Disease:
Death

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Gene ? Variant?
(147)
Alternate Names ? Chemicals ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
Translation
No VIP available No VIP available VA ADRB1 H1 N/A N/A N/A
No VIP available No VIP available VA CYP2C19 *1 N/A N/A N/A
No VIP available No VIP available VA CYP2C19 *2 N/A N/A N/A
No VIP available No VIP available VA CYP2C19 *3 N/A N/A N/A
No VIP available No VIP available VA CYP2C19 *4 N/A N/A N/A
No VIP available No VIP available VA CYP2C19 *5 N/A N/A N/A
No VIP available No VIP available VA CYP2C19 *17 N/A N/A N/A
No VIP available No VIP available VA CYP2D6 *1 N/A N/A N/A
No VIP available No VIP available VA CYP2D6 *1xN N/A N/A N/A
No VIP available No VIP available VA CYP2D6 *2xN N/A N/A N/A
No VIP available No VIP available VA CYP2D6 *3 N/A N/A N/A
No VIP available No VIP available VA CYP2D6 *4 N/A N/A N/A
No VIP available No VIP available VA CYP2D6 *5 N/A N/A N/A
No VIP available No VIP available VA CYP2D6 *10 N/A N/A N/A
No VIP available No VIP available VA CYP2D6 *41 N/A N/A N/A
No VIP available No VIP available VA DPYD *1 N/A N/A N/A
No VIP available No VIP available VA DPYD *13 N/A N/A N/A
No VIP available No VIP available VA GSTM1 non-null N/A N/A N/A
No VIP available No VIP available VA GSTM1 null N/A N/A N/A
No VIP available No VIP available VA GSTT1 non-null N/A N/A N/A
No VIP available No VIP available VA GSTT1 null N/A N/A N/A
No VIP available No Clinical Annotations available VA
rs10494366 NC_000001.10:g.162085685G>T, NC_000001.11:g.162115895G>T, NG_015979.1:g.51105G>T, NM_001164757.1:c.106-38510G>T, NM_014697.2:c.106-38510G>T, XR_922217.1:n.884-1993C>A, XR_922219.1:n.713-1993C>A, XR_922221.1:n.713-9147C>A, rs59845656
G > T
SNP
No VIP available No Clinical Annotations available VA
rs1076560 NC_000011.10:g.113412966C>A, NC_000011.9:g.113283688C>A, NG_008841.1:g.67314G>T, NM_000795.3:c.811-83G>T, NM_016574.3:c.724-83G>T, XM_005271425.1:c.811-83G>T, XM_005271426.1:c.808-83G>T, rs1800500
C > A
SNP
No VIP available No Clinical Annotations available VA
rs10895256 NC_000011.10:g.102107673T>G, NC_000011.9:g.101978404T>G, NG_029530.1:g.2213T>G, rs57332716
T > G
SNP
No VIP available No Clinical Annotations available VA
rs11155012 NC_000006.11:g.139151784G>A, NC_000006.12:g.138830647G>A, NM_001077706.2:c.180-7705G>A, NM_001195037.2:c.180-7705G>A, XM_006715472.2:c.180-7705G>A, XM_011535795.1:c.180-7705G>A, XM_011535796.1:c.231-7705G>A, XM_011535797.1:c.-28-7705G>A, XR_943064.1:n.208C>T, XR_943065.1:n.213C>T, rs56479252, rs58466605
G > A
SNP
No VIP available No Clinical Annotations available VA
rs1131882 NC_000019.10:g.3595925G>A, NC_000019.9:g.3595923G>A, NG_013363.1:g.15909C>T, NM_001060.5:c.795C>T, NM_201636.2:c.795C>T, NP_001051.1:p.Ile265=, NP_963998.2:p.Ile265=, XM_011528214.1:c.795C>T, XP_011526516.1:p.Ile265=, rs11085026, rs1805043
G > A
SNP
I265I
No VIP available No Clinical Annotations available VA
rs11615 NC_000019.10:g.45420395A>G, NC_000019.9:g.45923653A>G, NG_015839.2:g.63434T>C, NM_001166049.1:c.354T>C, NM_001983.3:c.354T>C, NM_202001.2:c.354T>C, NP_001159521.1:p.Asn118=, NP_001974.1:p.Asn118=, NP_973730.1:p.Asn118=, XM_005258634.1:c.354T>C, XM_005258635.1:c.354T>C, XM_005258635.2:c.354T>C, XM_005258636.1:c.354T>C, XM_005258636.3:c.354T>C, XM_005258637.1:c.354T>C, XM_005258638.1:c.138T>C, XM_011526610.1:c.354T>C, XP_005258691.1:p.Asn118=, XP_005258692.1:p.Asn118=, XP_005258693.1:p.Asn118=, XP_005258694.1:p.Asn118=, XP_005258695.1:p.Asn46=, XP_011524912.1:p.Asn118=, rs1130005, rs17285882, rs17359303, rs17845191, rs17858003, rs17859564, rs2228629, rs3177700, rs3188446, rs3752251, rs59923575
A > G
SNP
N118N
No VIP available No Clinical Annotations available VA
rs1187075 NC_000010.10:g.33246796A>G, NC_000010.11:g.32957868A>G, NG_029012.1:g.5498T>C, NM_002211.3:c.-1+277T>C, NM_133376.2:c.-110T>C, XM_005252448.1:c.-1+277T>C
A > G
SNP
No VIP available No Clinical Annotations available VA
rs151264360 NC_000018.10:g.673444_673449delTTAAAG, NC_000018.9:g.673444_673449delTTAAAG, NG_028255.1:g.20841_20846delTTAAAG, NM_001071.2:c.*447_*452delTTAAAG, NM_001126123.3:c.*145-373_*145-368del, NM_001126123.3:c.*145-373_*145-368delCTTTAA, NM_001318759.1:c.*145-373_*145-368del, NM_001318759.1:c.*145-373_*145-368delCTTTAA, NM_001318760.1:c.*446+410_*446+415delCTTTAA, NM_001318760.1:c.*856_*861del, NM_017512.5:c.*856_*861delCTTTAA, NM_202758.3:c.*856_*861delCTTTAA, XM_005258111.1:c.*856_*861delCTTTAA, XM_005258112.1:c.*856_*861delCTTTAA, XM_005258113.1:c.*856_*861delCTTTAA, XM_005258114.1:c.*856_*861delCTTTAA, XM_005258115.1:c.*856_*861delCTTTAA, XM_005258116.1:c.*856_*861delCTTTAA, XM_005258117.1:c.*856_*861delCTTTAA, XM_005258118.1:c.*856_*861delCTTTAA, XM_005258118.2:c.*856_*861del, XM_005258120.1:c.*856_*861delCTTTAA, XM_005258137.1:c.*447_*452delTTAAAG, XM_005258138.1:c.*447_*452delTTAAAG, XM_011525677.1:c.*856_*861del, XM_011525678.1:c.*856_*861del, XM_011525679.1:c.*856_*861del, XM_011525680.1:c.*856_*861del, XM_011525681.1:c.*856_*861del, XM_011525682.1:c.*856_*861del, XM_011525683.1:c.*856_*861del, XM_011525684.1:c.*856_*861del, XM_011525685.1:c.*856_*861del, XM_011525686.1:c.*856_*861del, XM_011525687.1:c.*856_*861del, XM_011525688.1:c.*856_*861del, XM_011525689.1:c.*856_*861del, XM_011525690.1:c.*856_*861del, XM_011525691.1:c.*856_*861del, XM_011525692.1:c.*856_*861del, XM_011525693.1:c.*856_*861del, XM_011525694.1:c.*856_*861del, XM_011525695.1:c.*856_*861del, XM_011525696.1:c.*856_*861del, XM_011525697.1:c.*856_*861del, XM_011525698.1:c.*856_*861del, XM_011525699.1:c.*856_*861del, XR_243810.1:n.1672-373_1672-368delCTTTAA, XR_243810.3:n.1513-373_1513-368del, XR_243811.1:n.1538-373_1538-368delCTTTAA, XR_243811.2:n.1538-373_1538-368del, XR_243812.1:n.2112_2117delCTTTAA, XR_430041.2:n.1633-373_1633-368del, XR_935066.1:n.2109_2114del, XR_935067.1:n.1967_1972del
TTAAAG > -
indel
No VIP available No Clinical Annotations available VA
rs1695 NC_000011.10:g.67585218A>G, NC_000011.9:g.67352689A>G, NG_012075.1:g.6624A>G, NM_000852.3:c.313A>G, NP_000843.1:p.Ile105Val, XM_005273958.1:c.313A>G, XP_005274015.1:p.Ile105Val, rs1138257, rs11553891, rs17353321, rs17856342, rs2230827, rs4609, rs56971933, rs947894
A > G
SNP
I105V
No VIP available No Clinical Annotations available VA
rs1801020 NC_000005.10:g.177409531A>G, NC_000005.9:g.176836532A>G, NG_007568.1:g.5046T>C, NM_000505.3:c.-4T>C, XM_011534461.1:c.-4T>C, rs17876008, rs3749733, rs386545613
A > G
SNP
No VIP available CA VA
rs1801252 NC_000010.10:g.115804036A>G, NC_000010.11:g.114044277A>G, NG_012187.1:g.5231A>G, NM_000684.2:c.145A>G, NP_000675.1:p.Ser49Gly, rs12720482, rs3740152
A > G
SNP
S49G
No VIP available No Clinical Annotations available VA
rs1801253 NC_000010.10:g.115805056G>C, NC_000010.11:g.114045297G>C, NG_012187.1:g.6251G>C, NM_000684.2:c.1165G>C, NP_000675.1:p.Gly389Arg, rs12718339, rs17091259, rs28365052, rs59130083
G > C
SNP
G389R
No VIP available No Clinical Annotations available VA
rs2071554 NC_000006.11:g.32784676C>T, NC_000006.12:g.32816899C>T, NG_009793.3:g.26872G>A, NG_012008.1:g.5150G>A, NM_002120.3:c.53G>A, NP_002111.1:p.Arg18Gln, NT_113891.2:g.4229206C>T, NT_113891.3:g.4229100C>T, NT_167244.1:g.4071839C>T, NT_167244.2:g.4121923C>T, NT_167245.1:g.4066202C>T, NT_167245.2:g.4060617C>T, NT_167247.1:g.4121577C>T, NT_167247.2:g.4115992C>T, NT_167249.1:g.4215609C>T, NT_167249.2:g.4216311C>T, rs115120730, rs117515083, rs143214015, rs17883529, rs45613631, rs52833026, rs60828729
C > T
SNP
R18Q
No VIP available No Clinical Annotations available VA
rs2207418 NC_000020.10:g.11174903G>A, NC_000020.11:g.11194255G>A, rs13042882, rs17189374, rs56478919, rs59661326
G > A
SNP
No VIP available No Clinical Annotations available VA
rs2230345 NC_000010.10:g.121086097A>T, NC_000010.11:g.119326585A>T, NM_005308.2:c.122A>T, NP_005299.1:p.Gln41Leu, XM_005269707.1:c.122A>T, XM_005269708.1:c.53-54230A>T, XP_005269764.1:p.Gln41Leu, rs17098707, rs45630571, rs52829401
A > T
SNP
Q41L
No VIP available No Clinical Annotations available VA
rs2230395 NC_000010.10:g.33211227T>G, NC_000010.11:g.32922299T>G, NG_029012.1:g.41067A>C, NM_002211.3:c.1086A>C, NM_033668.2:c.1086A>C, NM_133376.2:c.1086A>C, NP_002202.2:p.Ala362=, NP_391988.1:p.Ala362=, NP_596867.1:p.Ala362=, XM_005252448.1:c.1086A>C, XP_005252505.1:p.Ala362=, rs11009147, rs117994969, rs2298140, rs57973085, rs59510058
T > G
SNP
A362A
No VIP available No Clinical Annotations available VA
rs2283265 NC_000011.10:g.113414814C>A, NC_000011.9:g.113285536C>A, NG_008841.1:g.65466G>T, NM_000795.3:c.724-353G>T, NM_016574.3:c.723+607G>T, XM_005271425.1:c.724-353G>T, XM_005271426.1:c.721-353G>T, rs2734840, rs60749713
C > A
SNP
No VIP available No Clinical Annotations available VA
rs2306283 NC_000012.11:g.21329738A>G, NC_000012.12:g.21176804A>G, NG_011745.1:g.50611A>G, NM_006446.4:c.388A>G, NP_006437.3:p.Asn130Asp, rs17389242, rs52832430, rs60767041
A > G
SNP
N130D
No VIP available No Clinical Annotations available VA
rs28399504 NC_000010.10:g.96522463A>G, NC_000010.11:g.94762706A>G, NG_008384.2:g.5001A>G, NM_000769.1:c.1A>G, NM_000769.2:c.1A>G, NP_000760.1:p.Met1Val
A > G
SNP
M1L/V
No VIP available No Clinical Annotations available VA
rs2900420 NC_000012.11:g.10521794G>A, NC_000012.12:g.10369195G>A, NR_120430.1:n.266-4840G>A, XR_242912.1:n.266-4840G>A, rs201778694, rs4463923, rs61266878, rs76442040
G > A
SNP
No VIP available No Clinical Annotations available VA
rs3212986 NC_000019.10:g.45409478C>A, NC_000019.9:g.45912736C>A, NG_015839.2:g.74351G>T, NM_001166049.1:c.*197G>T, NM_001297590.1:c.1516C>A, NM_001983.3:c.*197G>T, NM_012099.1:c.1510C>A, NP_001284519.1:p.Gln506Lys, NP_036231.1:p.Gln504Lys, XM_005258425.1:c.1516C>A, XM_005258638.1:c.*197G>T, XP_005258482.1:p.Gln506Lys, rs386580934, rs60333438
C > A
C > T
SNP
Q506K
No VIP available No Clinical Annotations available VA
rs352046 NC_000004.11:g.74864550G>C, NC_000004.12:g.73998833G>C, NM_002994.4:c.-252C>G, XR_938874.1:n.61G>C, rs353017, rs3854134, rs57250141
G > C
SNP
No VIP available No Clinical Annotations available VA
rs3815583 NC_000016.10:g.55833130A=, NC_000016.10:g.55833130A>C, NC_000016.9:g.55867042A=, NC_000016.9:g.55867042A>C, NG_012057.1:g.5034T=, NG_012057.1:g.5034T>G, NM_001025194.1:c.-75T=, NM_001025194.1:c.-75T>G, NM_001025195.1:c.-75T=, NM_001025195.1:c.-75T>G, NM_001266.4:c.-75T=, NM_001266.4:c.-75T>G, NW_003315945.1:g.57035C=, NW_003315945.1:g.57035C>A, XM_005255774.1:c.-75T=, XM_005255774.1:c.-75T>G, XM_005276867.1:c.-75G=, XM_005276867.1:c.-75G>T, XM_011522816.1:c.-75T=, XM_011522816.1:c.-75T>G, XM_011546995.1:c.-75G=, XM_011546995.1:c.-75G>T, rs11076115, rs118051681
A > C
SNP
No VIP available No Clinical Annotations available VA
rs3836790 NC_000005.10:g.1411740_1411741insCACATACCATGCAACATACACACTCAGACA, NC_000005.9:g.1411855_1411856insCACATACCATGCAACATACACACTCAGACA, NG_015885.1:g.38688_38689insTGTCTGAGTGTGTATGTTGCATGGTATGTG, NM_001044.4:c.1157-386_1157-385insTGTCTGAGTGTGTATGTTGCATGGTATGTG, NT_187547.1:g.102268_102269insTGTCTGAGTGTGTATGTTGCATGGTATGTG
- > CACATACCATGCAACATACACACTCAGACA
indel
No VIP available No Clinical Annotations available VA
rs3918290 NC_000001.10:g.97915614C>T, NC_000001.11:g.97450058C>T, NG_008807.2:g.476002G>A, NM_000110.3:c.1905+1G>A, XM_005270561.1:c.1794+1G>A, XM_005270562.1:c.1689+1G>A, XM_005270562.3:c.1689+1G>A, XM_005270563.1:c.1905+1G>A, XM_006710397.2:c.1905+1G>A, rs199469548, rs386589337
C > G
C > T
SNP
No VIP available No Clinical Annotations available VA
rs4149056 NC_000012.11:g.21331549T>C, NC_000012.12:g.21178615T>C, NG_011745.1:g.52422T>C, NM_006446.4:c.521T>C, NP_006437.3:p.Val174Ala, rs52816141, rs60037639
T > C
SNP
V174A
No VIP available No Clinical Annotations available VA
rs4244285 NC_000010.10:g.96541616G>A, NC_000010.11:g.94781859G>A, NG_008384.2:g.24154G>A, NM_000769.1:c.681G>A, NM_000769.2:c.681G>A, NP_000760.1:p.Pro227=, rs116940633, rs17879456, rs60361278
G > A
SNP
P227P
No VIP available No Clinical Annotations available VA
rs430397 NC_000009.11:g.128001119C>T, NC_000009.12:g.125238840C>T, NG_027761.1:g.7548G>A, NM_005347.4:c.997-13G>A, rs11567635, rs35719250, rs3765559, rs52822178, rs60157411
C > T
SNP
No VIP available No Clinical Annotations available VA
rs4502225 NC_000016.10:g.78390934T>C, NC_000016.9:g.78424831T>C, NG_011698.1:g.296281T>C, NM_001291997.1:c.266+3986T>C, NM_016373.3:c.605+3986T>C, XM_005255980.1:c.409+275780T>C, XM_005255981.1:c.266+3986T>C, XM_005255982.1:c.516+226645T>C, XM_006721195.2:c.605+3986T>C, XM_011523100.1:c.605+3986T>C, XM_011523101.1:c.605+3986T>C, XM_011523102.1:c.605+3986T>C, XM_011523103.1:c.605+3986T>C, XM_011523104.1:c.605+3986T>C, XR_243411.1:n.730+3986T>C, rs60064696
T > C
SNP
No VIP available No Clinical Annotations available VA
rs4986893 NC_000010.10:g.96540410G>A, NC_000010.11:g.94780653G>A, NG_008384.2:g.22948G>A, NM_000769.2:c.636G>A, NP_000760.1:p.Trp212Ter, rs52827375, rs57081121
G > A
SNP
W212*
No VIP available No Clinical Annotations available VA
rs532545 NC_000001.10:g.20915172C>T, NC_000001.11:g.20588679C>T, NM_001785.2:c.-451C>T, rs2072669, rs386598350
C > T
SNP
No VIP available No Clinical Annotations available VA
rs55886062 NC_000001.10:g.97981343A>C, NC_000001.11:g.97515787A>C, NG_008807.2:g.410273T>G, NM_000110.3:c.1679T>G, NP_000101.2:p.Ile560Ser, XM_005270561.1:c.1568T>G, XM_005270562.1:c.1524+33773T>G, XM_005270562.3:c.1524+33773T>G, XM_005270563.1:c.1679T>G, XM_005270564.1:c.1679T>G, XM_006710397.2:c.1679T>G, XP_005270618.1:p.Ile523Ser, XP_005270620.1:p.Ile560Ser, XP_005270621.1:p.Ile560Ser, XP_006710460.1:p.Ile560Ser, rs199469542
A > C
SNP
I560S
No VIP available No Clinical Annotations available VA
rs5985 NC_000006.11:g.6318795C>A, NC_000006.12:g.6318562C>A, NG_008107.1:g.7130G>T, NM_000129.3:c.103G>T, NP_000120.2:p.Val35Leu, XM_006715010.2:c.103G>T, XM_011514342.1:c.265G>T, XP_006715073.1:p.Val35Leu, XP_011512644.1:p.Val89Leu, rs60452761
C > A
SNP
V35L
No VIP available No Clinical Annotations available VA
rs622342 NC_000006.11:g.160572866C>A, NC_000006.12:g.160151834C>A, NM_003057.2:c.1386-2964C>A, NM_153187.1:c.1386-4141C>A, XM_005267102.1:c.1386-2964C>A, XM_005267102.3:c.1386-2964C>A, XM_005267103.1:c.1386-2964C>A, XM_005267104.1:c.810-2964C>A, XM_005267104.3:c.810-2964C>A, XM_005267105.1:c.810-2964C>A, XM_005267105.3:c.810-2964C>A, XM_006715552.1:c.1386-6682C>A, XM_011536074.1:c.810-2964C>A, rs10399251, rs17202844, rs56541921, rs59312327
C > A
SNP
No VIP available No Clinical Annotations available VA
rs6347 NC_000005.10:g.1411297T>C, NC_000005.9:g.1411412T>C, NG_015885.1:g.39132A>G, NM_001044.4:c.1215A>G, NP_001035.1:p.Ser405=, NT_187547.1:g.102712A>G, rs3181571, rs3776509, rs57602838
T > C
SNP
S405S
No VIP available No Clinical Annotations available VA
rs6500843 NC_000016.10:g.6820854A>G, NC_000016.9:g.6870855A>G, NG_011881.1:g.806724A>G, NM_001142333.1:c.-16+166204A>G, NM_001142334.1:c.-16+46841A>G, NM_001308117.1:c.114+166204A>G, NM_018723.3:c.-16+166204A>G, XM_005255378.1:c.462+166204A>G, XM_005255379.1:c.114+166204A>G, XM_005255379.2:c.114+166204A>G, XM_005255380.1:c.93+166204A>G, XM_005255380.2:c.93+166204A>G, XM_005255384.1:c.-16+166204A>G, XM_005255384.2:c.-16+166204A>G, XM_005255385.1:c.-16+166204A>G, XM_005255385.3:c.-16+166204A>G, XM_005255389.1:c.114+166204A>G, XM_005255389.2:c.114+166204A>G, XM_005255390.1:c.-16+166204A>G, XM_005255390.2:c.-16+166204A>G, XM_005255391.1:c.-16+166204A>G, XM_005255391.2:c.-16+166204A>G, XM_005255392.1:c.-16+166204A>G, XM_005255395.1:c.93+166204A>G, XM_011522544.1:c.462+166204A>G, rs60379811
A > G
SNP
No VIP available No Clinical Annotations available VA
rs67376798 NC_000001.10:g.97547947T>A, NC_000001.11:g.97082391T>A, NG_008807.2:g.843669A>T, NM_000110.3:c.2846A>T, NP_000101.2:p.Asp949Val, XM_005270561.1:c.2735A>T, XM_005270562.1:c.2630A>T, XM_005270562.3:c.2630A>T, XP_005270618.1:p.Asp912Val, XP_005270619.1:p.Asp877Val, XP_005270619.2:p.Asp877Val, rs199469564, rs386467430, rs67376799
T > A
SNP
D949V
No VIP available No Clinical Annotations available VA
rs708272 NC_000016.10:g.56962376G>A, NC_000016.9:g.56996288G>A, NG_008952.1:g.5454G>A, NM_000078.2:c.118+279G>A, NM_001286085.1:c.118+279G>A, XM_005255776.1:c.118+279G>A, XM_006721124.2:c.118+279G>A, rs17237904, rs17290342, rs57207652
G > A
SNP
No VIP available No Clinical Annotations available VA
rs716274 NC_000011.10:g.103547430A>G, NC_000011.9:g.103418158A>G, rs56628356, rs57544138
A > G
SNP
No VIP available No Clinical Annotations available VA
rs8175347
(TA)6 > (TA)5
(TA)6 > (TA)7
(TA)6 > (TA)8
microsatellite
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 147

Overview

Alternate Names: 
Synonym
Cardiac Death; Death, Cardiac; Determination of Death; Near-Death Experience
PharmGKB Accession Id: PA443842
External Vocabularies

Curated Information ?

Curated Information ?

Relationships from National Drug File - Reference Terminology (NDF-RT)

Induces
No related diseases are available

Publications related to Death: 68

No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
New single-nucleotide polymorphisms associated with differences in platelet reactivity and their influence on survival in patients with type 2 diabetes treated with acetylsalicylic acid: an observational study. Acta diabetologica. 2017. Milanowski Lukasz, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Determinants of hepatotoxicity after repeated supratherapeutic paracetamol ingestion; systematic review of reported cases. British journal of clinical pharmacology. 2016. Acheampong P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Lethal 5-fluorouracil toxicity in a colorectal patient with severe dihydropyrimidine dehydrogenase (DPD) deficiency. International journal of colorectal disease. 2016. Dhelens Carole, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Prognostic impact of carboxylesterase 1 gene variants in patients with congestive heart failure treated with angiotensin-converting enzyme inhibitors. Pharmacogenetics and genomics. 2016. Nelveg-Kristensen Karl E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Uncommon dihydropyrimidine dehydrogenase mutations and toxicity by fluoropyrimidines: a lethal case with a new variant. Pharmacogenomics. 2016. Del Re Marzia, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genotyping of a family with a novel deleterious DPYD mutation supports the pretherapeutic screening of DPD deficiency with dihydrouracil/uracil ratio. Clinical pharmacology and therapeutics. 2015. Thomas F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genetic and platelet function testing of antiplatelet therapy for percutaneous coronary intervention: the ARCTIC-GENE study. European journal of clinical pharmacology. 2015. Collet Jean-Philippe, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
RNA expression of genes involved in cytarabine metabolism and transport predicts cytarabine response in acute myeloid leukemia. Pharmacogenomics. 2015. Abraham Ajay, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Functional polymorphisms of ITGB1 are associated with clinical outcome of Chinese patients with resected colorectal cancer. Cancer chemotherapy and pharmacology. 2015. Zhou Feng, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CYP2C19 polymorphism and clinical outcomes among patients of different races treated with clopidogrel: A systematic review and meta-analysis. Journal of Huazhong University of Science and Technology. Medical sciences = Hua zhong ke ji da xue xue bao. Yi xue Ying De wen ban = Huazhong keji daxue xuebao. Yixue Yingdewen ban. 2015. Niu Xuan, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Drugs with anticholinergic effects and cognitive impairment, falls and all-cause mortality in older adults: a systematic review and meta-analysis. British journal of clinical pharmacology. 2015. Ruxton Kimberley, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The SNP rs6500843 in 16p13.3 is associated with survival specifically among chemotherapy-treated breast cancer patients. Oncotarget. 2015. Fagerholm Rainer, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SLCO1B1 genetic variants, long-term low-density lipoprotein cholesterol levels and clinical events in patients following cardiac catheterization. Pharmacogenomics. 2015. Li Josephine H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Glutathione S-Transferase Gene Polymorphisms and Treatment Outcome in Cervical Cancer Patients under Concomitant Chemoradiation. PloS one. 2015. Abbas Mohammad, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Inflammation-related genetic variations and survival in patients with advanced non-small cell lung cancer receiving first-line chemotherapy. Clinical pharmacology and therapeutics. 2014. Pu X, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cost-effectiveness analysis of HLA-B5801 genotyping in the treatment of gout patients with chronic renal insufficiency in Korea. Arthritis care & research. 2014. Park Dong-Jin, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Factor XIII Val34Leu polymorphism and recurrent myocardial infarction in patients with coronary artery disease. Journal of thrombosis and thrombolysis. 2014. Kreutz Rolf P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CYP2D6 and adjuvant tamoxifen: possible differences of outcome in pre- and post-menopausal patients. Pharmacogenomics. 2013. Margolin Sara, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Dopamine transporter DAT and receptor DRD2 variants affect risk of lethal cocaine abuse: a gene-gene-environment interaction. Translational psychiatry. 2013. Sullivan D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
A predictive clinical-genetic model of tissue plasminogen activator response in acute ischemic stroke. Annals of neurology. 2012. del Río-Espínola Alberto, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CYP2C19 genetics in fatal carisoprodol intoxications. European journal of clinical pharmacology. 2012. Høiseth Gudrun, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
An intronic polymorphism in GRP78 improves chemotherapeutic prediction in non-small cell lung cancer. Chest. 2012. Zhu Xiao, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
More codeine fatalities after tonsillectomy in North American children. Pediatrics. 2012. Kelly Lauren E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Association between polymorphisms of ERCC1 and survival in epithelial ovarian cancer patients with chemotherapy. Pharmacogenomics. 2012. Yan Li, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A Common beta1-Adrenergic Receptor Polymorphism Predicts Favorable Response to Rate-Control Therapy in Atrial Fibrillation. Journal of the American College of Cardiology. 2012. Parvez Babar, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cholesteryl Ester Transfer Protein (CETP) polymorphisms affect mRNA splicing, HDL levels, and sex-dependent cardiovascular risk. PloS one. 2012. Papp Audrey C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
A bilateral cicatricial ectropion and bilateral upper lid shortening caused by 5-fluorouracil toxicity in a patient with dihydropyrimidine dehydrogenase deficiency. Cutaneous and ocular toxicology. 2011. Obi Ebube E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Carrying one or two reduced-function CYP2C19 alleles is associated with an increased risk of major adverse cardiovascular events in people undergoing percutaneous coronary intervention and treated with clopidogrel. Evidence-based medicine. 2011. Ramirez Andrea H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetics informatics trial (GIFT) of warfarin to prevent deep vein thrombosis (DVT): rationale and study design. The pharmacogenomics journal. 2011. Do E J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Contribution of deletion in angiotensin-converting enzyme but not A1166C angiotensin II type-1 receptor gene polymorphisms to clinical outcomes in atherothrombotic disease. Archives of medical research. 2011. Le Hello Claire, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Copy number variants in pharmacogenetic genes. Trends in molecular medicine. 2011. He Yijing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Hypertrophy-associated polymorphisms ascertained in a founder cohort applied to heart failure risk and mortality. Clinical and translational science. 2011. Parsa Afshin, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
OCT1 polymorphism is associated with response and survival time in anti-Parkinsonian drug users. Neurogenetics. 2011. Becker Matthijs L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genome-wide interrogation identifies YAP1 variants associated with survival of small-cell lung cancer patients. Cancer research. 2010. Wu Chen, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Polymorphisms in genes coding for GRK2 and GRK5 and response differences in antihypertensive-treated patients. Pharmacogenetics and genomics. 2010. Lobmeyer Maximilian T, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Cardiovascular risk in clopidogrel-treated patients according to cytochrome P450 2C19*2 loss-of-function allele or proton pump inhibitor coadministration: a systematic meta-analysis. Journal of the American College of Cardiology. 2010. Hulot Jean-Sébastien, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Investigation of IVS14 + 1G > A polymorphism of DPYD gene in a group of Bosnian patients treated with 5-Fluorouracil and capecitabine. Bosnian journal of basic medical sciences / Udru¿enje basi¿nih mediciniskih znanosti = Association of Basic Medical Sciences. 2010. Ceri¿ Timur, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Common genetic variation of beta1- and beta2-adrenergic receptor and response to four classes of antihypertensive treatment. Pharmacogenetics and genomics. 2010. Suonsyrjä Timo, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Haplotypes of the adrenergic system predict the blood pressure response to beta-blockers in women with essential hypertension. Pharmacogenomics. 2010. Filigheddu Fabiana, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Selective serotonin reuptake inhibitors and breast cancer mortality in women receiving tamoxifen: a population based cohort study. BMJ (Clinical research ed.). 2010. Kelly Catherine M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The CYP2D6*4 polymorphism affects breast cancer survival in tamoxifen users. Breast cancer research and treatment. 2009. Bijl Monique J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SNP analyses in cytarabine metabolizing enzymes in AML patients and their impact on treatment response and patient survival: identification of CDA SNP C-451T as an independent prognostic parameter for survival. Leukemia : official journal of the Leukemia Society of America, Leukemia Research Fund, U.K. 2009. Mahlknecht U, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CACNA1C gene polymorphisms, cardiovascular disease outcomes, and treatment response. Circulation. Cardiovascular genetics. 2009. Beitelshees Amber L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Codeine, ultrarapid-metabolism genotype, and postoperative death. The New England journal of medicine. 2009. Ciszkowski Catherine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Predictors of survival and toxicity in patients on adjuvant therapy with 5-fluorouracil for colorectal cancer. British journal of cancer. 2009. Gusella M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Cytochrome p-450 polymorphisms and response to clopidogrel. The New England journal of medicine. 2009. Mega Jessica L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic determinants of response to clopidogrel and cardiovascular events. The New England journal of medicine. 2009. Simon Tabassome, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
A common NOS1AP genetic polymorphism is associated with increased cardiovascular mortality in users of dihydropyridine calcium channel blockers. British journal of clinical pharmacology. 2009. Becker Matthijs L, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
beta-adrenergic receptor gene polymorphisms and beta-blocker treatment outcomes in hypertension. Clinical pharmacology and therapeutics. 2008. Pacanowski M A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CETP genotype predicts increased mortality in statin-treated men with proven cardiovascular disease: an adverse pharmacogenetic interaction. European heart journal. 2008. Regieli Jakub J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Beta-1-adrenoceptor genetic variants and ethnicity independently affect response to beta-blockade. Pharmacogenetics and genomics. 2008. Kurnik Daniel, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
UGT1A1*28 polymorphism predicts irinotecan-induced severe toxicities without affecting treatment outcome and survival in patients with metastatic colorectal carcinoma. Cancer. 2008. Liu Chun-Yu, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic association of the NPPA T2238C genetic variant with cardiovascular disease outcomes in patients with hypertension. JAMA : the journal of the American Medical Association. 2008. Lynch Amy I, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
A GRK5 polymorphism that inhibits beta-adrenergic receptor signaling is protective in heart failure. Nature medicine. 2008. Liggett Stephen B, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Epithelial neutrophil-activating peptide (ENA-78), acute coronary syndrome prognosis, and modulatory effect of statins. PloS one. 2008. Zineh Issam, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
DPYD*2A mutation: the most common mutation associated with DPD deficiency. Cancer chemotherapy and pharmacology. 2007. Saif M W, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Effects of torcetrapib in patients at high risk for coronary events. The New England journal of medicine. 2007. Barter Philip J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Oral anticoagulant and antiplatelet therapy and peripheral arterial disease. The New England journal of medicine. 2007. Warfarin Antiplatelet Vascular Evaluation Trial Investigators, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Rosuvastatin in older patients with systolic heart failure. The New England journal of medicine. 2007. Kjekshus John, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
LRP6 mutation in a family with early coronary disease and metabolic risk factors. Science (New York, N.Y.). 2007. Mani Arya, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacogenetics of capecitabine in advanced breast cancer patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2006. Largillier Rémy, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
beta1-Adrenergic receptor polymorphisms influence the response to metoprolol monotherapy in patients with essential hypertension. Clinical pharmacology and therapeutics. 2006. Liu Jie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Association between platelet P2Y12 haplotype and risk of cardiovascular events in chronic coronary disease. Thrombosis research. 2006. Schettert Isolmar T, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
beta-Adrenergic receptor polymorphisms and responses during titration of metoprolol controlled release/extended release in heart failure. Clinical pharmacology and therapeutics. 2005. Terra Steven G, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association between beta-1 and beta-2 adrenergic receptor gene polymorphisms and the response to beta-blockade in patients with stable congestive heart failure. Pharmacogenetics and genomics. 2005. de Groote Pascal, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Beta 1-adrenergic receptor polymorphisms and antihypertensive response to metoprolol. Clinical pharmacology and therapeutics. 2003. Johnson Julie A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Prevalence of a common point mutation in the dihydropyrimidine dehydrogenase (DPD) gene within the 5'-splice donor site of intron 14 in patients with severe 5-fluorouracil (5-FU)- related toxicity compared with controls. Clinical cancer research : an official journal of the American Association for Cancer Research. 2001. Raida M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Metoclopramide-induced methemoglobinemia in a patient with co-existing deficiency of glucose-6-phosphate dehydrogenase and NADH-cytochrome b5 reductase: failure of methylene blue treatment. Haematologica. 2001. Karadsheh N S, et al. PubMed