NC_000022.10:g.37632770T>A, NC_000022.11:g.37236730T>A, NG_007288.1:g.12536A>T, NM_002872.3:c.108-3812A>T, NM_002872.4:c.108-3812A>T, XM_006724286.2:c.108-3812A>T, rs52805510
T > A
T > G
No VIP available No Clinical Annotations available VA
rs13401281 NC_000002.11:g.234628679T>G, NC_000002.12:g.233720033T>G, NG_002601.2:g.135290T>G, NM_001072.3:c.861+26168T>G, NM_007120.2:c.867+346T>G, NM_019075.2:c.856-47001T>G, NM_019076.4:c.856-47001T>G, NM_019077.2:c.855+37241T>G, NM_019078.1:c.867+6175T>G, NM_021027.2:c.856-47001T>G, NM_205862.1:c.60+26168T>G, XR_241238.1:n.923+346T>G, XR_241240.1:n.1022+26168T>G, XR_241241.1:n.942-47001T>G
T > G
No VIP available No Clinical Annotations available VA
rs13422094 NC_000002.11:g.22181114T>C, NC_000002.12:g.21958242T>C, XR_939813.1:n.185+6266T>C
T > C
No VIP available CA VA
rs151264360 NC_000018.10:g.673444_673449delTTAAAG, NC_000018.9:g.673444_673449delTTAAAG, NG_028255.1:g.20841_20846delTTAAAG, NM_001071.2:c.*447_*452delTTAAAG, NM_001126123.3:c.*145-373_*145-368del, NM_001126123.3:c.*145-373_*145-368delCTTTAA, NM_001318759.1:c.*145-373_*145-368del, NM_001318759.1:c.*145-373_*145-368delCTTTAA, NM_001318760.1:c.*446+410_*446+415delCTTTAA, NM_001318760.1:c.*856_*861del, NM_017512.5:c.*856_*861delCTTTAA, NM_202758.3:c.*856_*861delCTTTAA, XM_005258111.1:c.*856_*861delCTTTAA, XM_005258112.1:c.*856_*861delCTTTAA, XM_005258113.1:c.*856_*861delCTTTAA, XM_005258114.1:c.*856_*861delCTTTAA, XM_005258115.1:c.*856_*861delCTTTAA, XM_005258116.1:c.*856_*861delCTTTAA, XM_005258117.1:c.*856_*861delCTTTAA, XM_005258118.1:c.*856_*861delCTTTAA, XM_005258118.2:c.*856_*861del, XM_005258120.1:c.*856_*861delCTTTAA, XM_005258137.1:c.*447_*452delTTAAAG, XM_005258138.1:c.*447_*452delTTAAAG, XM_011525677.1:c.*856_*861del, XM_011525678.1:c.*856_*861del, XM_011525679.1:c.*856_*861del, XM_011525680.1:c.*856_*861del, XM_011525681.1:c.*856_*861del, XM_011525682.1:c.*856_*861del, XM_011525683.1:c.*856_*861del, XM_011525684.1:c.*856_*861del, XM_011525685.1:c.*856_*861del, XM_011525686.1:c.*856_*861del, XM_011525687.1:c.*856_*861del, XM_011525688.1:c.*856_*861del, XM_011525689.1:c.*856_*861del, XM_011525690.1:c.*856_*861del, XM_011525691.1:c.*856_*861del, XM_011525692.1:c.*856_*861del, XM_011525693.1:c.*856_*861del, XM_011525694.1:c.*856_*861del, XM_011525695.1:c.*856_*861del, XM_011525696.1:c.*856_*861del, XM_011525697.1:c.*856_*861del, XM_011525698.1:c.*856_*861del, XM_011525699.1:c.*856_*861del, XR_243810.1:n.1672-373_1672-368delCTTTAA, XR_243810.3:n.1513-373_1513-368del, XR_243811.1:n.1538-373_1538-368delCTTTAA, XR_243811.2:n.1538-373_1538-368del, XR_243812.1:n.2112_2117delCTTTAA, XR_430041.2:n.1633-373_1633-368del, XR_935066.1:n.2109_2114del, XR_935067.1:n.1967_1972del
No VIP available No Clinical Annotations available VA
rs1523127 NC_000003.11:g.119501039C>A, NC_000003.12:g.119782192C>A, NG_011856.1:g.6709C>A, NM_003889.3:c.-131C>A, NM_022002.2:c.-566C>A, NM_033013.2:c.-131C>A, XM_005247866.1:c.-296C>A, rs58645792
C > A
No VIP available No Clinical Annotations available VA
rs1523130 NC_000003.11:g.119499507T>C, NC_000003.12:g.119780660T>C, NG_011856.1:g.5177T>C, NM_003889.3:c.-1663T>C, NM_033013.2:c.-1663T>C, XM_005247866.1:c.-1828T>C, rs118196528, rs3814054, rs59854583, rs61314694
T > C
No VIP available No Clinical Annotations available VA
rs1551285 NC_000002.11:g.234529122A>C, NC_000002.12:g.233620476A>C, NG_002601.2:g.35733A>C, NM_019076.4:c.855+1914A>C, rs60826737
A > C
No VIP available No Clinical Annotations available VA
rs1617640 NC_000007.13:g.100317298C>A, NC_000007.14:g.100719675C>A, NG_021471.1:g.3876C>A, NM_000799.2:c.-1306C>A, XM_005250190.1:c.-1306C>A, rs10304599, rs10342152, rs57979509
C > A
No VIP available No Clinical Annotations available VA
rs165728 NC_000022.10:g.19957023C>T, NC_000022.11:g.19969500C>T, NG_011526.1:g.32761C>T, NG_023326.1:g.52287G>A, NM_000754.3:c.*764C>T, NM_001135161.1:c.*764C>T, NM_001135162.1:c.*764C>T, NM_001670.2:c.*1256G>A, NM_001670.2:c.*877+379G>A, NM_007310.2:c.*764C>T, XM_005261229.1:c.*764C>T, XM_005261242.1:c.2764-2291G>A, XM_005261243.1:c.*1256G>A, XM_005261243.3:c.*1256G>A, XM_005261244.1:c.*1217G>A, XM_005261244.3:c.*1217G>A, XM_006724243.1:c.2782-2291G>A, XM_006724245.2:c.*1217G>A, XM_006724246.2:c.2536-2291G>A, XM_006724247.2:c.*1256G>A, XM_006724248.2:c.*1256G>A, XM_011529886.1:c.*764C>T, XM_011530179.1:c.2749-2291G>A, XM_011530182.1:c.1348-2291G>A, XM_011530183.1:c.*1217G>A, XR_937863.1:n.4112G>A, rs59845570
C > T
No VIP available CA No Variant Annotations available
rs1695 NC_000011.10:g.67585218A>G, NC_000011.9:g.67352689A>G, NG_012075.1:g.6624A>G, NM_000852.3:c.313A>G, NP_000843.1:p.Ile105Val, XM_005273958.1:c.313A>G, XP_005274015.1:p.Ile105Val, rs1138257, rs11553891, rs17353321, rs17856342, rs2230827, rs4609, rs56971933, rs947894
A > G
No VIP available No Clinical Annotations available VA
rs17216177 NC_000010.10:g.101603522T>C, NC_000010.11:g.99843765T>C, NG_011798.1:g.66060T>C, NM_000392.4:c.3742-34T>C, XM_005269536.1:c.3463-34T>C, XM_006717630.2:c.3046-34T>C, XR_945604.1:n.3931-34T>C, XR_945605.1:n.3806-34T>C, rs45616434
T > C
No VIP available No Clinical Annotations available VA
rs17287570 NC_000016.10:g.16061246A=, NC_000016.10:g.16061246A>C, NC_000016.9:g.16155103A>C, NG_028268.1:g.116670A=, NG_028268.1:g.116670A>C, NM_004996.3:c.1677+4951A>C, NM_004996.3:c.1677+4951C>A, NT_187607.1:g.1719137C=, NT_187607.1:g.1719137C>A, XM_005255326.1:c.1677+4951A>C, XM_005255327.1:c.1551+4951A>C, XM_005255328.1:c.1539+4951A>C, XM_005255329.1:c.1677+4951A>C, XM_011522497.1:c.1653+4951A>C, XM_011522497.1:c.1653+4951C>A, XM_011522498.1:c.1731+4951A>C, XM_011522498.1:c.1731+4951C>A, rs57882411
A > C
No VIP available CA VA
rs1736557 NC_000001.10:g.171080080G>A, NC_000001.11:g.171110939G>A, NG_012690.1:g.25063G>A, NM_001002294.2:c.769G>A, NM_001319173.1:c.709G>A, NM_001319174.1:c.580G>A, NM_006894.4:c.769G>A, NM_006894.5:c.769G>A, NP_001002294.1:p.Val257Met, NP_001306102.1:p.Val237Met, NP_001306103.1:p.Val194Met, NP_008825.4:p.Val257Met, XM_005245043.1:c.709G>A, XM_005245044.1:c.580G>A, XM_011509345.1:c.709G>A, XM_011509346.1:c.709G>A, XP_005245100.1:p.Val237Met, XP_005245101.1:p.Val194Met, XP_011507647.1:p.Val237Met, XP_011507648.1:p.Val237Met, rs17845981, rs17858963, rs56477964, rs58508781
G > A
No VIP available CA VA
rs17376848 NC_000001.10:g.97915624A>G, NC_000001.11:g.97450068A>G, NG_008807.2:g.475992T>C, NM_000110.3:c.1896T>C, NP_000101.2:p.Phe632=, XM_005270561.1:c.1785T>C, XM_005270562.1:c.1680T>C, XM_005270562.3:c.1680T>C, XM_005270563.1:c.1896T>C, XM_006710397.2:c.1896T>C, XP_005270618.1:p.Phe595=, XP_005270619.1:p.Phe560=, XP_005270619.2:p.Phe560=, XP_005270620.1:p.Phe632=, XP_006710460.1:p.Phe632=, rs117467766, rs52815410, rs58485702
A > G
No VIP available No Clinical Annotations available VA
rs174699 NC_000022.10:g.19954458C>T, NC_000022.11:g.19966935C>T, NG_011526.1:g.30196C>T, NM_000754.3:c.616-1601C>T, NM_001135161.1:c.616-1601C>T, NM_001135162.1:c.616-1601C>T, NM_007310.2:c.466-1601C>T, XM_005261229.1:c.616-1601C>T, XM_005261242.1:c.*41G>A, XM_006724243.1:c.*41G>A, XM_006724246.2:c.*41G>A, XM_011529885.1:c.730-229C>T, XM_011529886.1:c.730-1601C>T, XM_011529887.1:c.616-229C>T, XM_011529888.1:c.616-229C>T, XM_011529889.1:c.616-229C>T, XM_011529890.1:c.616-229C>T, XM_011529891.1:c.616-229C>T, XM_011530179.1:c.*41G>A, XM_011530182.1:c.*41G>A, rs361592, rs59292400, rs59837580
C > T
No VIP available CA VA
rs17583889 NC_000002.11:g.138746039C>A, NC_000002.12:g.137988469C>A, NG_012966.1:g.29232C>A, NM_006895.2:c.191-12449C>A, XM_005263654.1:c.191-12449C>A, XM_011511063.1:c.89-12449C>A, XM_011511064.1:c.-188-12449C>A
C > A
No VIP available CA VA
rs17645700 NC_000002.11:g.138780932T>C, NC_000002.12:g.138023362T>C, XR_244863.1:n.579-15566A>G
T > C
No VIP available No Clinical Annotations available VA
rs17822471 NC_000016.10:g.48208468G>A, NC_000016.9:g.48242379G>A, NG_011522.1:g.31710C>T, NM_032583.3:c.1637C>T, NM_033151.3:c.1637C>T, NM_145186.2:c.1637C>T, NP_115972.2:p.Thr546Met, NP_149163.2:p.Thr546Met, NP_660187.1:p.Thr546Met, XM_005256208.1:c.1637C>T, XM_005256209.1:c.1637C>T, XM_005256210.1:c.1637C>T, XM_011523396.1:c.1439C>T, XM_011523397.1:c.680C>T, XP_005256265.1:p.Thr546Met, XP_005256266.1:p.Thr546Met, XP_005256267.1:p.Thr546Met, XP_011521698.1:p.Thr480Met, XP_011521699.1:p.Thr227Met, XR_243432.1:n.1742C>T, rs386492901, rs52810988, rs57560138
G > A
No VIP available No Clinical Annotations available VA
rs17822931 NC_000016.10:g.48224287C>T, NC_000016.9:g.48258198C>T, NG_011522.1:g.15891G>A, NM_032583.3:c.538G>A, NM_033151.3:c.538G>A, NM_145186.2:c.538G>A, NP_115972.2:p.Gly180Arg, NP_149163.2:p.Gly180Arg, NP_660187.1:p.Gly180Arg, XM_005256208.1:c.538G>A, XM_005256209.1:c.538G>A, XM_005256210.1:c.538G>A, XM_011523396.1:c.340G>A, XM_011523397.1:c.-1144G>A, XP_005256265.1:p.Gly180Arg, XP_005256266.1:p.Gly180Arg, XP_005256267.1:p.Gly180Arg, XP_011521698.1:p.Gly114Arg, XR_243432.1:n.643G>A, rs52813591, rs58140753
C > T
No VIP available CA VA
rs17863783 NC_000002.11:g.234602277G>T, NC_000002.12:g.233693631G>T, NG_002601.2:g.108888G>T, NM_001072.3:c.627G>T, NM_019075.2:c.855+56254G>T, NM_019076.4:c.856-73403G>T, NM_019077.2:c.855+10839G>T, NM_021027.2:c.855+20842G>T, NM_205862.1:c.-7-168G>T, NP_001063.2:p.Val209=, XR_241240.1:n.788G>T, XR_241241.1:n.941+20842G>T, rs60686635
G > T
No VIP available CA VA
rs17868320 NC_000002.11:g.234578428C>T, NC_000002.12:g.233669782C>T, NG_002601.2:g.85039C>T, NM_019075.2:c.855+32405C>T, NM_019076.4:c.855+51220C>T
C > T
No VIP available No Clinical Annotations available VA
rs17868323 NC_000002.11:g.234590970T>G, NC_000002.12:g.233682324T>G, NG_002601.2:g.97581T>G, NM_019075.2:c.855+44947T>G, NM_019076.4:c.855+63762T>G, NM_019077.2:c.387T>G, NM_021027.2:c.855+9535T>G, NP_061950.2:p.Asn129Lys, XM_005246081.1:c.387T>G, XP_005246138.1:p.Asn129Lys, XR_241241.1:n.941+9535T>G
T > G
No VIP available No Clinical Annotations available VA
rs1799782 NC_000019.10:g.43553422G>A, NC_000019.9:g.44057574G>A, NG_033799.1:g.27157C>T, NM_006297.2:c.580C>T, NP_006288.2:p.Arg194Trp, rs11553655, rs2229674, rs3213359, rs3826914, rs386545546
G > A
No VIP available CA No Variant Annotations available
rs1799793 NC_000019.10:g.45364001C>T, NC_000019.9:g.45867259C>T, NG_007067.2:g.11587G>A, NM_000400.3:c.934G>A, NM_001130867.1:c.862G>A, NP_000391.1:p.Asp312Asn, NP_001124339.1:p.Asp288Asn, XM_005258639.1:c.862G>A, XM_005258640.1:c.700G>A, XM_005258641.1:c.196G>A, XM_005258642.1:c.934G>A, XM_011526611.1:c.856G>A, XP_005258696.1:p.Asp288Asn, XP_005258697.1:p.Asp234Asn, XP_005258698.1:p.Asp66Asn, XP_005258699.1:p.Asp312Asn, XP_011524913.1:p.Asp286Asn, XR_935763.1:n.981G>A, rs3916814, rs58989209
C > T
No VIP available No Clinical Annotations available VA
rs1799971 NC_000006.11:g.154360797A>G, NC_000006.12:g.154039662A>G, NG_021208.1:g.34162A>G, NM_000914.4:c.118A>G, NM_001008503.2:c.118A>G, NM_001008504.3:c.118A>G, NM_001008505.2:c.118A>G, NM_001145279.3:c.397A>G, NM_001145280.3:c.-11+28644A>G, NM_001145281.2:c.47+29103A>G, NM_001145282.2:c.118A>G, NM_001145283.2:c.118A>G, NM_001145284.3:c.118A>G, NM_001145285.2:c.118A>G, NM_001145286.2:c.118A>G, NM_001285522.1:c.118A>G, NM_001285523.1:c.118A>G, NM_001285524.1:c.397A>G, NP_000905.3:p.Asn40Asp, NP_001008503.2:p.Asn40Asp, NP_001008504.2:p.Asn40Asp, NP_001008505.2:p.Asn40Asp, NP_001138751.1:p.Asn133Asp, NP_001138754.1:p.Asn40Asp, NP_001138755.1:p.Asn40Asp, NP_001138756.1:p.Asn40Asp, NP_001138757.1:p.Asn40Asp, NP_001138758.1:p.Asn40Asp, NP_001272451.1:p.Asn40Asp, NP_001272452.1:p.Asn40Asp, NP_001272453.1:p.Asn133Asp, NR_104348.1:n.252A>G, NR_104349.1:n.252A>G, NR_104350.1:n.252A>G, NR_104351.1:n.252A>G, XM_005267002.1:c.304A>G, XM_006715497.2:c.304A>G, XM_011535849.1:c.397A>G, XP_005267059.1:p.Asn102Asp, XP_006715560.1:p.Asn102Asp, XP_011534151.1:p.Asn133Asp, XR_245534.1:n.304A>G, XR_245535.1:n.304A>G, XR_245536.1:n.304A>G, XR_245537.1:n.304A>G, rs17181017, rs52818856, rs61596185
A > G
No VIP available CA No Variant Annotations available
rs1799983 NC_000007.13:g.150696111T>G, NC_000007.14:g.150999023T>G, NG_011992.1:g.12965T>G, NM_000603.4:c.894T>G, NM_001160109.1:c.894T>G, NM_001160110.1:c.894T>G, NM_001160111.1:c.894T>G, NP_000594.2:p.Asp298Glu, NP_001153581.1:p.Asp298Glu, NP_001153582.1:p.Asp298Glu, NP_001153583.1:p.Asp298Glu, XM_006716002.2:c.894T>G, XP_006716065.1:p.Asp298Glu, rs11266811, rs13238975, rs13305983, rs13308813, rs17173672, rs3730304, rs57135373
T > G
No VIP available CA VA
rs1800460 NC_000006.11:g.18139228C>T, NC_000006.12:g.18138997C>T, NG_012137.2:g.21147G>A, NM_000367.3:c.460G>A, NP_000358.1:p.Ala154Thr, XM_011514839.1:c.460G>A, XM_011514840.1:c.391G>A, XP_011513141.1:p.Ala154Thr, XP_011513142.1:p.Ala131Thr, rs11568060, rs16880273, rs386545583, rs57650974
C > T
No VIP available CA No Variant Annotations available
rs1800566 NC_000016.10:g.69711242G>A, NC_000016.9:g.69745145G>A, NG_011504.1:g.20389C>T, NM_000903.2:c.559C>T, NM_001025433.1:c.457C>T, NM_001025434.1:c.445C>T, NM_001286137.1:c.343C>T, NP_000894.1:p.Pro187Ser, NP_001020604.1:p.Pro153Ser, NP_001020605.1:p.Pro149Ser, NP_001273066.1:p.Pro115Ser, XM_005255830.1:c.343C>T, XP_005255887.1:p.Pro115Ser, rs4134727, rs4149351, rs57135274
G > A
No VIP available No Clinical Annotations available VA
rs1801030 NC_000016.10:g.28606164C>T, NC_000016.9:g.28617485C>T, NG_028128.1:g.22382G>A, NM_001055.3:c.667G>A, NM_001310136.1:c.121-139262G>A, NM_177529.2:c.667G>A, NM_177530.2:c.667G>A, NM_177534.2:c.667G>A, NM_177536.3:c.433G>A, NP_001046.2:p.Val223Met, NP_803565.1:p.Val223Met, NP_803566.1:p.Val223Met, NP_803878.1:p.Val223Met, NP_803880.1:p.Val145Met, XM_005255522.1:c.667G>A, XP_005255579.1:p.Val223Met, rs61167940, rs8054402
C > T
No VIP available CA VA
rs1801131 NC_000001.10:g.11854476T>G, NC_000001.11:g.11794419T>G, NG_013351.1:g.16685A>C, NM_005957.4:c.1286A>C, NP_005948.3:p.Glu429Ala, XM_005263458.1:c.1409A>C, XM_005263458.2:c.1409A>C, XM_005263459.1:c.1355A>C, XM_005263460.1:c.1286A>C, XM_005263460.3:c.1286A>C, XM_005263461.1:c.1286A>C, XM_005263461.3:c.1286A>C, XM_005263462.1:c.1286A>C, XM_005263462.3:c.1286A>C, XM_005263463.1:c.1040A>C, XM_005263463.2:c.1040A>C, XM_011541495.1:c.1406A>C, XM_011541496.1:c.1409A>C, XP_005263515.1:p.Glu470Ala, XP_005263516.1:p.Glu452Ala, XP_005263517.1:p.Glu429Ala, XP_005263518.1:p.Glu429Ala, XP_005263519.1:p.Glu429Ala, XP_005263520.1:p.Glu347Ala, XP_011539797.1:p.Glu469Ala, XP_011539798.1:p.Glu470Ala, rs17367365, rs17857426, rs4134712
T > G
No VIP available CA VA
rs1801133 NC_000001.10:g.11856378G>A, NC_000001.11:g.11796321G>A, NG_013351.1:g.14783C>T, NM_005957.4:c.665C>T, NP_005948.3:p.Ala222Val, XM_005263458.1:c.788C>T, XM_005263458.2:c.788C>T, XM_005263459.1:c.734C>T, XM_005263460.1:c.665C>T, XM_005263460.3:c.665C>T, XM_005263461.1:c.665C>T, XM_005263461.3:c.665C>T, XM_005263462.1:c.665C>T, XM_005263462.3:c.665C>T, XM_005263463.1:c.419C>T, XM_005263463.2:c.419C>T, XM_011541495.1:c.785C>T, XM_011541496.1:c.788C>T, XP_005263515.1:p.Ala263Val, XP_005263516.1:p.Ala245Val, XP_005263517.1:p.Ala222Val, XP_005263518.1:p.Ala222Val, XP_005263519.1:p.Ala222Val, XP_005263520.1:p.Ala140Val, XP_011539797.1:p.Ala262Val, XP_011539798.1:p.Ala263Val, rs386545618, rs4134713, rs59514310
G > A
No VIP available CA VA
rs1801158 NC_000001.10:g.97981421C>T, NC_000001.11:g.97515865C>T, NG_008807.2:g.410195G>A, NM_000110.3:c.1601G>A, NP_000101.2:p.Ser534Asn, XM_005270561.1:c.1490G>A, XM_005270562.1:c.1524+33695G>A, XM_005270562.3:c.1524+33695G>A, XM_005270563.1:c.1601G>A, XM_005270564.1:c.1601G>A, XM_006710397.2:c.1601G>A, XP_005270618.1:p.Ser497Asn, XP_005270620.1:p.Ser534Asn, XP_005270621.1:p.Ser534Asn, XP_006710460.1:p.Ser534Asn, rs199469539, rs52824375, rs59516208
C > T
No VIP available CA VA
rs1801159 NC_000001.10:g.97981395T>C, NC_000001.11:g.97515839T>C, NG_008807.2:g.410221A>G, NM_000110.3:c.1627A>G, NP_000101.2:p.Ile543Val, XM_005270561.1:c.1516A>G, XM_005270562.1:c.1524+33721A>G, XM_005270562.3:c.1524+33721A>G, XM_005270563.1:c.1627A>G, XM_005270564.1:c.1627A>G, XM_006710397.2:c.1627A>G, XP_005270618.1:p.Ile506Val, XP_005270620.1:p.Ile543Val, XP_005270621.1:p.Ile543Val, XP_006710460.1:p.Ile543Val, rs117999026, rs17116825, rs199469541, rs386545620, rs58945530
T > C
No VIP available CA VA
rs1801160 NC_000001.10:g.97770920C>T, NC_000001.11:g.97305364C>T, NG_008807.2:g.620696G>A, NM_000110.3:c.2194G>A, NP_000101.2:p.Val732Ile, NR_046590.1:n.129-825C>T, XM_005270561.1:c.2083G>A, XM_005270562.1:c.1978G>A, XM_005270562.3:c.1978G>A, XM_005270563.1:c.2194G>A, XM_006710397.2:c.2194G>A, XP_005270618.1:p.Val695Ile, XP_005270619.1:p.Val660Ile, XP_005270619.2:p.Val660Ile, XP_005270620.1:p.Val732Ile, XP_006710460.1:p.Val732Ile, rs12720467, rs12720468, rs199469554
C > T
No VIP available CA VA
rs1801265 NC_000001.10:g.98348885G=, NC_000001.10:g.98348885G>A, NC_000001.11:g.97883329A=, NC_000001.11:g.97883329A>G, NG_008807.2:g.42731T=, NG_008807.2:g.42731T>C, NM_000110.3:c.85T=, NM_000110.3:c.85T>C, NM_001160301.1:c.85T=, NM_001160301.1:c.85T>C, NP_000101.2:p.Cys29=, NP_000101.2:p.Cys29Arg, NP_001153773.1:p.Cys29=, NP_001153773.1:p.Cys29Arg, XM_005270561.1:c.39+37555C>T, XM_005270561.1:c.39+37555T>C, XM_005270562.1:c.85C=, XM_005270562.1:c.85C>T, XM_005270562.3:c.85T=, XM_005270562.3:c.85T>C, XM_005270563.1:c.85C=, XM_005270563.1:c.85C>T, XM_005270564.1:c.85C=, XM_005270564.1:c.85C>T, XM_006710397.2:c.85T=, XM_006710397.2:c.85T>C, XP_005270619.1:p.Arg29=, XP_005270619.1:p.Arg29Cys, XP_005270619.2:p.Cys29=, XP_005270619.2:p.Cys29Arg, XP_005270620.1:p.Arg29=, XP_005270620.1:p.Arg29Cys, XP_005270621.1:p.Arg29=, XP_005270621.1:p.Arg29Cys, XP_006710460.1:p.Cys29=, XP_006710460.1:p.Cys29Arg, rs199469510, rs3211355, rs52823090, rs57596852
G > A
No VIP available CA VA
rs183205964 NC_000018.10:g.657657G>C, NC_000018.9:g.657657G>C, NG_028255.1:g.5054G>C, NM_001012716.2:c.*34+185C>G, NM_001071.2:c.-86G>C, XM_005258137.1:c.-86G>C, XM_005258138.1:c.-86G>C
G > C
No VIP available CA No Variant Annotations available
rs183484 NC_000011.10:g.4119902C>A, NC_000011.9:g.4141132C>A, NG_027992.2:g.30209C>A, NM_001033.3:c.850C>A, NM_001033.4:c.850C>A, NM_001318064.1:c.559C>A, NM_001318065.1:c.-207C>A, NP_001024.1:p.Arg284=, NP_001304993.1:p.Arg187=, XM_005253058.1:c.607C>A, XM_005253059.1:c.559C>A, XM_011520277.1:c.559C>A, XM_011520278.1:c.184C>A, XM_011520279.1:c.-207C>A, XP_005253115.1:p.Arg203=, XP_005253116.1:p.Arg187=, XP_011518579.1:p.Arg187=, XP_011518580.1:p.Arg62=, rs17210748, rs1735058, rs17850105, rs2228122
C > A
No VIP available CA No Variant Annotations available
rs1883112 NC_000022.10:g.37256846G>A, NC_000022.11:g.36860804G>A, NG_023400.1:g.4817G>A, NM_000631.4:c.-368G>A, NM_013416.3:c.-368G>A, NT_187631.1:g.81598G>A, XM_011530198.1:c.-1851G>A, XM_011530199.1:c.-915G>A, rs13055287, rs34673077, rs61381844
G > A
No VIP available No Clinical Annotations available VA
rs1885301 NC_000010.10:g.101541053A>G, NC_000010.11:g.99781296A>G, NG_011798.1:g.3591A>G, NM_000392.4:c.-1549A>G, XM_005269536.1:c.-1549A>G, XM_006717631.2:c.-1549A>G, XM_011539291.1:c.-1549A>G, XR_945604.1:n.-1360A>G, XR_945605.1:n.-1358A>G, rs17216261, rs59934936
A > G
No VIP available CA VA
rs1901440 NC_000002.11:g.134437959C>A, NC_000002.12:g.133680388C>A, rs60584215
C > A
No VIP available No Clinical Annotations available VA
rs2010963 NC_000006.11:g.43738350C>G, NC_000006.12:g.43770613C>G, NG_008732.1:g.5398C>G, NM_001025366.2:c.-94C>G, NM_001025367.2:c.-94C>G, NM_001025368.2:c.-94C>G, NM_001025369.2:c.-94C>G, NM_001025370.2:c.-94C>G, NM_001033756.2:c.-94C>G, NM_001171622.1:c.-94C>G, NM_001171623.1:c.-634C>G, NM_001171624.1:c.-634C>G, NM_001171625.1:c.-634C>G, NM_001171626.1:c.-634C>G, NM_001171627.1:c.-634C>G, NM_001171628.1:c.-634C>G, NM_001171629.1:c.-634C>G, NM_001171630.1:c.-634C>G, NM_001204384.1:c.-634C>G, NM_001204385.1:c.-94C>G, NM_001287044.1:c.-1507C>G, NM_001317010.1:c.-634C>G, NM_003376.5:c.-94C>G, XM_005249363.1:c.-1507C>G
C > G
No VIP available No Clinical Annotations available VA
rs2011404 NC_000002.11:g.234627937T>C, NC_000002.12:g.233719291T>C, NG_002601.2:g.134548T>C, NM_001072.3:c.861+25426T>C, NM_007120.2:c.471T>C, NM_019075.2:c.856-47743T>C, NM_019076.4:c.856-47743T>C, NM_019077.2:c.855+36499T>C, NM_019078.1:c.867+5433T>C, NM_021027.2:c.855+46502T>C, NM_205862.1:c.60+25426T>C, NP_009051.1:p.Cys157=, XR_241238.1:n.527T>C, XR_241240.1:n.1022+25426T>C, XR_241241.1:n.941+46502T>C, rs17633274, rs17866660, rs56712128
T > C
No VIP available CA VA
rs2019604 NC_000016.10:g.89549357T>G, NC_000016.9:g.89615765T>G, NG_008082.1:g.45961T>G, NM_003119.3:c.1664-1137T>G, XM_005256320.1:c.-21+2427T>G, XM_006721264.2:c.1664-1137T>G, rs17783931, rs3888234, rs57996679, rs74251519
T > G
No VIP available No Clinical Annotations available VA
rs2020870 NC_000001.10:g.171154959A>G, NC_000001.11:g.171185820A>G, NM_001301347.1:c.-386+461A>G, NM_001460.4:c.107A>G, NP_001451.2:p.Asp36Gly, XM_005245039.1:c.107A>G, XP_005245096.1:p.Asp36Gly, XR_426768.2:n.224A>G, XR_921761.1:n.224A>G, XR_922278.1:n.508-17632T>C, rs2266712, rs52821140, rs58458262
A > G
No VIP available No Clinical Annotations available VA
rs2032582 NC_000007.13:g.87160618A>C, NC_000007.13:g.87160618A>T, NC_000007.14:g.87531302A>C, NC_000007.14:g.87531302A>T, NG_011513.1:g.186947T>A, NG_011513.1:g.186947T>G, NM_000927.4:c.2677T>A, NM_000927.4:c.2677T>G, NP_000918.2:p.Ser893Ala, NP_000918.2:p.Ser893Thr, rs10228331, rs2229106, rs386553610, rs57135550, rs9641018
A > C
A > T
No VIP available No Clinical Annotations available VA
rs2070474 NC_000022.10:g.24891292C>G, NC_000022.11:g.24495324C>G, NG_012858.1:g.5042C>G, NM_016327.2:c.-80C>G, NR_028483.2:n.-250G>C, NR_028484.2:n.-250G>C, XM_005261633.1:c.-112C>G, XM_011530222.1:c.-80C>G, XM_011530223.1:c.-80C>G, XM_011530224.1:c.-80C>G, XM_011530225.1:c.-522C>G, XR_244378.1:n.265C>G, XR_937867.1:n.858C>G, rs199469575
C > G
No VIP available No Clinical Annotations available VA
rs2072671 NC_000001.10:g.20915701A>C, NC_000001.11:g.20589208A>C, NM_001785.2:c.79A>C, NP_001776.1:p.Lys27Gln, rs57221291
A > C
No VIP available CA VA
rs2075252 NC_000002.11:g.170010985T>C, NC_000002.12:g.169154475T>C, NG_012634.1:g.213138A>G, NM_004525.2:c.12280A>G, NP_004516.2:p.Lys4094Glu, XM_005246551.1:c.9991A>G, XM_011511183.1:c.12151A>G, XM_011511184.1:c.9991A>G, XP_005246608.1:p.Lys3331Glu, XP_011509485.1:p.Lys4051Glu, XP_011509486.1:p.Lys3331Glu, rs17848193, rs386556527, rs52808684, rs59573352
T > C
No VIP available No Clinical Annotations available VA
rs2075507 NC_000022.10:g.19928092G>A, NC_000022.11:g.19940569G>A, NG_011526.1:g.3830G>A, NG_011835.1:g.6268C>T, NM_000754.3:c.-1420G>A, NM_001282512.1:c.103+1132C>T, NM_006440.3:c.103+1132C>T, NM_006440.4:c.103+1132C>T, XM_005261214.1:c.103+1132C>T, XM_005261216.1:c.103+1132C>T, XM_005261217.1:c.103+1132C>T, XM_005261229.1:c.-1714G>A, XM_011529887.1:c.-1420G>A, XM_011529890.1:c.-1714G>A, XM_011529891.1:c.-1992G>A, rs2097603, rs2234763, rs3937420, rs4646309
G > A
No VIP available CA VA
rs2108623 NC_000019.10:g.15906196G>A, NC_000019.9:g.16017006G>A, rs17454858, rs3947944, rs4429395, rs59294251
G > A
No VIP available No Clinical Annotations available VA
rs2180314 NC_000006.11:g.52617731C>G, NC_000006.12:g.52752933C>G, NG_029430.1:g.15631G>C, NM_000846.4:c.335G>C, NP_000837.3:p.Ser112Thr, XM_011514532.1:c.335G>C, XP_011512834.1:p.Ser112Thr, rs17605670, rs17849682, rs3178048, rs52806894, rs57248371
C > G
No VIP available CA No Variant Annotations available
rs2207396 NC_000006.11:g.152382382G>A, NC_000006.12:g.152061247G>A, NG_008493.1:g.375752G>A, NM_000125.3:c.1369+123G>A, NM_001122740.1:c.1369+123G>A, NM_001122741.1:c.1369+123G>A, NM_001122742.1:c.1369+123G>A, NM_001291230.1:c.1375+123G>A, NM_001291241.1:c.1366+123G>A, XM_005266856.1:c.1375+123G>A, XM_005266857.1:c.1366+123G>A, XM_006715374.2:c.1369+123G>A, XM_006715375.2:c.850+123G>A, XM_011535543.1:c.1369+123G>A, XM_011535544.1:c.1369+123G>A, XM_011535545.1:c.1369+123G>A, XM_011535546.1:c.1369+123G>A, XM_011535547.1:c.1369+123G>A, XM_011535548.1:c.850+123G>A, XM_011535549.1:c.640+123G>A, XR_943116.1:n.7257C>T, rs17847072, rs57792040
G > A
No VIP available CA VA
rs2227983 NC_000007.13:g.55229255G>A, NC_000007.14:g.55161562G>A, NG_007726.3:g.147531G>A, NM_005228.3:c.1562G>A, NM_201282.1:c.1562G>A, NM_201284.1:c.1562G>A, NP_005219.2:p.Arg521Lys, NP_958439.1:p.Arg521Lys, NP_958441.1:p.Arg521Lys, XM_005271746.1:c.1427G>A, XM_005271747.1:c.1403G>A, XM_005271748.1:c.1562G>A, XP_005271803.1:p.Arg476Lys, XP_005271804.1:p.Arg468Lys, XP_005271805.1:p.Arg521Lys, rs11543848, rs117960725, rs12234746, rs17336807, rs3752650
G > A
No VIP available CA No Variant Annotations available
rs2228001 NC_000003.11:g.14187449G>T, NC_000003.12:g.14145949G>T, NG_011763.1:g.37724C>A, NM_001145769.1:c.2704C>A, NM_004628.4:c.2815C>A, NP_001139241.1:p.Gln902Lys, NP_004619.3:p.Gln939Lys, NR_027299.1:n.2795C>A, rs17620623, rs17856505, rs3729583, rs60736379
G > T
No VIP available No Clinical Annotations available VA
rs2228100 NC_000017.10:g.19642952G>C, NC_000017.11:g.19739639G>C, NG_012251.1:g.13795C>G, NM_000691.4:c.985C>G, NM_001135167.1:c.985C>G, NM_001135168.1:c.985C>G, NP_000682.3:p.Pro329Ala, NP_001128639.1:p.Pro329Ala, NP_001128640.1:p.Pro329Ala, XM_005256522.1:c.1336C>G, XM_005256523.1:c.1336C>G, XM_005256523.2:c.1336C>G, XM_005256524.1:c.1336C>G, XM_005256524.3:c.1336C>G, XM_005256525.1:c.1336C>G, XM_005256526.1:c.766C>G, XM_011523730.1:c.766C>G, XM_011523731.1:c.766C>G, XP_005256579.1:p.Pro446Ala, XP_005256580.1:p.Pro446Ala, XP_005256581.1:p.Pro446Ala, XP_005256582.1:p.Pro446Ala, XP_005256583.1:p.Pro256Ala, XP_011522032.1:p.Pro256Ala, XP_011522033.1:p.Pro256Ala, rs3744696, rs56956419
G > C
No VIP available CA VA
rs2228171 NC_000002.11:g.170053505C>T, NC_000002.12:g.169196995C>T, NG_012634.1:g.170618G>A, NM_004525.2:c.8614G>A, NP_004516.2:p.Ala2872Thr, XM_005246551.1:c.6325G>A, XM_005246552.1:c.8614G>A, XM_011511183.1:c.8614G>A, XM_011511184.1:c.6325G>A, XM_011511185.1:c.8614G>A, XP_005246608.1:p.Ala2109Thr, XP_005246609.1:p.Ala2872Thr, XP_011509485.1:p.Ala2872Thr, XP_011509486.1:p.Ala2109Thr, XP_011509487.1:p.Ala2872Thr, rs117432666, rs17848174, rs2302697, rs4668123, rs52816657, rs57579868
C > T
No VIP available CA VA
rs2229774 NC_000012.11:g.53605545G>A, NC_000012.12:g.53211761G>A, NG_029822.1:g.25496C>T, NM_000966.5:c.1280C>T, NM_001042728.2:c.1247C>T, NM_001243730.1:c.1064C>T, NM_001243731.1:c.917C>T, NM_001243732.1:c.1214C>T, NP_000957.1:p.Ser427Leu, NP_001036193.1:p.Ser416Leu, NP_001230659.1:p.Ser355Leu, NP_001230660.1:p.Ser306Leu, NP_001230661.1:p.Ser405Leu, XM_005269054.1:c.1541C>T, XM_005269054.2:c.1541C>T, XM_005269055.1:c.1541C>T, XM_005269055.2:c.1541C>T, XM_005269056.1:c.1280C>T, XM_005269056.2:c.1280C>T, XM_005269057.1:c.1280C>T, XM_011538628.1:c.1064C>T, XP_005269111.1:p.Ser514Leu, XP_005269112.1:p.Ser514Leu, XP_005269113.1:p.Ser427Leu, XP_005269114.1:p.Ser427Leu, XP_011536930.1:p.Ser355Leu, rs116930311, rs61642612
G > A
No VIP available CA VA
rs2231142 NC_000004.11:g.89052323G>T, NC_000004.12:g.88131171G>T, NG_032067.2:g.105152C>A, NM_001257386.1:c.421C>A, NM_004827.2:c.421C>A, NP_001244315.1:p.Gln141Lys, NP_004818.2:p.Gln141Lys, XM_005263354.1:c.421C>A, XM_005263354.2:c.421C>A, XM_005263355.1:c.421C>A, XM_005263355.2:c.421C>A, XM_005263356.1:c.421C>A, XM_005263356.2:c.421C>A, XM_011532420.1:c.421C>A, XP_005263411.1:p.Gln141Lys, XP_005263412.1:p.Gln141Lys, XP_005263413.1:p.Gln141Lys, XP_011530722.1:p.Gln141Lys, rs12721641, rs28365035, rs3736117, rs52809243, rs58973676
G > T
No VIP available No Clinical Annotations available VA
rs2232228 NC_000016.10:g.69109674A>G, NC_000016.9:g.69143577A>G, NM_001199280.1:c.279A>G, NM_005329.2:c.279A>G, NM_138612.2:c.279A>G, NP_001186209.1:p.Ala93=, NP_005320.2:p.Ala93=, NP_619515.1:p.Ala93=, XM_005255919.1:c.687A>G, XM_005255920.1:c.279A>G, XM_005255921.1:c.279A>G, XM_011523061.1:c.279A>G, XP_005255976.1:p.Ala229=, XP_005255977.1:p.Ala93=, XP_005255978.1:p.Ala93=, XP_011521363.1:p.Ala93=, rs17845662, rs17858598, rs3743679, rs61175697
A > G
No VIP available No Clinical Annotations available VA
rs2233302 NC_000005.10:g.151035537C>G, NC_000005.9:g.150415098C>G, NG_030590.1:g.57124G>C, NM_001252385.1:c.1521+45G>C, NM_001252386.1:c.1362+45G>C, NM_001252390.1:c.1521+45G>C, NM_001252391.1:c.1521+45G>C, NM_001252392.1:c.1521+45G>C, NM_001252393.1:c.1521+45G>C, NM_001258454.1:c.1521+45G>C, NM_001258455.1:c.1521+45G>C, NM_001258456.1:c.1521+45G>C, NM_006058.4:c.1521+45G>C, XM_005268355.1:c.1521+45G>C, XM_006714751.1:c.1521+45G>C, XM_006714752.1:c.1521+45G>C, XM_011537538.1:c.1521+45G>C
C > A
C > G
No VIP available CA No Variant Annotations available
rs2234693 NC_000006.11:g.152163335T>C, NC_000006.12:g.151842200T>C, NG_008493.1:g.156705T>C, NM_000125.3:c.453-397T>C, NM_001122740.1:c.453-397T>C, NM_001122741.1:c.453-397T>C, NM_001122742.1:c.453-397T>C, NM_001291230.1:c.453-397T>C, NM_001291241.1:c.453-397T>C, XM_005266856.1:c.453-397T>C, XM_005266857.1:c.453-397T>C, XM_006715374.2:c.453-397T>C, XM_006715375.2:c.-67-397T>C, XM_011535543.1:c.453-397T>C, XM_011535544.1:c.453-397T>C, XM_011535545.1:c.453-397T>C, XM_011535546.1:c.453-397T>C, XM_011535547.1:c.453-397T>C, XM_011535548.1:c.-67-397T>C, rs4134641, rs60769286
T > C
No VIP available CA VA
rs2235047 NC_000007.13:g.87138532A>C, NC_000007.14:g.87509216A>C, NG_011513.1:g.209033T>G, NM_000927.4:c.3489+59T>G, rs386562025, rs56488245, rs57169649, rs58701659
A > C
No VIP available No Clinical Annotations available VA
rs2236168 NC_000002.11:g.31607128T>C, NC_000002.12:g.31384262T>C, NG_008871.1:g.35484A>G, NM_000379.3:c.794-415A>G, XM_011533095.1:c.794-415A>G, XM_011533096.1:c.794-415A>G, rs4325801, rs56579209, rs59694787
T > C
No VIP available No Clinical Annotations available VA
rs2239393 NC_000022.10:g.19950428A>G, NC_000022.11:g.19962905A>G, NG_011526.1:g.26166A>G, NM_000754.3:c.289+90A>G, NM_001135161.1:c.289+90A>G, NM_001135162.1:c.289+90A>G, NM_007310.2:c.139+90A>G, NR_039918.1:n.-848A>G, XM_005261229.1:c.289+90A>G, XM_011529885.1:c.403+90A>G, XM_011529886.1:c.403+90A>G, XM_011529887.1:c.289+90A>G, XM_011529888.1:c.289+90A>G, XM_011529889.1:c.289+90A>G, XM_011529890.1:c.289+90A>G, XM_011529891.1:c.289+90A>G, rs58361251
A > G
No VIP available No Clinical Annotations available VA
rs2273697 NC_000010.10:g.101563815G>A, NC_000010.11:g.99804058G>A, NG_011798.1:g.26353G>A, NM_000392.4:c.1249G>A, NP_000383.1:p.Val417Ile, XM_005269536.1:c.1249G>A, XM_006717630.2:c.553G>A, XM_006717631.2:c.1249G>A, XM_011539291.1:c.1249G>A, XP_005269593.1:p.Val417Ile, XP_006717693.1:p.Val185Ile, XP_006717694.1:p.Val417Ile, XP_011537593.1:p.Val417Ile, XR_945604.1:n.1438G>A, XR_945605.1:n.1440G>A, rs17216184, rs60620335
G > A
No VIP available No Clinical Annotations available VA
rs2290271 NC_000015.10:g.84904404A>C, NC_000015.9:g.85447635A>C, NM_001287761.1:c.603+166A>C, NM_001287762.1:c.603+166A>C, NM_004213.4:c.603+166A>C, XM_005254988.1:c.603+166A>C, XM_005254989.1:c.603+166A>C, XM_005254990.1:c.603+166A>C, XM_005254991.1:c.603+166A>C, XM_005254992.1:c.576+166A>C, XM_005254993.1:c.603+166A>C, XM_005254994.1:c.369+166A>C, XM_005254995.1:c.603+166A>C, XM_011522203.1:c.603+166A>C, XM_011522204.1:c.603+166A>C, XM_011522205.1:c.603+166A>C, XM_011522206.1:c.603+166A>C, XM_011522207.1:c.603+166A>C, XM_011522208.1:c.576+166A>C, XM_011522209.1:c.603+166A>C, XM_011522210.1:c.603+166A>C, XM_011522211.1:c.369+166A>C, XM_011522212.1:c.603+166A>C, XM_011522213.1:c.603+166A>C, XM_011522214.1:c.603+166A>C, XM_011522215.1:c.603+166A>C, XM_011522216.1:c.369+166A>C, XM_011522217.1:c.603+166A>C, XM_011522218.1:c.603+166A>C, XR_931944.1:n.809+166A>C, XR_931945.1:n.809+166A>C, rs17608700, rs56963765
A > C
No VIP available CA VA
rs2291767 NC_000002.11:g.241080132T>C, NC_000002.12:g.240140715T>C, NM_148961.3:c.-214A>G
T > C
No VIP available No Clinical Annotations available VA
rs2293348 NC_000007.13:g.55266757C>T, NC_000007.14:g.55199064C>T, NG_007726.3:g.185033C>T, NM_005228.3:c.2848+201C>T, XM_005271746.1:c.2713+201C>T, XM_005271747.1:c.2689+201C>T, rs17337409, rs386564010, rs56649022, rs57162744
C > T
No VIP available No Clinical Annotations available VA
rs2294950 NC_000001.10:g.60314496T>G, NC_000001.11:g.59848824T>G, NM_015888.4:c.1132-249T>G, XM_005270922.1:c.1132-249T>G, XM_006710676.1:c.1132-249T>G, XM_011541562.1:c.1006-249T>G, XM_011541563.1:c.1132-249T>G, XR_246271.1:n.1328-249T>G, XR_246272.1:n.1328-249T>G, XR_946665.1:n.1328-249T>G
T > G
No VIP available CA VA
rs2297480 NC_000001.10:g.155279482T>G, NC_000001.11:g.155309691T>G, NG_045218.1:g.5944T>G, NM_001135821.1:c.-1-98T>G, NM_001135822.1:c.-1-373T>G, NM_001242824.1:c.-22-352T>G, NM_001242825.1:c.-175+726T>G, NM_002004.3:c.-1-98T>G, XM_005244962.1:c.-1-373T>G, XM_005244963.1:c.-22-352T>G, XM_005245266.1:c.-1000A>C, XM_005245266.3:c.-1000A>C, XM_011509639.1:c.-1000A>C, rs59477014
T > G
No VIP available CA VA
rs2297595 NC_000001.10:g.98165091T>C, NC_000001.11:g.97699535T>C, NG_008807.2:g.226525A>G, NM_000110.3:c.496A>G, NP_000101.2:p.Met166Val, XM_005270561.1:c.385A>G, XM_005270562.1:c.496A>G, XM_005270562.3:c.496A>G, XM_005270563.1:c.496A>G, XM_005270564.1:c.496A>G, XM_006710397.2:c.496A>G, XP_005270618.1:p.Met129Val, XP_005270619.1:p.Met166Val, XP_005270619.2:p.Met166Val, XP_005270620.1:p.Met166Val, XP_005270621.1:p.Met166Val, XP_006710460.1:p.Met166Val, rs118014431, rs199469517, rs52827192, rs61243782
T > C
No VIP available CA VA
rs2305364 NC_000015.10:g.84909044T>C, NC_000015.9:g.85452275T>C, NM_001287761.1:c.795+249T>C, NM_001287762.1:c.795+249T>C, NM_004213.4:c.795+249T>C, XM_005254988.1:c.795+249T>C, XM_005254989.1:c.795+249T>C, XM_005254990.1:c.795+249T>C, XM_005254991.1:c.795+249T>C, XM_005254992.1:c.768+249T>C, XM_005254993.1:c.717+3392T>C, XM_005254994.1:c.561+249T>C, XM_005254995.1:c.795+249T>C, XM_011522203.1:c.795+249T>C, XM_011522204.1:c.795+249T>C, XM_011522205.1:c.795+249T>C, XM_011522206.1:c.795+249T>C, XM_011522207.1:c.795+249T>C, XM_011522208.1:c.768+249T>C, XM_011522209.1:c.717+3392T>C, XM_011522210.1:c.795+249T>C, XM_011522211.1:c.561+249T>C, XM_011522212.1:c.795+249T>C, XM_011522213.1:c.795+249T>C, XM_011522214.1:c.795+249T>C, XM_011522215.1:c.795+249T>C, XM_011522216.1:c.561+249T>C, XM_011522217.1:c.795+249T>C, XM_011522218.1:c.795+249T>C, XR_931944.1:n.1001+249T>C, XR_931945.1:n.1001+249T>C
T > C
No VIP available CA VA
rs2306283 NC_000012.11:g.21329738A>G, NC_000012.12:g.21176804A>G, NG_011745.1:g.50611A>G, NM_006446.4:c.388A>G, NP_006437.3:p.Asn130Asp, rs17389242, rs52832430, rs60767041
A > G
No VIP available No Clinical Annotations available VA
rs2473967 NC_000006.11:g.113479335G>T, NC_000006.12:g.113158133G>T, rs74295796
G > T
No VIP available CA No Variant Annotations available
rs25487 NC_000019.10:g.43551574T>C, NC_000019.9:g.44055726T>C, NG_033799.1:g.29005A>G, NM_006297.2:c.1196A>G, NP_006288.2:p.Gln399Arg, rs11553658, rs17435395, rs3817410, rs386493716, rs57378728
T > C
No VIP available No Clinical Annotations available VA
rs25489 NC_000019.10:g.43552260C>T, NC_000019.9:g.44056412C>T, NG_033799.1:g.28319G>A, NM_006297.2:c.839G>A, NP_006288.2:p.Arg280His, rs17435388, rs2229675, rs2307183
C > T
No VIP available No Clinical Annotations available VA
rs2600834 NC_000005.10:g.102269937T>C, NC_000005.9:g.101605641T>C, NM_180991.4:c.802+687A>G, XM_011543370.1:c.538+687A>G, XM_011543371.1:c.454+687A>G, XM_011543372.1:c.388+687A>G, rs10395200, rs58191158
T > C
No VIP available CA No Variant Annotations available
rs2612091 NC_000018.10:g.683607C>T, NC_000018.9:g.683607C>T, NM_001126123.3:c.496-227G>A, NM_001318759.1:c.742-227G>A, NM_001318760.1:c.199-227G>A, NM_017512.5:c.742-227G>A, NM_202758.3:c.805-227G>A, XM_005258111.1:c.886-227G>A, XM_005258112.1:c.661-227G>A, XM_005258113.1:c.658-227G>A, XM_005258114.1:c.514-227G>A, XM_005258115.1:c.496-227G>A, XM_005258116.1:c.496-227G>A, XM_005258117.1:c.310-227G>A, XM_005258118.1:c.199-227G>A, XM_005258118.2:c.199-227G>A, XM_005258120.1:c.157-227G>A, XM_011525677.1:c.769-212G>A, XM_011525678.1:c.760-212G>A, XM_011525679.1:c.769-227G>A, XM_011525680.1:c.742-212G>A, XM_011525681.1:c.730-212G>A, XM_011525682.1:c.703-212G>A, XM_011525683.1:c.580-212G>A, XM_011525684.1:c.553-212G>A, XM_011525685.1:c.541-212G>A, XM_011525686.1:c.517-212G>A, XM_011525687.1:c.514-227G>A, XM_011525688.1:c.496-212G>A, XM_011525689.1:c.364-212G>A, XM_011525690.1:c.364-212G>A, XM_011525691.1:c.310-212G>A, XM_011525692.1:c.310-212G>A, XM_011525693.1:c.310-212G>A, XM_011525694.1:c.310-227G>A, XM_011525695.1:c.271-212G>A, XM_011525696.1:c.199-212G>A, XM_011525697.1:c.157-212G>A, XM_011525698.1:c.157-212G>A, XM_011525699.1:c.157-212G>A, XR_243810.1:n.937-227G>A, XR_243810.3:n.778-227G>A, XR_243811.1:n.803-227G>A, XR_243811.2:n.803-227G>A, XR_243812.1:n.938-227G>A, XR_430041.2:n.940-227G>A, XR_935066.1:n.778-212G>A, XR_935067.1:n.778-212G>A, rs61671949
C > T
No VIP available No Clinical Annotations available VA
rs2622604 NC_000004.11:g.89078924T>C, NC_000004.12:g.88157772T>C, NG_032067.2:g.78551A>G, NM_001257386.1:c.-19-17758A>G, NM_004827.2:c.-20+614A>G, XM_005263354.1:c.-20+805A>G, XM_005263354.2:c.-20+805A>G, XM_005263355.1:c.-19-17758A>G, XM_005263355.2:c.-19-17758A>G, XM_005263356.1:c.-20+614A>G, XM_005263356.2:c.-20+614A>G, XM_011532420.1:c.-19-17758A>G, rs61481684
T > A
T > C
No VIP available No Clinical Annotations available VA
rs2669429 NC_000008.10:g.105463690A>G, NC_000008.11:g.104451462A>G, NG_008840.1:g.20588T>C, NM_001385.2:c.265-58T>C, XM_005250818.1:c.265-58T>C, XM_005250818.2:c.265-58T>C, XM_005250819.1:c.265-58T>C, XM_006716518.2:c.265-3959T>C, XM_011516903.1:c.265-58T>C, XM_011516904.1:c.265-58T>C, rs17246278, rs199469604, rs3750186, rs60334774
A > G
No VIP available CA VA
rs2740574 NC_000007.13:g.99382096C>T, NC_000007.14:g.99784473C>T, NG_008421.1:g.4713G>A, NM_001202855.2:c.-392G>A, NM_017460.5:c.-392G>A, XM_011515841.1:c.-392G>A, XM_011515842.1:c.-392G>A, rs3176920, rs36231114, rs59393892
C > T
No VIP available No Clinical Annotations available VA
rs2804402 NC_000010.10:g.101541583A>G, NC_000010.11:g.99781826A>G, NG_011798.1:g.4121A>G, NM_000392.4:c.-1019A>G, XM_005269536.1:c.-1019A>G, XM_006717631.2:c.-1019A>G, XM_011539291.1:c.-1019A>G, XR_945604.1:n.-830A>G, XR_945605.1:n.-828A>G, rs17222526, rs60149027
A > G
No VIP available No Clinical Annotations available VA
T > C
No VIP available No Clinical Annotations available VA
rs2884129 NC_000010.10:g.17585149T>G, NC_000010.11:g.17543150T>G
T > G
No VIP available No Clinical Annotations available VA
rs2959023 NC_000008.10:g.105479149A>G, NC_000008.11:g.104466921A>G, NG_008840.1:g.5129T>C, NM_001385.2:c.-1T>C, XM_005250818.1:c.-1T>C, XM_005250818.2:c.-1T>C, XM_005250819.1:c.-1T>C, XM_006716518.2:c.-1T>C, XM_011516903.1:c.-1T>C, XM_011516904.1:c.-1T>C, XR_928507.1:n.112+934A>G, rs199469597, rs58165447
A > G
No VIP available CA VA
rs316019 NC_000006.11:g.160670282A>C, NC_000006.12:g.160249250A>C, NM_003058.3:c.808T>G, NP_003049.2:p.Ser270Ala, rs1755917, rs17846267, rs17859289, rs386580336, rs52803175, rs60007366, rs666224
A > C
No VIP available CA VA
rs3212986 NC_000019.10:g.45409478C>A, NC_000019.9:g.45912736C>A, NG_015839.2:g.74351G>T, NM_001166049.1:c.*197G>T, NM_001297590.1:c.1516C>A, NM_001983.3:c.*197G>T, NM_012099.1:c.1510C>A, NP_001284519.1:p.Gln506Lys, NP_036231.1:p.Gln504Lys, XM_005258425.1:c.1516C>A, XM_005258638.1:c.*197G>T, XP_005258482.1:p.Gln506Lys, rs386580934, rs60333438
C > A
C > T
No VIP available CA VA
rs3215400 NC_000001.10:g.20915590delC, NC_000001.11:g.20589097delC, NM_001785.2:c.-33delC, rs139923988, rs35386716, rs373015145, rs373391994, rs57426563, rs71752362
C > -
No VIP available CA VA
rs35599367 NC_000007.13:g.99366316G>A, NC_000007.14:g.99768693G>A, NG_008421.1:g.20493C>T, NM_001202855.2:c.522-191C>T, NM_017460.5:c.522-191C>T, XM_011515841.1:c.522-191C>T, XM_011515842.1:c.522-191C>T, rs45581939, rs62471940
G > A
No VIP available No Clinical Annotations available VA
T > C
No VIP available No Clinical Annotations available VA
rs3730089 NC_000005.10:g.68292320G>A, NC_000005.9:g.67588148G>A, NG_012849.2:g.81565G>A, NM_001242466.1:c.-480G>A, NM_181504.3:c.168G>A, NM_181523.1:c.978G>A, NM_181523.2:c.978G>A, NM_181524.1:c.78G>A, NP_852556.2:p.Met56Ile, NP_852664.1:p.Met326Ile, NP_852665.1:p.Met26Ile, XM_005248542.1:c.978G>A, XM_005248542.2:c.978G>A, XM_011543493.1:c.651G>A, XP_005248599.1:p.Met326Ile, XP_011541795.1:p.Met217Ile, rs17847316, rs386584794, rs52830014
G > A
No VIP available No Clinical Annotations available VA
rs3740066 NC_000010.10:g.101604207C>T, NC_000010.11:g.99844450C>T, NG_011798.1:g.66745C>T, NM_000392.4:c.3972C>T, NP_000383.1:p.Ile1324=, XM_005269536.1:c.3693C>T, XM_006717630.2:c.3276C>T, XP_005269593.1:p.Ile1231=, XP_006717693.1:p.Ile1092=, XR_945604.1:n.4161C>T, XR_945605.1:n.4036C>T, rs12780340, rs17216303, rs59292214
C > T
No VIP available CA VA
rs3750117 NC_000007.13:g.33060946A>G, NC_000007.14:g.33021334A>G, NG_015800.1:g.46464T>C, NM_001002009.2:c.276T>C, NM_001002010.2:c.393T>C, NM_001166118.2:c.240T>C, NM_016489.12:c.276T>C, NP_001002009.1:p.Tyr92=, NP_001002010.1:p.Tyr131=, NP_001159590.1:p.Tyr80=, NP_057573.2:p.Tyr92=, XM_011515409.1:c.240T>C, XP_011513711.1:p.Tyr80=, rs11547832, rs17851350, rs57965368
A > G
No VIP available No Clinical Annotations available VA
rs3755319 NC_000002.11:g.234667582A=, NC_000002.11:g.234667582A>C, NC_000002.12:g.233758936A=, NC_000002.12:g.233758936A>C, NG_002601.2:g.174193A=, NG_002601.2:g.174193A>C, NG_033238.1:g.3664A=, NG_033238.1:g.3664A>C, NM_000463.2:c.-1352A=, NM_000463.2:c.-1352A>C, NM_001072.3:c.862-8098A=, NM_001072.3:c.862-8098A>C, NM_007120.2:c.868-8098A=, NM_007120.2:c.868-8098A>C, NM_019075.2:c.856-8098A=, NM_019075.2:c.856-8098A>C, NM_019076.4:c.856-8098A=, NM_019076.4:c.856-8098A>C, NM_019077.2:c.856-8098A=, NM_019077.2:c.856-8098A>C, NM_019078.1:c.868-8098A=, NM_019078.1:c.868-8098A>C, NM_019093.2:c.868-8098A=, NM_019093.2:c.868-8098A>C, NM_021027.2:c.856-8098A=, NM_021027.2:c.856-8098A>C, NM_205862.1:c.61-8098A=, NM_205862.1:c.61-8098A>C, XR_241238.1:n.924-8098A=, XR_241238.1:n.924-8098A>C, XR_241239.1:n.-1330A=, XR_241239.1:n.-1330A>C, XR_241240.1:n.1023-8098A=, XR_241240.1:n.1023-8098A>C, XR_241241.1:n.942-8098A=, XR_241241.1:n.942-8098A>C, rs35208194, rs36208045, rs57256426
A > C
No VIP available No Clinical Annotations available VA
rs3760091 NC_000016.10:g.28609479C>G, NC_000016.9:g.28620800C>G, NG_028128.1:g.19067G>C, NM_001055.3:c.-5+452G>C, NM_001310136.1:c.121-142577G>C, NM_177529.2:c.-36+452G>C, NM_177530.2:c.-425G>C, NM_177534.2:c.-624G>C, NM_177536.3:c.139-2402G>C, XM_005255522.1:c.-5+452G>C, rs117385979, rs60448308
C > G
C > T
No VIP available No Clinical Annotations available VA
rs3813627 NC_000001.10:g.161195148G>T, NC_000001.11:g.161225358G>T, NG_012043.1:g.3271C>A, NM_001286373.1:c.-914G>T, NM_001286374.1:c.-914G>T, NM_001643.1:c.-1788C>A, NM_032174.5:c.-914G>T, NR_049819.1:n.-1828G>T, XM_005245536.1:c.-814G>T, XM_005245537.1:c.-914G>T, XM_005245538.1:c.-1005G>T, XM_006711572.1:c.-793G>T, XM_011510057.1:c.-793G>T
G > T
No VIP available No Clinical Annotations available VA
rs3813628 NC_000001.10:g.161196166A>C, NC_000001.11:g.161226376A>C, NG_012043.1:g.2253T>G, NM_001286373.1:c.-114A>C, NM_001286374.1:c.-114A>C, NM_032174.5:c.-114A>C, NR_049819.1:n.-810A>C, XM_005245536.1:c.-35-79A>C, XM_005245537.1:c.-114A>C, XM_005245538.1:c.-205A>C, XM_006711572.1:c.-14-100A>C, XM_011510057.1:c.-14-100A>C, rs57851595
A > C
No VIP available No Clinical Annotations available VA
rs3887137 NC_000009.11:g.107698612C>T, NC_000009.12:g.104936331C>T, XR_930204.1:n.952-2421C>T, rs57670930
C > T
No VIP available CA VA
rs3918290 NC_000001.10:g.97915614C>T, NC_000001.11:g.97450058C>T, NG_008807.2:g.476002G>A, NM_000110.3:c.1905+1G>A, XM_005270561.1:c.1794+1G>A, XM_005270562.1:c.1689+1G>A, XM_005270562.3:c.1689+1G>A, XM_005270563.1:c.1905+1G>A, XM_006710397.2:c.1905+1G>A, rs199469548, rs386589337
C > G
C > T
No VIP available No Clinical Annotations available VA
rs3918305 NC_000012.11:g.109331162C>T, NC_000012.12:g.108937386C>T, NM_018711.4:c.898-49G>A, rs59527033
C > T
No VIP available CA VA
rs4124874 NC_000002.11:g.234665659T>G, NC_000002.12:g.233757013T>G, NG_002601.2:g.172270T>G, NG_033238.1:g.1741T>G, NM_001072.3:c.862-10021T>G, NM_007120.2:c.868-10021T>G, NM_019075.2:c.856-10021T>G, NM_019076.4:c.856-10021T>G, NM_019077.2:c.856-10021T>G, NM_019078.1:c.868-10021T>G, NM_019093.2:c.868-10021T>G, NM_021027.2:c.856-10021T>G, NM_205862.1:c.61-10021T>G, NR_037694.1:n.-1668A>C, NR_037695.1:n.-1668A>C, NR_037696.1:n.-1668A>C, XR_241238.1:n.924-10021T>G, XR_241240.1:n.1023-10021T>G, XR_241241.1:n.942-10021T>G, rs57409706
T > G
No VIP available CA VA
rs4148323 NC_000002.11:g.234669144G>A, NC_000002.12:g.233760498G>A, NG_002601.2:g.175755G>A, NG_033238.1:g.5226G>A, NM_000463.2:c.211G>A, NM_001072.3:c.862-6536G>A, NM_007120.2:c.868-6536G>A, NM_019075.2:c.856-6536G>A, NM_019076.4:c.856-6536G>A, NM_019077.2:c.856-6536G>A, NM_019078.1:c.868-6536G>A, NM_019093.2:c.868-6536G>A, NM_021027.2:c.856-6536G>A, NM_205862.1:c.61-6536G>A, NP_000454.1:p.Gly71Arg, XR_241238.1:n.924-6536G>A, XR_241239.1:n.233G>A, XR_241240.1:n.1023-6536G>A, XR_241241.1:n.942-6536G>A, rs113525835, rs34360183, rs58105808, rs58585123
G > A
No VIP available CA VA
rs4148350 NC_000016.10:g.16076620G>T, NC_000016.9:g.16170477G>T, NG_028268.1:g.132044G>T, NM_004996.3:c.1988+219G>T, NT_187607.1:g.1734472G>T, XM_005255326.1:c.1988+219G>T, XM_005255327.1:c.1862+219G>T, XM_005255328.1:c.1850+219G>T, XM_005255329.1:c.1988+219G>T, XM_011522497.1:c.1964+219G>T, XM_011522498.1:c.1895+219G>T, rs587779726, rs60127316
G > T
No VIP available CA VA
rs4148808 NC_000007.13:g.87105795T>C, NC_000007.14:g.87476479T>C, NG_007118.1:g.8954A>G, NM_000443.3:c.-852A>G, NM_018849.2:c.-852A>G, NM_018850.2:c.-852A>G, XM_011516308.1:c.-715A>G, XM_011516309.1:c.-715A>G, XM_011516310.1:c.-715A>G, XM_011516311.1:c.-715A>G, XM_011516312.1:c.-715A>G, XM_011516313.1:c.-715A>G, XM_011516314.1:c.-332A>G, XR_927478.1:n.-619A>G, rs386591494, rs59666582
T > C
No VIP available CA VA
rs4149056 NC_000012.11:g.21331549T>C, NC_000012.12:g.21178615T>C, NG_011745.1:g.52422T>C, NM_006446.4:c.521T>C, NP_006437.3:p.Val174Ala, rs52816141, rs60037639
T > C
No VIP available No Clinical Annotations available VA
rs4149117 NC_000012.11:g.21011480T>G, NC_000012.12:g.20858546T>G, NG_032071.1:g.52843T>G, NM_019844.3:c.334T>G, NP_062818.1:p.Ser112Ala, XM_005253347.1:c.334T>G, XP_005253404.1:p.Ser112Ala, rs52800447, rs58702833
T > G
No VIP available No Clinical Annotations available VA
rs4149178 NC_000006.11:g.43272188A>G, NC_000006.12:g.43304450A>G, NM_006672.3:c.1586+206A>G, NM_153320.2:c.1592+206A>G, XM_005248823.1:c.1199+206A>G, XM_006714970.2:c.1601+206A>G, XM_006714971.2:c.1595+206A>G, XM_011514256.1:c.1778+206A>G, XM_011514257.1:c.1769+206A>G, XM_011514258.1:c.1676+206A>G, XM_011514260.1:c.1544+206A>G, XM_011514261.1:c.1208+206A>G, XM_011514263.1:c.1004+206A>G, XM_011514607.1:c.495+1769T>C, XM_011514608.1:c.495+1769T>C
A > G
No VIP available No Clinical Annotations available VA
rs42524 NC_000007.13:g.94043239C>G, NC_000007.14:g.94413927C>G, NG_007405.1:g.24367C>G, NM_000089.3:c.1645C>G, NP_000080.2:p.Pro549Ala, rs10383941, rs1136007, rs17857444, rs59646360
C > G
No VIP available CA VA
rs4261716 NC_000002.11:g.234593117G>T, NC_000002.12:g.233684471G>T, NG_002601.2:g.99728G>T, NM_019075.2:c.855+47094G>T, NM_019076.4:c.855+65909G>T, NM_019077.2:c.855+1679G>T, NM_021027.2:c.855+11682G>T, XM_005246081.1:c.855+1679G>T, XR_241241.1:n.941+11682G>T, rs17683792, rs58252906
G > T
No VIP available No Clinical Annotations available VA
rs4407290 NC_000002.11:g.31606670G>A, NC_000002.12:g.31383804G>A, NG_008871.1:g.35942C>T, NM_000379.3:c.837C>T, NP_000370.2:p.Val279=, XM_011533095.1:c.837C>T, XM_011533096.1:c.837C>T, XP_011531397.1:p.Val279=, XP_011531398.1:p.Val279=, rs17544440, rs57766493
G > A
No VIP available CA VA
rs45445694 NC_000018.10:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NC_000018.9:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NG_028255.1:g.5043_5070CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NM_001012716.2:c.*34+169_*34+196CGGGACGGAGGCAGGCCAAGTGGCGCGG[2][3][4][7][8][9], NM_001071.2:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258137.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258138.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], rs34743033 (retired)
No VIP available No Clinical Annotations available VA
rs45589337 NC_000001.10:g.98144726T>C, NC_000001.11:g.97679170T>C, NG_008807.2:g.246890A>G, NM_000110.3:c.775A>G, NP_000101.2:p.Lys259Glu, XM_005270561.1:c.664A>G, XM_005270562.1:c.775A>G, XM_005270562.3:c.775A>G, XM_005270563.1:c.775A>G, XM_005270564.1:c.775A>G, XM_006710397.2:c.775A>G, XP_005270618.1:p.Lys222Glu, XP_005270619.1:p.Lys259Glu, XP_005270619.2:p.Lys259Glu, XP_005270620.1:p.Lys259Glu, XP_005270621.1:p.Lys259Glu, XP_006710460.1:p.Lys259Glu, rs59034382
T > C
No VIP available CA VA
rs4646316 NC_000022.10:g.19952132C>T, NC_000022.11:g.19964609C>T, NG_011526.1:g.27870C>T, NM_000754.3:c.615+310C>T, NM_001135161.1:c.615+310C>T, NM_001135162.1:c.615+310C>T, NM_007310.2:c.465+310C>T, XM_005261229.1:c.615+310C>T, XM_011529885.1:c.729+310C>T, XM_011529886.1:c.729+310C>T, XM_011529887.1:c.615+310C>T, XM_011529888.1:c.615+310C>T, XM_011529889.1:c.615+310C>T, XM_011529890.1:c.615+310C>T, XM_011529891.1:c.615+310C>T, rs58510682
C > T
No VIP available CA VA
rs4655226 NC_000001.10:g.20928284C>T, NC_000001.11:g.20601791C>T, NM_001785.2:c.155-3137C>T
C > T
No VIP available CA No Variant Annotations available
rs4673 NC_000016.10:g.88646828A>G, NC_000016.9:g.88713236A>G, NG_007291.1:g.9222T>C, NM_000101.2:c.214T>C, NM_000101.3:c.214T>C, NP_000092.2:p.Tyr72His, XM_011522905.1:c.214T>C, XP_011521207.1:p.Tyr72His, rs11266997, rs1130413, rs2228471, rs2242272, rs3189211, rs386594564, rs4782392, rs59455247
A > G
No VIP available No Clinical Annotations available VA
rs4680 NC_000022.10:g.19951271G>A, NC_000022.11:g.19963748G>A, NG_011526.1:g.27009G>A, NM_000754.3:c.472G>A, NM_001135161.1:c.472G>A, NM_001135162.1:c.472G>A, NM_007310.2:c.322G>A, NP_000745.1:p.Val158Met, NP_001128633.1:p.Val158Met, NP_001128634.1:p.Val158Met, NP_009294.1:p.Val108Met, NR_039918.1:n.-5G>A, XM_005261229.1:c.472G>A, XM_011529885.1:c.586G>A, XM_011529886.1:c.586G>A, XM_011529887.1:c.472G>A, XM_011529888.1:c.472G>A, XM_011529889.1:c.472G>A, XM_011529890.1:c.472G>A, XM_011529891.1:c.472G>A, XP_005261286.1:p.Val158Met, XP_011528187.1:p.Val196Met, XP_011528188.1:p.Val196Met, XP_011528189.1:p.Val158Met, XP_011528190.1:p.Val158Met, XP_011528191.1:p.Val158Met, XP_011528192.1:p.Val158Met, XP_011528193.1:p.Val158Met, rs1131157, rs11544671, rs165688, rs17295216, rs17349704, rs17818178, rs17849308, rs17850006, rs2070104, rs3177905, rs3190784, rs3747070, rs58002978
G > A
No VIP available No Clinical Annotations available VA
rs4715354 NC_000006.11:g.52708797G>A, NC_000006.12:g.52843999G>A, NM_153699.1:c.-31+2057C>T, rs17268789, rs58826387
G > A
No VIP available No Clinical Annotations available VA
rs4818 NC_000022.10:g.19951207C>G, NC_000022.11:g.19963684C>G, NG_011526.1:g.26945C>G, NM_000754.3:c.408C>G, NM_001135161.1:c.408C>G, NM_001135162.1:c.408C>G, NM_007310.2:c.258C>G, NP_000745.1:p.Leu136=, NP_001128633.1:p.Leu136=, NP_001128634.1:p.Leu136=, NP_009294.1:p.Leu86=, NR_039918.1:n.-69C>G, XM_005261229.1:c.408C>G, XM_011529885.1:c.522C>G, XM_011529886.1:c.522C>G, XM_011529887.1:c.408C>G, XM_011529888.1:c.408C>G, XM_011529889.1:c.408C>G, XM_011529890.1:c.408C>G, XM_011529891.1:c.408C>G, XP_005261286.1:p.Leu136=, XP_011528187.1:p.Leu174=, XP_011528188.1:p.Leu174=, XP_011528189.1:p.Leu136=, XP_011528190.1:p.Leu136=, XP_011528191.1:p.Leu136=, XP_011528192.1:p.Leu136=, XP_011528193.1:p.Leu136=, rs117008153, rs17355478, rs17745510, rs17850822, rs2070103, rs3171583, rs3747069, rs57402237, rs712978
C > G
No VIP available No Clinical Annotations available VA
rs4834232 NC_000004.11:g.129024273C>T, NC_000004.12:g.128103118C>T, NM_001278604.1:c.814-4021C>T, NM_018078.3:c.814-4021C>T, NM_032239.3:c.814-4021C>T, NM_178043.2:c.814-4021C>T, XM_005263086.1:c.1417-4021C>T, XM_005263087.1:c.1417-4021C>T, XM_005263088.1:c.1417-4021C>T, XM_005263089.1:c.1273-4021C>T, XM_005263090.1:c.1417-4021C>T, XM_005263091.1:c.1417-4021C>T, XM_005263092.1:c.1417-4021C>T, XM_005263093.1:c.1417-4021C>T, XM_005263094.1:c.1417-4021C>T, XM_005263095.1:c.1417-4021C>T, XM_005263096.1:c.1417-4021C>T, XM_005263097.1:c.1417-4021C>T, XM_005263098.1:c.1417-4021C>T, XM_005263099.1:c.91-4021C>T, XM_005263100.1:c.91-4021C>T, XM_005263101.1:c.1417-4021C>T, XM_011532057.1:c.814-4021C>T, XM_011532058.1:c.814-4021C>T, XM_011532059.1:c.814-4021C>T, XM_011532060.1:c.814-4021C>T, XM_011532061.1:c.1276-4021C>T, XM_011532062.1:c.814-4021C>T, XM_011532063.1:c.814-4021C>T, XM_011532064.1:c.814-4021C>T, XM_011532065.1:c.1276-4021C>T, XM_011532066.1:c.814-4021C>T, XM_011532067.1:c.814-4021C>T, XM_011532068.1:c.673-4021C>T, XM_011532069.1:c.673-4021C>T, XM_011532070.1:c.814-4021C>T, XM_011532071.1:c.814-4021C>T, XM_011532072.1:c.814-4021C>T, XM_011532073.1:c.814-4021C>T, XM_011532074.1:c.814-4021C>T, XM_011532075.1:c.91-4021C>T, XM_011532076.1:c.91-4021C>T, XM_011532077.1:c.91-4021C>T, XM_011532078.1:c.814-4021C>T, XR_938753.1:n.891-4021C>T, XR_938754.1:n.891-4021C>T, XR_938755.1:n.891-4021C>T, XR_938756.1:n.891-4021C>T, XR_938757.1:n.891-4021C>T, XR_938758.1:n.891-4021C>T, XR_938759.1:n.891-4021C>T, XR_938760.1:n.891-4021C>T, XR_938761.1:n.891-4021C>T, XR_938762.1:n.891-4021C>T, rs17394472, rs59780448
C > T
No VIP available CA VA
rs4877847 NC_000009.11:g.86946417A>C, NC_000009.12:g.84331502A>C, NM_001199633.1:c.60+9072T>G, NM_022127.2:c.60+9072T>G, NR_037638.2:n.206+9072T>G, XM_011518905.1:c.60+9072T>G, XM_011518906.1:c.60+9072T>G, XM_011518907.1:c.-97-18048T>G, XM_011518909.1:c.60+9072T>G, XM_011518910.1:c.60+9072T>G, XR_929832.1:n.187+9072T>G
A > C
No VIP available No Clinical Annotations available VA
rs4982753 NC_000014.8:g.23814569C>T, NC_000014.9:g.23345360C>T, rs61203156
C > T
No VIP available CA VA
rs532545 NC_000001.10:g.20915172C>T, NC_000001.11:g.20588679C>T, NM_001785.2:c.-451C>T, rs2072669, rs386598350
C > T
No VIP available CA VA
rs55886062 NC_000001.10:g.97981343A>C, NC_000001.11:g.97515787A>C, NG_008807.2:g.410273T>G, NM_000110.3:c.1679T>G, NP_000101.2:p.Ile560Ser, XM_005270561.1:c.1568T>G, XM_005270562.1:c.1524+33773T>G, XM_005270562.3:c.1524+33773T>G, XM_005270563.1:c.1679T>G, XM_005270564.1:c.1679T>G, XM_006710397.2:c.1679T>G, XP_005270618.1:p.Ile523Ser, XP_005270620.1:p.Ile560Ser, XP_005270621.1:p.Ile560Ser, XP_006710460.1:p.Ile560Ser, rs199469542
A > C
No VIP available CA VA
rs56038477 NC_000001.10:g.98039419C>T, NC_000001.11:g.97573863C>T, NG_008807.2:g.352197G>A, NM_000110.3:c.1236G>A, NP_000101.2:p.Glu412=, XM_005270561.1:c.1125G>A, XM_005270562.1:c.1236G>A, XM_005270562.3:c.1236G>A, XM_005270563.1:c.1236G>A, XM_005270564.1:c.1236G>A, XM_006710397.2:c.1236G>A, XP_005270618.1:p.Glu375=, XP_005270619.1:p.Glu412=, XP_005270619.2:p.Glu412=, XP_005270620.1:p.Glu412=, XP_005270621.1:p.Glu412=, XP_006710460.1:p.Glu412=, rs199469533, rs61730901
C > T
No VIP available No Clinical Annotations available VA
C > T
No VIP available No Clinical Annotations available VA
A > G
No VIP available No Clinical Annotations available VA
rs5746849 NC_000022.10:g.19942997A>G, NC_000022.11:g.19955474A>G, NG_011526.1:g.18735A>G, NM_000754.3:c.-91-5725A>G, NM_001135161.1:c.-92+4422A>G, NM_001135162.1:c.-92+3820A>G, XM_005261229.1:c.-385-5725A>G, XM_011529887.1:c.-91-5725A>G, XM_011529888.1:c.-92+3820A>G, XM_011529889.1:c.-92+4422A>G, XM_011529890.1:c.-385-5725A>G, XM_011529891.1:c.-385-5725A>G, rs58299579
A > G
No VIP available CA VA
rs602950 NC_000001.10:g.20915531A>G, NC_000001.11:g.20589038A>G, NM_001785.2:c.-92A>G
A > G
No VIP available CA VA
rs60369023 NC_000001.10:g.20931474G>A, NC_000001.11:g.20604981G>A, NM_001785.2:c.208G>A, NP_001776.1:p.Ala70Thr
G > A
No VIP available No Clinical Annotations available VA
rs6151031 NC_000009.11:g.75568383_75568384insCTGGTGAGGAGAGAACC, NC_000009.12:g.72953467_72953468insCTGGTGAGGAGAGAACC, NG_012249.1:g.4586_4587insGGTTCTCTCCTCACCAG, NM_000689.4:c.-468_-467insGGTTCTCTCCTCACCAG, XM_005251800.1:c.-14-454_-14-453insGGTTCTCTCCTCACCAG, rs142856037
No VIP available No Clinical Annotations available VA
rs62298861 NC_000004.11:g.69963944A>G, NC_000004.12:g.69098226A>G, NM_001074.2:c.722-314A>G, XM_005265702.1:c.-26-314A>G, XM_005265702.2:c.-26-314A>G, XM_011532229.1:c.722-314A>G, XM_011532230.1:c.722-314A>G, XM_011532231.1:c.-26-314A>G
A > G
No VIP available No Clinical Annotations available VA
rs6269 NC_000022.10:g.19949952A>G, NC_000022.11:g.19962429A>G, NG_011526.1:g.25690A>G, NM_000754.3:c.1-98A>G, NM_001135161.1:c.1-98A>G, NM_001135162.1:c.1-98A>G, NM_007310.2:c.-248A>G, NR_039918.1:n.-1324A>G, XM_005261229.1:c.-98A>G, XM_011529885.1:c.115-98A>G, XM_011529886.1:c.115-98A>G, XM_011529887.1:c.1-98A>G, XM_011529888.1:c.1-98A>G, XM_011529889.1:c.1-98A>G, XM_011529890.1:c.-98A>G, XM_011529891.1:c.-98A>G, rs3827293
A > G
No VIP available CA VA
rs6431558 NC_000002.11:g.234529643C>T, NC_000002.12:g.233620997C>T, NG_002601.2:g.36254C>T, NM_019076.4:c.855+2435C>T, rs58319724
C > T
No VIP available CA No Variant Annotations available
rs662 NC_000007.13:g.94937446T>C, NC_000007.14:g.95308134T>C, NG_008779.1:g.21439A>G, NM_000446.5:c.575A>G, NP_000437.3:p.Gln192Arg, rs11567868, rs13306697, rs17773773, rs386603940, rs60480675
T > C
No VIP available No Clinical Annotations available VA
C > T
No VIP available No Clinical Annotations available VA
rs6721961 NC_000002.11:g.178130037T>G, NC_000002.12:g.177265309T>G, NM_001145412.3:c.-1910A>C, NM_001145413.3:c.-1910A>C, NM_001313900.1:c.-1784A>C, NM_001313901.1:c.-1876A>C, NM_001313902.1:c.-733A>C, NM_001313903.1:c.-733A>C, NM_001313904.1:c.-2091A>C, NM_006164.4:c.-733A>C, rs117801448
T > C
T > G
No VIP available CA VA
rs67376798 NC_000001.10:g.97547947T>A, NC_000001.11:g.97082391T>A, NG_008807.2:g.843669A>T, NM_000110.3:c.2846A>T, NP_000101.2:p.Asp949Val, XM_005270561.1:c.2735A>T, XM_005270562.1:c.2630A>T, XM_005270562.3:c.2630A>T, XP_005270618.1:p.Asp912Val, XP_005270619.1:p.Asp877Val, XP_005270619.2:p.Asp877Val, rs199469564, rs386467430, rs67376799
T > A
No VIP available CA VA
rs6755571 NC_000002.11:g.234627536C>A, NC_000002.12:g.233718890C>A, NG_002601.2:g.134147C>A, NM_001072.3:c.861+25025C>A, NM_007120.2:c.70C>A, NM_019075.2:c.856-48144C>A, NM_019076.4:c.856-48144C>A, NM_019077.2:c.855+36098C>A, NM_019078.1:c.867+5032C>A, NM_021027.2:c.855+46101C>A, NM_205862.1:c.60+25025C>A, NP_009051.1:p.Pro24Thr, XR_241238.1:n.126C>A, XR_241240.1:n.1022+25025C>A, XR_241241.1:n.941+46101C>A, rs17864908, rs52805064, rs58561863
C > A
No VIP available No Clinical Annotations available VA
rs6759892 NC_000002.11:g.234601669T>G, NC_000002.12:g.233693023T>G, NG_002601.2:g.108280T>G, NM_001072.3:c.19T>G, NM_019075.2:c.855+55646T>G, NM_019076.4:c.856-74011T>G, NM_019077.2:c.855+10231T>G, NM_021027.2:c.855+20234T>G, NM_205862.1:c.-7-776T>G, NP_001063.2:p.Ser7Ala, XR_241240.1:n.180T>G, XR_241241.1:n.941+20234T>G, rs17670302, rs60624335
T > G
No VIP available CA VA
rs6785049 NC_000003.11:g.119533733G>A, NC_000003.12:g.119814886G>A, NG_011856.1:g.39403G>A, NM_003889.3:c.795-93G>A, NM_022002.2:c.912-93G>A, NM_033013.2:c.684-93G>A, XM_005247866.1:c.630-93G>A, rs58368790
G > A
No VIP available No Clinical Annotations available VA
rs6848982 NC_000004.11:g.128959213G>A, NC_000004.12:g.128038058G>A, NM_001319305.1:c.*2245G>A, NM_001319306.1:c.*2245G>A, NM_001319307.1:c.*2245G>A
G > A
No VIP available No Clinical Annotations available VA
A > T
No VIP available No Clinical Annotations available VA
rs7104613 NC_000011.10:g.14058384C>T, NC_000011.9:g.14079931C>T, NM_006108.3:c.479+16730C>T, NW_003871075.1:g.116468C>T, rs60203831
C > T
No VIP available CA VA
rs712829 NC_000007.13:g.55086755G>T, NC_000007.14:g.55019062G>T, NG_007726.3:g.5031G>T, NM_005228.3:c.-216G>T, NM_201282.1:c.-216G>T, NM_201283.1:c.-216G>T, NM_201284.1:c.-216G>T, XM_005271746.1:c.-216G>T, XM_005271748.1:c.-216G>T, rs17288931
G > T
No VIP available No Clinical Annotations available VA
rs7131224 NC_000011.10:g.24225985T>C, NC_000011.9:g.24247531T>C, rs111186995, rs58002303, rs58056067
T > C
No VIP available No Clinical Annotations available VA
rs717620 NC_000010.10:g.101542578C>T, NC_000010.11:g.99782821C>T, NG_011798.1:g.5116C>T, NM_000392.4:c.-24C>T, XM_005269536.1:c.-24C>T, XM_006717631.2:c.-24C>T, XM_011539291.1:c.-24C>T, XR_945604.1:n.166C>T, XR_945605.1:n.168C>T, rs17216163, rs386485129, rs58371376
C > T
No VIP available CA VA
rs7194667 NC_000016.10:g.48208987T>G, NC_000016.9:g.48242898T>G, NG_011522.1:g.31191A>C, NM_032583.3:c.1609-491A>C, NM_033151.3:c.1609-491A>C, NM_145186.2:c.1609-491A>C, XM_005256208.1:c.1609-491A>C, XM_005256209.1:c.1609-491A>C, XM_005256210.1:c.1609-491A>C, XM_011523396.1:c.1411-491A>C, XM_011523397.1:c.652-491A>C, XR_243432.1:n.1714-491A>C, rs61621252
T > G
No VIP available CA No Variant Annotations available
rs724710 NC_000002.11:g.111907691T>C, NC_000002.12:g.111150114T>C, NG_029006.1:g.34201T>C, NM_001204106.1:c.195T>C, NM_001204107.1:c.195T>C, NM_001204108.1:c.465T>C, NM_001204109.1:c.395-3666T>C, NM_001204110.1:c.195T>C, NM_001204111.1:c.215-14019T>C, NM_001204112.1:c.215-3666T>C, NM_006538.4:c.285T>C, NM_138621.4:c.465T>C, NM_138622.3:c.465T>C, NM_138623.3:c.285T>C, NM_138624.3:c.*90T>C, NM_138625.3:c.*83T>C, NM_138626.3:c.395-14019T>C, NM_138627.3:c.125-14019T>C, NM_207003.2:c.195T>C, NP_001191035.1:p.Ile65=, NP_001191036.1:p.Ile65=, NP_001191037.1:p.Ile155=, NP_001191039.1:p.Ile65=, NP_006529.1:p.Ile95=, NP_619527.1:p.Ile155=, NP_619528.1:p.Ile155=, NP_619529.1:p.Ile95=, NP_996886.1:p.Ile65=, XM_005263550.1:c.747T>C, XM_005263550.2:c.747T>C, XM_005263551.1:c.747T>C, XM_005263552.1:c.567T>C, XM_005263552.2:c.567T>C, XM_005263553.1:c.567T>C, XM_005263554.1:c.677-14019T>C, XM_005263555.1:c.477T>C, XM_005263555.2:c.477T>C, XM_005263556.1:c.465T>C, XM_005263556.2:c.465T>C, XM_005263557.1:c.465T>C, XM_005263557.3:c.465T>C, XM_005263559.1:c.477T>C, XM_005263560.1:c.497-14019T>C, XM_005263561.1:c.285T>C, XM_005263561.2:c.285T>C, XM_011510463.1:c.516T>C, XP_005263607.1:p.Ile249=, XP_005263608.1:p.Ile249=, XP_005263609.1:p.Ile189=, XP_005263610.1:p.Ile189=, XP_005263612.1:p.Ile159=, XP_005263613.1:p.Ile155=, XP_005263614.1:p.Ile155=, XP_005263616.1:p.Ile159=, XP_005263618.1:p.Ile95=, XP_011508765.1:p.Ile172=, XR_244801.1:n.806T>C, XR_244802.1:n.806T>C, XR_244802.2:n.806T>C, XR_244803.1:n.626T>C, XR_244804.1:n.536T>C, XR_244805.1:n.753T>C, XR_244806.1:n.753T>C, XR_244807.1:n.683-3666T>C, XR_244808.1:n.786T>C, XR_244809.1:n.573T>C, XR_244810.1:n.483T>C, XR_244811.1:n.503-3666T>C, XR_244812.1:n.483T>C, XR_922828.1:n.806T>C, XR_922829.1:n.806T>C, XR_922830.1:n.736-3666T>C, rs13033893, rs17551042, rs3761703, rs56505964, rs60076061
T > C
No VIP available No Clinical Annotations available VA
rs72549307 NC_000001.10:g.98164955T>C, NC_000001.11:g.97699399T>C, NG_008807.2:g.226661A>G, NM_000110.3:c.632A>G, NP_000101.2:p.Tyr211Cys, XM_005270561.1:c.521A>G, XM_005270562.1:c.632A>G, XM_005270562.3:c.632A>G, XM_005270563.1:c.632A>G, XM_005270564.1:c.632A>G, XM_006710397.2:c.632A>G, XP_005270618.1:p.Tyr174Cys, XP_005270619.1:p.Tyr211Cys, XP_005270619.2:p.Tyr211Cys, XP_005270620.1:p.Tyr211Cys, XP_005270621.1:p.Tyr211Cys, XP_006710460.1:p.Tyr211Cys
T > C
No VIP available No Clinical Annotations available VA
rs7287550 NC_000022.10:g.19931976T>C, NC_000022.11:g.19944453T>C, NG_011526.1:g.7714T>C, NG_011835.1:g.2384A>G, NM_000754.3:c.-92+2556T>C, XM_005261229.1:c.-386+2556T>C, XM_011529887.1:c.-92+2556T>C, XM_011529890.1:c.-386+2556T>C, XM_011529891.1:c.-386+2278T>C
T > C
No VIP available No Clinical Annotations available VA
rs729147 NC_000004.11:g.100333267G>A, NC_000004.12:g.99412110G>A, NM_000673.4:c.*1038C>T, NM_001166504.1:c.*1038C>T, rs3805327, rs56638370, rs59352744
G > A
No VIP available CA VA
rs7319981 NC_000013.10:g.103723722G>A, NC_000013.11:g.103071372G>A, NG_016648.1:g.475C>T, rs56422021
G > A
No VIP available No Clinical Annotations available VA
rs73420732 NC_000007.13:g.55097762G>T, NC_000007.14:g.55030069G>T, NG_007726.3:g.16038G>T, NM_005228.3:c.88+10704G>T, NM_201282.1:c.88+10704G>T, NM_201283.1:c.88+10704G>T, NM_201284.1:c.88+10704G>T, XM_005271746.1:c.88+10704G>T, XM_005271748.1:c.88+10704G>T, XR_428151.2:n.681G>T
G > T
No VIP available No Clinical Annotations available VA
rs737866 NC_000022.10:g.19930109T>C, NC_000022.11:g.19942586T>C, NG_011526.1:g.5847T>C, NG_011835.1:g.4251A>G, NM_000754.3:c.-92+689T>C, NM_001282512.1:c.-783A>G, NM_006440.4:c.-783A>G, XM_005261214.1:c.-783A>G, XM_005261216.1:c.-783A>G, XM_005261217.1:c.-783A>G, XM_005261229.1:c.-386+689T>C, XM_011529887.1:c.-92+689T>C, XM_011529890.1:c.-386+689T>C, XM_011529891.1:c.-386+411T>C, rs17455584, rs386609683, rs60054527
T > C
No VIP available No Clinical Annotations available VA
rs740603 NC_000022.10:g.19945177A>G, NC_000022.11:g.19957654A>G, NG_011526.1:g.20915A>G, NM_000754.3:c.-91-3545A>G, NM_001135161.1:c.-91-3545A>G, NM_001135162.1:c.-91-3545A>G, XM_005261229.1:c.-385-3545A>G, XM_011529885.1:c.-331A>G, XM_011529886.1:c.-331A>G, XM_011529887.1:c.-91-3545A>G, XM_011529888.1:c.-91-3545A>G, XM_011529889.1:c.-91-3545A>G, XM_011529890.1:c.-385-3545A>G, XM_011529891.1:c.-385-3545A>G
A > G
No VIP available No Clinical Annotations available VA
rs750155 NC_000016.10:g.28609251C>T, NC_000016.9:g.28620572C>T, NG_028128.1:g.19295G>A, NM_001055.3:c.-4-392G>A, NM_001310136.1:c.121-142349G>A, NM_177529.2:c.-35-361G>A, NM_177530.2:c.-197G>A, NM_177534.2:c.-396G>A, NM_177536.3:c.139-2174G>A, XM_005255522.1:c.-4-392G>A
C > T
No VIP available CA VA
rs75017182 NC_000001.10:g.98045449G>C, NC_000001.11:g.97579893G>C, NG_008807.2:g.346167C>G, NM_000110.3:c.1129-5923C>G, XM_005270561.1:c.1018-5923C>G, XM_005270562.1:c.1129-5923C>G, XM_005270562.3:c.1129-5923C>G, XM_005270563.1:c.1129-5923C>G, XM_005270564.1:c.1129-5923C>G, XM_006710397.2:c.1129-5923C>G
G > C
No VIP available No Clinical Annotations available VA
rs7586110 NC_000002.11:g.234590527T>G, NC_000002.12:g.233681881T>G, NG_002601.2:g.97138T>G, NM_019075.2:c.855+44504T>G, NM_019076.4:c.855+63319T>G, NM_019077.2:c.-57T>G, NM_021027.2:c.855+9092T>G, XM_005246081.1:c.-57T>G, XR_241241.1:n.941+9092T>G, rs60348498
T > G
No VIP available CA No Variant Annotations available
rs760370 NC_000006.11:g.44200953A>G, NC_000006.12:g.44233216A>G, NG_042893.1:g.18712A>G, NM_001078174.1:c.1260-201A>G, NM_001078175.2:c.1260-201A>G, NM_001078176.2:c.1260-201A>G, NM_001078177.1:c.1260-201A>G, NM_001304462.1:c.1497-201A>G, NM_001304463.1:c.1386-201A>G, NM_001304465.1:c.1338-201A>G, NM_001304466.1:c.1335-201A>G, NM_004955.2:c.1260-201A>G, XM_005248875.1:c.1497-201A>G, XM_005248876.1:c.1389-201A>G, XM_005248876.3:c.1389-201A>G, XM_005248877.1:c.1386-201A>G, XM_005248878.1:c.1260-201A>G, XM_005248878.3:c.1260-201A>G, XM_005248879.1:c.1260-201A>G, XM_005248879.3:c.1260-201A>G, XM_005248880.1:c.1260-201A>G, XM_005248880.3:c.1260-201A>G, XM_005248881.1:c.1260-201A>G, XM_005248881.3:c.1260-201A>G, XM_005248882.1:c.1260-201A>G, XM_005248882.3:c.1260-201A>G, XM_011514341.1:c.1500-201A>G, rs59700015
A > G
No VIP available No Clinical Annotations available VA
rs7668258 NC_000004.11:g.69962078T>C, NC_000004.12:g.69096360T>C, NM_001074.2:c.-161T>C, XM_005265702.1:c.-26-2180T>C, XM_005265702.2:c.-26-2180T>C, XM_011532229.1:c.-161T>C, XM_011532230.1:c.-161T>C, XM_011532231.1:c.-26-2180T>C, rs17551675, rs60174701
T > C
No VIP available No Clinical Annotations available VA
rs768172 NC_000007.13:g.95805703A>T, NC_000007.14:g.96176391A>T, NG_012247.1:g.150757T>A, NM_001160210.1:c.1181-4867T>A, NM_014251.2:c.1178-4867T>A, NR_027662.1:n.1253-4867T>A, XM_006715831.2:c.1211-4867T>A, XM_011515727.1:c.1211-4867T>A, XM_011515728.1:c.326-4867T>A, rs118193516, rs59685268
A > T
No VIP available No Clinical Annotations available VA
rs770063251 NC_000008.10:g.105436493C>T, NC_000008.11:g.104424265C>T, NG_008840.1:g.47785G>A, NM_001385.2:c.1217G>A, NP_001376.1:p.Trp406Ter, XM_005250818.1:c.1217G>A, XM_005250818.2:c.1217G>A, XM_005250819.1:c.1217G>A, XM_006716518.2:c.1058G>A, XM_011516903.1:c.1217G>A, XM_011516904.1:c.1217G>A, XP_005250875.1:p.Trp406Ter, XP_005250876.1:p.Trp406Ter, XP_006716581.1:p.Trp353Ter, XP_011515205.1:p.Trp406Ter, XP_011515206.1:p.Trp406Ter
C > T
No VIP available No Clinical Annotations available VA
rs7746993 NC_000006.11:g.52714137C>A, NC_000006.12:g.52849339C>A, NG_029175.2:g.21120G>T, rs59957668
C > A
No VIP available No Clinical Annotations available VA
rs7754103 NC_000006.11:g.160061090C>T, NC_000006.12:g.159640058C>T, rs57022833
C > T
No VIP available No Clinical Annotations available VA
rs7757130 NC_000006.11:g.113317262C>A, NC_000006.12:g.112996060C>A, XR_942887.1:n.973-1377C>A
C > A
No VIP available No Clinical Annotations available VA
rs776746 NC_000007.13:g.99270539C>T, NC_000007.14:g.99672916T>C, NG_007938.1:g.12083G=, NG_007938.1:g.12083G>A, NM_000777.4:c.219-237A>G, NM_000777.4:c.219-237G>A, NM_001190484.2:c.219-237A>G, NM_001190484.2:c.219-237G>A, NM_001291829.1:c.-253-1A>G, NM_001291829.1:c.-253-1G>A, NM_001291830.1:c.189-237A>G, NM_001291830.1:c.189-237G>A, NR_033807.2:n.717-1A>G, NR_033807.2:n.717-1G>A, NR_033808.1:n.689-1G>A, NR_033809.1:n.581-237G>A, NR_033810.1:n.689-1G>A, NR_033811.1:n.321-1G>A, NR_033812.1:n.321-1G>A, XM_005250169.1:c.189-237G>A, XM_005250170.1:c.-357-1G>A, XM_005250171.1:c.-253-1G>A, XM_005250172.1:c.-254G>A, XM_005250173.1:c.-331-237G>A, XM_005250198.1:c.806-4288C>T, XM_006715859.2:c.219-237A>G, XM_011515843.1:c.-254A>G, XM_011515844.1:c.-229-237A>G, XM_011515845.1:c.-463-1A>G, XM_011515846.1:c.-331-237A>G, XM_011515847.1:c.-571-1A>G, XR_927383.1:n.344-237A>G, XR_927402.1:n.1466+48736T>C, rs10361242, rs11266830, rs386613022, rs58244770
C > T
No VIP available CA VA
rs7853758 NC_000009.11:g.86900926G>A, NC_000009.12:g.84286011G>A, NM_001199633.1:c.1381C>T, NM_022127.2:c.1381C>T, NP_001186562.1:p.Leu461=, NP_071410.1:p.Leu461=, NR_037638.2:n.1703C>T, XM_011518905.1:c.1465C>T, XM_011518906.1:c.1465C>T, XM_011518907.1:c.1132C>T, XM_011518908.1:c.742C>T, XP_011517207.1:p.Leu489=, XP_011517208.1:p.Leu489=, XP_011517209.1:p.Leu378=, XP_011517210.1:p.Leu248=, XR_929832.1:n.1572C>T, XR_930033.1:n.88-3031G>A, rs59483082, rs59559753
G > A
No VIP available CA No Variant Annotations available
rs7867504 NC_000009.11:g.86920236T>C, NC_000009.12:g.84305321T>C, NM_001199633.1:c.267A>G, NM_022127.2:c.267A>G, NP_001186562.1:p.Thr89=, NP_071410.1:p.Thr89=, NR_037638.2:n.589A>G, XM_011518905.1:c.419-2932A>G, XM_011518906.1:c.419-2932A>G, XM_011518907.1:c.86-2932A>G, XM_011518909.1:c.419-2932A>G, XM_011518910.1:c.419-2932A>G, XR_929832.1:n.546-2932A>G, rs386613708, rs60110305
T > -
T > C
No VIP available No Clinical Annotations available VA
rs7977213 NC_000012.11:g.20980800G>C, NC_000012.12:g.20827866G>C, NG_032071.1:g.22163G>C, NM_019844.3:c.84+12044G>C, XM_005253347.1:c.84+12044G>C, rs11502664, rs58558915
G > C
No VIP available No Clinical Annotations available VA
rs8001466 NC_000013.10:g.99355601G>C, NC_000013.11:g.98703347G>C, NG_017032.1:g.54329C>G, NM_005073.3:c.1417-818C>G
G > C
No VIP available No Clinical Annotations available VA
rs8056100 NC_000016.10:g.48226719G>A, NC_000016.9:g.48260630G>A, NG_011522.1:g.13459C>T, NM_032583.3:c.395+1087C>T, NM_033151.3:c.395+1087C>T, NM_145186.2:c.395+1087C>T, XM_005256208.1:c.395+1087C>T, XM_005256209.1:c.395+1087C>T, XM_005256210.1:c.395+1087C>T, XM_011523396.1:c.197+1087C>T, XR_243432.1:n.500+1087C>T, rs58118497
G > A
No VIP available CA VA
(TA)6 > (TA)5
(TA)6 > (TA)7
(TA)6 > (TA)8
No VIP available No Clinical Annotations available VA
rs8187710 NC_000010.10:g.101611294G>A, NC_000010.11:g.99851537G>A, NG_011798.1:g.73832G>A, NM_000392.4:c.4544G>A, NP_000383.1:p.Cys1515Tyr, XM_005269536.1:c.4265G>A, XM_006717630.2:c.3848G>A, XP_005269593.1:p.Cys1422Tyr, XP_006717693.1:p.Cys1283Tyr, XR_945605.1:n.4608G>A, rs17222568, rs52804507, rs58135906
G > A
No VIP available No Clinical Annotations available VA
rs8192924 NC_000016.10:g.66940496G>A, NC_000016.9:g.66974399G>A, NM_003869.5:c.809G>A, NM_198061.2:c.809G>A, NP_003860.2:p.Arg270His, NP_932327.1:p.Arg270His, NR_036684.1:n.2047G>A, XM_011523421.1:c.338G>A, XP_011521723.1:p.Arg113His
G > -
G > A
No VIP available No Clinical Annotations available VA
rs833061 NC_000006.11:g.43737486C>T, NC_000006.12:g.43769749C>T, NG_008732.1:g.4534C>T, NM_001025366.2:c.-958C>T, NM_001025367.2:c.-958C>T, NM_001025368.2:c.-958C>T, NM_001025369.2:c.-958C>T, NM_001025370.2:c.-958C>T, NM_001033756.2:c.-958C>T, NM_001171622.1:c.-958C>T, NM_001171623.1:c.-1498C>T, NM_001171624.1:c.-1498C>T, NM_001171625.1:c.-1498C>T, NM_001171626.1:c.-1498C>T, NM_001171627.1:c.-1498C>T, NM_001171628.1:c.-1498C>T, NM_001171629.1:c.-1498C>T, NM_001171630.1:c.-1498C>T, NM_001204384.1:c.-1498C>T, NM_001204385.1:c.-958C>T, NM_001317010.1:c.-1498C>T, NM_003376.5:c.-958C>T, rs36208046, rs60746584
C > T
No VIP available CA No Variant Annotations available
rs861539 NC_000014.8:g.104165753G>A, NC_000014.9:g.103699416G>A, NG_011516.1:g.21071C>T, NG_012307.1:g.75229G>A, NM_001100118.1:c.722C>T, NM_001100119.1:c.722C>T, NM_001130107.1:c.1782-1239G>A, NM_005432.3:c.722C>T, NM_182923.3:c.1651-1239G>A, NP_001093588.1:p.Thr241Met, NP_001093589.1:p.Thr241Met, NP_005423.1:p.Thr241Met, XM_005267599.1:c.1924-1239G>A, XM_005267600.1:c.*17-1239G>A, XM_005267602.1:c.1897-1239G>A, XM_005267603.1:c.*17-1239G>A, XM_005267604.1:c.1857-1239G>A, XM_005267605.1:c.1849-1239G>A, XM_005267606.1:c.*17-1239G>A, XM_005267607.1:c.1830-1239G>A, XM_005267608.1:c.1825-1239G>A, XM_005267609.1:c.1822-1239G>A, XM_005267610.1:c.*46-1239G>A, XM_005267612.1:c.*17-1239G>A, XM_005267613.1:c.1758-1239G>A, XM_005267614.1:c.1755-1239G>A, XM_005267615.1:c.1726-1239G>A, XM_005267616.1:c.*17-1239G>A, XM_005267617.1:c.1699-1239G>A, XM_005267618.1:c.*17-1239G>A, XM_005267624.1:c.1624-1239G>A, XM_005268045.1:c.722C>T, XM_005268046.1:c.722C>T, XM_005268047.1:c.722C>T, XM_011537138.1:c.722C>T, XP_005268102.1:p.Thr241Met, XP_005268103.1:p.Thr241Met, XP_005268104.1:p.Thr241Met, XP_011535440.1:p.Thr241Met, rs1734804, rs17435402, rs17850783, rs3212111, rs56934996
G > A
No VIP available No Clinical Annotations available VA
rs871514 NC_000002.11:g.234628529T>C, NC_000002.12:g.233719883T>C, NG_002601.2:g.135140T>C, NM_001072.3:c.861+26018T>C, NM_007120.2:c.867+196T>C, NM_019075.2:c.856-47151T>C, NM_019076.4:c.856-47151T>C, NM_019077.2:c.855+37091T>C, NM_019078.1:c.867+6025T>C, NM_021027.2:c.855+47094T>C, NM_205862.1:c.60+26018T>C, XR_241238.1:n.923+196T>C, XR_241240.1:n.1022+26018T>C, XR_241241.1:n.941+47094T>C, rs386618255, rs58866400, rs61099298
T > C
No VIP available CA VA
rs885004 NC_000009.11:g.86909550G>A, NC_000009.12:g.84294635G>A, NM_001199633.1:c.862-360C>T, NM_022127.2:c.862-360C>T, NR_037638.2:n.1184-360C>T, XM_011518905.1:c.946-360C>T, XM_011518906.1:c.946-360C>T, XM_011518907.1:c.613-360C>T, XM_011518908.1:c.223-360C>T, XM_011518909.1:c.946-360C>T, XM_011518910.1:c.946-360C>T, XR_929832.1:n.1073-360C>T, rs59238422
G > A
No VIP available CA VA
rs895819 NC_000019.10:g.13836478T>C, NC_000019.9:g.13947292T>C, NR_029495.1:n.182A>G, NR_029497.1:n.-119A>G, NR_029501.1:n.40A>G, NR_036515.1:n.-189A>G, rs117072305, rs61371382
T > C
No VIP available CA VA
rs9024 NC_000021.8:g.37445313G>A, NC_000021.9:g.36073015G>A, NM_001286789.1:c.*1076G>A, NM_001757.3:c.*133G>A, NR_040084.1:n.377+1866C>T, XM_005261073.1:c.*1076G>A, rs17228577, rs3171443, rs61389789
G > A
No VIP available No Clinical Annotations available VA
rs9282861 NC_000016.10:g.28606193C>T, NC_000016.9:g.28617514C>T, NG_028128.1:g.22353G>A, NM_001055.3:c.638G>A, NM_001310136.1:c.121-139291G>A, NM_177529.2:c.638G>A, NM_177530.2:c.638G>A, NM_177534.2:c.638G>A, NM_177536.3:c.404G>A, NP_001046.2:p.Arg213His, NP_803565.1:p.Arg213His, NP_803566.1:p.Arg213His, NP_803878.1:p.Arg213His, NP_803880.1:p.Arg135His, XM_005255522.1:c.638G>A, XP_005255579.1:p.Arg213His, rs17844870, rs17857585
C > T
No VIP available CA VA
rs9332377 NC_000022.10:g.19955692C>T, NC_000022.11:g.19968169C>T, NG_011526.1:g.31430C>T, NG_023326.1:g.53618G>A, NM_000754.3:c.616-367C>T, NM_001135161.1:c.616-367C>T, NM_001135162.1:c.616-367C>T, NM_007310.2:c.466-367C>T, XM_005261229.1:c.616-367C>T, XM_005261242.1:c.2764-960G>A, XM_006724243.1:c.2782-960G>A, XM_006724246.2:c.2536-960G>A, XM_011529885.1:c.*742C>T, XM_011529886.1:c.730-367C>T, XM_011529887.1:c.*742C>T, XM_011529888.1:c.*742C>T, XM_011529889.1:c.*742C>T, XM_011529890.1:c.*742C>T, XM_011529891.1:c.*742C>T, XM_011530179.1:c.2749-960G>A, XM_011530182.1:c.1348-960G>A, rs60676269
C > T
No VIP available CA No Variant Annotations available
rs9340799 NC_000006.11:g.152163381A>G, NC_000006.12:g.151842246A>G, NG_008493.1:g.156751A>G, NM_000125.3:c.453-351A>G, NM_001122740.1:c.453-351A>G, NM_001122741.1:c.453-351A>G, NM_001122742.1:c.453-351A>G, NM_001291230.1:c.453-351A>G, NM_001291241.1:c.453-351A>G, XM_005266856.1:c.453-351A>G, XM_005266857.1:c.453-351A>G, XM_006715374.2:c.453-351A>G, XM_006715375.2:c.-67-351A>G, XM_011535543.1:c.453-351A>G, XM_011535544.1:c.453-351A>G, XM_011535545.1:c.453-351A>G, XM_011535546.1:c.453-351A>G, XM_011535547.1:c.453-351A>G, XM_011535548.1:c.-67-351A>G, rs17208058, rs59875577
A > G
No VIP available CA VA
rs9351963 NC_000006.11:g.73749861A>C, NC_000006.12:g.73040138A>C, NM_001160130.1:c.490-1798A>C, NM_001160132.1:c.490-1798A>C, NM_001160133.1:c.490-1798A>C, NM_001160134.1:c.490-1798A>C, NM_019842.3:c.490-1798A>C, XM_005248734.1:c.-9-1798A>C, XM_011535944.1:c.490-1798A>C
A > C
No VIP available CA VA
rs9514091 NC_000013.10:g.103714254G>A, NC_000013.11:g.103061904G>A, NG_016648.1:g.9943C>T, NM_000452.2:c.378-3522C>T, rs57163569
G > A
No VIP available CA No Variant Annotations available
rs9561778 NC_000013.10:g.95713715G>T, NC_000013.11:g.95061461G>T, NM_001301829.1:c.3225+1243C>A, NM_005845.4:c.3366+1243C>A, XM_005254025.1:c.3237+1243C>A, XM_005254025.2:c.3237+1243C>A, XM_005254026.1:c.3225+1243C>A, XM_005254027.1:c.3141+1243C>A, XM_006719914.1:c.3276+1243C>A, XM_011521047.1:c.2817+1243C>A, rs17234943
G > A
G > T
No VIP available No Clinical Annotations available VA
rs9657362 NC_000008.10:g.1833801G>C, NC_000008.11:g.1885635G>C, NG_008480.1:g.66653G>C, NM_001308152.1:c.996G>C, NM_001308153.1:c.1185G>C, NM_014629.2:c.1110G>C, NM_014629.3:c.1110G>C, NP_001295081.1:p.Leu332Phe, NP_001295082.1:p.Leu395Phe, NP_055444.2:p.Leu370Phe, NT_187576.1:g.69011G>C, XM_005266039.1:c.1182G>C, XM_005266040.1:c.1185G>C, XM_005266040.3:c.1185G>C, XM_005266041.1:c.1113G>C, XM_005266041.2:c.1113G>C, XM_005266042.1:c.996G>C, XM_006725106.2:c.1185G>C, XM_006725107.2:c.1113G>C, XM_006725111.1:c.996G>C, XM_011534766.1:c.1113G>C, XM_011534767.1:c.993G>C, XM_011534768.1:c.1113G>C, XM_011534769.1:c.1068G>C, XM_011534770.1:c.1113G>C, XM_011546563.1:c.1113G>C, XM_011546564.1:c.993G>C, XM_011546565.1:c.1113G>C, XM_011546566.1:c.1068G>C, XM_011546567.1:c.1113G>C, XP_005266096.1:p.Leu394Phe, XP_005266097.1:p.Leu395Phe, XP_005266098.1:p.Leu371Phe, XP_005266099.1:p.Leu332Phe, XP_006725169.1:p.Leu395Phe, XP_006725170.1:p.Leu371Phe, XP_006725174.1:p.Leu332Phe, XP_011533068.1:p.Leu371Phe, XP_011533069.1:p.Leu331Phe, XP_011533070.1:p.Leu371Phe, XP_011533071.1:p.Leu356Phe, XP_011533072.1:p.Leu371Phe, XP_011544865.1:p.Leu371Phe, XP_011544866.1:p.Leu331Phe, XP_011544867.1:p.Leu371Phe, XP_011544868.1:p.Leu356Phe, XP_011544869.1:p.Leu371Phe, rs52817136, rs57380468
G > C
No VIP available CA No Variant Annotations available
rs9679162 NC_000002.11:g.31247514G>T, NC_000002.12:g.31024648G>T, NM_001253826.1:c.315-58346C>A, NM_001253827.1:c.70-31641C>A, NM_024572.3:c.130-31641C>A, NR_045602.1:n.903-31641C>A, XM_005264559.1:c.25-31641C>A, XM_011533104.1:c.448-31641C>A, XM_011533105.1:c.70-31641C>A, XM_011533106.1:c.43-31641C>A, rs56573917, rs57478659, rs60984987
G > T
No VIP available CA VA
rs9936750 NC_000016.10:g.55137962T>C, NC_000016.9:g.55171874T>C, rs17210912, rs61515867
T > C
No VIP available CA No Variant Annotations available
rs9937 NC_000011.10:g.4138227A>G, NC_000011.9:g.4159457A>G, NG_027992.2:g.48534A>G, NM_001033.3:c.2223A>G, NM_001033.4:c.2223A>G, NM_001318064.1:c.1932A>G, NM_001318065.1:c.1209A>G, NP_001024.1:p.Thr741=, NP_001304993.1:p.Thr644=, NP_001304994.1:p.Thr403=, XM_005253058.1:c.1980A>G, XM_005253059.1:c.1932A>G, XM_011520277.1:c.1932A>G, XM_011520278.1:c.1557A>G, XM_011520279.1:c.1209A>G, XP_005253115.1:p.Thr660=, XP_005253116.1:p.Thr644=, XP_011518579.1:p.Thr644=, XP_011518580.1:p.Thr519=, XP_011518581.1:p.Thr403=, rs1042857, rs17295553, rs17349998, rs17398272, rs17850106, rs2228120, rs3177016, rs59628733
A > G
No VIP available CA No Variant Annotations available
rs9981861 NC_000021.8:g.41415044T>C, NC_000021.9:g.40043117T>C, NM_001271534.1:c.5384-444A>G, NM_001389.3:c.5384-444A>G, NR_073202.1:n.5645-444A>G, XM_011529481.1:c.3020-444A>G, rs57793011
T > C
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 147


Alternate Names: 
Benign Neoplasm; Benign Neoplasms; Cancer; Cancers; Neoplasm; Neoplasm, Benign; Neoplasms NOS; Neoplasms, Benign; Tumor; Tumors; Tumour
PharmGKB Accession Id: PA445062
External Vocabularies

PharmGKB Curated Pathways

Pathways created internally by PharmGKB based primarily on literature evidence.

  1. Thiopurine Pathway, Pharmacokinetics/Pharmacodynamics
    Diagrammatic representation of a non-tissue specific cancer cell displaying candidate genes involved in the metabolism and action of thiopurines.

Curated Information ?

No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available

Curated Information ?