Disease:
Neoplasms

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Gene ? Variant?
(147)
Alternate Names ? Chemicals ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
Translation
No VIP available CA No VIP available CYP2A6 *1A N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *4A N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *4C N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *7 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2A6 *9 N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *9A N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *10 N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *11 N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *18A N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *19 N/A N/A N/A
No VIP available CA No VIP available CYP2B6 *1 N/A N/A N/A
No VIP available CA No VIP available CYP2B6 *6 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C19 *1 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C19 *2A N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C19 *2B N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C19 *17 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C9 *1 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C9 *2 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2C9 *3 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *1 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *1xN N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *2 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *3 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *4 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *6 N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *10 N/A N/A N/A
No VIP available No VIP available No VIP available CYP3A4 *1A N/A N/A N/A
No VIP available No VIP available No VIP available CYP3A4 *1B N/A N/A N/A
No VIP available CA No VIP available CYP3A5 *1A N/A N/A N/A
No VIP available CA No VIP available CYP3A5 *3A N/A N/A N/A
No VIP available No VIP available No VIP available CYP3A5 *3C N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *1 N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *2A N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *4 N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *5 N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *6 N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *9A N/A N/A N/A
No VIP available No VIP available No VIP available DPYD *13 N/A N/A N/A
No VIP available No VIP available No VIP available G6PD Mediterranean, Dallas, Panama' Sassari, Cagliari, Birmingham N/A N/A N/A
No VIP available CA No VIP available GSTM1 non-null N/A N/A N/A
No VIP available CA No VIP available GSTM1 null N/A N/A N/A
No VIP available CA No VIP available GSTT1 non-null N/A N/A N/A
No VIP available CA No VIP available GSTT1 null N/A N/A N/A
No VIP available No VIP available No VIP available HLA-A *02:01 N/A N/A N/A
No VIP available No VIP available No VIP available HLA-A *03:01:01:01 N/A N/A N/A
No VIP available No VIP available No VIP available PIK3CA H4 N/A N/A N/A
No VIP available No VIP available No VIP available PIK3CA H5 N/A N/A N/A
No VIP available No VIP available No VIP available SLCO1B1 *1 N/A N/A N/A
No VIP available No VIP available No VIP available SLCO1B1 *15 N/A N/A N/A
No VIP available No VIP available VA TPMT *1 N/A N/A N/A
No VIP available No VIP available VA TPMT *3A N/A N/A N/A
No VIP available No VIP available VA TPMT *3C N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *1 N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *6 N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *28 N/A N/A N/A
No VIP available CA No VIP available UGT1A1 *60 N/A N/A N/A
No VIP available No VIP available No VIP available UGT1A1 *93 N/A N/A N/A
No VIP available No Clinical Annotations available VA
rs10024471
A > G
SNP
No VIP available No Clinical Annotations available VA
rs10144771 NC_000014.8:g.94778653A>G, NC_000014.9:g.94312316A>G, NG_011796.1:g.16036T>C, NM_001756.3:c.613+1720T>C, NT_187601.1:g.1426878A>G, rs60270135
A > G
SNP
No VIP available No Clinical Annotations available VA
rs10413396 NC_000019.10:g.44309549G>T, NC_000019.9:g.44813702G>T
G > T
SNP
No VIP available CA No Variant Annotations available
rs1042522 NC_000017.10:g.7579472G=, NC_000017.10:g.7579472G>C, NC_000017.10:g.7579472G>T, NC_000017.11:g.7676154G=, NC_000017.11:g.7676154G>C, NC_000017.11:g.7676154G>T, NG_017013.2:g.16397C=, NG_017013.2:g.16397C>A, NG_017013.2:g.16397C>G, NM_000546.5:c.215C=, NM_000546.5:c.215C>A, NM_000546.5:c.215C>G, NM_001126112.2:c.215C=, NM_001126112.2:c.215C>A, NM_001126112.2:c.215C>G, NM_001126113.2:c.215C=, NM_001126113.2:c.215C>A, NM_001126113.2:c.215C>G, NM_001126114.2:c.215C=, NM_001126114.2:c.215C>A, NM_001126114.2:c.215C>G, NM_001126115.1:c.-939C=, NM_001126115.1:c.-939C>A, NM_001126115.1:c.-939C>G, NM_001126116.1:c.-939C=, NM_001126116.1:c.-939C>A, NM_001126116.1:c.-939C>G, NM_001126117.1:c.-939C=, NM_001126117.1:c.-939C>A, NM_001126117.1:c.-939C>G, NM_001126118.1:c.98C=, NM_001126118.1:c.98C>A, NM_001126118.1:c.98C>G, NM_001276695.1:c.98C=, NM_001276695.1:c.98C>A, NM_001276695.1:c.98C>G, NM_001276696.1:c.98C=, NM_001276696.1:c.98C>A, NM_001276696.1:c.98C>G, NM_001276697.1:c.-1020C=, NM_001276697.1:c.-1020C>A, NM_001276697.1:c.-1020C>G, NM_001276698.1:c.-1020C=, NM_001276698.1:c.-1020C>A, NM_001276698.1:c.-1020C>G, NM_001276699.1:c.-1020C=, NM_001276699.1:c.-1020C>A, NM_001276699.1:c.-1020C>G, NM_001276760.1:c.98C=, NM_001276760.1:c.98C>A, NM_001276760.1:c.98C>G, NM_001276761.1:c.98C=, NM_001276761.1:c.98C>A, NM_001276761.1:c.98C>G, NP_000537.3:p.Pro72=, NP_000537.3:p.Pro72Arg, NP_000537.3:p.Pro72His, NP_001119584.1:p.Pro72=, NP_001119584.1:p.Pro72Arg, NP_001119584.1:p.Pro72His, NP_001119585.1:p.Pro72=, NP_001119585.1:p.Pro72Arg, NP_001119585.1:p.Pro72His, NP_001119586.1:p.Pro72=, NP_001119586.1:p.Pro72Arg, NP_001119586.1:p.Pro72His, NP_001119590.1:p.Pro33=, NP_001119590.1:p.Pro33Arg, NP_001119590.1:p.Pro33His, NP_001263624.1:p.Pro33=, NP_001263624.1:p.Pro33Arg, NP_001263624.1:p.Pro33His, NP_001263625.1:p.Pro33=, NP_001263625.1:p.Pro33Arg, NP_001263625.1:p.Pro33His, NP_001263689.1:p.Pro33=, NP_001263689.1:p.Pro33Arg, NP_001263689.1:p.Pro33His, NP_001263690.1:p.Pro33=, NP_001263690.1:p.Pro33Arg, NP_001263690.1:p.Pro33His, XM_005256778.1:c.176-21C=, XM_005256778.1:c.176-21C>A, XM_005256778.1:c.176-21C>G, XR_243565.1:n.354C=, XR_243565.1:n.354C>A, XR_243565.1:n.354C>G, XR_243566.1:n.354C=, XR_243566.1:n.354C>A, XR_243566.1:n.354C>G, rs17844988, rs17857747, rs17882155, rs2229076, rs3174747, rs4134781, rs60388830
G > C
SNP
P72R
No VIP available No Clinical Annotations available VA
rs1042597 NC_000002.11:g.234526871C>G, NC_000002.12:g.233618225C>G, NG_002601.2:g.33482C>G, NM_019076.4:c.518C>G, NP_061949.3:p.Ala173Gly, rs117092283, rs13387262, rs17862843, rs2071043, rs56696602
C > G
SNP
A173G
No VIP available No Clinical Annotations available VA
rs1042605 NC_000002.11:g.234527118A>G, NC_000002.12:g.233618472A>G, NG_002601.2:g.33729A>G, NM_019076.4:c.765A>G, NP_061949.3:p.Thr255=, rs17868307, rs58240369
A > G
SNP
T255T
No VIP available CA VA
rs10426377 NC_000019.10:g.48588977C>A, NC_000019.9:g.49092234C>A, NG_029063.1:g.41806C>A, NM_004605.2:c.378+1540C>A, NM_177973.1:c.423+1540C>A, XM_005259182.1:c.-228C>A, XM_005259182.2:c.-228C>A, rs61651031
C > A
SNP
No VIP available No Clinical Annotations available VA
rs10426628 NC_000019.10:g.48589173A>G, NC_000019.9:g.49092430A>G, NG_029063.1:g.42002A>G, NM_004605.2:c.378+1736A>G, NM_177973.1:c.423+1736A>G, XM_005259182.1:c.-32A>G, XM_005259182.2:c.-32A>G, rs57560171
A > G
SNP
No VIP available CA VA
rs1044457 NC_000001.10:g.47842777C>T, NC_000001.11:g.47377105C>T, NM_001136140.1:c.*360C>T, NM_016308.2:c.*360C>T, NR_046394.1:n.1119C>T, rs17378832, rs3184215, rs3767626
C > -
C > T
SNP
No VIP available CA VA
rs1045642 NC_000007.13:g.87138645A>G, NC_000007.14:g.87509329A>G, NG_011513.1:g.208920T>C, NM_000927.4:c.3435T>C, NP_000918.2:p.Ile1145=, rs10239679, rs11568726, rs117328163, rs17210003, rs2229108, rs386513066, rs60023214, rs9690664
A > G
SNP
I1145I
No VIP available CA VA
rs1048977 NC_000001.10:g.20945055C>T, NC_000001.11:g.20618562C>T, NM_001785.2:c.435C>T, NP_001776.1:p.Thr145=, rs17846527, rs17859600, rs3189038, rs57498302
C > T
SNP
T145T
No VIP available No Clinical Annotations available VA
rs10497346 NC_000002.11:g.169771196T>C, NC_000002.12:g.168914686T>C, NW_003315909.1:g.101313T>C
T > C
SNP
No VIP available No Clinical Annotations available VA
rs10509681 NC_000010.10:g.96798749T>C, NC_000010.11:g.95038992T>C, NG_007972.1:g.35506A>G, NM_000770.3:c.1196A>G, NM_001198853.1:c.986A>G, NM_001198854.1:c.890A>G, NM_001198855.1:c.986A>G, NP_000761.3:p.Lys399Arg, NP_001185782.1:p.Lys329Arg, NP_001185783.1:p.Lys297Arg, NP_001185784.1:p.Lys329Arg, XR_246073.1:n.1331A>G, XR_945610.1:n.1331A>G, rs17522568, rs56435423, rs61450273
T > C
SNP
K399R
No VIP available CA No Variant Annotations available
rs1051266 NC_000021.8:g.46957794T>C, NC_000021.9:g.45537880T>C, NG_028278.1:g.9592A>G, NM_001205206.1:c.80A>G, NM_194255.2:c.80A>G, NP_001192135.1:p.His27Arg, NP_919231.1:p.His27Arg, XM_005261163.1:c.80A>G, XM_005261164.1:c.-279A>G, XM_005261164.2:c.-279A>G, XM_011529696.1:c.371A>G, XM_011529697.1:c.371A>G, XM_011529698.1:c.146A>G, XM_011529699.1:c.-1639A>G, XM_011529700.1:c.80A>G, XM_011529701.1:c.80A>G, XM_011529702.1:c.80A>G, XM_011529703.1:c.80A>G, XM_011529704.1:c.80A>G, XM_011529705.1:c.371A>G, XM_011529707.1:c.371A>G, XM_011529708.1:c.80A>G, XM_011529709.1:c.-279A>G, XM_011529710.1:c.-165-5732A>G, XP_005261220.1:p.His27Arg, XP_011527998.1:p.His124Arg, XP_011527999.1:p.His124Arg, XP_011528000.1:p.His49Arg, XP_011528002.1:p.His27Arg, XP_011528003.1:p.His27Arg, XP_011528004.1:p.His27Arg, XP_011528005.1:p.His27Arg, XP_011528006.1:p.His27Arg, XP_011528007.1:p.His124Arg, XP_011528009.1:p.His124Arg, XP_011528010.1:p.His27Arg, rs17844977, rs17857726, rs3171496, rs386514057, rs61510559
T > C
SNP
H27R
No VIP available CA VA
rs1051640 NC_000017.10:g.48768486A>G, NC_000017.11:g.50691125A>G, NM_003786.3:c.4509A>G, NP_003777.2:p.Glu1503=, XM_005257763.1:c.4317A>G, XM_005257763.2:c.4317A>G, XM_011525422.1:c.4422A>G, XM_011525423.1:c.4614A>G, XM_011525424.1:c.3834A>G, XM_011525425.1:c.3783A>G, XP_005257820.1:p.Glu1439=, XP_011523724.1:p.Glu1474=, XP_011523725.1:p.Glu1538=, XP_011523726.1:p.Glu1278=, XP_011523727.1:p.Glu1261=, XR_934586.1:n.4970A>G, rs17414117, rs17643255, rs3192040, rs57272614, rs60786737
A > G
SNP
E1503E
No VIP available CA VA
rs1056892 NC_000021.8:g.37518706G>A, NC_000021.9:g.36146408G>A, NM_001236.3:c.730G>A, NP_001227.1:p.Val244Met, NR_038892.1:n.93-53C>T, NR_038893.1:n.93-53C>T, NR_038894.1:n.93-53C>T, rs3171445, rs52816011, rs58776388
G > A
SNP
V244M
No VIP available No Clinical Annotations available VA
rs1058930 NC_000010.10:g.96818119G>C, NC_000010.11:g.95058362G>C, NG_007972.1:g.16136C>G, NM_000770.3:c.792C>G, NM_001198853.1:c.582C>G, NM_001198854.1:c.486C>G, NM_001198855.1:c.582C>G, NP_000761.3:p.Ile264Met, NP_001185782.1:p.Ile194Met, NP_001185783.1:p.Ile162Met, NP_001185784.1:p.Ile194Met, XR_246073.1:n.888C>G, XR_945610.1:n.888C>G, rs17420739, rs3199599, rs56489507, rs56929063
G > C
SNP
I264M
No VIP available CA No Variant Annotations available
rs1060896 NC_000015.10:g.45262069C>A, NC_000015.9:g.45554267C>A, NM_004212.3:c.225C>A, NP_004203.2:p.Ser75Arg, NR_120335.1:n.27-6071G>T, XM_011522198.1:c.225C>A, XM_011522199.1:c.225C>A, XM_011522200.1:c.225C>A, XM_011522201.1:c.225C>A, XP_011520500.1:p.Ser75Arg, XP_011520501.1:p.Ser75Arg, XP_011520502.1:p.Ser75Arg, XP_011520503.1:p.Ser75Arg, XR_243147.1:n.32-6071G>T, rs17215647, rs17532209, rs52828213, rs58568974
C > A
SNP
S75R
No VIP available No Clinical Annotations available VA
rs10815019 NC_000009.11:g.4547288A>G, NC_000009.12:g.4547288A>G, NG_017044.1:g.61862A>G, NM_004170.5:c.232+2581A>G, XM_011518007.1:c.301+2581A>G, XM_011518008.1:c.241+2581A>G, XM_011518009.1:c.172+2581A>G, XM_011518010.1:c.92-14161A>G, rs56618216, rs59895460
A > G
A > T
SNP
No VIP available No Clinical Annotations available VA
rs10841661 NC_000012.11:g.20984832C>T, NC_000012.12:g.20831898C>T, NG_032071.1:g.26195C>T, NM_019844.3:c.84+16076C>T, XM_005253347.1:c.84+16076C>T, rs60957758
C > T
SNP
No VIP available No Clinical Annotations available VA
rs10916825
A > G
SNP
No VIP available No Clinical Annotations available VA
rs10929302 NC_000002.11:g.234665782G>A, NC_000002.12:g.233757136G>A, NG_002601.2:g.172393G>A, NG_033238.1:g.1864G>A, NM_001072.3:c.862-9898G>A, NM_007120.2:c.868-9898G>A, NM_019075.2:c.856-9898G>A, NM_019076.4:c.856-9898G>A, NM_019077.2:c.856-9898G>A, NM_019078.1:c.868-9898G>A, NM_019093.2:c.868-9898G>A, NM_021027.2:c.856-9898G>A, NM_205862.1:c.61-9898G>A, NR_037694.1:n.-1791C>T, NR_037695.1:n.-1791C>T, NR_037696.1:n.-1791C>T, XR_241238.1:n.924-9898G>A, XR_241240.1:n.1023-9898G>A, XR_241241.1:n.942-9898G>A
G > A
SNP
No VIP available No Clinical Annotations available VA
rs10931910 NC_000002.11:g.201523736A>G, NC_000002.12:g.200659013A>G, NM_001159.3:c.3172-152A>G, XM_005246506.1:c.1840-152A>G, XM_011511062.1:c.3172-152A>G, XR_922913.1:n.3329-152A>G, rs13005946, rs59990000
A > G
SNP
No VIP available No Clinical Annotations available VA
rs10950831
G > T
SNP
No VIP available No Clinical Annotations available VA
rs11022922 NC_000011.10:g.2457965C>T, NC_000011.9:g.2479195C>T, NG_008935.1:g.17975C>T, NM_000218.2:c.386+12481C>T, rs60426613
C > T
SNP
No VIP available CA VA
rs11045585 NC_000012.11:g.21045694A>G, NC_000012.12:g.20892760A>G, NG_032071.1:g.87057A>G, NM_019844.3:c.1683-5676A>G, XM_005253347.1:c.1683-5676A>G
A > G
SNP
No VIP available No Clinical Annotations available VA
rs11046217 NC_000012.11:g.22017157G>C, NC_000012.12:g.21864223G>C, NG_012819.1:g.77472C>G, NM_005691.2:c.2237+216C>G, NM_005691.3:c.2237+216C>G, NM_020297.2:c.2237+216C>G, NM_020297.3:c.2237+216C>G, XM_005253284.1:c.2237+216C>G, XM_005253284.2:c.2237+216C>G, XM_005253285.1:c.2237+216C>G, XM_005253286.1:c.2237+216C>G, XM_005253286.2:c.2237+216C>G, XM_005253287.1:c.2237+216C>G, XM_005253287.3:c.2237+216C>G, XM_005253288.1:c.2237+216C>G, XM_005253288.2:c.2237+216C>G, XM_005253289.1:c.2199-1169C>G, XM_005253289.2:c.2199-1169C>G, XM_005253290.1:c.2199-3168C>G, XM_005253290.2:c.2199-3168C>G, XM_005253291.1:c.2237+216C>G, XM_006719025.2:c.2199-1169C>G, XM_011520545.1:c.2237+216C>G
G > C
SNP
No VIP available No Clinical Annotations available VA
rs11075646 NC_000016.10:g.66935273C>G, NC_000016.9:g.66969176C>G, NM_003869.5:c.-171C>G, NM_016062.3:c.-909G>C, NM_198061.2:c.-171C>G, NR_024525.2:n.-850G>C, NR_036684.1:n.803C>G, NR_046109.1:n.-850G>C, XM_011523421.1:c.-806C>G, rs16957087, rs60326948
C > -
C > G
SNP
No VIP available No Clinical Annotations available VA
rs1113129 NC_000010.10:g.96811045G>C, NC_000010.11:g.95051288G>C, NG_007972.1:g.23210C>G, NM_000770.3:c.820-5337C>G, NM_001198853.1:c.610-5337C>G, NM_001198854.1:c.514-5337C>G, NM_001198855.1:c.610-5337C>G, XR_246073.1:n.916-5337C>G, XR_945610.1:n.916-5337C>G, rs4488135
G > C
SNP
No VIP available CA VA
rs11141915 NC_000009.11:g.90235794A>C, NC_000009.12:g.87620879A>C, NG_029883.1:g.128039A>C, NM_001288729.1:c.284+15704A>C, NM_001288730.1:c.284+15704A>C, NM_001288731.1:c.284+15704A>C, NM_004938.3:c.284+15704A>C, XM_005251755.1:c.284+15704A>C, XM_005251756.1:c.284+15704A>C, XM_005251757.1:c.284+15704A>C, XM_005251757.2:c.284+15704A>C, rs36209074, rs58921402
A > C
SNP
No VIP available CA No Variant Annotations available
rs11211524 NC_000001.10:g.47833213A>C, NC_000001.11:g.47367541A>C, NM_001136140.1:c.172-5414A>C, NM_016308.2:c.172-928A>C, NR_046394.1:n.321-928A>C
A > C
SNP
No VIP available CA VA
rs1128503 NC_000007.13:g.87179601A>G, NC_000007.14:g.87550285A>G, NG_011513.1:g.167964T>C, NM_000927.4:c.1236T>C, NP_000918.2:p.Gly412=, rs116989428, rs17276907, rs2032587, rs2229105, rs28365046, rs386518005, rs58257317
A > G
SNP
G412G
No VIP available CA No Variant Annotations available
rs1138272 NC_000011.10:g.67586108C>T, NC_000011.9:g.67353579C>T, NG_012075.1:g.7514C>T, NM_000852.3:c.341C>T, NP_000843.1:p.Ala114Val, XM_005273958.1:c.338C>T, XP_005274015.1:p.Ala113Val, rs11553894, rs17434783, rs1799811, rs1804665, rs3202011, rs4134657, rs52800258, rs61323549
C > T
SNP
A114V
No VIP available CA VA
rs1142345 NC_000006.11:g.18130918T>C, NC_000006.12:g.18130687T>C, NG_012137.2:g.29457A>G, NM_000367.3:c.719A>G, NP_000358.1:p.Tyr240Cys, XM_011514839.1:c.674A>G, XM_011514840.1:c.650A>G, XP_011513141.1:p.Tyr225Cys, XP_011513142.1:p.Tyr217Cys, rs16880254, rs1801205, rs29001646, rs52798150, rs61510596
T > C
SNP
Y240C
No VIP available CA No Variant Annotations available
rs11479 NC_000022.10:g.50964236G>A, NC_000022.11:g.50525807G>A, NG_011860.1:g.9279C>T, NG_016235.1:g.5633C>T, NG_021419.1:g.22592G>A, NM_001113755.2:c.1412C>T, NM_001113756.2:c.1412C>T, NM_001169109.1:c.-14+439C>T, NM_001169110.1:c.-14+194C>T, NM_001169111.1:c.-379C>T, NM_001257988.1:c.1412C>T, NM_001257989.1:c.1427C>T, NM_001953.4:c.1412C>T, NM_005138.2:c.-349C>T, NP_001107227.1:p.Ser471Leu, NP_001107228.1:p.Ser471Leu, NP_001244917.1:p.Ser471Leu, NP_001244918.1:p.Ser476Leu, NP_001944.1:p.Ser471Leu, rs17846490, rs17859554, rs3202233, rs3829983
G > A
SNP
S471L
No VIP available CA VA
rs1149222 NC_000007.13:g.87073775G>T, NC_000007.14:g.87444459G>T, NG_007118.1:g.40974C>A, NM_000443.3:c.1119+403C>A, NM_018849.2:c.1119+403C>A, NM_018850.2:c.1119+403C>A, XM_011516308.1:c.1119+403C>A, XM_011516309.1:c.1119+403C>A, XM_011516310.1:c.1119+403C>A, XM_011516311.1:c.1119+403C>A, XM_011516312.1:c.1119+403C>A, XM_011516313.1:c.1119+403C>A, XM_011516314.1:c.1140+403C>A, XM_011516315.1:c.459+403C>A, XR_927478.1:n.1215+403C>A, rs10376488, rs1639242, rs17297653, rs60948017
G > T
SNP
No VIP available CA No Variant Annotations available
rs115232898 NC_000001.10:g.98165030T>C, NC_000001.11:g.97699474T>C, NG_008807.2:g.226586A>G, NM_000110.3:c.557A>G, NP_000101.2:p.Tyr186Cys, XM_005270561.1:c.446A>G, XM_005270562.1:c.557A>G, XM_005270562.3:c.557A>G, XM_005270563.1:c.557A>G, XM_005270564.1:c.557A>G, XM_006710397.2:c.557A>G, XP_005270618.1:p.Tyr149Cys, XP_005270619.1:p.Tyr186Cys, XP_005270619.2:p.Tyr186Cys, XP_005270620.1:p.Tyr186Cys, XP_005270621.1:p.Tyr186Cys, XP_006710460.1:p.Tyr186Cys, rs199469520
T > C
SNP
Y186C
No VIP available No Clinical Annotations available VA
rs115349832
A > C
A > G
SNP
No VIP available No Clinical Annotations available VA
rs11572080 NC_000010.10:g.96827030C>T, NC_000010.11:g.95067273C>T, NG_007972.1:g.7225G>A, NM_000770.3:c.416G>A, NM_001198853.1:c.206G>A, NM_001198854.1:c.110G>A, NM_001198855.1:c.206G>A, NP_000761.3:p.Arg139Lys, NP_001185782.1:p.Arg69Lys, NP_001185783.1:p.Arg37Lys, NP_001185784.1:p.Arg69Lys, XR_246073.1:n.512G>A, XR_945610.1:n.512G>A, rs60090616
C > T
SNP
R139K
No VIP available No Clinical Annotations available VA
rs11572103 NC_000010.10:g.96818106T>A, NC_000010.11:g.95058349T>A, NG_007972.1:g.16149A>T, NM_000770.3:c.805A>T, NM_001198853.1:c.595A>T, NM_001198854.1:c.499A>T, NM_001198855.1:c.595A>T, NP_000761.3:p.Ile269Phe, NP_001185782.1:p.Ile199Phe, NP_001185783.1:p.Ile167Phe, NP_001185784.1:p.Ile199Phe, XR_246073.1:n.901A>T, XR_945610.1:n.901A>T, rs52833642, rs58027822
T > A
SNP
I269F
No VIP available CA VA
rs11598702 NC_000010.10:g.104897985T>C, NC_000010.11:g.103138228T>C, NG_042272.1:g.60079A>G, NM_001134373.2:c.175+1178A>G, NM_012229.4:c.175+1178A>G, XM_005269632.1:c.175+1178A>G, XM_005269632.3:c.175+1178A>G, XM_005269633.1:c.175+1178A>G, XM_005269633.3:c.175+1178A>G, XM_005269634.1:c.175+1178A>G, XM_005269634.3:c.175+1178A>G, XM_005269635.1:c.175+1178A>G, XM_005269635.3:c.175+1178A>G, XM_005269636.1:c.175+1178A>G, XM_005269636.3:c.175+1178A>G, XM_005269637.1:c.88+1178A>G, XM_005269637.3:c.88+1178A>G, XM_005269638.1:c.79+1178A>G, XM_005269638.3:c.79+1178A>G, XM_005269639.1:c.88+1178A>G, XM_005269639.3:c.88+1178A>G, XM_005269640.1:c.-460+1178A>G, XM_005269640.3:c.-460+1178A>G, XM_005269641.1:c.-460+1178A>G, XM_005269641.3:c.-460+1178A>G, XM_005269642.1:c.-460+1178A>G, XM_005269642.3:c.-460+1178A>G, XM_005269643.1:c.-398-31522A>G, XM_005269643.3:c.-398-31522A>G, XM_005269644.1:c.-484+1178A>G, XM_005269644.3:c.-484+1178A>G, XM_005269645.1:c.-484+1178A>G, XM_005269645.3:c.-484+1178A>G, XM_005269646.1:c.-483-26423A>G, XM_005269646.3:c.-483-26423A>G, XM_006717721.2:c.-459-26423A>G, XM_006717722.2:c.-281+1178A>G, XM_006717723.2:c.-281+1178A>G, XM_006717724.2:c.-305+1178A>G, XM_011539534.1:c.175+1178A>G, XM_011539535.1:c.-1974A>G, XM_011539536.1:c.-43+1178A>G, XM_011539537.1:c.175+1178A>G, rs17728547, rs52826896, rs61084912
T > C
SNP
No VIP available No Clinical Annotations available VA
rs116134453
T > C
SNP
No VIP available CA VA
rs11615 NC_000019.10:g.45420395A>G, NC_000019.9:g.45923653A>G, NG_015839.2:g.63434T>C, NM_001166049.1:c.354T>C, NM_001983.3:c.354T>C, NM_202001.2:c.354T>C, NP_001159521.1:p.Asn118=, NP_001974.1:p.Asn118=, NP_973730.1:p.Asn118=, XM_005258634.1:c.354T>C, XM_005258635.1:c.354T>C, XM_005258635.2:c.354T>C, XM_005258636.1:c.354T>C, XM_005258636.3:c.354T>C, XM_005258637.1:c.354T>C, XM_005258638.1:c.138T>C, XM_011526610.1:c.354T>C, XP_005258691.1:p.Asn118=, XP_005258692.1:p.Asn118=, XP_005258693.1:p.Asn118=, XP_005258694.1:p.Asn118=, XP_005258695.1:p.Asn46=, XP_011524912.1:p.Asn118=, rs1130005, rs17285882, rs17359303, rs17845191, rs17858003, rs17859564, rs2228629, rs3177700, rs3188446, rs3752251, rs59923575
A > G
SNP
N118N
No VIP available No Clinical Annotations available VA
rs11646213
A > T
SNP
No VIP available No Clinical Annotations available VA
rs11671784 NC_000019.10:g.13836482G>A, NC_000019.9:g.13947296G>A, NR_029495.1:n.178C>T, NR_029497.1:n.-123C>T, NR_029501.1:n.36C>T, NR_036515.1:n.-193C>T
G > A
SNP
No VIP available No Clinical Annotations available VA
rs11692021 NC_000002.11:g.234591205T>C, NC_000002.12:g.233682559T>C, NG_002601.2:g.97816T>C, NM_019075.2:c.855+45182T>C, NM_019076.4:c.855+63997T>C, NM_019077.2:c.622T>C, NM_021027.2:c.855+9770T>C, NP_061950.2:p.Trp208Arg, XM_005246081.1:c.622T>C, XP_005246138.1:p.Trp208Arg, XR_241241.1:n.941+9770T>C, rs17863779, rs57605148
T > C
SNP
W208R
No VIP available CA VA
rs11719165 NC_000003.11:g.194586088T>C, NC_000003.12:g.194865359T>C, rs57619894
T > C
SNP
No VIP available No Clinical Annotations available VA
rs117308378
T > C
SNP
No VIP available No Clinical Annotations available VA
rs117412990
G > A
SNP
No VIP available No Clinical Annotations available VA
rs117484357
C > T
SNP
No VIP available No Clinical Annotations available VA
rs117876855
A > G
SNP
No VIP available No Clinical Annotations available VA
rs11861118
A > G
SNP
No VIP available CA VA
rs12046844 NC_000001.10:g.66238379G>A, NC_000001.11:g.65772696G>A, rs60665040
G > A
SNP
No VIP available No Clinical Annotations available VA
rs12059276 NC_000001.10:g.110273541C>T, NC_000001.11:g.109730919C>T, rs60940964
C > T
SNP
No VIP available CA No Variant Annotations available
rs12119882
A > G
SNP
No VIP available No Clinical Annotations available VA
rs1214763 NC_000006.11:g.43360261T>C, NC_000006.12:g.43392523T>C, XR_926814.1:n.400+789T>C, XR_926815.1:n.400+789T>C, rs1772678, rs2153700, rs60427804
T > C
SNP
No VIP available CA VA
rs12201199 NC_000006.11:g.18139802A>T, NC_000006.12:g.18139571A>T, NG_012137.2:g.20573T>A, NM_000367.3:c.419+94T>A, XM_011514839.1:c.419+94T>A, XM_011514840.1:c.350+94T>A, rs58109747
A > T
SNP
No VIP available No Clinical Annotations available VA
rs12211463 NC_000006.11:g.93467158T>G, NC_000006.12:g.92757440T>G, rs59764123
T > G
SNP
No VIP available No Clinical Annotations available VA
rs12468274 NC_000002.11:g.234627914T>C, NC_000002.12:g.233719268T>C, NG_002601.2:g.134525T>C, NM_001072.3:c.861+25403T>C, NM_007120.2:c.448T>C, NM_019075.2:c.856-47766T>C, NM_019076.4:c.856-47766T>C, NM_019077.2:c.855+36476T>C, NM_019078.1:c.867+5410T>C, NM_021027.2:c.855+46479T>C, NM_205862.1:c.60+25403T>C, NP_009051.1:p.Leu150=, XR_241238.1:n.504T>C, XR_241240.1:n.1022+25403T>C, XR_241241.1:n.941+46479T>C
T > C
SNP
L150L
No VIP available No Clinical Annotations available VA
rs12658397 NC_000005.10:g.102415949T>C, NC_000005.9:g.101751653T>C, NM_001289002.1:c.1473-2806A>G, NM_001289004.1:c.1287-2806A>G, NM_001308014.1:c.714-2806A>G, NM_173488.4:c.1473-2806A>G, XM_005271873.1:c.1473-2806A>G, XM_005271874.1:c.1473-2806A>G, XM_005271874.2:c.1473-2806A>G, XM_005271875.1:c.1287-2806A>G, XM_005271876.1:c.1287-2806A>G, XM_005271877.1:c.714-2806A>G, XM_011543147.1:c.1368-2806A>G, XM_011543148.1:c.1236-2806A>G, XM_011543149.1:c.900-2806A>G, XM_011543150.1:c.744-2806A>G, XM_011543151.1:c.714-2806A>G, XM_011543152.1:c.714-2806A>G, XM_011543153.1:c.651-2806A>G, rs61168560
T > C
SNP
No VIP available CA No Variant Annotations available
rs12721627 NC_000007.13:g.99366093G>C, NC_000007.14:g.99768470G>C, NG_008421.1:g.20716C>G, NM_001202855.2:c.554C>G, NM_017460.5:c.554C>G, NP_001189784.1:p.Thr185Ser, NP_059488.2:p.Thr185Ser, XM_011515841.1:c.554C>G, XM_011515842.1:c.554C>G, XP_011514143.1:p.Thr185Ser, XP_011514144.1:p.Thr185Ser, rs28371754, rs56915287
G > C
SNP
T185S
No VIP available No Clinical Annotations available VA
rs12762549 NC_000010.10:g.101620771C>G, NC_000010.11:g.99861014C>G, rs61161342
C > G
SNP
No VIP available CA VA
rs12948783 NC_000017.10:g.74499400G>A, NC_000017.11:g.76503318G>A, NG_032852.1:g.3110C>T, NM_024599.5:c.-2185C>T, XM_005257669.1:c.-2602C>T, XM_005257669.2:c.-2602C>T, XM_005257670.1:c.-2185C>T, XM_005257671.1:c.-2286C>T, XM_011525250.1:c.-2286C>T, XM_011525251.1:c.-2127C>T, XM_011525252.1:c.-2185C>T, rs117129397, rs60624663
G > A
G > T
SNP
No VIP available CA No Variant Annotations available
rs13058338 NC_000022.10:g.37632770T>A, NC_000022.11:g.37236730T>A, NG_007288.1:g.12536A>T, NM_002872.3:c.108-3812A>T, NM_002872.4:c.108-3812A>T, XM_006724286.2:c.108-3812A>T, rs52805510
T > A
T > G
SNP
No VIP available No Clinical Annotations available VA
rs13401281 NC_000002.11:g.234628679T>G, NC_000002.12:g.233720033T>G, NG_002601.2:g.135290T>G, NM_001072.3:c.861+26168T>G, NM_007120.2:c.867+346T>G, NM_019075.2:c.856-47001T>G, NM_019076.4:c.856-47001T>G, NM_019077.2:c.855+37241T>G, NM_019078.1:c.867+6175T>G, NM_021027.2:c.856-47001T>G, NM_205862.1:c.60+26168T>G, XR_241238.1:n.923+346T>G, XR_241240.1:n.1022+26168T>G, XR_241241.1:n.942-47001T>G
T > G
SNP
No VIP available No Clinical Annotations available VA
rs13422094 NC_000002.11:g.22181114T>C, NC_000002.12:g.21958242T>C, XR_939813.1:n.185+6266T>C
T > C
SNP
No VIP available No Clinical Annotations available VA
rs138385713
G > A
SNP
No VIP available No Clinical Annotations available VA
rs139368788
A > G
SNP
No VIP available No Clinical Annotations available VA
rs139544515
A > G
SNP
No VIP available No Clinical Annotations available VA
rs141213385
G > C
G > T
SNP
No VIP available No Clinical Annotations available VA
rs141531882
C > A
C > T
SNP
No VIP available No Clinical Annotations available VA
rs143414470
T > C
SNP
No VIP available No Clinical Annotations available VA
rs144470777
C > T
SNP
No VIP available No Clinical Annotations available VA
rs146644707
T > C
SNP
No VIP available No Clinical Annotations available VA
rs146898897
C > T
SNP
No VIP available CA VA
rs151264360 NC_000018.10:g.673444_673449delTTAAAG, NC_000018.9:g.673444_673449delTTAAAG, NG_028255.1:g.20841_20846delTTAAAG, NM_001071.2:c.*447_*452delTTAAAG, NM_001126123.3:c.*145-373_*145-368del, NM_001126123.3:c.*145-373_*145-368delCTTTAA, NM_001318759.1:c.*145-373_*145-368del, NM_001318759.1:c.*145-373_*145-368delCTTTAA, NM_001318760.1:c.*446+410_*446+415delCTTTAA, NM_001318760.1:c.*856_*861del, NM_017512.5:c.*856_*861delCTTTAA, NM_202758.3:c.*856_*861delCTTTAA, XM_005258111.1:c.*856_*861delCTTTAA, XM_005258112.1:c.*856_*861delCTTTAA, XM_005258113.1:c.*856_*861delCTTTAA, XM_005258114.1:c.*856_*861delCTTTAA, XM_005258115.1:c.*856_*861delCTTTAA, XM_005258116.1:c.*856_*861delCTTTAA, XM_005258117.1:c.*856_*861delCTTTAA, XM_005258118.1:c.*856_*861delCTTTAA, XM_005258118.2:c.*856_*861del, XM_005258120.1:c.*856_*861delCTTTAA, XM_005258137.1:c.*447_*452delTTAAAG, XM_005258138.1:c.*447_*452delTTAAAG, XM_011525677.1:c.*856_*861del, XM_011525678.1:c.*856_*861del, XM_011525679.1:c.*856_*861del, XM_011525680.1:c.*856_*861del, XM_011525681.1:c.*856_*861del, XM_011525682.1:c.*856_*861del, XM_011525683.1:c.*856_*861del, XM_011525684.1:c.*856_*861del, XM_011525685.1:c.*856_*861del, XM_011525686.1:c.*856_*861del, XM_011525687.1:c.*856_*861del, XM_011525688.1:c.*856_*861del, XM_011525689.1:c.*856_*861del, XM_011525690.1:c.*856_*861del, XM_011525691.1:c.*856_*861del, XM_011525692.1:c.*856_*861del, XM_011525693.1:c.*856_*861del, XM_011525694.1:c.*856_*861del, XM_011525695.1:c.*856_*861del, XM_011525696.1:c.*856_*861del, XM_011525697.1:c.*856_*861del, XM_011525698.1:c.*856_*861del, XM_011525699.1:c.*856_*861del, XR_243810.1:n.1672-373_1672-368delCTTTAA, XR_243810.3:n.1513-373_1513-368del, XR_243811.1:n.1538-373_1538-368delCTTTAA, XR_243811.2:n.1538-373_1538-368del, XR_243812.1:n.2112_2117delCTTTAA, XR_430041.2:n.1633-373_1633-368del, XR_935066.1:n.2109_2114del, XR_935067.1:n.1967_1972del
TTAAAG > -
indel
No VIP available No Clinical Annotations available VA
rs1523127 NC_000003.11:g.119501039C>A, NC_000003.12:g.119782192C>A, NG_011856.1:g.6709C>A, NM_003889.3:c.-131C>A, NM_022002.2:c.-566C>A, NM_033013.2:c.-131C>A, XM_005247866.1:c.-296C>A, rs58645792
C > A
SNP
No VIP available No Clinical Annotations available VA
rs1523130 NC_000003.11:g.119499507T>C, NC_000003.12:g.119780660T>C, NG_011856.1:g.5177T>C, NM_003889.3:c.-1663T>C, NM_033013.2:c.-1663T>C, XM_005247866.1:c.-1828T>C, rs118196528, rs3814054, rs59854583, rs61314694
T > C
SNP
No VIP available No Clinical Annotations available VA
rs1551285 NC_000002.11:g.234529122A>C, NC_000002.12:g.233620476A>C, NG_002601.2:g.35733A>C, NM_019076.4:c.855+1914A>C, rs60826737
A > C
SNP
No VIP available No Clinical Annotations available VA
rs1617640 NC_000007.13:g.100317298C>A, NC_000007.14:g.100719675C>A, NG_021471.1:g.3876C>A, NM_000799.2:c.-1306C>A, XM_005250190.1:c.-1306C>A, rs10304599, rs10342152, rs57979509
C > A
SNP
No VIP available No Clinical Annotations available VA
rs165728 NC_000022.10:g.19957023C>T, NC_000022.11:g.19969500C>T, NG_011526.1:g.32761C>T, NG_023326.1:g.52287G>A, NM_000754.3:c.*764C>T, NM_001135161.1:c.*764C>T, NM_001135162.1:c.*764C>T, NM_001670.2:c.*1256G>A, NM_001670.2:c.*877+379G>A, NM_007310.2:c.*764C>T, XM_005261229.1:c.*764C>T, XM_005261242.1:c.2764-2291G>A, XM_005261243.1:c.*1256G>A, XM_005261243.3:c.*1256G>A, XM_005261244.1:c.*1217G>A, XM_005261244.3:c.*1217G>A, XM_006724243.1:c.2782-2291G>A, XM_006724245.2:c.*1217G>A, XM_006724246.2:c.2536-2291G>A, XM_006724247.2:c.*1256G>A, XM_006724248.2:c.*1256G>A, XM_011529886.1:c.*764C>T, XM_011530179.1:c.2749-2291G>A, XM_011530182.1:c.1348-2291G>A, XM_011530183.1:c.*1217G>A, XR_937863.1:n.4112G>A, rs59845570
C > T
SNP
No VIP available CA No Variant Annotations available
rs1695 NC_000011.10:g.67585218A>G, NC_000011.9:g.67352689A>G, NG_012075.1:g.6624A>G, NM_000852.3:c.313A>G, NP_000843.1:p.Ile105Val, XM_005273958.1:c.313A>G, XP_005274015.1:p.Ile105Val, rs1138257, rs11553891, rs17353321, rs17856342, rs2230827, rs4609, rs56971933, rs947894
A > G
SNP
I105V
No VIP available No Clinical Annotations available VA
rs17110453 NC_000010.10:g.96829529A>C, NC_000010.11:g.95069772A>C, NG_007972.1:g.4726T>G, NM_000770.3:c.-370T>G, NM_001198853.1:c.-618T>G, NM_001198854.1:c.-551T>G, NM_001198855.1:c.-680T>G, XR_246073.1:n.-274T>G, XR_945610.1:n.-274T>G, rs386542449, rs56470669, rs57410615
A > C
SNP
No VIP available No Clinical Annotations available VA
rs17216177 NC_000010.10:g.101603522T>C, NC_000010.11:g.99843765T>C, NG_011798.1:g.66060T>C, NM_000392.4:c.3742-34T>C, XM_005269536.1:c.3463-34T>C, XM_006717630.2:c.3046-34T>C, XR_945604.1:n.3931-34T>C, XR_945605.1:n.3806-34T>C, rs45616434
T > C
SNP
No VIP available No Clinical Annotations available VA
rs17287570 NC_000016.10:g.16061246A=, NC_000016.10:g.16061246A>C, NC_000016.9:g.16155103A>C, NG_028268.1:g.116670A=, NG_028268.1:g.116670A>C, NM_004996.3:c.1677+4951A>C, NM_004996.3:c.1677+4951C>A, NT_187607.1:g.1719137C=, NT_187607.1:g.1719137C>A, XM_005255326.1:c.1677+4951A>C, XM_005255327.1:c.1551+4951A>C, XM_005255328.1:c.1539+4951A>C, XM_005255329.1:c.1677+4951A>C, XM_011522497.1:c.1653+4951A>C, XM_011522497.1:c.1653+4951C>A, XM_011522498.1:c.1731+4951A>C, XM_011522498.1:c.1731+4951C>A, rs57882411
A > C
SNP
No VIP available CA VA
rs1736557 NC_000001.10:g.171080080G>A, NC_000001.11:g.171110939G>A, NG_012690.1:g.25063G>A, NM_001002294.2:c.769G>A, NM_001319173.1:c.709G>A, NM_001319174.1:c.580G>A, NM_006894.4:c.769G>A, NM_006894.5:c.769G>A, NP_001002294.1:p.Val257Met, NP_001306102.1:p.Val237Met, NP_001306103.1:p.Val194Met, NP_008825.4:p.Val257Met, XM_005245043.1:c.709G>A, XM_005245044.1:c.580G>A, XM_011509345.1:c.709G>A, XM_011509346.1:c.709G>A, XP_005245100.1:p.Val237Met, XP_005245101.1:p.Val194Met, XP_011507647.1:p.Val237Met, XP_011507648.1:p.Val237Met, rs17845981, rs17858963, rs56477964, rs58508781
G > A
SNP
V257M
No VIP available CA VA
rs17376848 NC_000001.10:g.97915624A>G, NC_000001.11:g.97450068A>G, NG_008807.2:g.475992T>C, NM_000110.3:c.1896T>C, NP_000101.2:p.Phe632=, XM_005270561.1:c.1785T>C, XM_005270562.1:c.1680T>C, XM_005270562.3:c.1680T>C, XM_005270563.1:c.1896T>C, XM_006710397.2:c.1896T>C, XP_005270618.1:p.Phe595=, XP_005270619.1:p.Phe560=, XP_005270619.2:p.Phe560=, XP_005270620.1:p.Phe632=, XP_006710460.1:p.Phe632=, rs117467766, rs52815410, rs58485702
A > G
SNP
F632F
No VIP available No Clinical Annotations available VA
rs174699 NC_000022.10:g.19954458C>T, NC_000022.11:g.19966935C>T, NG_011526.1:g.30196C>T, NM_000754.3:c.616-1601C>T, NM_001135161.1:c.616-1601C>T, NM_001135162.1:c.616-1601C>T, NM_007310.2:c.466-1601C>T, XM_005261229.1:c.616-1601C>T, XM_005261242.1:c.*41G>A, XM_006724243.1:c.*41G>A, XM_006724246.2:c.*41G>A, XM_011529885.1:c.730-229C>T, XM_011529886.1:c.730-1601C>T, XM_011529887.1:c.616-229C>T, XM_011529888.1:c.616-229C>T, XM_011529889.1:c.616-229C>T, XM_011529890.1:c.616-229C>T, XM_011529891.1:c.616-229C>T, XM_011530179.1:c.*41G>A, XM_011530182.1:c.*41G>A, rs361592, rs59292400, rs59837580
C > T
SNP
No VIP available CA VA
rs17583889 NC_000002.11:g.138746039C>A, NC_000002.12:g.137988469C>A, NG_012966.1:g.29232C>A, NM_006895.2:c.191-12449C>A, XM_005263654.1:c.191-12449C>A, XM_011511063.1:c.89-12449C>A, XM_011511064.1:c.-188-12449C>A
C > A
SNP
No VIP available CA VA
rs17645700 NC_000002.11:g.138780932T>C, NC_000002.12:g.138023362T>C, XR_244863.1:n.579-15566A>G
T > C
SNP
No VIP available No Clinical Annotations available VA
rs17822471 NC_000016.10:g.48208468G>A, NC_000016.9:g.48242379G>A, NG_011522.1:g.31710C>T, NM_032583.3:c.1637C>T, NM_033151.3:c.1637C>T, NM_145186.2:c.1637C>T, NP_115972.2:p.Thr546Met, NP_149163.2:p.Thr546Met, NP_660187.1:p.Thr546Met, XM_005256208.1:c.1637C>T, XM_005256209.1:c.1637C>T, XM_005256210.1:c.1637C>T, XM_011523396.1:c.1439C>T, XM_011523397.1:c.680C>T, XP_005256265.1:p.Thr546Met, XP_005256266.1:p.Thr546Met, XP_005256267.1:p.Thr546Met, XP_011521698.1:p.Thr480Met, XP_011521699.1:p.Thr227Met, XR_243432.1:n.1742C>T, rs386492901, rs52810988, rs57560138
G > A
SNP
T546M
No VIP available No Clinical Annotations available VA
rs17822931 NC_000016.10:g.48224287C>T, NC_000016.9:g.48258198C>T, NG_011522.1:g.15891G>A, NM_032583.3:c.538G>A, NM_033151.3:c.538G>A, NM_145186.2:c.538G>A, NP_115972.2:p.Gly180Arg, NP_149163.2:p.Gly180Arg, NP_660187.1:p.Gly180Arg, XM_005256208.1:c.538G>A, XM_005256209.1:c.538G>A, XM_005256210.1:c.538G>A, XM_011523396.1:c.340G>A, XM_011523397.1:c.-1144G>A, XP_005256265.1:p.Gly180Arg, XP_005256266.1:p.Gly180Arg, XP_005256267.1:p.Gly180Arg, XP_011521698.1:p.Gly114Arg, XR_243432.1:n.643G>A, rs52813591, rs58140753
C > T
SNP
G180R
No VIP available CA VA
rs17863783 NC_000002.11:g.234602277G>T, NC_000002.12:g.233693631G>T, NG_002601.2:g.108888G>T, NM_001072.3:c.627G>T, NM_019075.2:c.855+56254G>T, NM_019076.4:c.856-73403G>T, NM_019077.2:c.855+10839G>T, NM_021027.2:c.855+20842G>T, NM_205862.1:c.-7-168G>T, NP_001063.2:p.Val209=, XR_241240.1:n.788G>T, XR_241241.1:n.941+20842G>T, rs60686635
G > T
SNP
V209V
No VIP available CA VA
rs17868320 NC_000002.11:g.234578428C>T, NC_000002.12:g.233669782C>T, NG_002601.2:g.85039C>T, NM_019075.2:c.855+32405C>T, NM_019076.4:c.855+51220C>T
C > T
SNP
No VIP available No Clinical Annotations available VA
rs17868323 NC_000002.11:g.234590970T>G, NC_000002.12:g.233682324T>G, NG_002601.2:g.97581T>G, NM_019075.2:c.855+44947T>G, NM_019076.4:c.855+63762T>G, NM_019077.2:c.387T>G, NM_021027.2:c.855+9535T>G, NP_061950.2:p.Asn129Lys, XM_005246081.1:c.387T>G, XP_005246138.1:p.Asn129Lys, XR_241241.1:n.941+9535T>G
T > G
SNP
N129K
No VIP available No Clinical Annotations available VA
rs1799782 NC_000019.10:g.43553422G>A, NC_000019.9:g.44057574G>A, NG_033799.1:g.27157C>T, NM_006297.2:c.580C>T, NP_006288.2:p.Arg194Trp, rs11553655, rs2229674, rs3213359, rs3826914, rs386545546
G > A
SNP
R194W
No VIP available CA No Variant Annotations available
rs1799793 NC_000019.10:g.45364001C>T, NC_000019.9:g.45867259C>T, NG_007067.2:g.11587G>A, NM_000400.3:c.934G>A, NM_001130867.1:c.862G>A, NP_000391.1:p.Asp312Asn, NP_001124339.1:p.Asp288Asn, XM_005258639.1:c.862G>A, XM_005258640.1:c.700G>A, XM_005258641.1:c.196G>A, XM_005258642.1:c.934G>A, XM_011526611.1:c.856G>A, XP_005258696.1:p.Asp288Asn, XP_005258697.1:p.Asp234Asn, XP_005258698.1:p.Asp66Asn, XP_005258699.1:p.Asp312Asn, XP_011524913.1:p.Asp286Asn, XR_935763.1:n.981G>A, rs3916814, rs58989209
C > T
SNP
D312N
No VIP available No Clinical Annotations available VA
rs1799971 NC_000006.11:g.154360797A>G, NC_000006.12:g.154039662A>G, NG_021208.1:g.34162A>G, NM_000914.4:c.118A>G, NM_001008503.2:c.118A>G, NM_001008504.3:c.118A>G, NM_001008505.2:c.118A>G, NM_001145279.3:c.397A>G, NM_001145280.3:c.-11+28644A>G, NM_001145281.2:c.47+29103A>G, NM_001145282.2:c.118A>G, NM_001145283.2:c.118A>G, NM_001145284.3:c.118A>G, NM_001145285.2:c.118A>G, NM_001145286.2:c.118A>G, NM_001285522.1:c.118A>G, NM_001285523.1:c.118A>G, NM_001285524.1:c.397A>G, NP_000905.3:p.Asn40Asp, NP_001008503.2:p.Asn40Asp, NP_001008504.2:p.Asn40Asp, NP_001008505.2:p.Asn40Asp, NP_001138751.1:p.Asn133Asp, NP_001138754.1:p.Asn40Asp, NP_001138755.1:p.Asn40Asp, NP_001138756.1:p.Asn40Asp, NP_001138757.1:p.Asn40Asp, NP_001138758.1:p.Asn40Asp, NP_001272451.1:p.Asn40Asp, NP_001272452.1:p.Asn40Asp, NP_001272453.1:p.Asn133Asp, NR_104348.1:n.252A>G, NR_104349.1:n.252A>G, NR_104350.1:n.252A>G, NR_104351.1:n.252A>G, XM_005267002.1:c.304A>G, XM_006715497.2:c.304A>G, XM_011535849.1:c.397A>G, XP_005267059.1:p.Asn102Asp, XP_006715560.1:p.Asn102Asp, XP_011534151.1:p.Asn133Asp, XR_245534.1:n.304A>G, XR_245535.1:n.304A>G, XR_245536.1:n.304A>G, XR_245537.1:n.304A>G, rs17181017, rs52818856, rs61596185
A > G
SNP
N40D
No VIP available CA No Variant Annotations available
rs1799983 NC_000007.13:g.150696111T>G, NC_000007.14:g.150999023T>G, NG_011992.1:g.12965T>G, NM_000603.4:c.894T>G, NM_001160109.1:c.894T>G, NM_001160110.1:c.894T>G, NM_001160111.1:c.894T>G, NP_000594.2:p.Asp298Glu, NP_001153581.1:p.Asp298Glu, NP_001153582.1:p.Asp298Glu, NP_001153583.1:p.Asp298Glu, XM_006716002.2:c.894T>G, XP_006716065.1:p.Asp298Glu, rs11266811, rs13238975, rs13305983, rs13308813, rs17173672, rs3730304, rs57135373
T > G
SNP
D298E
No VIP available CA VA
rs1800460 NC_000006.11:g.18139228C>T, NC_000006.12:g.18138997C>T, NG_012137.2:g.21147G>A, NM_000367.3:c.460G>A, NP_000358.1:p.Ala154Thr, XM_011514839.1:c.460G>A, XM_011514840.1:c.391G>A, XP_011513141.1:p.Ala154Thr, XP_011513142.1:p.Ala131Thr, rs11568060, rs16880273, rs386545583, rs57650974
C > T
SNP
A154T
No VIP available CA No Variant Annotations available
rs1800566 NC_000016.10:g.69711242G>A, NC_000016.9:g.69745145G>A, NG_011504.1:g.20389C>T, NM_000903.2:c.559C>T, NM_001025433.1:c.457C>T, NM_001025434.1:c.445C>T, NM_001286137.1:c.343C>T, NP_000894.1:p.Pro187Ser, NP_001020604.1:p.Pro153Ser, NP_001020605.1:p.Pro149Ser, NP_001273066.1:p.Pro115Ser, XM_005255830.1:c.343C>T, XP_005255887.1:p.Pro115Ser, rs4134727, rs4149351, rs57135274
G > A
SNP
P187S
No VIP available No Clinical Annotations available VA
rs1801030 NC_000016.10:g.28606164C>T, NC_000016.9:g.28617485C>T, NG_028128.1:g.22382G>A, NM_001055.3:c.667G>A, NM_001310136.1:c.121-139262G>A, NM_177529.2:c.667G>A, NM_177530.2:c.667G>A, NM_177534.2:c.667G>A, NM_177536.3:c.433G>A, NP_001046.2:p.Val223Met, NP_803565.1:p.Val223Met, NP_803566.1:p.Val223Met, NP_803878.1:p.Val223Met, NP_803880.1:p.Val145Met, XM_005255522.1:c.667G>A, XP_005255579.1:p.Val223Met, rs61167940, rs8054402
C > T
SNP
V223M
No VIP available CA VA
rs1801131 NC_000001.10:g.11854476T>G, NC_000001.11:g.11794419T>G, NG_013351.1:g.16685A>C, NM_005957.4:c.1286A>C, NP_005948.3:p.Glu429Ala, XM_005263458.1:c.1409A>C, XM_005263458.2:c.1409A>C, XM_005263459.1:c.1355A>C, XM_005263460.1:c.1286A>C, XM_005263460.3:c.1286A>C, XM_005263461.1:c.1286A>C, XM_005263461.3:c.1286A>C, XM_005263462.1:c.1286A>C, XM_005263462.3:c.1286A>C, XM_005263463.1:c.1040A>C, XM_005263463.2:c.1040A>C, XM_011541495.1:c.1406A>C, XM_011541496.1:c.1409A>C, XP_005263515.1:p.Glu470Ala, XP_005263516.1:p.Glu452Ala, XP_005263517.1:p.Glu429Ala, XP_005263518.1:p.Glu429Ala, XP_005263519.1:p.Glu429Ala, XP_005263520.1:p.Glu347Ala, XP_011539797.1:p.Glu469Ala, XP_011539798.1:p.Glu470Ala, rs17367365, rs17857426, rs4134712
T > G
SNP
E429A
No VIP available CA VA
rs1801133 NC_000001.10:g.11856378G>A, NC_000001.11:g.11796321G>A, NG_013351.1:g.14783C>T, NM_005957.4:c.665C>T, NP_005948.3:p.Ala222Val, XM_005263458.1:c.788C>T, XM_005263458.2:c.788C>T, XM_005263459.1:c.734C>T, XM_005263460.1:c.665C>T, XM_005263460.3:c.665C>T, XM_005263461.1:c.665C>T, XM_005263461.3:c.665C>T, XM_005263462.1:c.665C>T, XM_005263462.3:c.665C>T, XM_005263463.1:c.419C>T, XM_005263463.2:c.419C>T, XM_011541495.1:c.785C>T, XM_011541496.1:c.788C>T, XP_005263515.1:p.Ala263Val, XP_005263516.1:p.Ala245Val, XP_005263517.1:p.Ala222Val, XP_005263518.1:p.Ala222Val, XP_005263519.1:p.Ala222Val, XP_005263520.1:p.Ala140Val, XP_011539797.1:p.Ala262Val, XP_011539798.1:p.Ala263Val, rs386545618, rs4134713, rs59514310
G > A
SNP
A222V
No VIP available CA VA
rs1801158 NC_000001.10:g.97981421C>T, NC_000001.11:g.97515865C>T, NG_008807.2:g.410195G>A, NM_000110.3:c.1601G>A, NP_000101.2:p.Ser534Asn, XM_005270561.1:c.1490G>A, XM_005270562.1:c.1524+33695G>A, XM_005270562.3:c.1524+33695G>A, XM_005270563.1:c.1601G>A, XM_005270564.1:c.1601G>A, XM_006710397.2:c.1601G>A, XP_005270618.1:p.Ser497Asn, XP_005270620.1:p.Ser534Asn, XP_005270621.1:p.Ser534Asn, XP_006710460.1:p.Ser534Asn, rs199469539, rs52824375, rs59516208
C > T
SNP
S534N
No VIP available CA VA
rs1801159 NC_000001.10:g.97981395T>C, NC_000001.11:g.97515839T>C, NG_008807.2:g.410221A>G, NM_000110.3:c.1627A>G, NP_000101.2:p.Ile543Val, XM_005270561.1:c.1516A>G, XM_005270562.1:c.1524+33721A>G, XM_005270562.3:c.1524+33721A>G, XM_005270563.1:c.1627A>G, XM_005270564.1:c.1627A>G, XM_006710397.2:c.1627A>G, XP_005270618.1:p.Ile506Val, XP_005270620.1:p.Ile543Val, XP_005270621.1:p.Ile543Val, XP_006710460.1:p.Ile543Val, rs117999026, rs17116825, rs199469541, rs386545620, rs58945530
T > C
SNP
I543V
No VIP available CA VA
rs1801160 NC_000001.10:g.97770920C>T, NC_000001.11:g.97305364C>T, NG_008807.2:g.620696G>A, NM_000110.3:c.2194G>A, NP_000101.2:p.Val732Ile, NR_046590.1:n.129-825C>T, XM_005270561.1:c.2083G>A, XM_005270562.1:c.1978G>A, XM_005270562.3:c.1978G>A, XM_005270563.1:c.2194G>A, XM_006710397.2:c.2194G>A, XP_005270618.1:p.Val695Ile, XP_005270619.1:p.Val660Ile, XP_005270619.2:p.Val660Ile, XP_005270620.1:p.Val732Ile, XP_006710460.1:p.Val732Ile, rs12720467, rs12720468, rs199469554
C > T
SNP
V732I
No VIP available CA VA
rs1801265 NC_000001.10:g.98348885G=, NC_000001.10:g.98348885G>A, NC_000001.11:g.97883329A=, NC_000001.11:g.97883329A>G, NG_008807.2:g.42731T=, NG_008807.2:g.42731T>C, NM_000110.3:c.85T=, NM_000110.3:c.85T>C, NM_001160301.1:c.85T=, NM_001160301.1:c.85T>C, NP_000101.2:p.Cys29=, NP_000101.2:p.Cys29Arg, NP_001153773.1:p.Cys29=, NP_001153773.1:p.Cys29Arg, XM_005270561.1:c.39+37555C>T, XM_005270561.1:c.39+37555T>C, XM_005270562.1:c.85C=, XM_005270562.1:c.85C>T, XM_005270562.3:c.85T=, XM_005270562.3:c.85T>C, XM_005270563.1:c.85C=, XM_005270563.1:c.85C>T, XM_005270564.1:c.85C=, XM_005270564.1:c.85C>T, XM_006710397.2:c.85T=, XM_006710397.2:c.85T>C, XP_005270619.1:p.Arg29=, XP_005270619.1:p.Arg29Cys, XP_005270619.2:p.Cys29=, XP_005270619.2:p.Cys29Arg, XP_005270620.1:p.Arg29=, XP_005270620.1:p.Arg29Cys, XP_005270621.1:p.Arg29=, XP_005270621.1:p.Arg29Cys, XP_006710460.1:p.Cys29=, XP_006710460.1:p.Cys29Arg, rs199469510, rs3211355, rs52823090, rs57596852
G > A
SNP
C29R
No VIP available CA VA
rs183205964 NC_000018.10:g.657657G>C, NC_000018.9:g.657657G>C, NG_028255.1:g.5054G>C, NM_001012716.2:c.*34+185C>G, NM_001071.2:c.-86G>C, XM_005258137.1:c.-86G>C, XM_005258138.1:c.-86G>C
G > C
SNP
No VIP available CA No Variant Annotations available
rs183484 NC_000011.10:g.4119902C>A, NC_000011.9:g.4141132C>A, NG_027992.2:g.30209C>A, NM_001033.3:c.850C>A, NM_001033.4:c.850C>A, NM_001318064.1:c.559C>A, NM_001318065.1:c.-207C>A, NP_001024.1:p.Arg284=, NP_001304993.1:p.Arg187=, XM_005253058.1:c.607C>A, XM_005253059.1:c.559C>A, XM_011520277.1:c.559C>A, XM_011520278.1:c.184C>A, XM_011520279.1:c.-207C>A, XP_005253115.1:p.Arg203=, XP_005253116.1:p.Arg187=, XP_011518579.1:p.Arg187=, XP_011518580.1:p.Arg62=, rs17210748, rs1735058, rs17850105, rs2228122
C > A
SNP
R284R
No VIP available No Clinical Annotations available VA
rs185217050
T > C
SNP
No VIP available No Clinical Annotations available VA
rs185346775
A > G
SNP
No VIP available No Clinical Annotations available VA
rs1872328 NC_000002.11:g.54395259G>A, NC_000002.12:g.54168122G>A, NM_138448.3:c.185+29374G>A
G > A
SNP
No VIP available No Clinical Annotations available VA
rs187805828
C > T
SNP
No VIP available CA No Variant Annotations available
rs1883112 NC_000022.10:g.37256846G>A, NC_000022.11:g.36860804G>A, NG_023400.1:g.4817G>A, NM_000631.4:c.-368G>A, NM_013416.3:c.-368G>A, NT_187631.1:g.81598G>A, XM_011530198.1:c.-1851G>A, XM_011530199.1:c.-915G>A, rs13055287, rs34673077, rs61381844
G > A
SNP
No VIP available No Clinical Annotations available VA
rs1885301 NC_000010.10:g.101541053A>G, NC_000010.11:g.99781296A>G, NG_011798.1:g.3591A>G, NM_000392.4:c.-1549A>G, XM_005269536.1:c.-1549A>G, XM_006717631.2:c.-1549A>G, XM_011539291.1:c.-1549A>G, XR_945604.1:n.-1360A>G, XR_945605.1:n.-1358A>G, rs17216261, rs59934936
A > G
SNP
No VIP available CA VA
rs1901440 NC_000002.11:g.134437959C>A, NC_000002.12:g.133680388C>A, rs60584215
C > A
SNP
No VIP available No Clinical Annotations available VA
rs191934521
G > A
G > T
SNP
No VIP available No Clinical Annotations available VA
rs2010963 NC_000006.11:g.43738350C>G, NC_000006.12:g.43770613C>G, NG_008732.1:g.5398C>G, NM_001025366.2:c.-94C>G, NM_001025367.2:c.-94C>G, NM_001025368.2:c.-94C>G, NM_001025369.2:c.-94C>G, NM_001025370.2:c.-94C>G, NM_001033756.2:c.-94C>G, NM_001171622.1:c.-94C>G, NM_001171623.1:c.-634C>G, NM_001171624.1:c.-634C>G, NM_001171625.1:c.-634C>G, NM_001171626.1:c.-634C>G, NM_001171627.1:c.-634C>G, NM_001171628.1:c.-634C>G, NM_001171629.1:c.-634C>G, NM_001171630.1:c.-634C>G, NM_001204384.1:c.-634C>G, NM_001204385.1:c.-94C>G, NM_001287044.1:c.-1507C>G, NM_001317010.1:c.-634C>G, NM_003376.5:c.-94C>G, XM_005249363.1:c.-1507C>G
C > G
SNP
No VIP available No Clinical Annotations available VA
rs2011404 NC_000002.11:g.234627937T>C, NC_000002.12:g.233719291T>C, NG_002601.2:g.134548T>C, NM_001072.3:c.861+25426T>C, NM_007120.2:c.471T>C, NM_019075.2:c.856-47743T>C, NM_019076.4:c.856-47743T>C, NM_019077.2:c.855+36499T>C, NM_019078.1:c.867+5433T>C, NM_021027.2:c.855+46502T>C, NM_205862.1:c.60+25426T>C, NP_009051.1:p.Cys157=, XR_241238.1:n.527T>C, XR_241240.1:n.1022+25426T>C, XR_241241.1:n.941+46502T>C, rs17633274, rs17866660, rs56712128
T > C
SNP
C157C
No VIP available CA VA
rs2019604 NC_000016.10:g.89549357T>G, NC_000016.9:g.89615765T>G, NG_008082.1:g.45961T>G, NM_003119.3:c.1664-1137T>G, XM_005256320.1:c.-21+2427T>G, XM_006721264.2:c.1664-1137T>G, rs17783931, rs3888234, rs57996679, rs74251519
T > G
SNP
No VIP available No Clinical Annotations available VA
rs2020870 NC_000001.10:g.171154959A>G, NC_000001.11:g.171185820A>G, NM_001301347.1:c.-386+461A>G, NM_001460.4:c.107A>G, NP_001451.2:p.Asp36Gly, XM_005245039.1:c.107A>G, XP_005245096.1:p.Asp36Gly, XR_426768.2:n.224A>G, XR_921761.1:n.224A>G, XR_922278.1:n.508-17632T>C, rs2266712, rs52821140, rs58458262
A > G
SNP
D36G
No VIP available No Clinical Annotations available VA
rs2032582 NC_000007.13:g.87160618A>C, NC_000007.13:g.87160618A>T, NC_000007.14:g.87531302A>C, NC_000007.14:g.87531302A>T, NG_011513.1:g.186947T>A, NG_011513.1:g.186947T>G, NM_000927.4:c.2677T>A, NM_000927.4:c.2677T>G, NP_000918.2:p.Ser893Ala, NP_000918.2:p.Ser893Thr, rs10228331, rs2229106, rs386553610, rs57135550, rs9641018
A > C
A > T
SNP
S893A
No VIP available No Clinical Annotations available VA
rs2070474 NC_000022.10:g.24891292C>G, NC_000022.11:g.24495324C>G, NG_012858.1:g.5042C>G, NM_016327.2:c.-80C>G, NR_028483.2:n.-250G>C, NR_028484.2:n.-250G>C, XM_005261633.1:c.-112C>G, XM_011530222.1:c.-80C>G, XM_011530223.1:c.-80C>G, XM_011530224.1:c.-80C>G, XM_011530225.1:c.-522C>G, XR_244378.1:n.265C>G, XR_937867.1:n.858C>G, rs199469575
C > G
SNP
No VIP available CA VA
rs2072671 NC_000001.10:g.20915701A>C, NC_000001.11:g.20589208A>C, NM_001785.2:c.79A>C, NP_001776.1:p.Lys27Gln, rs57221291
A > C
SNP
K27Q
No VIP available CA VA
rs2075252 NC_000002.11:g.170010985T>C, NC_000002.12:g.169154475T>C, NG_012634.1:g.213138A>G, NM_004525.2:c.12280A>G, NP_004516.2:p.Lys4094Glu, XM_005246551.1:c.9991A>G, XM_011511183.1:c.12151A>G, XM_011511184.1:c.9991A>G, XP_005246608.1:p.Lys3331Glu, XP_011509485.1:p.Lys4051Glu, XP_011509486.1:p.Lys3331Glu, rs17848193, rs386556527, rs52808684, rs59573352
T > C
SNP
K4094E
No VIP available No Clinical Annotations available VA
rs2075507 NC_000022.10:g.19928092G>A, NC_000022.11:g.19940569G>A, NG_011526.1:g.3830G>A, NG_011835.1:g.6268C>T, NM_000754.3:c.-1420G>A, NM_001282512.1:c.103+1132C>T, NM_006440.3:c.103+1132C>T, NM_006440.4:c.103+1132C>T, XM_005261214.1:c.103+1132C>T, XM_005261216.1:c.103+1132C>T, XM_005261217.1:c.103+1132C>T, XM_005261229.1:c.-1714G>A, XM_011529887.1:c.-1420G>A, XM_011529890.1:c.-1714G>A, XM_011529891.1:c.-1992G>A, rs2097603, rs2234763, rs3937420, rs4646309
G > A
SNP
No VIP available CA VA
rs2108623 NC_000019.10:g.15906196G>A, NC_000019.9:g.16017006G>A, rs17454858, rs3947944, rs4429395, rs59294251
G > A
SNP
No VIP available No Clinical Annotations available VA
rs2180314 NC_000006.11:g.52617731C>G, NC_000006.12:g.52752933C>G, NG_029430.1:g.15631G>C, NM_000846.4:c.335G>C, NP_000837.3:p.Ser112Thr, XM_011514532.1:c.335G>C, XP_011512834.1:p.Ser112Thr, rs17605670, rs17849682, rs3178048, rs52806894, rs57248371
C > G
SNP
S112T
No VIP available CA No Variant Annotations available
rs2207396 NC_000006.11:g.152382382G>A, NC_000006.12:g.152061247G>A, NG_008493.1:g.375752G>A, NM_000125.3:c.1369+123G>A, NM_001122740.1:c.1369+123G>A, NM_001122741.1:c.1369+123G>A, NM_001122742.1:c.1369+123G>A, NM_001291230.1:c.1375+123G>A, NM_001291241.1:c.1366+123G>A, XM_005266856.1:c.1375+123G>A, XM_005266857.1:c.1366+123G>A, XM_006715374.2:c.1369+123G>A, XM_006715375.2:c.850+123G>A, XM_011535543.1:c.1369+123G>A, XM_011535544.1:c.1369+123G>A, XM_011535545.1:c.1369+123G>A, XM_011535546.1:c.1369+123G>A, XM_011535547.1:c.1369+123G>A, XM_011535548.1:c.850+123G>A, XM_011535549.1:c.640+123G>A, XR_943116.1:n.7257C>T, rs17847072, rs57792040
G > A
SNP
No VIP available CA VA
rs2227983 NC_000007.13:g.55229255G>A, NC_000007.14:g.55161562G>A, NG_007726.3:g.147531G>A, NM_005228.3:c.1562G>A, NM_201282.1:c.1562G>A, NM_201284.1:c.1562G>A, NP_005219.2:p.Arg521Lys, NP_958439.1:p.Arg521Lys, NP_958441.1:p.Arg521Lys, XM_005271746.1:c.1427G>A, XM_005271747.1:c.1403G>A, XM_005271748.1:c.1562G>A, XP_005271803.1:p.Arg476Lys, XP_005271804.1:p.Arg468Lys, XP_005271805.1:p.Arg521Lys, rs11543848, rs117960725, rs12234746, rs17336807, rs3752650
G > A
SNP
R521K
No VIP available CA No Variant Annotations available
rs2228001 NC_000003.11:g.14187449G>T, NC_000003.12:g.14145949G>T, NG_011763.1:g.37724C>A, NM_001145769.1:c.2704C>A, NM_004628.4:c.2815C>A, NP_001139241.1:p.Gln902Lys, NP_004619.3:p.Gln939Lys, NR_027299.1:n.2795C>A, rs17620623, rs17856505, rs3729583, rs60736379
G > T
SNP
Q902K
No VIP available No Clinical Annotations available VA
rs2228100 NC_000017.10:g.19642952G>C, NC_000017.11:g.19739639G>C, NG_012251.1:g.13795C>G, NM_000691.4:c.985C>G, NM_001135167.1:c.985C>G, NM_001135168.1:c.985C>G, NP_000682.3:p.Pro329Ala, NP_001128639.1:p.Pro329Ala, NP_001128640.1:p.Pro329Ala, XM_005256522.1:c.1336C>G, XM_005256523.1:c.1336C>G, XM_005256523.2:c.1336C>G, XM_005256524.1:c.1336C>G, XM_005256524.3:c.1336C>G, XM_005256525.1:c.1336C>G, XM_005256526.1:c.766C>G, XM_011523730.1:c.766C>G, XM_011523731.1:c.766C>G, XP_005256579.1:p.Pro446Ala, XP_005256580.1:p.Pro446Ala, XP_005256581.1:p.Pro446Ala, XP_005256582.1:p.Pro446Ala, XP_005256583.1:p.Pro256Ala, XP_011522032.1:p.Pro256Ala, XP_011522033.1:p.Pro256Ala, rs3744696, rs56956419
G > C
SNP
P329A
No VIP available CA VA
rs2228171 NC_000002.11:g.170053505C>T, NC_000002.12:g.169196995C>T, NG_012634.1:g.170618G>A, NM_004525.2:c.8614G>A, NP_004516.2:p.Ala2872Thr, XM_005246551.1:c.6325G>A, XM_005246552.1:c.8614G>A, XM_011511183.1:c.8614G>A, XM_011511184.1:c.6325G>A, XM_011511185.1:c.8614G>A, XP_005246608.1:p.Ala2109Thr, XP_005246609.1:p.Ala2872Thr, XP_011509485.1:p.Ala2872Thr, XP_011509486.1:p.Ala2109Thr, XP_011509487.1:p.Ala2872Thr, rs117432666, rs17848174, rs2302697, rs4668123, rs52816657, rs57579868
C > T
SNP
A2872T
No VIP available CA VA
rs2229774 NC_000012.11:g.53605545G>A, NC_000012.12:g.53211761G>A, NG_029822.1:g.25496C>T, NM_000966.5:c.1280C>T, NM_001042728.2:c.1247C>T, NM_001243730.1:c.1064C>T, NM_001243731.1:c.917C>T, NM_001243732.1:c.1214C>T, NP_000957.1:p.Ser427Leu, NP_001036193.1:p.Ser416Leu, NP_001230659.1:p.Ser355Leu, NP_001230660.1:p.Ser306Leu, NP_001230661.1:p.Ser405Leu, XM_005269054.1:c.1541C>T, XM_005269054.2:c.1541C>T, XM_005269055.1:c.1541C>T, XM_005269055.2:c.1541C>T, XM_005269056.1:c.1280C>T, XM_005269056.2:c.1280C>T, XM_005269057.1:c.1280C>T, XM_011538628.1:c.1064C>T, XP_005269111.1:p.Ser514Leu, XP_005269112.1:p.Ser514Leu, XP_005269113.1:p.Ser427Leu, XP_005269114.1:p.Ser427Leu, XP_011536930.1:p.Ser355Leu, rs116930311, rs61642612
G > A
SNP
S427L
No VIP available CA VA
rs2231142 NC_000004.11:g.89052323G>T, NC_000004.12:g.88131171G>T, NG_032067.2:g.105152C>A, NM_001257386.1:c.421C>A, NM_004827.2:c.421C>A, NP_001244315.1:p.Gln141Lys, NP_004818.2:p.Gln141Lys, XM_005263354.1:c.421C>A, XM_005263354.2:c.421C>A, XM_005263355.1:c.421C>A, XM_005263355.2:c.421C>A, XM_005263356.1:c.421C>A, XM_005263356.2:c.421C>A, XM_011532420.1:c.421C>A, XP_005263411.1:p.Gln141Lys, XP_005263412.1:p.Gln141Lys, XP_005263413.1:p.Gln141Lys, XP_011530722.1:p.Gln141Lys, rs12721641, rs28365035, rs3736117, rs52809243, rs58973676
G > T
SNP
Q141K
No VIP available No Clinical Annotations available VA
rs2232228 NC_000016.10:g.69109674A>G, NC_000016.9:g.69143577A>G, NM_001199280.1:c.279A>G, NM_005329.2:c.279A>G, NM_138612.2:c.279A>G, NP_001186209.1:p.Ala93=, NP_005320.2:p.Ala93=, NP_619515.1:p.Ala93=, XM_005255919.1:c.687A>G, XM_005255920.1:c.279A>G, XM_005255921.1:c.279A>G, XM_011523061.1:c.279A>G, XP_005255976.1:p.Ala229=, XP_005255977.1:p.Ala93=, XP_005255978.1:p.Ala93=, XP_011521363.1:p.Ala93=, rs17845662, rs17858598, rs3743679, rs61175697
A > G
SNP
A93A
No VIP available No Clinical Annotations available VA
rs2233302 NC_000005.10:g.151035537C>G, NC_000005.9:g.150415098C>G, NG_030590.1:g.57124G>C, NM_001252385.1:c.1521+45G>C, NM_001252386.1:c.1362+45G>C, NM_001252390.1:c.1521+45G>C, NM_001252391.1:c.1521+45G>C, NM_001252392.1:c.1521+45G>C, NM_001252393.1:c.1521+45G>C, NM_001258454.1:c.1521+45G>C, NM_001258455.1:c.1521+45G>C, NM_001258456.1:c.1521+45G>C, NM_006058.4:c.1521+45G>C, XM_005268355.1:c.1521+45G>C, XM_006714751.1:c.1521+45G>C, XM_006714752.1:c.1521+45G>C, XM_011537538.1:c.1521+45G>C
C > A
C > G
SNP
No VIP available CA No Variant Annotations available
rs2234693 NC_000006.11:g.152163335T>C, NC_000006.12:g.151842200T>C, NG_008493.1:g.156705T>C, NM_000125.3:c.453-397T>C, NM_001122740.1:c.453-397T>C, NM_001122741.1:c.453-397T>C, NM_001122742.1:c.453-397T>C, NM_001291230.1:c.453-397T>C, NM_001291241.1:c.453-397T>C, XM_005266856.1:c.453-397T>C, XM_005266857.1:c.453-397T>C, XM_006715374.2:c.453-397T>C, XM_006715375.2:c.-67-397T>C, XM_011535543.1:c.453-397T>C, XM_011535544.1:c.453-397T>C, XM_011535545.1:c.453-397T>C, XM_011535546.1:c.453-397T>C, XM_011535547.1:c.453-397T>C, XM_011535548.1:c.-67-397T>C, rs4134641, rs60769286
T > C
SNP
No VIP available CA VA
rs2235047 NC_000007.13:g.87138532A>C, NC_000007.14:g.87509216A>C, NG_011513.1:g.209033T>G, NM_000927.4:c.3489+59T>G, rs386562025, rs56488245, rs57169649, rs58701659
A > C
SNP
No VIP available No Clinical Annotations available VA
rs2236168 NC_000002.11:g.31607128T>C, NC_000002.12:g.31384262T>C, NG_008871.1:g.35484A>G, NM_000379.3:c.794-415A>G, XM_011533095.1:c.794-415A>G, XM_011533096.1:c.794-415A>G, rs4325801, rs56579209, rs59694787
T > C
SNP
No VIP available No Clinical Annotations available VA
rs2239393 NC_000022.10:g.19950428A>G, NC_000022.11:g.19962905A>G, NG_011526.1:g.26166A>G, NM_000754.3:c.289+90A>G, NM_001135161.1:c.289+90A>G, NM_001135162.1:c.289+90A>G, NM_007310.2:c.139+90A>G, NR_039918.1:n.-848A>G, XM_005261229.1:c.289+90A>G, XM_011529885.1:c.403+90A>G, XM_011529886.1:c.403+90A>G, XM_011529887.1:c.289+90A>G, XM_011529888.1:c.289+90A>G, XM_011529889.1:c.289+90A>G, XM_011529890.1:c.289+90A>G, XM_011529891.1:c.289+90A>G, rs58361251
A > G
SNP
No VIP available No Clinical Annotations available VA
rs2244613 NC_000016.10:g.55810697G>T, NC_000016.9:g.55844609G>T, NG_012057.1:g.27467C>A, NM_001025194.1:c.1168-33C>A, NM_001025195.1:c.1171-33C>A, NM_001266.4:c.1165-33C>A, NW_003315945.1:g.34574G>T, XM_005255774.1:c.1168-33C>A, XM_005276867.1:c.1168-33C>A, rs61164855, rs72486000
G > T
SNP
No VIP available No Clinical Annotations available VA
rs2244614
G > A
SNP
No VIP available CA No Variant Annotations available
rs2270860
C > T
SNP
S423S
No VIP available No Clinical Annotations available VA
rs2273697 NC_000010.10:g.101563815G>A, NC_000010.11:g.99804058G>A, NG_011798.1:g.26353G>A, NM_000392.4:c.1249G>A, NP_000383.1:p.Val417Ile, XM_005269536.1:c.1249G>A, XM_006717630.2:c.553G>A, XM_006717631.2:c.1249G>A, XM_011539291.1:c.1249G>A, XP_005269593.1:p.Val417Ile, XP_006717693.1:p.Val185Ile, XP_006717694.1:p.Val417Ile, XP_011537593.1:p.Val417Ile, XR_945604.1:n.1438G>A, XR_945605.1:n.1440G>A, rs17216184, rs60620335
G > A
SNP
V417I
No VIP available No Clinical Annotations available VA
rs2290271 NC_000015.10:g.84904404A>C, NC_000015.9:g.85447635A>C, NM_001287761.1:c.603+166A>C, NM_001287762.1:c.603+166A>C, NM_004213.4:c.603+166A>C, XM_005254988.1:c.603+166A>C, XM_005254989.1:c.603+166A>C, XM_005254990.1:c.603+166A>C, XM_005254991.1:c.603+166A>C, XM_005254992.1:c.576+166A>C, XM_005254993.1:c.603+166A>C, XM_005254994.1:c.369+166A>C, XM_005254995.1:c.603+166A>C, XM_011522203.1:c.603+166A>C, XM_011522204.1:c.603+166A>C, XM_011522205.1:c.603+166A>C, XM_011522206.1:c.603+166A>C, XM_011522207.1:c.603+166A>C, XM_011522208.1:c.576+166A>C, XM_011522209.1:c.603+166A>C, XM_011522210.1:c.603+166A>C, XM_011522211.1:c.369+166A>C, XM_011522212.1:c.603+166A>C, XM_011522213.1:c.603+166A>C, XM_011522214.1:c.603+166A>C, XM_011522215.1:c.603+166A>C, XM_011522216.1:c.369+166A>C, XM_011522217.1:c.603+166A>C, XM_011522218.1:c.603+166A>C, XR_931944.1:n.809+166A>C, XR_931945.1:n.809+166A>C, rs17608700, rs56963765
A > C
SNP
No VIP available CA VA
rs2291767 NC_000002.11:g.241080132T>C, NC_000002.12:g.240140715T>C, NM_148961.3:c.-214A>G
T > C
SNP
No VIP available No Clinical Annotations available VA
rs2293348 NC_000007.13:g.55266757C>T, NC_000007.14:g.55199064C>T, NG_007726.3:g.185033C>T, NM_005228.3:c.2848+201C>T, XM_005271746.1:c.2713+201C>T, XM_005271747.1:c.2689+201C>T, rs17337409, rs386564010, rs56649022, rs57162744
C > T
SNP
No VIP available No Clinical Annotations available VA
rs2294950 NC_000001.10:g.60314496T>G, NC_000001.11:g.59848824T>G, NM_015888.4:c.1132-249T>G, XM_005270922.1:c.1132-249T>G, XM_006710676.1:c.1132-249T>G, XM_011541562.1:c.1006-249T>G, XM_011541563.1:c.1132-249T>G, XR_246271.1:n.1328-249T>G, XR_246272.1:n.1328-249T>G, XR_946665.1:n.1328-249T>G
T > G
SNP
No VIP available CA VA
rs2297480 NC_000001.10:g.155279482T>G, NC_000001.11:g.155309691T>G, NG_045218.1:g.5944T>G, NM_001135821.1:c.-1-98T>G, NM_001135822.1:c.-1-373T>G, NM_001242824.1:c.-22-352T>G, NM_001242825.1:c.-175+726T>G, NM_002004.3:c.-1-98T>G, XM_005244962.1:c.-1-373T>G, XM_005244963.1:c.-22-352T>G, XM_005245266.1:c.-1000A>C, XM_005245266.3:c.-1000A>C, XM_011509639.1:c.-1000A>C, rs59477014
T > G
SNP
No VIP available CA VA
rs2297595 NC_000001.10:g.98165091T>C, NC_000001.11:g.97699535T>C, NG_008807.2:g.226525A>G, NM_000110.3:c.496A>G, NP_000101.2:p.Met166Val, XM_005270561.1:c.385A>G, XM_005270562.1:c.496A>G, XM_005270562.3:c.496A>G, XM_005270563.1:c.496A>G, XM_005270564.1:c.496A>G, XM_006710397.2:c.496A>G, XP_005270618.1:p.Met129Val, XP_005270619.1:p.Met166Val, XP_005270619.2:p.Met166Val, XP_005270620.1:p.Met166Val, XP_005270621.1:p.Met166Val, XP_006710460.1:p.Met166Val, rs118014431, rs199469517, rs52827192, rs61243782
T > C
SNP
M166V
No VIP available CA VA
rs2305364 NC_000015.10:g.84909044T>C, NC_000015.9:g.85452275T>C, NM_001287761.1:c.795+249T>C, NM_001287762.1:c.795+249T>C, NM_004213.4:c.795+249T>C, XM_005254988.1:c.795+249T>C, XM_005254989.1:c.795+249T>C, XM_005254990.1:c.795+249T>C, XM_005254991.1:c.795+249T>C, XM_005254992.1:c.768+249T>C, XM_005254993.1:c.717+3392T>C, XM_005254994.1:c.561+249T>C, XM_005254995.1:c.795+249T>C, XM_011522203.1:c.795+249T>C, XM_011522204.1:c.795+249T>C, XM_011522205.1:c.795+249T>C, XM_011522206.1:c.795+249T>C, XM_011522207.1:c.795+249T>C, XM_011522208.1:c.768+249T>C, XM_011522209.1:c.717+3392T>C, XM_011522210.1:c.795+249T>C, XM_011522211.1:c.561+249T>C, XM_011522212.1:c.795+249T>C, XM_011522213.1:c.795+249T>C, XM_011522214.1:c.795+249T>C, XM_011522215.1:c.795+249T>C, XM_011522216.1:c.561+249T>C, XM_011522217.1:c.795+249T>C, XM_011522218.1:c.795+249T>C, XR_931944.1:n.1001+249T>C, XR_931945.1:n.1001+249T>C
T > C
SNP
No VIP available CA VA
rs2306283 NC_000012.11:g.21329738A>G, NC_000012.12:g.21176804A>G, NG_011745.1:g.50611A>G, NM_006446.4:c.388A>G, NP_006437.3:p.Asn130Asp, rs17389242, rs52832430, rs60767041
A > G
SNP
N130D
No VIP available No Clinical Annotations available VA
rs2473967 NC_000006.11:g.113479335G>T, NC_000006.12:g.113158133G>T, rs74295796
G > T
SNP
No VIP available CA No Variant Annotations available
rs25487 NC_000019.10:g.43551574T>C, NC_000019.9:g.44055726T>C, NG_033799.1:g.29005A>G, NM_006297.2:c.1196A>G, NP_006288.2:p.Gln399Arg, rs11553658, rs17435395, rs3817410, rs386493716, rs57378728
T > C
SNP
Q399R
No VIP available No Clinical Annotations available VA
rs25489 NC_000019.10:g.43552260C>T, NC_000019.9:g.44056412C>T, NG_033799.1:g.28319G>A, NM_006297.2:c.839G>A, NP_006288.2:p.Arg280His, rs17435388, rs2229675, rs2307183
C > T
SNP
R280H
No VIP available No Clinical Annotations available VA
rs2600834 NC_000005.10:g.102269937T>C, NC_000005.9:g.101605641T>C, NM_180991.4:c.802+687A>G, XM_011543370.1:c.538+687A>G, XM_011543371.1:c.454+687A>G, XM_011543372.1:c.388+687A>G, rs10395200, rs58191158
T > C
SNP
No VIP available CA No Variant Annotations available
rs2612091 NC_000018.10:g.683607C>T, NC_000018.9:g.683607C>T, NM_001126123.3:c.496-227G>A, NM_001318759.1:c.742-227G>A, NM_001318760.1:c.199-227G>A, NM_017512.5:c.742-227G>A, NM_202758.3:c.805-227G>A, XM_005258111.1:c.886-227G>A, XM_005258112.1:c.661-227G>A, XM_005258113.1:c.658-227G>A, XM_005258114.1:c.514-227G>A, XM_005258115.1:c.496-227G>A, XM_005258116.1:c.496-227G>A, XM_005258117.1:c.310-227G>A, XM_005258118.1:c.199-227G>A, XM_005258118.2:c.199-227G>A, XM_005258120.1:c.157-227G>A, XM_011525677.1:c.769-212G>A, XM_011525678.1:c.760-212G>A, XM_011525679.1:c.769-227G>A, XM_011525680.1:c.742-212G>A, XM_011525681.1:c.730-212G>A, XM_011525682.1:c.703-212G>A, XM_011525683.1:c.580-212G>A, XM_011525684.1:c.553-212G>A, XM_011525685.1:c.541-212G>A, XM_011525686.1:c.517-212G>A, XM_011525687.1:c.514-227G>A, XM_011525688.1:c.496-212G>A, XM_011525689.1:c.364-212G>A, XM_011525690.1:c.364-212G>A, XM_011525691.1:c.310-212G>A, XM_011525692.1:c.310-212G>A, XM_011525693.1:c.310-212G>A, XM_011525694.1:c.310-227G>A, XM_011525695.1:c.271-212G>A, XM_011525696.1:c.199-212G>A, XM_011525697.1:c.157-212G>A, XM_011525698.1:c.157-212G>A, XM_011525699.1:c.157-212G>A, XR_243810.1:n.937-227G>A, XR_243810.3:n.778-227G>A, XR_243811.1:n.803-227G>A, XR_243811.2:n.803-227G>A, XR_243812.1:n.938-227G>A, XR_430041.2:n.940-227G>A, XR_935066.1:n.778-212G>A, XR_935067.1:n.778-212G>A, rs61671949
C > T
SNP
No VIP available No Clinical Annotations available VA
rs2622604 NC_000004.11:g.89078924T>C, NC_000004.12:g.88157772T>C, NG_032067.2:g.78551A>G, NM_001257386.1:c.-19-17758A>G, NM_004827.2:c.-20+614A>G, XM_005263354.1:c.-20+805A>G, XM_005263354.2:c.-20+805A>G, XM_005263355.1:c.-19-17758A>G, XM_005263355.2:c.-19-17758A>G, XM_005263356.1:c.-20+614A>G, XM_005263356.2:c.-20+614A>G, XM_011532420.1:c.-19-17758A>G, rs61481684
T > A
T > C
SNP
No VIP available No Clinical Annotations available VA
rs2669429 NC_000008.10:g.105463690A>G, NC_000008.11:g.104451462A>G, NG_008840.1:g.20588T>C, NM_001385.2:c.265-58T>C, XM_005250818.1:c.265-58T>C, XM_005250818.2:c.265-58T>C, XM_005250819.1:c.265-58T>C, XM_006716518.2:c.265-3959T>C, XM_011516903.1:c.265-58T>C, XM_011516904.1:c.265-58T>C, rs17246278, rs199469604, rs3750186, rs60334774
A > G
SNP
No VIP available CA VA
rs2740574 NC_000007.13:g.99382096C>T, NC_000007.14:g.99784473C>T, NG_008421.1:g.4713G>A, NM_001202855.2:c.-392G>A, NM_017460.5:c.-392G>A, XM_011515841.1:c.-392G>A, XM_011515842.1:c.-392G>A, rs3176920, rs36231114, rs59393892
C > T
SNP
No VIP available No Clinical Annotations available VA
rs2804402 NC_000010.10:g.101541583A>G, NC_000010.11:g.99781826A>G, NG_011798.1:g.4121A>G, NM_000392.4:c.-1019A>G, XM_005269536.1:c.-1019A>G, XM_006717631.2:c.-1019A>G, XM_011539291.1:c.-1019A>G, XR_945604.1:n.-830A>G, XR_945605.1:n.-828A>G, rs17222526, rs60149027
A > G
SNP
No VIP available No Clinical Annotations available VA
rs2811178
T > C
SNP
No VIP available No Clinical Annotations available VA
rs2884129 NC_000010.10:g.17585149T>G, NC_000010.11:g.17543150T>G
T > G
SNP
No VIP available No Clinical Annotations available VA
rs2959023 NC_000008.10:g.105479149A>G, NC_000008.11:g.104466921A>G, NG_008840.1:g.5129T>C, NM_001385.2:c.-1T>C, XM_005250818.1:c.-1T>C, XM_005250818.2:c.-1T>C, XM_005250819.1:c.-1T>C, XM_006716518.2:c.-1T>C, XM_011516903.1:c.-1T>C, XM_011516904.1:c.-1T>C, XR_928507.1:n.112+934A>G, rs199469597, rs58165447
A > G
SNP
No VIP available CA VA
rs316019 NC_000006.11:g.160670282A>C, NC_000006.12:g.160249250A>C, NM_003058.3:c.808T>G, NP_003049.2:p.Ser270Ala, rs1755917, rs17846267, rs17859289, rs386580336, rs52803175, rs60007366, rs666224
A > C
SNP
S270A
No VIP available CA VA
rs3212986 NC_000019.10:g.45409478C>A, NC_000019.9:g.45912736C>A, NG_015839.2:g.74351G>T, NM_001166049.1:c.*197G>T, NM_001297590.1:c.1516C>A, NM_001983.3:c.*197G>T, NM_012099.1:c.1510C>A, NP_001284519.1:p.Gln506Lys, NP_036231.1:p.Gln504Lys, XM_005258425.1:c.1516C>A, XM_005258638.1:c.*197G>T, XP_005258482.1:p.Gln506Lys, rs386580934, rs60333438
C > A
C > T
SNP
Q506K
No VIP available CA VA
rs3215400 NC_000001.10:g.20915590delC, NC_000001.11:g.20589097delC, NM_001785.2:c.-33delC, rs139923988, rs35386716, rs373015145, rs373391994, rs57426563, rs71752362
C > -
indel
No VIP available No Clinical Annotations available VA
rs3217164
G > -
indel
No VIP available CA VA
rs35599367 NC_000007.13:g.99366316G>A, NC_000007.14:g.99768693G>A, NG_008421.1:g.20493C>T, NM_001202855.2:c.522-191C>T, NM_017460.5:c.522-191C>T, XM_011515841.1:c.522-191C>T, XM_011515842.1:c.522-191C>T, rs45581939, rs62471940
G > A
SNP
No VIP available No Clinical Annotations available VA
rs367619008
T > C
SNP
K63E
No VIP available No Clinical Annotations available VA
rs3730089 NC_000005.10:g.68292320G>A, NC_000005.9:g.67588148G>A, NG_012849.2:g.81565G>A, NM_001242466.1:c.-480G>A, NM_181504.3:c.168G>A, NM_181523.1:c.978G>A, NM_181523.2:c.978G>A, NM_181524.1:c.78G>A, NP_852556.2:p.Met56Ile, NP_852664.1:p.Met326Ile, NP_852665.1:p.Met26Ile, XM_005248542.1:c.978G>A, XM_005248542.2:c.978G>A, XM_011543493.1:c.651G>A, XP_005248599.1:p.Met326Ile, XP_011541795.1:p.Met217Ile, rs17847316, rs386584794, rs52830014
G > A
SNP
M56I
No VIP available No Clinical Annotations available VA
rs3740066 NC_000010.10:g.101604207C>T, NC_000010.11:g.99844450C>T, NG_011798.1:g.66745C>T, NM_000392.4:c.3972C>T, NP_000383.1:p.Ile1324=, XM_005269536.1:c.3693C>T, XM_006717630.2:c.3276C>T, XP_005269593.1:p.Ile1231=, XP_006717693.1:p.Ile1092=, XR_945604.1:n.4161C>T, XR_945605.1:n.4036C>T, rs12780340, rs17216303, rs59292214
C > T
SNP
I1324I
No VIP available CA VA
rs3750117 NC_000007.13:g.33060946A>G, NC_000007.14:g.33021334A>G, NG_015800.1:g.46464T>C, NM_001002009.2:c.276T>C, NM_001002010.2:c.393T>C, NM_001166118.2:c.240T>C, NM_016489.12:c.276T>C, NP_001002009.1:p.Tyr92=, NP_001002010.1:p.Tyr131=, NP_001159590.1:p.Tyr80=, NP_057573.2:p.Tyr92=, XM_011515409.1:c.240T>C, XP_011513711.1:p.Tyr80=, rs11547832, rs17851350, rs57965368
A > G
SNP
Y92Y
No VIP available No Clinical Annotations available VA
rs3755319 NC_000002.11:g.234667582A=, NC_000002.11:g.234667582A>C, NC_000002.12:g.233758936A=, NC_000002.12:g.233758936A>C, NG_002601.2:g.174193A=, NG_002601.2:g.174193A>C, NG_033238.1:g.3664A=, NG_033238.1:g.3664A>C, NM_000463.2:c.-1352A=, NM_000463.2:c.-1352A>C, NM_001072.3:c.862-8098A=, NM_001072.3:c.862-8098A>C, NM_007120.2:c.868-8098A=, NM_007120.2:c.868-8098A>C, NM_019075.2:c.856-8098A=, NM_019075.2:c.856-8098A>C, NM_019076.4:c.856-8098A=, NM_019076.4:c.856-8098A>C, NM_019077.2:c.856-8098A=, NM_019077.2:c.856-8098A>C, NM_019078.1:c.868-8098A=, NM_019078.1:c.868-8098A>C, NM_019093.2:c.868-8098A=, NM_019093.2:c.868-8098A>C, NM_021027.2:c.856-8098A=, NM_021027.2:c.856-8098A>C, NM_205862.1:c.61-8098A=, NM_205862.1:c.61-8098A>C, XR_241238.1:n.924-8098A=, XR_241238.1:n.924-8098A>C, XR_241239.1:n.-1330A=, XR_241239.1:n.-1330A>C, XR_241240.1:n.1023-8098A=, XR_241240.1:n.1023-8098A>C, XR_241241.1:n.942-8098A=, XR_241241.1:n.942-8098A>C, rs35208194, rs36208045, rs57256426
A > C
SNP
No VIP available No Clinical Annotations available VA
rs3760091 NC_000016.10:g.28609479C>G, NC_000016.9:g.28620800C>G, NG_028128.1:g.19067G>C, NM_001055.3:c.-5+452G>C, NM_001310136.1:c.121-142577G>C, NM_177529.2:c.-36+452G>C, NM_177530.2:c.-425G>C, NM_177534.2:c.-624G>C, NM_177536.3:c.139-2402G>C, XM_005255522.1:c.-5+452G>C, rs117385979, rs60448308
C > G
C > T
SNP
No VIP available No Clinical Annotations available VA
rs3813627 NC_000001.10:g.161195148G>T, NC_000001.11:g.161225358G>T, NG_012043.1:g.3271C>A, NM_001286373.1:c.-914G>T, NM_001286374.1:c.-914G>T, NM_001643.1:c.-1788C>A, NM_032174.5:c.-914G>T, NR_049819.1:n.-1828G>T, XM_005245536.1:c.-814G>T, XM_005245537.1:c.-914G>T, XM_005245538.1:c.-1005G>T, XM_006711572.1:c.-793G>T, XM_011510057.1:c.-793G>T
G > T
SNP
No VIP available No Clinical Annotations available VA
rs3813628 NC_000001.10:g.161196166A>C, NC_000001.11:g.161226376A>C, NG_012043.1:g.2253T>G, NM_001286373.1:c.-114A>C, NM_001286374.1:c.-114A>C, NM_032174.5:c.-114A>C, NR_049819.1:n.-810A>C, XM_005245536.1:c.-35-79A>C, XM_005245537.1:c.-114A>C, XM_005245538.1:c.-205A>C, XM_006711572.1:c.-14-100A>C, XM_011510057.1:c.-14-100A>C, rs57851595
A > C
SNP
No VIP available No Clinical Annotations available VA
rs3887137 NC_000009.11:g.107698612C>T, NC_000009.12:g.104936331C>T, XR_930204.1:n.952-2421C>T, rs57670930
C > T
SNP
No VIP available CA VA
rs3918290 NC_000001.10:g.97915614C>T, NC_000001.11:g.97450058C>T, NG_008807.2:g.476002G>A, NM_000110.3:c.1905+1G>A, XM_005270561.1:c.1794+1G>A, XM_005270562.1:c.1689+1G>A, XM_005270562.3:c.1689+1G>A, XM_005270563.1:c.1905+1G>A, XM_006710397.2:c.1905+1G>A, rs199469548, rs386589337
C > G
C > T
SNP
No VIP available No Clinical Annotations available VA
rs3918305 NC_000012.11:g.109331162C>T, NC_000012.12:g.108937386C>T, NM_018711.4:c.898-49G>A, rs59527033
C > T
SNP
No VIP available CA VA
rs4124874 NC_000002.11:g.234665659T>G, NC_000002.12:g.233757013T>G, NG_002601.2:g.172270T>G, NG_033238.1:g.1741T>G, NM_001072.3:c.862-10021T>G, NM_007120.2:c.868-10021T>G, NM_019075.2:c.856-10021T>G, NM_019076.4:c.856-10021T>G, NM_019077.2:c.856-10021T>G, NM_019078.1:c.868-10021T>G, NM_019093.2:c.868-10021T>G, NM_021027.2:c.856-10021T>G, NM_205862.1:c.61-10021T>G, NR_037694.1:n.-1668A>C, NR_037695.1:n.-1668A>C, NR_037696.1:n.-1668A>C, XR_241238.1:n.924-10021T>G, XR_241240.1:n.1023-10021T>G, XR_241241.1:n.942-10021T>G, rs57409706
T > G
SNP
No VIP available CA VA
rs4148323 NC_000002.11:g.234669144G>A, NC_000002.12:g.233760498G>A, NG_002601.2:g.175755G>A, NG_033238.1:g.5226G>A, NM_000463.2:c.211G>A, NM_001072.3:c.862-6536G>A, NM_007120.2:c.868-6536G>A, NM_019075.2:c.856-6536G>A, NM_019076.4:c.856-6536G>A, NM_019077.2:c.856-6536G>A, NM_019078.1:c.868-6536G>A, NM_019093.2:c.868-6536G>A, NM_021027.2:c.856-6536G>A, NM_205862.1:c.61-6536G>A, NP_000454.1:p.Gly71Arg, XR_241238.1:n.924-6536G>A, XR_241239.1:n.233G>A, XR_241240.1:n.1023-6536G>A, XR_241241.1:n.942-6536G>A, rs113525835, rs34360183, rs58105808, rs58585123
G > A
SNP
G71R
No VIP available CA VA
rs4148350 NC_000016.10:g.16076620G>T, NC_000016.9:g.16170477G>T, NG_028268.1:g.132044G>T, NM_004996.3:c.1988+219G>T, NT_187607.1:g.1734472G>T, XM_005255326.1:c.1988+219G>T, XM_005255327.1:c.1862+219G>T, XM_005255328.1:c.1850+219G>T, XM_005255329.1:c.1988+219G>T, XM_011522497.1:c.1964+219G>T, XM_011522498.1:c.1895+219G>T, rs587779726, rs60127316
G > T
SNP
No VIP available CA VA
rs4148808 NC_000007.13:g.87105795T>C, NC_000007.14:g.87476479T>C, NG_007118.1:g.8954A>G, NM_000443.3:c.-852A>G, NM_018849.2:c.-852A>G, NM_018850.2:c.-852A>G, XM_011516308.1:c.-715A>G, XM_011516309.1:c.-715A>G, XM_011516310.1:c.-715A>G, XM_011516311.1:c.-715A>G, XM_011516312.1:c.-715A>G, XM_011516313.1:c.-715A>G, XM_011516314.1:c.-332A>G, XR_927478.1:n.-619A>G, rs386591494, rs59666582
T > C
SNP
No VIP available CA VA
rs4149056 NC_000012.11:g.21331549T>C, NC_000012.12:g.21178615T>C, NG_011745.1:g.52422T>C, NM_006446.4:c.521T>C, NP_006437.3:p.Val174Ala, rs52816141, rs60037639
T > C
SNP
V174A
No VIP available No Clinical Annotations available VA
rs4149117 NC_000012.11:g.21011480T>G, NC_000012.12:g.20858546T>G, NG_032071.1:g.52843T>G, NM_019844.3:c.334T>G, NP_062818.1:p.Ser112Ala, XM_005253347.1:c.334T>G, XP_005253404.1:p.Ser112Ala, rs52800447, rs58702833
T > G
SNP
S112A
No VIP available CA VA
rs4149178 NC_000006.11:g.43272188A>G, NC_000006.12:g.43304450A>G, NM_006672.3:c.1586+206A>G, NM_153320.2:c.1592+206A>G, XM_005248823.1:c.1199+206A>G, XM_006714970.2:c.1601+206A>G, XM_006714971.2:c.1595+206A>G, XM_011514256.1:c.1778+206A>G, XM_011514257.1:c.1769+206A>G, XM_011514258.1:c.1676+206A>G, XM_011514260.1:c.1544+206A>G, XM_011514261.1:c.1208+206A>G, XM_011514263.1:c.1004+206A>G, XM_011514607.1:c.495+1769T>C, XM_011514608.1:c.495+1769T>C
A > G
SNP
No VIP available No Clinical Annotations available VA
rs42524 NC_000007.13:g.94043239C>G, NC_000007.14:g.94413927C>G, NG_007405.1:g.24367C>G, NM_000089.3:c.1645C>G, NP_000080.2:p.Pro549Ala, rs10383941, rs1136007, rs17857444, rs59646360
C > G
SNP
P549A
No VIP available CA VA
rs4261716 NC_000002.11:g.234593117G>T, NC_000002.12:g.233684471G>T, NG_002601.2:g.99728G>T, NM_019075.2:c.855+47094G>T, NM_019076.4:c.855+65909G>T, NM_019077.2:c.855+1679G>T, NM_021027.2:c.855+11682G>T, XM_005246081.1:c.855+1679G>T, XR_241241.1:n.941+11682G>T, rs17683792, rs58252906
G > T
SNP
No VIP available No Clinical Annotations available VA
rs4407290 NC_000002.11:g.31606670G>A, NC_000002.12:g.31383804G>A, NG_008871.1:g.35942C>T, NM_000379.3:c.837C>T, NP_000370.2:p.Val279=, XM_011533095.1:c.837C>T, XM_011533096.1:c.837C>T, XP_011531397.1:p.Val279=, XP_011531398.1:p.Val279=, rs17544440, rs57766493
G > A
SNP
V279V
No VIP available CA VA
rs45445694 NC_000018.10:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NC_000018.9:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NG_028255.1:g.5043_5070CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NM_001012716.2:c.*34+169_*34+196CGGGACGGAGGCAGGCCAAGTGGCGCGG[2][3][4][7][8][9], NM_001071.2:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258137.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258138.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], rs34743033 (retired)
(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2
(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)4
(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)7
(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)8
(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)9
microsatellite
No VIP available No Clinical Annotations available VA
rs45589337 NC_000001.10:g.98144726T>C, NC_000001.11:g.97679170T>C, NG_008807.2:g.246890A>G, NM_000110.3:c.775A>G, NP_000101.2:p.Lys259Glu, XM_005270561.1:c.664A>G, XM_005270562.1:c.775A>G, XM_005270562.3:c.775A>G, XM_005270563.1:c.775A>G, XM_005270564.1:c.775A>G, XM_006710397.2:c.775A>G, XP_005270618.1:p.Lys222Glu, XP_005270619.1:p.Lys259Glu, XP_005270619.2:p.Lys259Glu, XP_005270620.1:p.Lys259Glu, XP_005270621.1:p.Lys259Glu, XP_006710460.1:p.Lys259Glu, rs59034382
T > C
SNP
K259E
No VIP available CA VA
rs4646316 NC_000022.10:g.19952132C>T, NC_000022.11:g.19964609C>T, NG_011526.1:g.27870C>T, NM_000754.3:c.615+310C>T, NM_001135161.1:c.615+310C>T, NM_001135162.1:c.615+310C>T, NM_007310.2:c.465+310C>T, XM_005261229.1:c.615+310C>T, XM_011529885.1:c.729+310C>T, XM_011529886.1:c.729+310C>T, XM_011529887.1:c.615+310C>T, XM_011529888.1:c.615+310C>T, XM_011529889.1:c.615+310C>T, XM_011529890.1:c.615+310C>T, XM_011529891.1:c.615+310C>T, rs58510682
C > T
SNP
No VIP available CA VA
rs4655226 NC_000001.10:g.20928284C>T, NC_000001.11:g.20601791C>T, NM_001785.2:c.155-3137C>T
C > T
SNP
No VIP available CA No Variant Annotations available
rs4673 NC_000016.10:g.88646828A>G, NC_000016.9:g.88713236A>G, NG_007291.1:g.9222T>C, NM_000101.2:c.214T>C, NM_000101.3:c.214T>C, NP_000092.2:p.Tyr72His, XM_011522905.1:c.214T>C, XP_011521207.1:p.Tyr72His, rs11266997, rs1130413, rs2228471, rs2242272, rs3189211, rs386594564, rs4782392, rs59455247
A > G
SNP
Y72H
No VIP available CA No Variant Annotations available
rs4678145
G > A
G > C
SNP
No VIP available No Clinical Annotations available VA
rs4680 NC_000022.10:g.19951271G>A, NC_000022.11:g.19963748G>A, NG_011526.1:g.27009G>A, NM_000754.3:c.472G>A, NM_001135161.1:c.472G>A, NM_001135162.1:c.472G>A, NM_007310.2:c.322G>A, NP_000745.1:p.Val158Met, NP_001128633.1:p.Val158Met, NP_001128634.1:p.Val158Met, NP_009294.1:p.Val108Met, NR_039918.1:n.-5G>A, XM_005261229.1:c.472G>A, XM_011529885.1:c.586G>A, XM_011529886.1:c.586G>A, XM_011529887.1:c.472G>A, XM_011529888.1:c.472G>A, XM_011529889.1:c.472G>A, XM_011529890.1:c.472G>A, XM_011529891.1:c.472G>A, XP_005261286.1:p.Val158Met, XP_011528187.1:p.Val196Met, XP_011528188.1:p.Val196Met, XP_011528189.1:p.Val158Met, XP_011528190.1:p.Val158Met, XP_011528191.1:p.Val158Met, XP_011528192.1:p.Val158Met, XP_011528193.1:p.Val158Met, rs1131157, rs11544671, rs165688, rs17295216, rs17349704, rs17818178, rs17849308, rs17850006, rs2070104, rs3177905, rs3190784, rs3747070, rs58002978
G > A
SNP
V158M
No VIP available No Clinical Annotations available VA
rs4715354 NC_000006.11:g.52708797G>A, NC_000006.12:g.52843999G>A, NM_153699.1:c.-31+2057C>T, rs17268789, rs58826387
G > A
SNP
No VIP available No Clinical Annotations available VA
rs4818 NC_000022.10:g.19951207C>G, NC_000022.11:g.19963684C>G, NG_011526.1:g.26945C>G, NM_000754.3:c.408C>G, NM_001135161.1:c.408C>G, NM_001135162.1:c.408C>G, NM_007310.2:c.258C>G, NP_000745.1:p.Leu136=, NP_001128633.1:p.Leu136=, NP_001128634.1:p.Leu136=, NP_009294.1:p.Leu86=, NR_039918.1:n.-69C>G, XM_005261229.1:c.408C>G, XM_011529885.1:c.522C>G, XM_011529886.1:c.522C>G, XM_011529887.1:c.408C>G, XM_011529888.1:c.408C>G, XM_011529889.1:c.408C>G, XM_011529890.1:c.408C>G, XM_011529891.1:c.408C>G, XP_005261286.1:p.Leu136=, XP_011528187.1:p.Leu174=, XP_011528188.1:p.Leu174=, XP_011528189.1:p.Leu136=, XP_011528190.1:p.Leu136=, XP_011528191.1:p.Leu136=, XP_011528192.1:p.Leu136=, XP_011528193.1:p.Leu136=, rs117008153, rs17355478, rs17745510, rs17850822, rs2070103, rs3171583, rs3747069, rs57402237, rs712978
C > G
SNP
L136L
No VIP available No Clinical Annotations available VA
rs4834232 NC_000004.11:g.129024273C>T, NC_000004.12:g.128103118C>T, NM_001278604.1:c.814-4021C>T, NM_018078.3:c.814-4021C>T, NM_032239.3:c.814-4021C>T, NM_178043.2:c.814-4021C>T, XM_005263086.1:c.1417-4021C>T, XM_005263087.1:c.1417-4021C>T, XM_005263088.1:c.1417-4021C>T, XM_005263089.1:c.1273-4021C>T, XM_005263090.1:c.1417-4021C>T, XM_005263091.1:c.1417-4021C>T, XM_005263092.1:c.1417-4021C>T, XM_005263093.1:c.1417-4021C>T, XM_005263094.1:c.1417-4021C>T, XM_005263095.1:c.1417-4021C>T, XM_005263096.1:c.1417-4021C>T, XM_005263097.1:c.1417-4021C>T, XM_005263098.1:c.1417-4021C>T, XM_005263099.1:c.91-4021C>T, XM_005263100.1:c.91-4021C>T, XM_005263101.1:c.1417-4021C>T, XM_011532057.1:c.814-4021C>T, XM_011532058.1:c.814-4021C>T, XM_011532059.1:c.814-4021C>T, XM_011532060.1:c.814-4021C>T, XM_011532061.1:c.1276-4021C>T, XM_011532062.1:c.814-4021C>T, XM_011532063.1:c.814-4021C>T, XM_011532064.1:c.814-4021C>T, XM_011532065.1:c.1276-4021C>T, XM_011532066.1:c.814-4021C>T, XM_011532067.1:c.814-4021C>T, XM_011532068.1:c.673-4021C>T, XM_011532069.1:c.673-4021C>T, XM_011532070.1:c.814-4021C>T, XM_011532071.1:c.814-4021C>T, XM_011532072.1:c.814-4021C>T, XM_011532073.1:c.814-4021C>T, XM_011532074.1:c.814-4021C>T, XM_011532075.1:c.91-4021C>T, XM_011532076.1:c.91-4021C>T, XM_011532077.1:c.91-4021C>T, XM_011532078.1:c.814-4021C>T, XR_938753.1:n.891-4021C>T, XR_938754.1:n.891-4021C>T, XR_938755.1:n.891-4021C>T, XR_938756.1:n.891-4021C>T, XR_938757.1:n.891-4021C>T, XR_938758.1:n.891-4021C>T, XR_938759.1:n.891-4021C>T, XR_938760.1:n.891-4021C>T, XR_938761.1:n.891-4021C>T, XR_938762.1:n.891-4021C>T, rs17394472, rs59780448
C > T
SNP
No VIP available CA VA
rs4877847 NC_000009.11:g.86946417A>C, NC_000009.12:g.84331502A>C, NM_001199633.1:c.60+9072T>G, NM_022127.2:c.60+9072T>G, NR_037638.2:n.206+9072T>G, XM_011518905.1:c.60+9072T>G, XM_011518906.1:c.60+9072T>G, XM_011518907.1:c.-97-18048T>G, XM_011518909.1:c.60+9072T>G, XM_011518910.1:c.60+9072T>G, XR_929832.1:n.187+9072T>G
A > C
SNP
No VIP available No Clinical Annotations available VA
rs4982753 NC_000014.8:g.23814569C>T, NC_000014.9:g.23345360C>T, rs61203156
C > T
SNP
No VIP available CA VA
rs532545 NC_000001.10:g.20915172C>T, NC_000001.11:g.20588679C>T, NM_001785.2:c.-451C>T, rs2072669, rs386598350
C > T
SNP
No VIP available CA VA
rs55886062 NC_000001.10:g.97981343A>C, NC_000001.11:g.97515787A>C, NG_008807.2:g.410273T>G, NM_000110.3:c.1679T>G, NP_000101.2:p.Ile560Ser, XM_005270561.1:c.1568T>G, XM_005270562.1:c.1524+33773T>G, XM_005270562.3:c.1524+33773T>G, XM_005270563.1:c.1679T>G, XM_005270564.1:c.1679T>G, XM_006710397.2:c.1679T>G, XP_005270618.1:p.Ile523Ser, XP_005270620.1:p.Ile560Ser, XP_005270621.1:p.Ile560Ser, XP_006710460.1:p.Ile560Ser, rs199469542
A > C
SNP
I560S
No VIP available CA VA
rs56038477 NC_000001.10:g.98039419C>T, NC_000001.11:g.97573863C>T, NG_008807.2:g.352197G>A, NM_000110.3:c.1236G>A, NP_000101.2:p.Glu412=, XM_005270561.1:c.1125G>A, XM_005270562.1:c.1236G>A, XM_005270562.3:c.1236G>A, XM_005270563.1:c.1236G>A, XM_005270564.1:c.1236G>A, XM_006710397.2:c.1236G>A, XP_005270618.1:p.Glu375=, XP_005270619.1:p.Glu412=, XP_005270619.2:p.Glu412=, XP_005270620.1:p.Glu412=, XP_005270621.1:p.Glu412=, XP_006710460.1:p.Glu412=, rs199469533, rs61730901
C > T
SNP
E412E
No VIP available No Clinical Annotations available VA
rs56276561
C > T
SNP
No VIP available No Clinical Annotations available VA
rs56293913
A > G
SNP
No VIP available No Clinical Annotations available VA
rs5746849 NC_000022.10:g.19942997A>G, NC_000022.11:g.19955474A>G, NG_011526.1:g.18735A>G, NM_000754.3:c.-91-5725A>G, NM_001135161.1:c.-92+4422A>G, NM_001135162.1:c.-92+3820A>G, XM_005261229.1:c.-385-5725A>G, XM_011529887.1:c.-91-5725A>G, XM_011529888.1:c.-92+3820A>G, XM_011529889.1:c.-92+4422A>G, XM_011529890.1:c.-385-5725A>G, XM_011529891.1:c.-385-5725A>G, rs58299579
A > G
SNP
No VIP available CA VA
rs602950 NC_000001.10:g.20915531A>G, NC_000001.11:g.20589038A>G, NM_001785.2:c.-92A>G
A > G
SNP
No VIP available CA VA
rs60369023 NC_000001.10:g.20931474G>A, NC_000001.11:g.20604981G>A, NM_001785.2:c.208G>A, NP_001776.1:p.Ala70Thr
G > A
SNP
A70T
No VIP available No Clinical Annotations available VA
rs6151031 NC_000009.11:g.75568383_75568384insCTGGTGAGGAGAGAACC, NC_000009.12:g.72953467_72953468insCTGGTGAGGAGAGAACC, NG_012249.1:g.4586_4587insGGTTCTCTCCTCACCAG, NM_000689.4:c.-468_-467insGGTTCTCTCCTCACCAG, XM_005251800.1:c.-14-454_-14-453insGGTTCTCTCCTCACCAG, rs142856037
- > CTGGTGAGGAGAGAACC
indel
No VIP available No Clinical Annotations available VA
rs62298861 NC_000004.11:g.69963944A>G, NC_000004.12:g.69098226A>G, NM_001074.2:c.722-314A>G, XM_005265702.1:c.-26-314A>G, XM_005265702.2:c.-26-314A>G, XM_011532229.1:c.722-314A>G, XM_011532230.1:c.722-314A>G, XM_011532231.1:c.-26-314A>G
A > G
SNP
No VIP available No Clinical Annotations available VA
rs6269 NC_000022.10:g.19949952A>G, NC_000022.11:g.19962429A>G, NG_011526.1:g.25690A>G, NM_000754.3:c.1-98A>G, NM_001135161.1:c.1-98A>G, NM_001135162.1:c.1-98A>G, NM_007310.2:c.-248A>G, NR_039918.1:n.-1324A>G, XM_005261229.1:c.-98A>G, XM_011529885.1:c.115-98A>G, XM_011529886.1:c.115-98A>G, XM_011529887.1:c.1-98A>G, XM_011529888.1:c.1-98A>G, XM_011529889.1:c.1-98A>G, XM_011529890.1:c.-98A>G, XM_011529891.1:c.-98A>G, rs3827293
A > G
SNP
No VIP available CA VA
rs6431558 NC_000002.11:g.234529643C>T, NC_000002.12:g.233620997C>T, NG_002601.2:g.36254C>T, NM_019076.4:c.855+2435C>T, rs58319724
C > T
SNP
No VIP available CA No Variant Annotations available
rs662 NC_000007.13:g.94937446T>C, NC_000007.14:g.95308134T>C, NG_008779.1:g.21439A>G, NM_000446.5:c.575A>G, NP_000437.3:p.Gln192Arg, rs11567868, rs13306697, rs17773773, rs386603940, rs60480675
T > C
SNP
Q192R
No VIP available No Clinical Annotations available VA
rs6668296
C > T
SNP
No VIP available No Clinical Annotations available VA
rs6690069
G > A
SNP
No VIP available No Clinical Annotations available VA
rs6721961 NC_000002.11:g.178130037T>G, NC_000002.12:g.177265309T>G, NM_001145412.3:c.-1910A>C, NM_001145413.3:c.-1910A>C, NM_001313900.1:c.-1784A>C, NM_001313901.1:c.-1876A>C, NM_001313902.1:c.-733A>C, NM_001313903.1:c.-733A>C, NM_001313904.1:c.-2091A>C, NM_006164.4:c.-733A>C, rs117801448
T > C
T > G
SNP
No VIP available CA VA
rs67376798 NC_000001.10:g.97547947T>A, NC_000001.11:g.97082391T>A, NG_008807.2:g.843669A>T, NM_000110.3:c.2846A>T, NP_000101.2:p.Asp949Val, XM_005270561.1:c.2735A>T, XM_005270562.1:c.2630A>T, XM_005270562.3:c.2630A>T, XP_005270618.1:p.Asp912Val, XP_005270619.1:p.Asp877Val, XP_005270619.2:p.Asp877Val, rs199469564, rs386467430, rs67376799
T > A
SNP
D949V
No VIP available CA VA
rs6755571 NC_000002.11:g.234627536C>A, NC_000002.12:g.233718890C>A, NG_002601.2:g.134147C>A, NM_001072.3:c.861+25025C>A, NM_007120.2:c.70C>A, NM_019075.2:c.856-48144C>A, NM_019076.4:c.856-48144C>A, NM_019077.2:c.855+36098C>A, NM_019078.1:c.867+5032C>A, NM_021027.2:c.855+46101C>A, NM_205862.1:c.60+25025C>A, NP_009051.1:p.Pro24Thr, XR_241238.1:n.126C>A, XR_241240.1:n.1022+25025C>A, XR_241241.1:n.941+46101C>A, rs17864908, rs52805064, rs58561863
C > A
SNP
P24T
No VIP available No Clinical Annotations available VA
rs6759892 NC_000002.11:g.234601669T>G, NC_000002.12:g.233693023T>G, NG_002601.2:g.108280T>G, NM_001072.3:c.19T>G, NM_019075.2:c.855+55646T>G, NM_019076.4:c.856-74011T>G, NM_019077.2:c.855+10231T>G, NM_021027.2:c.855+20234T>G, NM_205862.1:c.-7-776T>G, NP_001063.2:p.Ser7Ala, XR_241240.1:n.180T>G, XR_241241.1:n.941+20234T>G, rs17670302, rs60624335
T > G
SNP
S7A
No VIP available CA VA
rs6785049 NC_000003.11:g.119533733G>A, NC_000003.12:g.119814886G>A, NG_011856.1:g.39403G>A, NM_003889.3:c.795-93G>A, NM_022002.2:c.912-93G>A, NM_033013.2:c.684-93G>A, XM_005247866.1:c.630-93G>A, rs58368790
G > A
SNP
No VIP available No Clinical Annotations available VA
rs6848982 NC_000004.11:g.128959213G>A, NC_000004.12:g.128038058G>A, NM_001319305.1:c.*2245G>A, NM_001319306.1:c.*2245G>A, NM_001319307.1:c.*2245G>A
G > A
SNP
No VIP available CA No Variant Annotations available
rs699517
C > T
SNP
No VIP available No Clinical Annotations available VA
rs7016778
A > T
SNP
No VIP available No Clinical Annotations available VA
rs7104613 NC_000011.10:g.14058384C>T, NC_000011.9:g.14079931C>T, NM_006108.3:c.479+16730C>T, NW_003871075.1:g.116468C>T, rs60203831
C > T
SNP
No VIP available CA VA
rs712829 NC_000007.13:g.55086755G>T, NC_000007.14:g.55019062G>T, NG_007726.3:g.5031G>T, NM_005228.3:c.-216G>T, NM_201282.1:c.-216G>T, NM_201283.1:c.-216G>T, NM_201284.1:c.-216G>T, XM_005271746.1:c.-216G>T, XM_005271748.1:c.-216G>T, rs17288931
G > T
SNP
No VIP available No Clinical Annotations available VA
rs7131224 NC_000011.10:g.24225985T>C, NC_000011.9:g.24247531T>C, rs111186995, rs58002303, rs58056067
T > C
SNP
No VIP available No Clinical Annotations available VA
rs717620 NC_000010.10:g.101542578C>T, NC_000010.11:g.99782821C>T, NG_011798.1:g.5116C>T, NM_000392.4:c.-24C>T, XM_005269536.1:c.-24C>T, XM_006717631.2:c.-24C>T, XM_011539291.1:c.-24C>T, XR_945604.1:n.166C>T, XR_945605.1:n.168C>T, rs17216163, rs386485129, rs58371376
C > T
SNP
No VIP available No Clinical Annotations available VA
rs7187684
T > C
SNP
No VIP available CA VA
rs7194667 NC_000016.10:g.48208987T>G, NC_000016.9:g.48242898T>G, NG_011522.1:g.31191A>C, NM_032583.3:c.1609-491A>C, NM_033151.3:c.1609-491A>C, NM_145186.2:c.1609-491A>C, XM_005256208.1:c.1609-491A>C, XM_005256209.1:c.1609-491A>C, XM_005256210.1:c.1609-491A>C, XM_011523396.1:c.1411-491A>C, XM_011523397.1:c.652-491A>C, XR_243432.1:n.1714-491A>C, rs61621252
T > G
SNP
No VIP available CA No Variant Annotations available
rs724710 NC_000002.11:g.111907691T>C, NC_000002.12:g.111150114T>C, NG_029006.1:g.34201T>C, NM_001204106.1:c.195T>C, NM_001204107.1:c.195T>C, NM_001204108.1:c.465T>C, NM_001204109.1:c.395-3666T>C, NM_001204110.1:c.195T>C, NM_001204111.1:c.215-14019T>C, NM_001204112.1:c.215-3666T>C, NM_006538.4:c.285T>C, NM_138621.4:c.465T>C, NM_138622.3:c.465T>C, NM_138623.3:c.285T>C, NM_138624.3:c.*90T>C, NM_138625.3:c.*83T>C, NM_138626.3:c.395-14019T>C, NM_138627.3:c.125-14019T>C, NM_207003.2:c.195T>C, NP_001191035.1:p.Ile65=, NP_001191036.1:p.Ile65=, NP_001191037.1:p.Ile155=, NP_001191039.1:p.Ile65=, NP_006529.1:p.Ile95=, NP_619527.1:p.Ile155=, NP_619528.1:p.Ile155=, NP_619529.1:p.Ile95=, NP_996886.1:p.Ile65=, XM_005263550.1:c.747T>C, XM_005263550.2:c.747T>C, XM_005263551.1:c.747T>C, XM_005263552.1:c.567T>C, XM_005263552.2:c.567T>C, XM_005263553.1:c.567T>C, XM_005263554.1:c.677-14019T>C, XM_005263555.1:c.477T>C, XM_005263555.2:c.477T>C, XM_005263556.1:c.465T>C, XM_005263556.2:c.465T>C, XM_005263557.1:c.465T>C, XM_005263557.3:c.465T>C, XM_005263559.1:c.477T>C, XM_005263560.1:c.497-14019T>C, XM_005263561.1:c.285T>C, XM_005263561.2:c.285T>C, XM_011510463.1:c.516T>C, XP_005263607.1:p.Ile249=, XP_005263608.1:p.Ile249=, XP_005263609.1:p.Ile189=, XP_005263610.1:p.Ile189=, XP_005263612.1:p.Ile159=, XP_005263613.1:p.Ile155=, XP_005263614.1:p.Ile155=, XP_005263616.1:p.Ile159=, XP_005263618.1:p.Ile95=, XP_011508765.1:p.Ile172=, XR_244801.1:n.806T>C, XR_244802.1:n.806T>C, XR_244802.2:n.806T>C, XR_244803.1:n.626T>C, XR_244804.1:n.536T>C, XR_244805.1:n.753T>C, XR_244806.1:n.753T>C, XR_244807.1:n.683-3666T>C, XR_244808.1:n.786T>C, XR_244809.1:n.573T>C, XR_244810.1:n.483T>C, XR_244811.1:n.503-3666T>C, XR_244812.1:n.483T>C, XR_922828.1:n.806T>C, XR_922829.1:n.806T>C, XR_922830.1:n.736-3666T>C, rs13033893, rs17551042, rs3761703, rs56505964, rs60076061
T > C
SNP
I65I
No VIP available No Clinical Annotations available VA
rs72549307 NC_000001.10:g.98164955T>C, NC_000001.11:g.97699399T>C, NG_008807.2:g.226661A>G, NM_000110.3:c.632A>G, NP_000101.2:p.Tyr211Cys, XM_005270561.1:c.521A>G, XM_005270562.1:c.632A>G, XM_005270562.3:c.632A>G, XM_005270563.1:c.632A>G, XM_005270564.1:c.632A>G, XM_006710397.2:c.632A>G, XP_005270618.1:p.Tyr174Cys, XP_005270619.1:p.Tyr211Cys, XP_005270619.2:p.Tyr211Cys, XP_005270620.1:p.Tyr211Cys, XP_005270621.1:p.Tyr211Cys, XP_006710460.1:p.Tyr211Cys
T > C
SNP
Y211C
No VIP available No Clinical Annotations available VA
rs72765700
T > A
T > C
SNP
No VIP available No Clinical Annotations available VA
rs7287550 NC_000022.10:g.19931976T>C, NC_000022.11:g.19944453T>C, NG_011526.1:g.7714T>C, NG_011835.1:g.2384A>G, NM_000754.3:c.-92+2556T>C, XM_005261229.1:c.-386+2556T>C, XM_011529887.1:c.-92+2556T>C, XM_011529890.1:c.-386+2556T>C, XM_011529891.1:c.-386+2278T>C
T > C
SNP
No VIP available No Clinical Annotations available VA
rs729147 NC_000004.11:g.100333267G>A, NC_000004.12:g.99412110G>A, NM_000673.4:c.*1038C>T, NM_001166504.1:c.*1038C>T, rs3805327, rs56638370, rs59352744
G > A
SNP
No VIP available CA VA
rs7319981 NC_000013.10:g.103723722G>A, NC_000013.11:g.103071372G>A, NG_016648.1:g.475C>T, rs56422021
G > A
SNP
No VIP available No Clinical Annotations available VA
rs73420732 NC_000007.13:g.55097762G>T, NC_000007.14:g.55030069G>T, NG_007726.3:g.16038G>T, NM_005228.3:c.88+10704G>T, NM_201282.1:c.88+10704G>T, NM_201283.1:c.88+10704G>T, NM_201284.1:c.88+10704G>T, XM_005271746.1:c.88+10704G>T, XM_005271748.1:c.88+10704G>T, XR_428151.2:n.681G>T
G > T
SNP
No VIP available No Clinical Annotations available VA
rs737866 NC_000022.10:g.19930109T>C, NC_000022.11:g.19942586T>C, NG_011526.1:g.5847T>C, NG_011835.1:g.4251A>G, NM_000754.3:c.-92+689T>C, NM_001282512.1:c.-783A>G, NM_006440.4:c.-783A>G, XM_005261214.1:c.-783A>G, XM_005261216.1:c.-783A>G, XM_005261217.1:c.-783A>G, XM_005261229.1:c.-386+689T>C, XM_011529887.1:c.-92+689T>C, XM_011529890.1:c.-386+689T>C, XM_011529891.1:c.-386+411T>C, rs17455584, rs386609683, rs60054527
T > C
SNP
No VIP available No Clinical Annotations available VA
rs740603 NC_000022.10:g.19945177A>G, NC_000022.11:g.19957654A>G, NG_011526.1:g.20915A>G, NM_000754.3:c.-91-3545A>G, NM_001135161.1:c.-91-3545A>G, NM_001135162.1:c.-91-3545A>G, XM_005261229.1:c.-385-3545A>G, XM_011529885.1:c.-331A>G, XM_011529886.1:c.-331A>G, XM_011529887.1:c.-91-3545A>G, XM_011529888.1:c.-91-3545A>G, XM_011529889.1:c.-91-3545A>G, XM_011529890.1:c.-385-3545A>G, XM_011529891.1:c.-385-3545A>G
A > G
SNP
No VIP available No Clinical Annotations available VA
rs750155 NC_000016.10:g.28609251C>T, NC_000016.9:g.28620572C>T, NG_028128.1:g.19295G>A, NM_001055.3:c.-4-392G>A, NM_001310136.1:c.121-142349G>A, NM_177529.2:c.-35-361G>A, NM_177530.2:c.-197G>A, NM_177534.2:c.-396G>A, NM_177536.3:c.139-2174G>A, XM_005255522.1:c.-4-392G>A
C > T
SNP
No VIP available CA VA
rs75017182 NC_000001.10:g.98045449G>C, NC_000001.11:g.97579893G>C, NG_008807.2:g.346167C>G, NM_000110.3:c.1129-5923C>G, XM_005270561.1:c.1018-5923C>G, XM_005270562.1:c.1129-5923C>G, XM_005270562.3:c.1129-5923C>G, XM_005270563.1:c.1129-5923C>G, XM_005270564.1:c.1129-5923C>G, XM_006710397.2:c.1129-5923C>G
G > C
SNP
No VIP available No Clinical Annotations available VA
rs75267292
A > G
SNP
No VIP available No Clinical Annotations available VA
rs7586110 NC_000002.11:g.234590527T>G, NC_000002.12:g.233681881T>G, NG_002601.2:g.97138T>G, NM_019075.2:c.855+44504T>G, NM_019076.4:c.855+63319T>G, NM_019077.2:c.-57T>G, NM_021027.2:c.855+9092T>G, XM_005246081.1:c.-57T>G, XR_241241.1:n.941+9092T>G, rs60348498
T > G
SNP
No VIP available CA No Variant Annotations available
rs760370 NC_000006.11:g.44200953A>G, NC_000006.12:g.44233216A>G, NG_042893.1:g.18712A>G, NM_001078174.1:c.1260-201A>G, NM_001078175.2:c.1260-201A>G, NM_001078176.2:c.1260-201A>G, NM_001078177.1:c.1260-201A>G, NM_001304462.1:c.1497-201A>G, NM_001304463.1:c.1386-201A>G, NM_001304465.1:c.1338-201A>G, NM_001304466.1:c.1335-201A>G, NM_004955.2:c.1260-201A>G, XM_005248875.1:c.1497-201A>G, XM_005248876.1:c.1389-201A>G, XM_005248876.3:c.1389-201A>G, XM_005248877.1:c.1386-201A>G, XM_005248878.1:c.1260-201A>G, XM_005248878.3:c.1260-201A>G, XM_005248879.1:c.1260-201A>G, XM_005248879.3:c.1260-201A>G, XM_005248880.1:c.1260-201A>G, XM_005248880.3:c.1260-201A>G, XM_005248881.1:c.1260-201A>G, XM_005248881.3:c.1260-201A>G, XM_005248882.1:c.1260-201A>G, XM_005248882.3:c.1260-201A>G, XM_011514341.1:c.1500-201A>G, rs59700015
A > G
SNP
No VIP available No Clinical Annotations available VA
rs7668258 NC_000004.11:g.69962078T>C, NC_000004.12:g.69096360T>C, NM_001074.2:c.-161T>C, XM_005265702.1:c.-26-2180T>C, XM_005265702.2:c.-26-2180T>C, XM_011532229.1:c.-161T>C, XM_011532230.1:c.-161T>C, XM_011532231.1:c.-26-2180T>C, rs17551675, rs60174701
T > C
SNP
No VIP available No Clinical Annotations available VA
rs768172 NC_000007.13:g.95805703A>T, NC_000007.14:g.96176391A>T, NG_012247.1:g.150757T>A, NM_001160210.1:c.1181-4867T>A, NM_014251.2:c.1178-4867T>A, NR_027662.1:n.1253-4867T>A, XM_006715831.2:c.1211-4867T>A, XM_011515727.1:c.1211-4867T>A, XM_011515728.1:c.326-4867T>A, rs118193516, rs59685268
A > T
SNP
No VIP available No Clinical Annotations available VA
rs770063251 NC_000008.10:g.105436493C>T, NC_000008.11:g.104424265C>T, NG_008840.1:g.47785G>A, NM_001385.2:c.1217G>A, NP_001376.1:p.Trp406Ter, XM_005250818.1:c.1217G>A, XM_005250818.2:c.1217G>A, XM_005250819.1:c.1217G>A, XM_006716518.2:c.1058G>A, XM_011516903.1:c.1217G>A, XM_011516904.1:c.1217G>A, XP_005250875.1:p.Trp406Ter, XP_005250876.1:p.Trp406Ter, XP_006716581.1:p.Trp353Ter, XP_011515205.1:p.Trp406Ter, XP_011515206.1:p.Trp406Ter
C > T
SNP
W406*
No VIP available No Clinical Annotations available VA
rs7746993 NC_000006.11:g.52714137C>A, NC_000006.12:g.52849339C>A, NG_029175.2:g.21120G>T, rs59957668
C > A
SNP
No VIP available No Clinical Annotations available VA
rs77475703
C > G
SNP
No VIP available No Clinical Annotations available VA
rs7754103 NC_000006.11:g.160061090C>T, NC_000006.12:g.159640058C>T, rs57022833
C > T
SNP
No VIP available No Clinical Annotations available VA
rs7757130 NC_000006.11:g.113317262C>A, NC_000006.12:g.112996060C>A, XR_942887.1:n.973-1377C>A
C > A
SNP
No VIP available No Clinical Annotations available VA
rs776746 NC_000007.13:g.99270539C>T, NC_000007.14:g.99672916T>C, NG_007938.1:g.12083G=, NG_007938.1:g.12083G>A, NM_000777.4:c.219-237A>G, NM_000777.4:c.219-237G>A, NM_001190484.2:c.219-237A>G, NM_001190484.2:c.219-237G>A, NM_001291829.1:c.-253-1A>G, NM_001291829.1:c.-253-1G>A, NM_001291830.1:c.189-237A>G, NM_001291830.1:c.189-237G>A, NR_033807.2:n.717-1A>G, NR_033807.2:n.717-1G>A, NR_033808.1:n.689-1G>A, NR_033809.1:n.581-237G>A, NR_033810.1:n.689-1G>A, NR_033811.1:n.321-1G>A, NR_033812.1:n.321-1G>A, XM_005250169.1:c.189-237G>A, XM_005250170.1:c.-357-1G>A, XM_005250171.1:c.-253-1G>A, XM_005250172.1:c.-254G>A, XM_005250173.1:c.-331-237G>A, XM_005250198.1:c.806-4288C>T, XM_006715859.2:c.219-237A>G, XM_011515843.1:c.-254A>G, XM_011515844.1:c.-229-237A>G, XM_011515845.1:c.-463-1A>G, XM_011515846.1:c.-331-237A>G, XM_011515847.1:c.-571-1A>G, XR_927383.1:n.344-237A>G, XR_927402.1:n.1466+48736T>C, rs10361242, rs11266830, rs386613022, rs58244770
C > T
SNP
No VIP available CA VA
rs7853758 NC_000009.11:g.86900926G>A, NC_000009.12:g.84286011G>A, NM_001199633.1:c.1381C>T, NM_022127.2:c.1381C>T, NP_001186562.1:p.Leu461=, NP_071410.1:p.Leu461=, NR_037638.2:n.1703C>T, XM_011518905.1:c.1465C>T, XM_011518906.1:c.1465C>T, XM_011518907.1:c.1132C>T, XM_011518908.1:c.742C>T, XP_011517207.1:p.Leu489=, XP_011517208.1:p.Leu489=, XP_011517209.1:p.Leu378=, XP_011517210.1:p.Leu248=, XR_929832.1:n.1572C>T, XR_930033.1:n.88-3031G>A, rs59483082, rs59559753
G > A
SNP
L461L
No VIP available CA No Variant Annotations available
rs7867504 NC_000009.11:g.86920236T>C, NC_000009.12:g.84305321T>C, NM_001199633.1:c.267A>G, NM_022127.2:c.267A>G, NP_001186562.1:p.Thr89=, NP_071410.1:p.Thr89=, NR_037638.2:n.589A>G, XM_011518905.1:c.419-2932A>G, XM_011518906.1:c.419-2932A>G, XM_011518907.1:c.86-2932A>G, XM_011518909.1:c.419-2932A>G, XM_011518910.1:c.419-2932A>G, XR_929832.1:n.546-2932A>G, rs386613708, rs60110305
T > -
T > C
SNP
T89T
No VIP available No Clinical Annotations available VA
rs7909236 NC_000010.10:g.96829430G>T, NC_000010.11:g.95069673G>T, NG_007972.1:g.4825C>A, NM_000770.3:c.-271C>A, NM_001198853.1:c.-519C>A, NM_001198854.1:c.-452C>A, NM_001198855.1:c.-581C>A, XR_246073.1:n.-175C>A, XR_945610.1:n.-175C>A, rs386613993, rs57610240
G > T
SNP
No VIP available No Clinical Annotations available VA
rs7977213 NC_000012.11:g.20980800G>C, NC_000012.12:g.20827866G>C, NG_032071.1:g.22163G>C, NM_019844.3:c.84+12044G>C, XM_005253347.1:c.84+12044G>C, rs11502664, rs58558915
G > C
SNP
No VIP available No Clinical Annotations available VA
rs8001466 NC_000013.10:g.99355601G>C, NC_000013.11:g.98703347G>C, NG_017032.1:g.54329C>G, NM_005073.3:c.1417-818C>G
G > C
SNP
No VIP available No Clinical Annotations available VA
rs8056100 NC_000016.10:g.48226719G>A, NC_000016.9:g.48260630G>A, NG_011522.1:g.13459C>T, NM_032583.3:c.395+1087C>T, NM_033151.3:c.395+1087C>T, NM_145186.2:c.395+1087C>T, XM_005256208.1:c.395+1087C>T, XM_005256209.1:c.395+1087C>T, XM_005256210.1:c.395+1087C>T, XM_011523396.1:c.197+1087C>T, XR_243432.1:n.500+1087C>T, rs58118497
G > A
SNP
No VIP available CA VA
rs8175347
(TA)6 > (TA)5
(TA)6 > (TA)7
(TA)6 > (TA)8
microsatellite
No VIP available No Clinical Annotations available VA
rs8187710 NC_000010.10:g.101611294G>A, NC_000010.11:g.99851537G>A, NG_011798.1:g.73832G>A, NM_000392.4:c.4544G>A, NP_000383.1:p.Cys1515Tyr, XM_005269536.1:c.4265G>A, XM_006717630.2:c.3848G>A, XP_005269593.1:p.Cys1422Tyr, XP_006717693.1:p.Cys1283Tyr, XR_945605.1:n.4608G>A, rs17222568, rs52804507, rs58135906
G > A
SNP
C1515Y
No VIP available No Clinical Annotations available VA
rs8192924 NC_000016.10:g.66940496G>A, NC_000016.9:g.66974399G>A, NM_003869.5:c.809G>A, NM_198061.2:c.809G>A, NP_003860.2:p.Arg270His, NP_932327.1:p.Arg270His, NR_036684.1:n.2047G>A, XM_011523421.1:c.338G>A, XP_011521723.1:p.Arg113His
G > -
G > A
SNP
R270H
No VIP available No Clinical Annotations available VA
rs833061 NC_000006.11:g.43737486C>T, NC_000006.12:g.43769749C>T, NG_008732.1:g.4534C>T, NM_001025366.2:c.-958C>T, NM_001025367.2:c.-958C>T, NM_001025368.2:c.-958C>T, NM_001025369.2:c.-958C>T, NM_001025370.2:c.-958C>T, NM_001033756.2:c.-958C>T, NM_001171622.1:c.-958C>T, NM_001171623.1:c.-1498C>T, NM_001171624.1:c.-1498C>T, NM_001171625.1:c.-1498C>T, NM_001171626.1:c.-1498C>T, NM_001171627.1:c.-1498C>T, NM_001171628.1:c.-1498C>T, NM_001171629.1:c.-1498C>T, NM_001171630.1:c.-1498C>T, NM_001204384.1:c.-1498C>T, NM_001204385.1:c.-958C>T, NM_001317010.1:c.-1498C>T, NM_003376.5:c.-958C>T, rs36208046, rs60746584
C > T
SNP
No VIP available CA No Variant Annotations available
rs861539 NC_000014.8:g.104165753G>A, NC_000014.9:g.103699416G>A, NG_011516.1:g.21071C>T, NG_012307.1:g.75229G>A, NM_001100118.1:c.722C>T, NM_001100119.1:c.722C>T, NM_001130107.1:c.1782-1239G>A, NM_005432.3:c.722C>T, NM_182923.3:c.1651-1239G>A, NP_001093588.1:p.Thr241Met, NP_001093589.1:p.Thr241Met, NP_005423.1:p.Thr241Met, XM_005267599.1:c.1924-1239G>A, XM_005267600.1:c.*17-1239G>A, XM_005267602.1:c.1897-1239G>A, XM_005267603.1:c.*17-1239G>A, XM_005267604.1:c.1857-1239G>A, XM_005267605.1:c.1849-1239G>A, XM_005267606.1:c.*17-1239G>A, XM_005267607.1:c.1830-1239G>A, XM_005267608.1:c.1825-1239G>A, XM_005267609.1:c.1822-1239G>A, XM_005267610.1:c.*46-1239G>A, XM_005267612.1:c.*17-1239G>A, XM_005267613.1:c.1758-1239G>A, XM_005267614.1:c.1755-1239G>A, XM_005267615.1:c.1726-1239G>A, XM_005267616.1:c.*17-1239G>A, XM_005267617.1:c.1699-1239G>A, XM_005267618.1:c.*17-1239G>A, XM_005267624.1:c.1624-1239G>A, XM_005268045.1:c.722C>T, XM_005268046.1:c.722C>T, XM_005268047.1:c.722C>T, XM_011537138.1:c.722C>T, XP_005268102.1:p.Thr241Met, XP_005268103.1:p.Thr241Met, XP_005268104.1:p.Thr241Met, XP_011535440.1:p.Thr241Met, rs1734804, rs17435402, rs17850783, rs3212111, rs56934996
G > A
SNP
T241M
No VIP available No Clinical Annotations available VA
rs871514 NC_000002.11:g.234628529T>C, NC_000002.12:g.233719883T>C, NG_002601.2:g.135140T>C, NM_001072.3:c.861+26018T>C, NM_007120.2:c.867+196T>C, NM_019075.2:c.856-47151T>C, NM_019076.4:c.856-47151T>C, NM_019077.2:c.855+37091T>C, NM_019078.1:c.867+6025T>C, NM_021027.2:c.855+47094T>C, NM_205862.1:c.60+26018T>C, XR_241238.1:n.923+196T>C, XR_241240.1:n.1022+26018T>C, XR_241241.1:n.941+47094T>C, rs386618255, rs58866400, rs61099298
T > C
SNP
No VIP available CA VA
rs885004 NC_000009.11:g.86909550G>A, NC_000009.12:g.84294635G>A, NM_001199633.1:c.862-360C>T, NM_022127.2:c.862-360C>T, NR_037638.2:n.1184-360C>T, XM_011518905.1:c.946-360C>T, XM_011518906.1:c.946-360C>T, XM_011518907.1:c.613-360C>T, XM_011518908.1:c.223-360C>T, XM_011518909.1:c.946-360C>T, XM_011518910.1:c.946-360C>T, XR_929832.1:n.1073-360C>T, rs59238422
G > A
SNP
No VIP available CA VA
rs895819 NC_000019.10:g.13836478T>C, NC_000019.9:g.13947292T>C, NR_029495.1:n.182A>G, NR_029497.1:n.-119A>G, NR_029501.1:n.40A>G, NR_036515.1:n.-189A>G, rs117072305, rs61371382
T > C
SNP
No VIP available CA VA
rs9024 NC_000021.8:g.37445313G>A, NC_000021.9:g.36073015G>A, NM_001286789.1:c.*1076G>A, NM_001757.3:c.*133G>A, NR_040084.1:n.377+1866C>T, XM_005261073.1:c.*1076G>A, rs17228577, rs3171443, rs61389789
G > A
SNP
No VIP available No Clinical Annotations available VA
rs9282861 NC_000016.10:g.28606193C>T, NC_000016.9:g.28617514C>T, NG_028128.1:g.22353G>A, NM_001055.3:c.638G>A, NM_001310136.1:c.121-139291G>A, NM_177529.2:c.638G>A, NM_177530.2:c.638G>A, NM_177534.2:c.638G>A, NM_177536.3:c.404G>A, NP_001046.2:p.Arg213His, NP_803565.1:p.Arg213His, NP_803566.1:p.Arg213His, NP_803878.1:p.Arg213His, NP_803880.1:p.Arg135His, XM_005255522.1:c.638G>A, XP_005255579.1:p.Arg213His, rs17844870, rs17857585
C > T
SNP
R213H
No VIP available CA VA
rs9332377 NC_000022.10:g.19955692C>T, NC_000022.11:g.19968169C>T, NG_011526.1:g.31430C>T, NG_023326.1:g.53618G>A, NM_000754.3:c.616-367C>T, NM_001135161.1:c.616-367C>T, NM_001135162.1:c.616-367C>T, NM_007310.2:c.466-367C>T, XM_005261229.1:c.616-367C>T, XM_005261242.1:c.2764-960G>A, XM_006724243.1:c.2782-960G>A, XM_006724246.2:c.2536-960G>A, XM_011529885.1:c.*742C>T, XM_011529886.1:c.730-367C>T, XM_011529887.1:c.*742C>T, XM_011529888.1:c.*742C>T, XM_011529889.1:c.*742C>T, XM_011529890.1:c.*742C>T, XM_011529891.1:c.*742C>T, XM_011530179.1:c.2749-960G>A, XM_011530182.1:c.1348-960G>A, rs60676269
C > T
SNP
No VIP available CA No Variant Annotations available
rs9340799 NC_000006.11:g.152163381A>G, NC_000006.12:g.151842246A>G, NG_008493.1:g.156751A>G, NM_000125.3:c.453-351A>G, NM_001122740.1:c.453-351A>G, NM_001122741.1:c.453-351A>G, NM_001122742.1:c.453-351A>G, NM_001291230.1:c.453-351A>G, NM_001291241.1:c.453-351A>G, XM_005266856.1:c.453-351A>G, XM_005266857.1:c.453-351A>G, XM_006715374.2:c.453-351A>G, XM_006715375.2:c.-67-351A>G, XM_011535543.1:c.453-351A>G, XM_011535544.1:c.453-351A>G, XM_011535545.1:c.453-351A>G, XM_011535546.1:c.453-351A>G, XM_011535547.1:c.453-351A>G, XM_011535548.1:c.-67-351A>G, rs17208058, rs59875577
A > G
SNP
No VIP available CA VA
rs9351963 NC_000006.11:g.73749861A>C, NC_000006.12:g.73040138A>C, NM_001160130.1:c.490-1798A>C, NM_001160132.1:c.490-1798A>C, NM_001160133.1:c.490-1798A>C, NM_001160134.1:c.490-1798A>C, NM_019842.3:c.490-1798A>C, XM_005248734.1:c.-9-1798A>C, XM_011535944.1:c.490-1798A>C
A > C
SNP
No VIP available CA VA
rs9514091 NC_000013.10:g.103714254G>A, NC_000013.11:g.103061904G>A, NG_016648.1:g.9943C>T, NM_000452.2:c.378-3522C>T, rs57163569
G > A
SNP
No VIP available CA No Variant Annotations available
rs9561778 NC_000013.10:g.95713715G>T, NC_000013.11:g.95061461G>T, NM_001301829.1:c.3225+1243C>A, NM_005845.4:c.3366+1243C>A, XM_005254025.1:c.3237+1243C>A, XM_005254025.2:c.3237+1243C>A, XM_005254026.1:c.3225+1243C>A, XM_005254027.1:c.3141+1243C>A, XM_006719914.1:c.3276+1243C>A, XM_011521047.1:c.2817+1243C>A, rs17234943
G > A
G > T
SNP
No VIP available No Clinical Annotations available VA
rs9657362 NC_000008.10:g.1833801G>C, NC_000008.11:g.1885635G>C, NG_008480.1:g.66653G>C, NM_001308152.1:c.996G>C, NM_001308153.1:c.1185G>C, NM_014629.2:c.1110G>C, NM_014629.3:c.1110G>C, NP_001295081.1:p.Leu332Phe, NP_001295082.1:p.Leu395Phe, NP_055444.2:p.Leu370Phe, NT_187576.1:g.69011G>C, XM_005266039.1:c.1182G>C, XM_005266040.1:c.1185G>C, XM_005266040.3:c.1185G>C, XM_005266041.1:c.1113G>C, XM_005266041.2:c.1113G>C, XM_005266042.1:c.996G>C, XM_006725106.2:c.1185G>C, XM_006725107.2:c.1113G>C, XM_006725111.1:c.996G>C, XM_011534766.1:c.1113G>C, XM_011534767.1:c.993G>C, XM_011534768.1:c.1113G>C, XM_011534769.1:c.1068G>C, XM_011534770.1:c.1113G>C, XM_011546563.1:c.1113G>C, XM_011546564.1:c.993G>C, XM_011546565.1:c.1113G>C, XM_011546566.1:c.1068G>C, XM_011546567.1:c.1113G>C, XP_005266096.1:p.Leu394Phe, XP_005266097.1:p.Leu395Phe, XP_005266098.1:p.Leu371Phe, XP_005266099.1:p.Leu332Phe, XP_006725169.1:p.Leu395Phe, XP_006725170.1:p.Leu371Phe, XP_006725174.1:p.Leu332Phe, XP_011533068.1:p.Leu371Phe, XP_011533069.1:p.Leu331Phe, XP_011533070.1:p.Leu371Phe, XP_011533071.1:p.Leu356Phe, XP_011533072.1:p.Leu371Phe, XP_011544865.1:p.Leu371Phe, XP_011544866.1:p.Leu331Phe, XP_011544867.1:p.Leu371Phe, XP_011544868.1:p.Leu356Phe, XP_011544869.1:p.Leu371Phe, rs52817136, rs57380468
G > C
SNP
L332F
No VIP available CA No Variant Annotations available
rs9679162 NC_000002.11:g.31247514G>T, NC_000002.12:g.31024648G>T, NM_001253826.1:c.315-58346C>A, NM_001253827.1:c.70-31641C>A, NM_024572.3:c.130-31641C>A, NR_045602.1:n.903-31641C>A, XM_005264559.1:c.25-31641C>A, XM_011533104.1:c.448-31641C>A, XM_011533105.1:c.70-31641C>A, XM_011533106.1:c.43-31641C>A, rs56573917, rs57478659, rs60984987
G > T
SNP
No VIP available CA VA
rs9936750 NC_000016.10:g.55137962T>C, NC_000016.9:g.55171874T>C, rs17210912, rs61515867
T > C
SNP
No VIP available CA No Variant Annotations available
rs9937 NC_000011.10:g.4138227A>G, NC_000011.9:g.4159457A>G, NG_027992.2:g.48534A>G, NM_001033.3:c.2223A>G, NM_001033.4:c.2223A>G, NM_001318064.1:c.1932A>G, NM_001318065.1:c.1209A>G, NP_001024.1:p.Thr741=, NP_001304993.1:p.Thr644=, NP_001304994.1:p.Thr403=, XM_005253058.1:c.1980A>G, XM_005253059.1:c.1932A>G, XM_011520277.1:c.1932A>G, XM_011520278.1:c.1557A>G, XM_011520279.1:c.1209A>G, XP_005253115.1:p.Thr660=, XP_005253116.1:p.Thr644=, XP_011518579.1:p.Thr644=, XP_011518580.1:p.Thr519=, XP_011518581.1:p.Thr403=, rs1042857, rs17295553, rs17349998, rs17398272, rs17850106, rs2228120, rs3177016, rs59628733
A > G
SNP
T741T
No VIP available CA No Variant Annotations available
rs9981861 NC_000021.8:g.41415044T>C, NC_000021.9:g.40043117T>C, NM_001271534.1:c.5384-444A>G, NM_001389.3:c.5384-444A>G, NR_073202.1:n.5645-444A>G, XM_011529481.1:c.3020-444A>G, rs57793011
T > C
SNP
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 147

Overview

Alternate Names: 
Synonym
Benign Neoplasm; Benign Neoplasms; Cancer; Cancers; Neoplasm; Neoplasm, Benign; Neoplasms NOS; Neoplasms, Benign; Tumor; Tumors; Tumour
PharmGKB Accession Id: PA445062
External Vocabularies

Curated Information ?

Curated Information ?

Evidence Drug
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ABT-751
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
acetylcysteine
No Dosing Guideline available DL CA No Variant Annotation available No VIP available No VIP available
anastrozole
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
arsenic trioxide
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
azacitidine
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
azathioprine
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
belinostat
No Dosing Guideline available DL CA No Variant Annotation available No VIP available No VIP available
bevacizumab
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
bilirubin
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
bortezomib
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
busulfan
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
caffeine
No Dosing Guideline available DL CA VA No VIP available No VIP available
capecitabine
No Dosing Guideline available DL CA VA No VIP available No VIP available
carboplatin
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
carmustine
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
celecoxib
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
cetuximab
No Dosing Guideline available DL CA VA No VIP available No VIP available
cisplatin
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
clomipramine
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
conjugated estrogens
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
cyanocobalamin
No Dosing Guideline available DL CA VA No VIP available No VIP available
cyclophosphamide
No Dosing Guideline available DL CA No Variant Annotation available No VIP available No VIP available
cytarabine
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
dactinomycin
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
dasatinib
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
daunorubicin
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
difluorodeoxyuridine
No Dosing Guideline available DL CA VA No VIP available No VIP available
docetaxel
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
doxorubicin
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
epinephrine
No Dosing Guideline available DL CA No Variant Annotation available No VIP available No VIP available
epirubicin
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
epoprostenol
No Dosing Guideline available DL CA VA No VIP available No VIP available
erlotinib
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
erythromycin
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
etoposide
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
everolimus
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
fentanyl
No Dosing Guideline available DL CA VA No VIP available No VIP available
fluorouracil
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
fluphenazine
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
folic acid
No Dosing Guideline available DL CA No Variant Annotation available No VIP available No VIP available
gefitinib
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
geldanamycin
No Dosing Guideline available DL CA VA No VIP available No VIP available
gemcitabine
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
granisetron
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
haloperidol
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
idarubicin
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ifosfamide
No Dosing Guideline available DL CA VA No VIP available No VIP available
imatinib
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
indomethacin
No Dosing Guideline available DL CA VA No VIP available No VIP available
irinotecan
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ketamine
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
lapatinib
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
letrozole
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
leucovorin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
lurbinectedin
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
mercaptopurine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
metformin
No Dosing Guideline available DL CA VA No VIP available No VIP available
methotrexate
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
methylene blue
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
metoclopramide
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
midazolam
No Dosing Guideline available DL CA No Variant Annotation available No VIP available No VIP available
mitoxantrone
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
morphine
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
nicotine
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
nsc697887
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ondansetron
No Dosing Guideline available DL CA VA No VIP available No VIP available
oxaliplatin
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
oxycodone
No Dosing Guideline available DL CA VA No VIP available No VIP available
paclitaxel
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
panitumumab
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
pazopanib
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
pemetrexed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
platinum
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
probenecid
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
raltitrexed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
rasburicase
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
s 1 (combination)
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
sertraline
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
sildenafil
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
simvastatin
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
sirolimus
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SN-38
No Dosing Guideline available DL CA VA No VIP available No VIP available
sorafenib
No Dosing Guideline available DL CA VA No VIP available No VIP available
sunitinib
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
tamoxifen
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
tegafur
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
temsirolimus
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
teniposide
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
thalidomide
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
thioguanine
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
thiotepa
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
tipifarnib
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
trastuzumab
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
treprostinil
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
tropisetron
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
valproic acid
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
vincristine
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
vinorelbine
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
voriconazole
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
warfarin
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
zoledronate

Relationships from National Drug File - Reference Terminology (NDF-RT)

May Treat
Contraindicated With
No related diseases are available

Publications related to Neoplasms: 734

No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
UGT1A1 polymorphisms with irinotecan-induced toxicities and treatment outcome in Asians with Lung Cancer: a meta-analysis. Cancer chemotherapy and pharmacology. 2017. Chen Xuewei, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
TPMT, COMT and ACYP2 genetic variants in paediatric cancer patients with cisplatin-induced ototoxicity. Pharmacogenetics and genomics. 2017. Thiesen Signe, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics in pediatric acute lymphoblastic leukemia: promises and limitations. Pharmacogenomics. 2017. Al-Mahayri Zeina N, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Incidence and triggers of Stevens-Johnson syndrome and toxic epidermal necrolysis in a large cancer patient cohort. The Journal of investigative dermatology. 2017. Gillis Nancy K, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association Between SLC16A5 Genetic Variation and Cisplatin-Induced Ototoxic Effects in Adult Patients With Testicular Cancer. JAMA oncology. 2017. Drögemöller Britt I, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Influence of CYP2C8 polymorphisms on imatinib steady-state trough level in chronic myeloid leukemia and gastrointestinal stromal tumor patients. Pharmacogenetics and genomics. 2017. Verboom Michiel C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The role of germline variants in chemotherapy outcome in brain tumors: a systematic review of pharmacogenetic studies. Pharmacogenomics. 2017. Klumpers Marije J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Clinical-pharmacogenetic models for personalized cancer treatment: application to malignant mesothelioma. Scientific reports. 2017. Goričar Katja, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
AKT-phosphorylated FOXO1 suppresses ERK activation and chemoresistance by disrupting IQGAP1-MAPK interaction. The EMBO journal. 2017. Pan Chun-Wu, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Quantitative contribution of rs75017182 to dihydropyrimidine dehydrogenase mRNA splicing and enzyme activity. Clinical pharmacology and therapeutics. 2017. Nie Qian, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
OPRM1 c.118A>G Polymorphism and Duration of Morphine Treatment Associated with Morphine Doses and Quality-of-Life in Palliative Cancer Pain Settings. International journal of molecular sciences. 2017. Hajj Aline, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Identification of new SNPs associated with severe toxicity to capecitabine. Pharmacological research. 2017. Pellicer Marta, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Data Sharing, Clinical Trials and Biomarkers in Precision Oncology Challenges, Opportunities and Programs at the Department of Veterans Affairs. Clinical pharmacology and therapeutics. 2017. Fiore L D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Novel genetic variants in carboxylesterase 1 predict severe early-onset capecitabine-related toxicity. Clinical pharmacology and therapeutics. 2017. Hamzic Seid, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Predictive Value of UGT1A1*28 Polymorphism In Irinotecan-based Chemotherapy. Journal of Cancer. 2017. Liu Xing-Han, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic variants associated with outcome in patients with advanced gastric cancer treated with fluoropyrimidine and platinum-based triplet combinations: a pooled analysis of three prospective studies. The pharmacogenomics journal. 2016. Meulendijks D, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Evaluation of 5-fluorouracil degradation rate and Pharmacogenetic profiling to predict toxicity following adjuvant Capecitabine. European journal of clinical pharmacology. 2016. Roberto Michela, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pancytopenia and Severe Gastrointestinal Toxicities Associated with 5-Fluorouracil in a Patient with Thymidylate Synthase (TYMS) Polymorphism. Cureus. 2016. Wang Bo, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The First Case of Severe Takotsubo Cardiomyopathy Associated with 5-Fluorouracil in a Patient with Abnormalities of Both Dihydropyrimidine Dehydrogenase (DPYD) and Thymidylate Synthase (TYMS) Genes. Cureus. 2016. Saif Muhammad W, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The TYMS-TSER polymorphism is associated with toxicity of low-dose capecitabine in patients with advanced gastrointestinal cancer. Anti-cancer drugs. 2016. Romiti Adriana, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Patients homozygous for DPYD c.1129-5923C>G/haplotype B3 have partial DPD deficiency and require a dose reduction when treated with fluoropyrimidines. Cancer chemotherapy and pharmacology. 2016. Meulendijks Didier, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MultiDimensional ClinOmics for Precision Therapy of Children and Adolescent Young Adults with Relapsed and Refractory Cancer: A Report from the Center for Cancer Research. Clinical cancer research : an official journal of the American Association for Cancer Research. 2016. Chang Wendy, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Opioid treatment failure in cancer patients: the role of clinical and genetic factors. Pharmacogenomics. 2016. Oosten Astrid W, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic predictors of toxicity to platinum based chemotherapy in non-small cell lung cancer patients. Pharmacological research. 2016. Pérez-Ramírez Cristina, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Influence of ADORA2A gene polymorphism on leukoencephalopathy risk in MTX-treated pediatric patients affected by hematological malignancies. Pediatric blood & cancer. 2016. Tsujimoto Shin-Ichi, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Promoter region variation in NFE2L2 influences susceptibility to ototoxicity in patients exposed to high cumulative doses of cisplatin. The pharmacogenomics journal. 2016. Spracklen T F, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Prospective study of the UGT1A1*27 gene polymorphism during irinotecan therapy in patients with lung cancer: Results of Lung Oncology Group in Kyusyu (LOGIK1004B). Thoracic cancer. 2016. Fukuda Minoru, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
LAT-1 activity of meta-substituted phenylalanine and tyrosine analogs. Bioorganic & medicinal chemistry letters. 2016. Augustyn Evan, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Rs895819 in MIR27A improves the predictive value of DPYD variants to identify patients at risk of severe fluoropyrimidine-associated toxicity. International journal of cancer. 2016. Meulendijks Didier, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
miRNAs: mediators of ErbB family targeted therapy resistance. Pharmacogenomics. 2016. Adem Bárbara Filipa, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A novel genetic score model of UGT1A1 and TGFB pathway as predictor of severe irinotecan-related diarrhea in metastatic colorectal cancer patients. Journal of cancer research and clinical oncology. 2016. Li Jing, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Influence of ABCB1 and ABCG2 polymorphisms on the antiemetic efficacy in patients with cancer receiving cisplatin-based chemotherapy: a TRIPLE pharmacogenomics study. The pharmacogenomics journal. 2016. Tsuji D, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Effect of Single Nucleotide Polymorphisms in the Xenobiotic-sensing Receptors NR1I2 and NR1I3 on the Pharmacokinetics and Toxicity of Irinotecan in Colorectal Cancer Patients. Clinical pharmacokinetics. 2016. Mbatchi Litaty Céphanoée, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Treatment with subcutaneous and transdermal fentanyl: results from a population pharmacokinetic study in cancer patients. European journal of clinical pharmacology. 2016. Oosten Astrid W, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacokinetics and pharmacogenetics of Gemcitabine as a mainstay in adult and pediatric oncology: an EORTC-PAMM perspective. Cancer chemotherapy and pharmacology. 2016. Ciccolini Joseph, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Effects of UGT1A1*6, UGT1A1*28, and ABCB1-3435C>T polymorphisms on irinotecan induced toxicity in Chinese cancer patients. International journal of clinical pharmacology and therapeutics. 2016. Yan Liang, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Lethal 5-fluorouracil toxicity in a colorectal patient with severe dihydropyrimidine dehydrogenase (DPD) deficiency. International journal of colorectal disease. 2016. Dhelens Carole, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association of thymidylate synthase polymorphisms with the tumor response to preoperative chemoradiotherapy in rectal cancer: a systematic review and meta-analysis. The pharmacogenomics journal. 2016. Yang Y C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The impact of ABCC11 polymorphisms on the risk of early-onset fluoropyrimidine toxicity. The pharmacogenomics journal. 2016. Hamzic S, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Impact of UGT1A1 genotype upon toxicities of combination with low-dose irinotecan plus platinum. Asia-Pacific journal of clinical oncology. 2016. Takano Masashi, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Evidence for association of SNPs in ABCB1 and CBR3, but not RAC2, NCF4, SLC28A3 or TOP2B, with chronic cardiotoxicity in a cohort of breast cancer patients treated with anthracyclines. Pharmacogenomics. 2016. Hertz Daniel L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Personalizing supportive care in oncology patients using pharmacogenetic-driven treatment pathways. Pharmacogenomics. 2016. Andersen Rebecca L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Targeting therapeutic liabilities engendered by PIK3R1 mutations for cancer treatment. Pharmacogenomics. 2016. Cheung Lydia Wt, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
DPYD gene polymorphisms are associated with risk and chemotherapy prognosis in pediatric patients with acute lymphoblastic leukemia. Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine. 2016. Zhao Xiao-Qiang, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
TP53 Codon 72 Polymorphism Predicts Efficacy of Paclitaxel Plus Capecitabine Chemotherapy in Advanced Gastric Cancer Patients. Archives of medical research. 2016. Zha Yong, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Phenotypic and clinical implications of variants in the dihydropyrimidine dehydrogenase gene. Biochimica et biophysica acta. 2016. Kuilenburg André B P van, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Development of a physiologically based pharmacokinetic model of actinomycin D in children with cancer. British journal of clinical pharmacology. 2016. Walsh Christopher, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
New perspectives on mTOR inhibitors (Rapamycin, Rapalogs and TORKinibs) in transplantation. British journal of clinical pharmacology. 2016. Waldner Matthias, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Improvement of a predictive model in ovarian cancer patients submitted to platinum-based chemotherapy: implications of a GST activity profile. European journal of clinical pharmacology. 2016. Pereira Deolinda, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Increased risk of severe fluoropyrimidine-associated toxicity in patients carrying a G to C substitution in the first 28-bp tandem repeat of the thymidylate synthase 2R allele. International journal of cancer. Journal international du cancer. 2016. Meulendijks Didier, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
DPYD Genotyping to Predict Adverse Events Following Treatment With Flourouracil-Based Adjuvant Chemotherapy in Patients With Stage III Colon Cancer: A Secondary Analysis of the PETACC-8 Randomized Clinical Trial. JAMA oncology. 2016. Boige Valérie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The potential anticancer effect of beta-blockers and the genetic variations involved in the interindividual difference. Pharmacogenomics. 2016. He Ruo-Hui, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Correlation of UGT1A1(*)28 and (*)6 polymorphisms with irinotecan-induced neutropenia in Thai colorectal cancer patients. Drug metabolism and pharmacokinetics. 2015. Atasilp Chalirmporn, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Clinical validity of a DPYD-based pharmacogenetic test to predict severe toxicity to fluoropyrimidines. International journal of cancer. Journal international du cancer. 2015. Toffoli Giuseppe, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
UGT1A1 genotype-dependent dose adjustment of belinostat in patients with advanced cancers using population pharmacokinetic modeling and simulation. Journal of clinical pharmacology. 2015. Peer Cody J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Damage-inducible intragenic demethylation of the human TP53 tumor suppressor gene is associated with transcription from an alternative intronic promoter. Molecular carcinogenesis. 2015. Blackburn James, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphism of CYP3A4 and ABCB1 genes increase the risk of neuropathy in breast cancer patients treated with paclitaxel and docetaxel. OncoTargets and therapy. 2016. Kus Tulay, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association between DPYD c.1129-5923 C>G/hapB3 and severe toxicity to 5-fluorouracil-based chemotherapy in stage III colon cancer patients: NCCTG N0147 (Alliance). Pharmacogenetics and genomics. 2015. Lee Adam M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
G80A Single Nucleotide Polymorphism in Reduced Folate Carrier-1 Gene in a Mexican Population and its Impact on Survival in Patients with Acute Lymphoblastic Leukemia. Revista de investigación clínica; organo del Hospital de Enfermedades de la Nutrición. 2016. Candelaria Myrna, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Highlight on DPYD gene polymorphisms and treatment by capecitabine (.). Scandinavian journal of clinical and laboratory investigation. Supplementum. 2016. Milano Gérard. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Plasma extracellular RNA profiles in healthy and cancer patients. Scientific reports. 2016. Yuan Tiezheng, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Clinical relevance of DPYD variants c.1679T>G, c.1236G>A/HapB3, and c.1601G>A as predictors of severe fluoropyrimidine-associated toxicity: a systematic review and meta-analysis of individual patient data. The Lancet. Oncology. 2015. Meulendijks Didier, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Therapeutic potential of mTOR inhibitors for targeting cancer stem cells. British journal of clinical pharmacology. 2015. Francipane Maria Giovanna, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Integrated Patient and Tumor Genetic Testing for Individualized Cancer Therapy. Clinical pharmacology and therapeutics. 2015. Hertz Daniel L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Upfront Genotyping of DPYD*2A to Individualize Fluoropyrimidine Therapy: A Safety and Cost Analysis. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2015. Deenen Maarten J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinical Implications of Opioid Pharmacogenomics in Patients With Cancer. Cancer control : journal of the Moffitt Cancer Center. 2015. Bell Gillian C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Participation in Cancer Pharmacogenomic Studies: A Study of 8456 Patients Registered to Clinical Trials in the Cancer and Leukemia Group B (Alliance). Journal of the National Cancer Institute. 2015. Dressler Lynn G, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Association of the Charcot-Marie-Tooth disease gene ARHGEF10 with paclitaxel induced peripheral neuropathy in NCCTG N08CA (Alliance). Journal of the neurological sciences. 2015. Boora Ganesh K, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Impact of genetic variants of RFC1, DHFR and MTHFR in osteosarcoma patients treated with high-dose methotrexate. The pharmacogenomics journal. 2015. Jabeen S, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A coding variant in RARG confers susceptibility to anthracycline-induced cardiotoxicity in childhood cancer. Nature genetics. 2015. Aminkeng Folefac, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Comparable efficacy with varying dosages of glucarpidase in pediatric oncology patients. Pediatric blood & cancer. 2015. Scott Jeffrey R, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
High-throughput screening identified inherited genetic variations in the EGFR pathway contributing to skin toxicity of EGFR inhibitors. Pharmacogenomics. 2015. Hasheminasab Sayed-Mohammad, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The future of patient-derived tumor xenografts in cancer treatment. Pharmacogenomics. 2015. Sia Daniela, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
What role could organoids play in the personalization of cancer treatment?. Pharmacogenomics. 2015. Francies Hayley E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacokinetics and pharmacogenetics of capecitabine and its metabolites following replicate administration of two 500 mg tablet formulations. Cancer chemotherapy and pharmacology. 2015. Queckenberg Christian, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genotyping of a family with a novel deleterious DPYD mutation supports the pretherapeutic screening of DPD deficiency with dihydrouracil/uracil ratio. Clinical pharmacology and therapeutics. 2015. Thomas F, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Variability in Expression of CYP3A5 in Human Fetal Liver. Drug metabolism and disposition: the biological fate of chemicals. 2015. Vyhlidal Carrie A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Effects of UGT1A1 genotype on the pharmacokinetics, pharmacodynamics and toxicities of belinostat administered by 48 h continuous infusion in patients with cancer. Journal of clinical pharmacology. 2015. Goey Andrew K L, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Translating DPYD genotype into DPD phenotype: using the DPYD gene activity score. Pharmacogenomics. 2015. Henricks Linda M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genetic variants in SLC22A17 and SLC22A7 are associated with anthracycline-induced cardiotoxicity in children. Pharmacogenomics. 2015. Visscher Henk, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genotype-phenotype correlations in 5-fluorouracil metabolism: a candidate DPYD haplotype to improve toxicity prediction. The pharmacogenomics journal. 2015. Gentile G, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
4beta-hydroxycholesterol as an endogenous CYP3A marker in cancer patients treated with taxanes. British journal of clinical pharmacology. 2015. de Graan Anne-Joy M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Progressive decline in tacrolimus clearance after renal transplantation is partially explained by decreasing CYP3A4 activity and increasing hematocrit. British journal of clinical pharmacology. 2015. de Jonge Hylke, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Massively Parallel Functional Analysis of BRCA1 RING Domain Variants. Genetics. 2015. Starita Lea M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Deciphering Signaling Pathway Networks to Understand the Molecular Mechanisms of Metformin Action. PLoS computational biology. 2015. Sun Jingchun, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Relationship of MTHFR and NQO1 Pharmacogenetics and Chemotherapy Clinical Outcomes in Breast Cancer Patients. Biochemical genetics. 2015. Chaturvedi Pankaj, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Polymorphisms in MIR27A Associated with Early-Onset Toxicity in Fluoropyrimidine-Based Chemotherapy. Clinical cancer research : an official journal of the American Association for Cancer Research. 2015. Amstutz Ursula, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic studies in children with acute lymphoblastic leukemia in Argentina. Leukemia & lymphoma. 2015. Aráoz Hilda Verónica, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Role of folate status and methylenetetrahydrofolate reductase genotype on the toxicity and outcome of induction chemotherapy in children with acute lymphoblastic leukemia. Leukemia & lymphoma. 2015. Roy Moulik Nirmalya, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cancer pharmacogenomics: implications on ethnic diversity and drug response. Pharmacogenetics and genomics. 2015. Patel Jai N. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Phase I study of olaparib plus gemcitabine in patients with advanced solid tumours and comparison with gemcitabine alone in patients with locally advanced/metastatic pancreatic cancer. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO. 2015. Bendell J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Clinical validity of new genetic biomarkers of irinotecan neutropenia: an independent replication study. The pharmacogenomics journal. 2015. Crona D J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IL8 polymorphisms and overall survival in pazopanib- or sunitinib-treated patients with renal cell carcinoma. British journal of cancer. 2015. Xu C-F, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
DPD and UGT1A1 deficiency in colorectal cancer patients receiving triplet chemotherapy with fluoropyrimidines, oxaliplatin and irinotecan. British journal of clinical pharmacology. 2015. Falvella Felicia Stefania, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DBC1 functions as a tumor suppressor by regulating p53 stability. Cell reports. 2015. Qin Bo, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
YAP and the drug resistance highway. Nature genetics. 2015. Keren-Paz Alona, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CYP2B6*6 allele and age substantially reduce steady-state ketamine clearance in chronic pain patients: impact on adverse effects. British journal of clinical pharmacology. 2015. Li Yibai, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Germline TYMS genotype is highly predictive in patients with metastatic gastrointestinal malignancies receiving capecitabine-based chemotherapy. Cancer chemotherapy and pharmacology. 2015. Joerger M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Role of the lean body mass and of pharmacogenetic variants on the pharmacokinetics and pharmacodynamics of sunitinib in cancer patients. Investigational new drugs. 2015. Narjoz C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The Hippo effector YAP promotes resistance to RAF- and MEK-targeted cancer therapies. Nature genetics. 2015. Lin Luping, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic variability of DNA repair mechanisms and glutathione-S-transferase genes influences treatment outcome in osteosarcoma. Cancer epidemiology. 2015. Goričar Katja, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Validating drug repurposing signals using electronic health records: a case study of metformin associated with reduced cancer mortality. Journal of the American Medical Informatics Association : JAMIA. 2015. Xu Hua, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Dihydropyrimidine dehydrogenase 85T>C mutation is associated with ocular toxicity of 5-fluorouracil: a case report. American journal of therapeutics. 2015. Baskin Yasemin, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Relationship between UGT1A1*6/*28 polymorphisms and severe toxicities in Chinese patients with pancreatic or biliary tract cancer treated with irinotecan-containing regimens. Drug design, development and therapy. 2015. Yang Chen, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Correlation of UGT1A1 and ERCC1 gene polymorphisms with the outcome of combined irinotecan plus cisplatin treatment in recurrent ovarian cancer. Genetics and molecular research : GMR. 2015. Xu Q, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
DPYD Variants as Predictors of 5-fluorouracil Toxicity in Adjuvant Colon Cancer Treatment (NCCTG N0147). Journal of the National Cancer Institute. 2014. Lee Adam M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association between reduced folate carrier G80A polymorphism and methotrexate toxicity in childhood acute lymphoblastic leukemia: a meta-analysis. Leukemia & lymphoma. 2014. He Hai-Rong, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Crystal structure, biochemical and cellular activities demonstrate separate functions of MTH1 and MTH2. Nature communications. 2015. Carter Megan, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association of NADPH oxidase polymorphisms with anthracycline-induced cardiotoxicity in the RICOVER-60 trial of patients with aggressive CD20(+) B-cell lymphoma. Pharmacogenomics. 2015. Reichwagen Annegret, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Dihydropyrimidinase and beta-ureidopropionase gene variation and severe fluoropyrimidine-related toxicity. Pharmacogenomics. 2015. Kummer Dominic, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Polymorphisms in SLCO1B3 and NR1I2 as genetic determinants of hematotoxicity of carboplatin and paclitaxel combination. Pharmacogenomics. 2015. Mbatchi Litaty Céphanoée, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association of ABCB1 and FLT3 Polymorphisms with Toxicities and Survival in Asian Patients Receiving Sunitinib for Renal Cell Carcinoma. PloS one. 2015. Chu Ying-Hsia, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinicopathological characteristics of patients with non-small-cell lung cancer who harbor EML4-ALK fusion gene: a meta-analysis. PloS one. 2015. Zhao Fengzhi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Differential Activity of Nivolumab, Pembrolizumab and MPDL3280A according to the Tumor Expression of Programmed Death-Ligand-1 (PD-L1): Sensitivity Analysis of Trials in Melanoma, Lung and Genitourinary Cancers. PloS one. 2015. Carbognin Luisa, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Glutathione S-Transferase Gene Polymorphisms and Treatment Outcome in Cervical Cancer Patients under Concomitant Chemoradiation. PloS one. 2015. Abbas Mohammad, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Model-Based Individualized Treatment of Chemotherapeutics: Bayesian Population Modeling and Dose Optimization. PloS one. 2015. Jayachandran Devaraj, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Discovery of novel mutations in the dihydropyrimidine dehydrogenase gene associated with toxicity of fluoropyrimidines and viewpoint on preemptive pharmacogenetic screening in patients. The EPMA journal. 2015. Del Re Marzia, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Sequencing of Charcot-Marie-Tooth disease genes in a toxic polyneuropathy. Annals of neurology. 2014. Beutler Andreas S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Nras in melanoma: targeting the undruggable target. Critical reviews in oncology/hematology. 2014. Mandalà Mario, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Copy number variability analysis of pharmacogenes in patients with lymphoma, leukemia, hepatocellular, and lung carcinoma using The Cancer Genome Atlas data. Pharmacogenetics and genomics. 2014. Kim In-Wha, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
SNPs and taxane toxicity in breast cancer patients. Pharmacogenomics. 2014. Bosó Virginia, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of the DNA repair pathways in advanced non-small cell lung cancer patients treated with platinum-based chemotherapy. Cancer letters. 2014. Sullivan Ivana, et al. PubMed