Disease:
Carcinoma, Non-Small-Cell Lung

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Gene ? Variant?
(146)
Alternate Names ? Chemicals ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
Translation
No VIP available No VIP available VA ABCB1 *2 (PMID: 11503014) N/A N/A N/A
No VIP available No VIP available No VIP available CYP2A6 *4C N/A N/A N/A
No VIP available CA VA CYP2D6 *1 N/A N/A N/A
No VIP available CA VA CYP2D6 *2 N/A N/A N/A
No VIP available CA No VIP available CYP2D6 *3 N/A N/A N/A
No VIP available CA No VIP available CYP2D6 *4 N/A N/A N/A
No VIP available CA No VIP available CYP2D6 *4xN N/A N/A N/A
No VIP available CA VA CYP2D6 *5 N/A N/A N/A
No VIP available CA No VIP available CYP2D6 *6 N/A N/A N/A
No VIP available CA VA CYP2D6 *10 N/A N/A N/A
No VIP available CA VA CYP2D6 *14 N/A N/A N/A
No VIP available No VIP available VA CYP2D6 *14A N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *36 N/A N/A N/A
No VIP available CA No VIP available CYP2D6 *41 N/A N/A N/A
No VIP available No VIP available VA CYP3A4 *1 N/A N/A N/A
No VIP available No VIP available VA CYP3A4 *1G N/A N/A N/A
No VIP available No VIP available VA CYP3A5 *1A N/A N/A N/A
No VIP available No VIP available VA CYP3A5 *3A N/A N/A N/A
No VIP available No Clinical Annotations available VA
rs1042858 2232G>A, 4099466G>A, 4159466G>A, 48543G>A, Ala744=, RRM1:2464G>A, rs1042858
G > A
Synonymous
Ala744Ala
No VIP available No Clinical Annotations available VA
rs1044457 *360C>T, 1119C>T, 17814695C>T, 47842777C>T
C > T
Not Available
No VIP available CA VA
rs1045642 208920T>A, 208920T>C, 25171488A>G, 25171488A>T, 3435T>A, 3435T>C, 87138645A>G, 87138645A>T, ABCB1*6, ABCB1: 3435C>T, ABCB1: C3435T, ABCB1: c.3435C>T, ABCB1:3435C>T, Ile1145=, Ile1145Ile, MDR1 3435C>T, MDR1 C3435T, PGP C3435T, c.3435C>T, mRNA 3853C>T
A > T
A > G
Synonymous
Ile1145Ile
No VIP available No Clinical Annotations available VA
rs1047768 103504517T>C, 11344T>C, 138T>C, 1500T>C, 16594193T>C, His46=, His500=
T > C
Synonymous
His46His
No VIP available No Clinical Annotations available VA
rs1048977 20618562C>T, 20945055C>T, 435C>T, CDA:435C>T, T145T, Thr145=, mRNA 614C>T
C > T
Synonymous
Thr145Thr
No VIP available CA VA
rs10510050 120626562A>G, 71431026A>G
A > G
Not Available
No VIP available CA VA
rs1051298 *64C>T, *746C>T, 114721G>A, 2522C>T, 32560C>T, 3929267G>A, 46934826G>A
G > A
3' UTR
No VIP available CA VA
rs1052555 18123742G>A, 2133C>T, 23322C>T, 45855524G>A, Asp711=
C > G
C > A
Synonymous
Asp711Asp
No VIP available No Clinical Annotations available VA
rs1060896 16344824C>A, 225A>C, 225C>A, 45554267C>A, R75S, SLC28A2:283A>C, Ser75Arg, mRNA 284A>C
C > A
Missense
Ser75Arg
No VIP available CA VA
rs1065634 *1022A>G, -507A>G, 115259768T>C, 4748A>G, 85231686T>C
T > C
5' Flanking
No VIP available No Clinical Annotations available VA
rs10787899 120798655G>A, 3527-704C>T, 71603119G>A
G > A
Intronic
No VIP available No Clinical Annotations available VA
rs10799754 22746686T>C, 9426774T>C
T > C
Not Available
No VIP available No Clinical Annotations available VA
rs10868138 16081833T>C, 338A>G, 660A>G, 86917301T>C, Tyr113Cys
T > C
Not Available
Tyr113Cys
No VIP available CA VA
rs10878232 27665953T>G, 65522647T>G
T > G
Not Available
No VIP available No Clinical Annotations available VA
rs10886342 120690832G>A, 71495296G>A
G > A
Not Available
No VIP available CA VA
rs10981694 -36+2451T>G, 115986409T>G, 45150941T>G
T > G
Intronic
No VIP available No Clinical Annotations available VA
rs11030918 -756T>C, 243555T>C, 4055487T>C, 4115487T>C, 4564T>C
T > C
5' Flanking
No VIP available No Clinical Annotations available VA
rs11128347 7349291G>C, 73619561G>C, 918+31944C>G
G > C
Not Available
No VIP available No Clinical Annotations available VA
rs11198804 120909785C>T, 71714249C>T
C > T
Not Available
No VIP available No Clinical Annotations available VA
rs11211524 172-5414A>C, 172-928A>C, 17805131A>C, 321-928A>C, 47833213A>C
A > C
Intronic
No VIP available CA VA
rs1127687 *810G>A, *926G>A, 115490109G>A, 66294573G>A
G > A
3' UTR
No VIP available No Clinical Annotations available VA
rs1128503 1236T>C, 167964T>C, 87179601A>G, 87550285A>G, ABCB1 1236C>T, ABCB1*8, ABCB1: c.1236T>C, ABCB1:1236C>T, ABCB1:1236T>C, Gly412=, Gly412Gly, mRNA 1654T>C, p.Gly412Gly
A > G
Synonymous
Gly412Gly
No VIP available No Clinical Annotations available VA
rs1138272 12659374C>T, 341C>T, 67353579C>T, 7514C>T, A114V, Ala114Val, GSTP1: A114V, GSTP1: C341T
C > T
Missense
Ala114Val
No VIP available CA VA
rs11545078 15803165G>A, 17847C>T, 452C>T, 63938764G>A, GGH: 452C>T, GGH: c.452C>T, Thr151Ile, p.Thr127Ile, p.Thr151Ile
G > A
Missense
Thr151Ile
No VIP available CA No Variant Annotations available
rs11568315 55020563_55020564CA[9][14][15][16][17][18][19][20][21][22][23], 55088256_55088257CA[9][14][15][16][17][18][19][20][21][22][23], 6532_6533CA[9][14][15][16][17][18][19][20][21][22][23], 88+1198_88+1199CA[9][14][15][16][17][18][19][20][21][22][23]
CA > 19
CA > 15
CA > 16
CA > 17
CA > 18
CA > 22
CA > 23
CA > 14
CA > (CA)9
CA > 20
CA > 21
Intronic
No VIP available CA VA
rs11615 18191871A>G, 354T>C, 45923653A>G, 63434T>C, Asn118=, ERCC1:19007T>C, ERCC1:Asn118Asn
A > G
Synonymous
Asn118Asn
No VIP available CA VA
rs11710163 -27+9024T>C, 12636288A>G, 12696288A>G, 14391T>C
A > G
Intronic
No VIP available CA VA
rs11854484 16336035C>T, 45545478C>T, 65C>T, Pro22Leu
C > T
Missense
Pro22Leu
No VIP available CA VA
rs11868547 28797755G>C, 39138C>G, 63523603G>C
G > C
Not Available
No VIP available No Clinical Annotations available VA
rs11979430 103+36739G>A, 18542099C>T, 80509256C>T
C > T
Intronic
No VIP available No Clinical Annotations available VA
rs12090346 17813475C>T, 47841557C>T, 498+592C>T, 645+592C>T, 717+592C>T
C > T
Intronic
No VIP available No Clinical Annotations available VA
rs1209950 25835399C>T, 40173528C>T
C > T
Not Available
No VIP available CA VA
rs12118636 23048077G>A, 53076159G>A
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs12139042 *396C>T, 11167146G>A, 7171878G>A
G > A
3' UTR
No VIP available CA VA
rs121434568 177791T>G, 2573T>G, 55181822T>G, 55191822T>G, Leu858Arg
T > G
Not Available
Leu858Arg
No VIP available CA VA
rs121434569 1193G>A, 167347C>T, 2369C>T, 55171378C>T, 55181378C>T, Thr790Met
C > T
Not Available
Thr790Met
No VIP available No Clinical Annotations available VA
rs12145722 22742985C>T, 9423073C>T
C > T
Not Available
No VIP available CA VA
rs12415607 -1310C>A, -1534C>A, -1542C>A, -1608C>A, -905C>A, 115438204C>A, 66242668C>A
C > A
5' Flanking
No VIP available CA VA
rs12721627 20716C>G, 37398936G>C, 554C>G, 99366093G>C, CYP3A4*16, CYP3A4*16A, CYP3A4:185 Thr>Ser, CYP3A4:554C>G, CYP3A4:658 C>G, CYP3A4:T185S, CYP3A4:Thr185Ser, Thr185Ser
G > C
Missense
Thr185Ser
No VIP available No Clinical Annotations available VA
rs12806698 -269C>A, 244042C>A, 4055974C>A, 4115974C>A, 5051C>A
C > A
5' UTR
No VIP available CA VA
rs12819505 *1247A>G, 1696665A>G, 1756665A>G
A > G
3' Flanking
No VIP available No Clinical Annotations available VA
rs12995526 216197971T>C, 26293T>C, 66407389T>C, 815-102T>C
T > C
Intronic
No VIP available CA VA
rs13181 *304T>G, 18123137T>G, 2251A>C, 23927A>C, 45854919T>G, ERCC2 Lys751Gln, ERCC2:2251A>C, ERCC2:Lys751Gln, Lys751Gln, rs13181:T>G
T > G
Missense
Lys751Gln
No VIP available CA VA
rs1382368 316-40514C>T, 33045434C>T, 82451075C>T
C > T
Intronic
No VIP available CA VA
rs1409314 120615752A>G, 71420216A>G
A > G
Not Available
No VIP available CA VA
rs1517114 21253618C>G, 69389217C>G, 736+8162C>G
C > G
Intronic
No VIP available CA VA
rs1650697 -473T>A, -473T>C, -473T>G, 235A>C, 235A>G, 235A>T, 30545140A>C, 30545140A>G, 30545140A>T, 5020T>A, 5020T>C, 5020T>G, 5488A>C, 5488A>G, 5488A>T, 79950781A>C, 79950781A>G, 79950781A>T, Ile79Leu, Ile79Val
A > G
5' UTR
Ile79Val
No VIP available No Clinical Annotations available VA
rs1656402 233426526C>T, 271-2431C>T, 83635944C>T
C > T
Intronic
No VIP available No Clinical Annotations available VA
rs1661167 17320286G>A, 45052068G>A, 498+149C>T
G > A
Intronic
No VIP available CA VA
rs16886403 33347T>C, 483-13181T>C, 56139246T>C, 6733605T>C
T > C
Intronic
No VIP available No Clinical Annotations available VA
rs16930092 15804765T>C, 16247A>G, 276-540A>G, 63940364T>C
T > C
Intronic
No VIP available CA VA
rs1695 12658484A>G, 313A>G, 6624A>G, 67352689A>G, GSTP1*2, GSTP1*B, GSTP1: I105V, GSTP1:A313G, GSTP1:I105V, GSTP1:Ile105Val, Ile105Val, Part of haplotypes GSTP1*B and GSTP1*C, rs1695:A>G
A > G
Missense
Ile105Val
No VIP available No Clinical Annotations available VA
rs17215836 403839_403840insTGT, 419_420insTGT, 85438312_85438313insTGT, Leu140delinsLeuVal
- > TGT
- > TTG
Not Available
No VIP available No Clinical Annotations available VA
rs17216177 -34T>C, 101603522T>C, 3742-34T>C, 52407986T>C, 66060T>C
T > C
Intronic
No VIP available CA VA
rs17309872 *771A>T, *843T>A, 32814T>A, 33515788A>T, 3711880A>T, 58044A>T
A > T
3' Flanking
No VIP available No Clinical Annotations available VA
rs17661089 56105996A>G, 6700355A>G, 97A>G
A > G
Not Available
No VIP available CA VA
rs1799782 16325792G>A, 44057574G>A, 580C>T, Arg194Trp
G > A
Missense
Arg194Trp
No VIP available CA VA
rs1799793 11587G>A, 18135477C>T, 45867259C>T, 862G>A, 934G>A, Asp288Asn, Asp312Asn, XPD Asp312Asn, XPD:Asp312Asn
C > T
Missense
Asp288Asn
No VIP available CA VA
rs1799801 13981958T>C, 14041958T>C, 2505T>C, 32945T>C, Ser835=
T > C
Synonymous
Ser835Ser
No VIP available CA VA
rs1800566 20389C>T, 23359344G>A, 445C>T, 457C>T, 559C>T, 69745145G>A, NQO1*2, NQO1:C609T, NQO1:P187S, NQO1:c.558C>T, Pro149Ser, Pro153Ser, Pro187Ser, rs1800566 C>T
G > A
Missense
Pro149Ser
No VIP available CA VA
rs1800975 -4A>G, 100459578T>C, 114A>G, 29624110T>C, 5114A>G
T > C
Not Available
No VIP available No Clinical Annotations available VA
rs1801131 1040A>C, 11208431T>G, 11794419T>G, 1286A>C, 1409A>C, 16685A>C, A1298C, Glu347Ala, Glu429Ala, Glu470Ala, MTHFR:1298A>C
T > G
Not Available
Glu347Ala
No VIP available CA VA
rs1801133 11210333G>A, 11796321G>A, 14783C>T, 419C>T, 665C>T, 677C>T, 788C>T, A222V, Ala140Val, Ala222Val, Ala263Val, C677T, MTHFR: c.677C>T, MTHFR:667C>T, p.A222V
G > A
Not Available
Ala140Val
No VIP available No Clinical Annotations available VA
rs1805087 237048500A>G, 2756A>G, 30566279A>G, 94920A>G, Asp919Gly, MS 2756A>G, MS D919G, MTR:2756A>G, MTR:Asp919Gly
A > G
Missense
Asp919Gly
No VIP available No Clinical Annotations available VA
rs183484 30209C>A, 4081132C>A, 4141132C>A, 850C>A, Arg284=
C > A
Synonymous
Arg284Arg
No VIP available No Clinical Annotations available VA
rs1885301 -1358A>G, -1360A>G, -1549A>G, -1549G>A, 101541053A>G, 3591A>G, 99781296A>G
A > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs2032582 186947T>A, 186947T>G, 2677A, 2677G, 2677T, 2677T>A, 2677T>G, 3095G>T/A, 87160618A>C, 87160618A>T, 87531302A>C, 87531302A>T, 893 Ala, 893 Ser, 893 Thr, ABCB1*7, ABCB1: 2677G>T/A, ABCB1: 2677T/A>G, ABCB1: A893S, ABCB1: G2677T/A, ABCB1: c.2677G>T/A, ABCB1:2677G>A/T, ABCB1:2677G>T/A, ABCB1:A893T, Ala893Ser/Thr, MDR1, MDR1 G2677T/A, Ser893Ala, Ser893Thr, mRNA 3095G>T/A, p.Ala893Ser/Thr
A > T
A > C
Missense
Ser893Ala
Ser893Thr
No VIP available CA VA
rs2072671 20589208A>C, 20915701A>C, 79A>C, CDA: c.79A>C, CDA:79A>C, K27Q, Lys27Gln, p.Lys27Gln
A > C
Missense
Lys27Gln
No VIP available CA VA
rs2227310 1020C>G, 115489152C>G, 66293616C>G, 690C>G, 731C>G, 765C>G, 864C>G, Asp230Glu, Asp255Glu, Asp288Glu, Asp340Glu, Thr244Ser
C > G
Missense
Asp230Glu
Asp230Ser
No VIP available CA No Variant Annotations available
rs2227983 147531G>A, 147531G>C, 147531G>T, 1562G>A, 1562G>C, 1562G>T, 4818624G>A, 4818624G>C, 4818624G>T, 55229255G>A, 55229255G>C, 55229255G>T, Arg521Lys, Arg521Met, Arg521Thr, EGFR: 497G/A, EGFR:1562G>A, EGFR:R497K, R497K, R521K
G > A
G > T
G > C
Missense
Arg521Thr
Arg521Lys
Arg521Met
No VIP available CA VA
rs2231137 13608835C>T, 23898G>A, 34G>A, 89061114C>T, ABCG2:V12M, Val12Met
C > T
Missense
Val12Met
No VIP available No Clinical Annotations available VA
rs2231142 13600044G>T, 32689C>A, 421C>A, 89052323G>T, ABCG2: Q141K, ABCG2:421C>A, ABCG2:Q141K, ABCG2:c.421C>A, Gln141Lys, rs2231142
G > T
Missense
Gln141Lys
No VIP available No Clinical Annotations available VA
rs2234767 -1032G>A, -1378G>A, -24+1440C>T, 3969G>A, 41553720G>A, 6892C>T, 90749256G>A
G > A
5' Flanking
No VIP available CA VA
rs2234922 19544185A>G, 226026406A>G, 33610A>G, 416A>G, EPHX1: H139R, His139Arg, NM_000120.2: c.416A>G, NT_004559.13: g.2228559A>G, mRNA 457A>G, mRNA 691A>G, p.His139Arg
A > G
Missense
His139Arg
No VIP available CA VA
rs2242046 1561G>A, 444256G>A, 85478729G>A, Asp521Asn, N521D, SLC28A1:1576T>C
G > A
Missense
Asp521Asn
No VIP available No Clinical Annotations available VA
rs2242047 1528C>T, 444223C>T, 85478696C>T, Arg510Cys, R510C, SLC28A1:1543G>A
C > T
Missense
Arg510Cys
No VIP available No Clinical Annotations available VA
rs2242048 1368G>G, 443937A>G, 85478410A>G, Gln456=, SLC28A1:1383C>T
A > G
Not Available
No VIP available CA VA
rs2269577 -245C>G, 29196757G>C, 4804C>G, 8587326G>C
G > C
5' Flanking
No VIP available No Clinical Annotations available VA
rs2273697 101563815G>A, 1249G>A, 1438G>A, 1440G>A, 26353G>A, 553G>A, 99804058G>A, ABCC2: c.1249G>A, ABCC2:1249G>A, ABCC2:V417I, ABCC2:c.1249G>A, Val185Ile, Val417Ile, p.V417I
G > A
Not Available
Val417Ile
No VIP available No Clinical Annotations available VA
rs2275112 120917616G>A, 71722080G>A
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs2284449 20-2374T>C, 4060849T>C, 4120849T>C, 9926T>C
T > C
Intronic
No VIP available No Clinical Annotations available VA
rs2290272 412958G>A, 565G>A, 85447431G>A, SLC28A1: V189I, Val189Ile
G > A
Missense
Val189Ile
No VIP available CA No Variant Annotations available
rs2293347 187192C>T, 2982C>T, 4858285C>T, 55268916C>T, Asp994=
C > T
Synonymous
Asp994Asp
No VIP available No Clinical Annotations available VA
rs2306283 14089862A>G, 21329738A>G, 388A>G, 50611A>G, Asn130Asp, SLCO1B1*1B
A > G
Missense
Asn130Asp
No VIP available No Clinical Annotations available VA
rs232043 28202G>A, 4079125G>A, 4139125G>A, 651-425G>A
G > A
Intronic
No VIP available No Clinical Annotations available VA
rs238406 10537A>C, 18136527T>G, 396A>C, 45868309T>G, 468A>C, Arg132=, Arg156=
A > T
A > G
Synonymous
Arg132Arg
No VIP available No Clinical Annotations available VA
rs2494750 -1172C>G, -1256C>G, 105262912G>C, 4169C>G, 86262912G>C
G > C
5' Flanking
No VIP available CA VA
rs2494752 -1868T>C, -1952T>C, 105263608A>G, 3473T>C, 86263608A>G
A > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs2498786 -628G>C, -712G>C, 105262368C>G, 4713G>C, 86262368C>G
C > G
5' Flanking
No VIP available CA VA
rs25487 1196A>G, 16323944T>C, 44055726T>C, Gln399Arg, XRCC1 Arg399Gln, XRCC1:Arg399Gln
T > C
Missense
Gln399Arg
No VIP available No Clinical Annotations available VA
rs2622604 -19-17758A>G, -20+614A>G, 13626645T>C, 6088A>G, 89078924T>C, ABCG2 SNP in intron 1, rs2622604 C>T
T > C
Intronic
No VIP available No Clinical Annotations available VA
rs2699887 -77+17C>T, 178866408C>T, 5098C>T, 85361554C>T
C > T
Intronic
No VIP available No Clinical Annotations available VA
rs2745761 169648G>C, 178-74086G>C, 8217943G>C, 8277943G>C
G > C
Intronic
No VIP available No Clinical Annotations available VA
rs2762939 14266C>G, 22977343G>C, 52781251G>C, 733-149C>G
G > C
Intronic
No VIP available CA VA
rs3212986 *197G>T, 1510C>A, 18180954C>A, 45912736C>A, 74351G>T, ERCC1 C8092A, ERCC1:8090C>A, ERCC1:8092C>A, Gln504Lys
C > A
3' UTR
Gln504Lys
No VIP available CA VA
rs3213239 -1450_-1449insGGCC, -18_-17insGGCC, -213_-212insGGCC, 3671_3672insGGCC, 43576907_43576908insGGCC, 44081059_44081060insGGCC
- > CCGG
5' Flanking
No VIP available No Clinical Annotations available VA
rs34716810 -1586C>T, -1642C>T, -1735C>T, 13060807G>A, 3677C>T, 40792589G>A
G > A
5' Flanking
No VIP available No Clinical Annotations available VA
rs34743033 28-bp tandem repeats, CCGCGCCACTTGGCCTGCCTCCGTCCCG, TSER*2, TSER*3, TYMS: 28 bp tandem repeat, TYMS: 2R, TYMS: TSER *2/*3, TYMS:TSER 28-basepair 5'UTR enhancer region repeat
CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC > CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC
CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC > CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC
CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC > CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC
Not Available
No VIP available CA VA
rs3738948 128018063A>G, 17766726A>G, 2064+741T>C, 38690T>C
A > G
Intronic
No VIP available CA VA
rs3740066 101604207C>T, 3972C>T, 52408671C>T, 66745C>T, ABCC2:3972C>T, I1324I, Ile1324=
C > T
Synonymous
Ile1324Ile
No VIP available No Clinical Annotations available VA
rs3740556 -7C>T, 120840195G>A, 71644659G>A
G > A
5' UTR
No VIP available No Clinical Annotations available VA
rs3775289 12073341T>C, 71862674T>C, 8410T>C, 92-1110T>C, DCK:IVS1-1110T>C
T > C
Intronic
No VIP available CA No Variant Annotations available
rs3780126 109+1307C>T, 1307C>T, 15814313G>A, 63949912G>A, 6699C>T, GGH: IVS1, c.109+1307G>C
G > A
Intronic
No VIP available No Clinical Annotations available VA
rs3787554 12837C>T, 22978772G>A, 52782680G>A, 641-308C>T
G > A
Intronic
No VIP available CA VA
rs3788189 1174-529A>C, 1294-1517A>C, 1294-529A>C, 30803A>C, 3931024T>G, 46936583T>G
T > G
Intronic
No VIP available No Clinical Annotations available VA
rs3817657 31669T>C, 4082592T>C, 4142592T>C, 877-242T>C
T > C
Intronic
No VIP available CA VA
rs3832043 -127delT, -41delT, 10, 233671808delT, 234580454delT, 855+34431delT, 855+53246delT, 87065delT, 9/, T, UGT1A9*22, UGT1A9:
T > -
5' Flanking
No VIP available No Clinical Annotations available VA
rs4124874 -1668A>C, 172270T>G, 234665659T>G, 61-10021T>G, 611918T>G, 856-10021T>G, 862-10021T>G, 868-10021T>G, UGT1A1*60, UGT1A1:-3263T>G, UGT1A1:-3279T>G
T > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs4148323 175755G>A, 211G>A, 234669144G>A, 61-6536G>A, 615403G>A, 856-6536G>A, 862-6536G>A, 868-6536G>A, Gly71Arg, UGT1A1*6, UGT1A1: G71R, UGT1A1:211G>A, UGT1A1:G211A, UGT1A1:Gly71Arg
G > A
Intronic
Gly71Arg
No VIP available CA VA
rs4149015 -910G>A, 14043446G>A, 21283322G>A, 4195G>A, SLCO1B1:11187G>A, SLCO1B1:G-11187A
G > A
5' Flanking
No VIP available CA VA
rs4149056 14091673T>C, 21331549T>C, 521T>C, 52422T>C, SLCO1B1*5, Val174Ala
T > C
Missense
Val174Ala
No VIP available No Clinical Annotations available VA
rs4149117 13771604T>G, 21011480T>G, 334T>G, 52843T>G, SCLO1B3: exon 4 c.334T>G, Ser112Ala, mRNA 460T>G, p.Ser112Ala
T > G
Missense
Ser112Ala
No VIP available CA VA
rs430397 128001119C>T, 57165651C>T, 7548G>A, 997-13G>A
C > T
Intronic
No VIP available CA VA
rs4353229 *290T>C, *406T>C, 115489589T>C, 66294053T>C
T > C
3' UTR
No VIP available CA VA
rs4413407 *118T>C, 105393361A>G, 29941082A>G
A > G
3' UTR
No VIP available CA VA
rs442767 -1188C>A, 237+713G>T, 30545855G>T, 4305C>A, 6203G>T, 79951496G>T
G > T
5' Flanking
No VIP available No Clinical Annotations available VA
rs4492666 171+1057A>C, 17772763A>C, 320+1057A>C, 47800845A>C
A > C
Intronic
No VIP available CA VA
rs451774 *606A>G, *851A>G, 24754A>G, 28442550A>G, 28502550A>G
A > G
3' UTR
No VIP available CA VA
rs4541111 1060-77G>T, 28203G>T, 28808690C>A, 63534538C>A
C > A
Intronic
No VIP available No Clinical Annotations available VA
rs45445694 *34+169_*34+196CGGGACGGAGGCAGGCCAAGTGGCGCGG[2][3][4][7][8][9], -97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], 2, 28-bp tandem repeats located in the TS enhancer region of 5'UTR, 5043_5070CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], 657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], TYMS:*2
CCGCGCCACTTGGCCTGCCTCCGTCCCG > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2
CCGCGCCACTTGGCCTGCCTCCGTCCCG > 4
CCGCGCCACTTGGCCTGCCTCCGTCCCG > 3
CCGCGCCACTTGGCCTGCCTCCGTCCCG > 8
CCGCGCCACTTGGCCTGCCTCCGTCCCG > 7
CCGCGCCACTTGGCCTGCCTCCGTCCCG > 9
5' UTR
No VIP available No Clinical Annotations available VA
rs4742 108363409A>C, 108363409A>G, 108363409A>T, 183815688A>C, 183815688A>G, 183815688A>T, 315T>A, 315T>C, 315T>G, 348T>A, 348T>C, 348T>G, DCTD:315T>C, V105V, V116V, Val105=, Val116=, mRNA 489T>C, mRNA 512T>C
A > T
A > C
A > G
Synonymous
Val116Val
No VIP available CA VA
rs4752219 120615561C>T, 71420025C>T
C > T
Not Available
No VIP available CA VA
rs4752220 120615609A>G, 71420073A>G
A > G
Not Available
No VIP available No Clinical Annotations available VA
rs4752269 121037952C>T, 53-48076C>T, 71842416C>T
C > T
Intronic
No VIP available No Clinical Annotations available VA
rs487989 10370485G>A, 1747G>A, 65064690G>A, G583R, Gly583Arg, POLA2:2089G>A
G > A
Missense
Gly583Arg
No VIP available CA VA
rs518329 14592T>C, 21576998T>C, 23695236T>C, 476+2013T>C
T > C
Intronic
No VIP available CA VA
rs61734430 17155925C>T, 292C>T, 71850130C>T, 8360C>T, Arg98Cys
C > T
Missense
Arg98Cys
No VIP available No Clinical Annotations available VA
rs62107593 -1923G>C, -1979G>C, -2072G>C, 13061144C>G, 3340G>C, 40792926C>G
C > G
5' Flanking
No VIP available CA VA
rs7091672 120596421T>C, 71400885T>C
T > C
Not Available
No VIP available No Clinical Annotations available VA
rs712829 -216G>T, 216G>T, 4676124G>T, 5031G>T, 55086755G>T, EGFR:-216G>T
G > T
5' UTR
No VIP available No Clinical Annotations available VA
rs717620 -24C>T, 101542578C>T, 5116C>T, 52347042C>T, ABCC2: 5'UTR, ABCC2:(-24)C>T, mRNA 118C>T
C > T
5' UTR
No VIP available No Clinical Annotations available VA
rs720106 29055T>C, 4079978T>C, 4139978T>C, 792+287T>C
T > C
Intronic
No VIP available No Clinical Annotations available VA
rs725518 17922G>A, 387+80G>A, 4068845G>A, 4128845G>A
G > A
Intronic
No VIP available No Clinical Annotations available VA
rs726501 21967G>A, 482+15984G>A, 56127866G>A, 6722225G>A
G > A
Intronic
No VIP available CA VA
rs7311358 13775884G>A, 21015760G>A, 57123G>A, 699G>A, Met233Ile, SCLO1B3: exon 7 c.699G>A, mRNA 825G>A, p.Met233Ile
G > A
Missense
Met233Ile
No VIP available No Clinical Annotations available VA
rs74090038 -1041G>A, -1125G>A, 105262781C>T, 4300G>A, 86262781C>T
C > T
5' Flanking
No VIP available No Clinical Annotations available VA
rs763110 -157-687T>C, 172627498C>C, 24116140C>C, 4314C>C
C > T
5' Flanking
No VIP available No Clinical Annotations available VA
rs776746 -229-237G>A, -253-1G>A, -254A=, -254A>G, -254G>A, -331-237G>A, -357-1G>A, -463-1G>A, -571-1G>A, 12083G>A, 1466+48736C>T, 189-237G>A, 219-237G>A, 321-1G>A, 344-237G>A, 581-237G>A, 689-1G>A, 717-1G>A, 806-4288C>T, 99270539C>T, 99672916T=, 99672916T>C, CYP3A5*1, CYP3A5*3, CYP3A5*3C, CYP3A5:6986A>G, g.6986A>G, intron 3 splicing defect, rs776746 A>G
T > C
Intronic
No VIP available CA VA
rs7779029 103+13883A>G, 18564955T>C, 80532112T>C
T > C
Intronic
No VIP available CA VA
rs7851395 -35-15930A>G, 116002464A>G, 45166996A>G
A > G
Intronic
No VIP available CA VA
rs7921977 -1+461C>T, -169C>T, -177C>T, -243C>T, 115439569C>T, 56C>T, 66244033C>T, Thr19Ile
C > T
Missense
Thr19Ile
No VIP available No Clinical Annotations available VA
rs7940013 27381C>T, 4078304C>T, 4138304C>T, 651-1246C>T
C > T
Intronic
No VIP available No Clinical Annotations available VA
rs8175347 233760235_233760236TA[5][6][7][8], 5-TA insertion in promoter, 7-TA insertion in promoter, 8-TA insertion in promoter, UGT1A1*28, UGT1A1*36, UGT1A1*37, microsatellite, short tandem repeat
(TA)6 > (TA)8
(TA)6 > (TA)5
(TA)6 > (TA)7
Not Available
No VIP available No Clinical Annotations available VA
rs8187710 101611294G>A, 4544G>A, 52415758G>A, 73832G>A, ABCC2 rs8187710, Cys1515Tyr, MRP2 Cys1515Tyr
G > A
Missense
Cys1515Tyr
No VIP available No Clinical Annotations available VA
rs8187758 414402C>A, 709C>A, 85448875C>A, Gln237Lys
C > A
Missense
Gln237Lys
No VIP available No Clinical Annotations available VA
rs861539 104165753G>A, 1651-1239G>A, 1782-1239G>A, 21071C>T, 722C>T, 75229G>A, 85165753G>A, Thr241Met
G > A
Intronic
Thr241Met
No VIP available CA VA
rs870995 -76-3532C>A, 178913006C>A, 51696C>A, 85408152C>A
C > A
Intronic
No VIP available CA VA
rs914232 14636A>G, 190-688A>G, 3947191T>C, 46952750T>C, 70-688A>G
T > C
Intronic
No VIP available CA VA
rs9597 *157C>G, 1314951C>G, 1374951C>G
C > G
3' UTR
No VIP available No Clinical Annotations available VA
rs9937 2223A>G, 4099457A>G, 4159457A>G, 48534A>G, RRM1:2455A>G, Thr741=, rs3177016
A > G
Synonymous
Thr741Thr
No VIP available CA VA
rs9981861 27076915T>C, 41415044T>C, 5384-444A>G, 5645-444A>G
T > C
Intronic
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 146

Overview

Alternate Names: 
Synonym
Carcinoma, Non Small Cell Lung; Carcinoma, Non-Small Cell Lung; Carcinomas, Non-Small-Cell Lung; Lung Carcinoma, Non-Small-Cell; Lung Carcinomas, Non-Small-Cell; NSCLC; Non Small Cell Lung Carcinoma; Non-Small-Cell Lung Carcinoma; Non-Small-Cell Lung Carcinomas; Non-small cell lung cancer
PharmGKB Accession Id: PA443622
External Vocabularies

Curated Information ?

EvidenceGene
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ABCB1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ABCC2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABCC3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABCC4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABCC5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABCC8
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ABCG2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABL1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ACE
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ACSS2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
AKR1B10
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
AKT1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
AKT2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ALK
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
APAF1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
APLF
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
APOE
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ATIC
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ATM
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ATP7B
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
AXIN2
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
BAIAP3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BAX
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BCL2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BCL2L1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BCR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BID
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BIRC3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BRAF
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BRCA2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
C10orf11
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
C18orf56
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
C8orf34
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CAMK2D
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CASP7
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CCDC122
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CCT3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CD274
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CD33
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CD3EAP
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CD52
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CDA
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CDKN2A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CFTR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CHRNA3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CHRNA5
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CLCN6
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CMPK1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CTNNB1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CXCR4
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CXXC4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP1B1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CYP24A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CYP2A6
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2B6
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2C18
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2C19
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2C8
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2C9
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CYP2D6
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2E1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP2F1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CYP3A
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CYP3A4
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CYP3A5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP3A7
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DAPK1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
DCK
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
DCTD
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
DHFR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DNAJC15
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DPYD
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
DSCAM
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
EGF
EGFR
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
EIF3A
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
EIF4E2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
EML4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ENC1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
EPHA5
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
EPHX1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
EPHX2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ERBB2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ERBB3
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ERCC1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ERCC2
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ERCC3
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ERCC4
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ERCC5
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ETS2
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
FAS
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
FASLG
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FGD4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FGF1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
FKBP15
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
FOLR3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FPGS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FUS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FZD3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
G6PD
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GAB1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
GGH
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GNAS
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
GPX5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTA2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTA3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTA4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTM1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTM5
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
GSTP1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTT1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTT2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GTF2H2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HLA-B
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HPRT1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
HSPA5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HYKK
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IGF2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IGFBP1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IGFBP2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IL15
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IL17F
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IL1R2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KIT
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
KRAS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
LDLR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAGI1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAP2K4
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
MAP3K1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAPK7
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MCL1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MCPH1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MDM2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MET
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MGMT
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MITF
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MKI67
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MLH1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MSLN
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
MTHFR
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
MTOR
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
MTR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MUC4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MVP
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MYB
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MYC
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NAT2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NDUFB4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NNMT
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
NQO1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
NRAS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NT5C2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
OPRM1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
OTC
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PALB2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PDCD1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PDE4B
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PDGFA
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PDGFRA
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PDGFRB
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
PDZRN3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PGR
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
PIK3CA
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
PLCB1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PML
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
POLA2
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
PPP1R13L
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PRAM1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
PRDX4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PROC
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PRSS1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PSCA
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PTEN
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
RAD51
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
RAF1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
RB1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
RNF26
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ROS1
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
RPS20P2
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
RRM1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
RRM2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
S100A4
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SEMA3C
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SLC19A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC22A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC22A2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC22A3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC22A7
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SLC28A1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SLC28A2
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SLC28A3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC29A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC29A2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC29A3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC29A4
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SLC31A1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SLCO1B1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SLCO1B3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SMAD4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SMG5
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
STIM1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
STK11
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
STK39
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SULT1A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SULT1A3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SUMO1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TAP2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TGFBR2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TGFBR3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TGFBRAP1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
TIGD1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TNFAIP2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TOP1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TOP2A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TP53
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TPMT
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TRPV1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
TYMS
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
UBE2I
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
UGT1A1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UGT1A9
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
UGT2B17
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
VEGFA
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
VKORC1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
WIF1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
WNT5B
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
XBP1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
XPA
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
XPC
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
XRCC1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
XRCC3
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
XRCC4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
XRCC5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ZBTB40

Curated Information ?

Evidence Drug
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
abacavir
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
afatinib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
alemtuzumab
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
alfentanil
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
amitriptyline
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
anastrozole
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
aripiprazole
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
arsenic trioxide
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
atezolizumab
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
atomoxetine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
atorvastatin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
azathioprine
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
bevacizumab
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
boceprevir
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
busulfan
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
calcitriol
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
capecitabine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
carbamazepine
No Dosing Guideline available DL CA VA No VIP available No VIP available
carboplatin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
carisoprodol
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
carvedilol
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
celecoxib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ceritinib
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
cetuximab
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
cevimeline
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
chloroquine
No Dosing Guideline available DL CA VA No VIP available No VIP available
cisplatin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
citalopram
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
clobazam
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
clomipramine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
clopidogrel
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
clozapine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
codeine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
coumarin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
crizotinib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
cyclophosphamide
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
cyclosporine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
dapsone
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
dasatinib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
daunorubicin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
desipramine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
dextromethorphan
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
diazepam
No Dosing Guideline available DL CA VA No VIP available No VIP available
docetaxel
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
doxepin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
doxorubicin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
epirubicin
No Dosing Guideline available DL CA VA No VIP available No VIP available
erlotinib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
esomeprazole
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
estradiol
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
etoposide
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
exemestane
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
flucloxacillin
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
fluorouracil
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
fluoxetine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
flurbiprofen
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
fulvestrant
No Dosing Guideline available DL CA VA No VIP available No VIP available
gefitinib
No Dosing Guideline available DL CA VA No VIP available No VIP available
gemcitabine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
gemtuzumab ozogamicin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
hydralazine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ifosfamide
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
iloperidone
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
imatinib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
imipramine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
indacaterol
No Dosing Guideline available DL CA VA No VIP available No VIP available
irinotecan
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
isoniazid
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ivacaftor
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
lapatinib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
lenalidomide
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
letrozole
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
maraviroc
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
mercaptopurine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
methotrexate
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
metoprolol
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
mitomycin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
modafinil
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
morphine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
mycophenolate mofetil
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
nelfinavir
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
nicotine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
nilotinib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
nivolumab
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
nortriptyline
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
olanzapine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
omeprazole
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
oxaliplatin
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
paclitaxel
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
panitumumab
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
pantoprazole
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
paroxetine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
peginterferon alfa-2b
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
pembrolizumab
No Dosing Guideline available DL CA VA No VIP available No VIP available
pemetrexed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
perphenazine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
pertuzumab
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PHA-665752
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
phenytoin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
pimozide
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
pitavastatin
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
platinum
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
prasugrel
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
pravastatin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
prednisone
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
primaquine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
propafenone
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
propranolol
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
protriptyline
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
quinidine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
rabeprazole
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ramipril
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
rasburicase
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
rifampin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
risperidone
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
rituximab
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
rosuvastatin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
simvastatin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
sirolimus
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SN-38
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
sorafenib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
sunitinib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
tacrine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
tacrolimus
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
tamoxifen
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
tegafur
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
telaprevir
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
temsirolimus
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
terbinafine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
tetrabenazine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
thioguanine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
thioridazine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ticagrelor
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
timolol
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
tiotropium
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
tolterodine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
toremifene
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
tramadol
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
trastuzumab
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
tretinoin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
trimipramine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
valproic acid
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
vandetanib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
vemurafenib
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
venlafaxine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
vincristine
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
vinorelbine
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
voriconazole
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
warfarin

Relationships from National Drug File - Reference Terminology (NDF-RT)

May Treat
No related diseases are available

Publications related to Carcinoma, Non-Small-Cell Lung: 192

No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of pharmacokinetics and pharmacogenomics with safety and efficacy of gefitinib in patients with EGFR mutation positive advanced non-small cell lung cancer. Lung cancer (Amsterdam, Netherlands). 2016. Hirose Takashi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The potential anticancer effect of beta-blockers and the genetic variations involved in the interindividual difference. Pharmacogenomics. 2016. He Ruo-Hui, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic analysis of advanced non-small-cell lung cancer patients treated with first-line paclitaxel and carboplatin chemotherapy. Pharmacogenetics and genomics. 2015. Park Hyung Soon, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Ceritinib for the treatment of patients with anaplastic lymphoma kinase (ALK)-positive metastatic non-small cell lung cancer. Expert review of clinical pharmacology. 2015. Landi Lorenza, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Impact of single nucleotide polymorphisms on severe hepatotoxicity induced by EGFR tyrosine kinase inhibitors in patients with non-small cell lung cancer harboring EGFR mutations. Lung cancer (Amsterdam, Netherlands). 2015. Sugiyama Eri, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PTEN and PI3K/AKT in non-small-cell lung cancer. Pharmacogenomics. 2015. Pérez-Ramírez Cristina, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Comparison of clinical outcomes of patients with non-small-cell lung cancer harbouring epidermal growth factor receptor exon 19 or exon 21 mutations after tyrosine kinase inhibitors treatment: a meta-analysis. European journal of clinical pharmacology. 2015. Sheng Miaomiao, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics in the treatment of lung cancer: an update. Pharmacogenomics. 2015. Morales-Espinosa Daniela, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Relationship Among Gefitinib Exposure, Polymorphisms of Its Metabolizing Enzymes and Transporters, and Side Effects in Japanese Patients With Non-Small-Cell Lung Cancer. Clinical lung cancer. 2015. Kobayashi Hiroyuki, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Meta-analysis of the risks of hypertension and QTc prolongation in patients with advanced non-small cell lung cancer who were receiving vandetanib. European journal of clinical pharmacology. 2015. Liu Ying, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of positively selected eIF3a polymorphisms with toxicity of platinum-based chemotherapy in NSCLC patients. Acta pharmacologica Sinica. 2015. Yin Ji-ye, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Prognostic and predictive significance of thymidylate synthase protein expression in non-small cell lung cancer: a systematic review and meta-analysis. Cancer biomarkers : section A of Disease markers. 2015. Liu Qingyun, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Phase II trial of carboplatin and pemetrexed as first-line chemotherapy for non-squamous non-small cell lung cancer, and correlation between the efficacy/toxicity and genetic polymorphisms associated with pemetrexed metabolism: Hokkaido Lung Cancer Clinical Study Group Trial (HOT) 0902. Cancer chemotherapy and pharmacology. 2014. Kanazawa Kenya, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Assessment of high-sensitive methods for the detection of EGFR mutations in circulating free tumor DNA from NSCLC patients. Pharmacogenomics. 2015. Pasquale Raffaella, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Correlation of genetic polymorphisms with clinical outcomes in pemetrexed-treated advanced lung adenocarcinoma patients. Pharmacogenomics. 2015. Woo Hye In, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MET: a new promising biomarker in non-small-cell lung carcinoma. Pharmacogenomics. 2015. Pérez-Ramírez Cristina, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinicopathological characteristics of patients with non-small-cell lung cancer who harbor EML4-ALK fusion gene: a meta-analysis. PloS one. 2015. Zhao Fengzhi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Differential Activity of Nivolumab, Pembrolizumab and MPDL3280A according to the Tumor Expression of Programmed Death-Ligand-1 (PD-L1): Sensitivity Analysis of Trials in Melanoma, Lung and Genitourinary Cancers. PloS one. 2015. Carbognin Luisa, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Wnt signaling pathway pharmacogenetics in non-small cell lung cancer. The pharmacogenomics journal. 2014. Stewart D J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetics of the DNA repair pathways in advanced non-small cell lung cancer patients treated with platinum-based chemotherapy. Cancer letters. 2014. Sullivan Ivana, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetics of pemetrexed combination therapy in lung cancer: pathway analysis reveals novel toxicity associations. The pharmacogenomics journal. 2014. Corrigan A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
The prognostic impact of KRAS, its codon and amino acid specific mutations, on survival in resected stage I lung adenocarcinoma. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2014. Izar Benjamin, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of solute carrier transporters in pancreatic cancer: a review. Pharmacogenomics. 2014. Lemstrová Radmila, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenomic assessment of cisplatin-based chemotherapy outcomes in ovarian cancer. Pharmacogenomics. 2014. Khrunin Andrey V, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetics of DNA repair gene polymorphisms in non-small-cell lung carcinoma patients on platinum-based chemotherapy. Genetics and molecular research : GMR. 2014. Zhang L, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Multi-loci analysis reveals the importance of genetic variations in sensitivity of platinum-based chemotherapy in non-small-cell lung cancer. Molecular carcinogenesis. 2013. Liu Li, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
ERCC1 Cys8092Ala and XRCC1 Arg399Gln polymorphisms predict progression-free survival after curative radiotherapy for nasopharyngeal carcinoma. PloS one. 2014. Jin Hekun, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Oxidative stress-related genetic polymorphisms are associated with the prognosis of metastatic gastric cancer patients treated with epirubicin, oxaliplatin and 5-Fluorouracil combination chemotherapy. PloS one. 2014. Geng Ruixuan, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Polymorphisms of CYP2D6 gene and gefitinib-induced hepatotoxicity. Clinical lung cancer. 2013. Takimoto Takayuki, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
ERCC1 C8092A (rs3212986) polymorphism as a predictive marker in esophageal cancer patients treated with cisplatin/5-FU-based neoadjuvant therapy. Pharmacogenetics and genomics. 2013. Rumiato Enrica, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
PharmGKB summary: very important pharmacogene information for the epidermal growth factor receptor. Pharmacogenetics and genomics. 2013. Hodoglugil Ugur, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Intergenic polymorphisms in the amphiregulin gene region as biomarkers in metastatic colorectal cancer patients treated with anti-EGFR plus irinotecan. The pharmacogenomics journal. 2013. Sebio A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenomic assessment of outcomes of pemetrexed-treated patients with adenocarcinoma of the lung. Yonsei medical journal. 2013. Jung Minkyu, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
XBP1 promoter polymorphism modulates platinum-based chemotherapy gastrointestinal toxicity for advanced non-small cell lung cancer patients. Lung cancer (Amsterdam, Netherlands). 2013. Peng J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Implications of Genome-Wide Association Studies in Cancer Therapeutics. British journal of clinical pharmacology. 2013. Patel Jai N, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
A phase I/II pharmacokinetic and pharmacogenomic study of calcitriol in combination with cisplatin and docetaxel in advanced non-small-cell lung cancer. Cancer chemotherapy and pharmacology. 2013. Ramnath N, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Challenges in pharmacogenetics. European journal of clinical pharmacology. 2013. Cascorbi Ingolf, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DNA repair and cytotoxic drugs: the potential role of RAD51 in clinical outcome of non-small-cell lung cancer patients. Pharmacogenomics. 2013. Nogueira Augusto, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Association between eIF3alpha polymorphism and severe toxicity caused by platinum-based chemotherapy in non-small cell lung cancer patients. British journal of clinical pharmacology. 2013. Xu Xiaojing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The A/G allele of eIF3a rs3740556 predicts platinum-based chemotherapy resistance in lung cancer patients. Lung cancer (Amsterdam, Netherlands). 2013. Xu Xiaojing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
XRCC3 Thr241Met polymorphism and clinical outcomes of NSCLC patients receiving platinum-based chemotherapy: a systematic review and meta-analysis. PloS one. 2013. Shen Xiao-yong, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Impact of Systematic EGFR and KRAS Mutation Evaluation on Progression-Free Survival and Overall Survival in Patients with Advanced Non-Small-Cell Lung Cancer Treated by Erlotinib in a French Prospective Cohort (ERMETIC Project-Part 2). Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2012. Cadranel Jacques, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of CASP7 polymorphisms and survival of patients with non-small cell lung cancer with platinum-based chemotherapy treatment. Chest. 2012. Qian Ji, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Efficacy of EGFR tyrosine kinase inhibitors for non-adenocarcinoma NSCLC patients with EGFR mutation. Cancer chemotherapy and pharmacology. 2012. Cho Su-Hee, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
High incidence of severe neutropenia after gemcitabine-based chemotherapy in Chinese cancer patients with CDA 79A>C mutation. Clinica chimica acta; international journal of clinical chemistry. 2012. Xu Jialin, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics and pharmacogenomics: role of mutational analysis in anti-cancer targeted therapy. The pharmacogenomics journal. 2012. Savonarola A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
An intronic polymorphism in GRP78 improves chemotherapeutic prediction in non-small cell lung cancer. Chest. 2012. Zhu Xiao, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic polymorphism of copper transporter protein 1 is related to platinum resistance in Chinese non-small cell lung carcinoma patients. Clinical and experimental pharmacology & physiology. 2012. Xu Xiaojing, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A genome-wide association study for irinotecan-related severe toxicities in patients with advanced non-small-cell lung cancer. The pharmacogenomics journal. 2012. Han J-Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Associations Between ABCC2 Polymorphisms and Cisplatin Disposition and Efficacy. Clinical pharmacology and therapeutics. 2012. Sprowl J A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ROS1 as a 'druggable' receptor tyrosine kinase: lessons learned from inhibiting the ALK pathway. Expert review of anticancer therapy. 2012. Ou Sai-Hong Ignatius, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
First-SIGNAL: first-line single-agent iressa versus gemcitabine and cisplatin trial in never-smokers with adenocarcinoma of the lung. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2012. Han Ji-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Prediction of copper transport protein 1 (CTR1) genotype on severe cisplatin induced toxicity in non-small cell lung cancer (NSCLC) patients. Lung cancer (Amsterdam, Netherlands). 2012. Xu Xiaojing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Association of ABCB1 polymorphisms with erlotinib pharmacokinetics and toxicity in Japanese patients with non-small-cell lung cancer. Pharmacogenomics. 2012. Hamada Akinobu, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Plasma epidermal growth factor receptor mutation analysis and possible clinical applications in pulmonary adenocarcinoma patients treated with erlotinib. Oncology letters. 2012. Chen Yuh-Min, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association between polymorphisms of ERCC1 and survival in epithelial ovarian cancer patients with chemotherapy. Pharmacogenomics. 2012. Yan Li, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Erlotinib versus standard chemotherapy as first-line treatment for European patients with advanced EGFR mutation-positive non-small-cell lung cancer (EURTAC): a multicentre, open-label, randomised phase 3 trial. The lancet oncology. 2012. Rosell Rafael, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pretreatment epidermal growth factor receptor (EGFR) T790M mutation predicts shorter EGFR tyrosine kinase inhibitor response duration in patients with non-small-cell lung cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2012. Su Kang-Yi, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic analysis of BR.21, a placebo-controlled randomized phase III clinical trial of erlotinib in advanced non-small cell lung cancer. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2012. Liu Geoffrey, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Gene polymorphisms, pharmacokinetics, and hematological toxicity in advanced non-small-cell lung cancer patients receiving cisplatin/gemcitabine. Cancer chemotherapy and pharmacology. 2012. Joerger M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Epidermal growth factor receptor mutation status in circulating free DNA in serum: from IPASS, a phase III study of gefitinib or carboplatin/paclitaxel in non-small cell lung cancer. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2012. Goto Koichi, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The influence of gemcitabine pathway polymorphisms on treatment outcome in patients with malignant mesothelioma. Pharmacogenetics and genomics. 2012. Er¿ulj Nina, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenomics of cisplatin-based chemotherapy in ovarian cancer patients of different ethnic origins. Pharmacogenomics. 2012. Khrunin Andrey, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variants in the PI3K/PTEN/AKT/mTOR pathway predict platinum-based chemotherapy response of advanced non-small cell lung cancers in a Chinese population. Asian Pacific journal of cancer prevention : APJCP. 2012. Xu Jia-Li, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Reduced CYP2D6 function is associated with gefitinib-induced rash in patients with non-small cell lung cancer. BMC cancer. 2012. Suzumura Tomohiro, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Two minor NQO1 and NQO2 alleles predict poor response of breast cancer patients to adjuvant doxorubicin and cyclophosphamide therapy. Pharmacogenetics and genomics. 2011. Jamieson David, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association between DNA-repair polymorphisms and survival in pancreatic cancer patients treated with combination chemotherapy. Pharmacogenomics. 2011. Giovannetti Elisa, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Meta-analysis on pharmacogenetics of platinum-based chemotherapy in non small cell lung cancer (NSCLC) patients. PloS one. 2012. Yin Ji-Ye, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Quality of life with gefitinib in patients with EGFR-mutated non-small cell lung cancer: quality of life analysis of North East Japan Study Group 002 Trial. The oncologist. 2012. Oizumi Satoshi, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic predictors for EGFR-inhibitor-associated skin toxicity. The pharmacogenomics journal. 2011. Parmar S, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Prospective molecular marker analyses of EGFR and KRAS from a randomized, placebo-controlled study of erlotinib maintenance therapy in advanced non-small-cell lung cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2011. Brugger Wolfram, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A noninvasive system for monitoring resistance to epidermal growth factor receptor tyrosine kinase inhibitors with plasma DNA. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2011. Nakamura Tomomi, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic analyses of cisplatin-induced nephrotoxicity indicate a renoprotective effect of ERCC1 polymorphisms. Pharmacogenomics. 2011. Tzvetkov Mladen V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Differential effect of polymorphisms of CMPK1 and RRM1 on survival in advanced non-small cell lung cancer patients treated with gemcitabine or taxane/cisplatinum. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2011. Ryu Jeong-Seon, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Erlotinib versus chemotherapy as first-line treatment for patients with advanced EGFR mutation-positive non-small-cell lung cancer (OPTIMAL, CTONG-0802): a multicentre, open-label, randomised, phase 3 study. The lancet oncology. 2011. Zhou Caicun, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Safe and successful treatment with erlotinib after gefitinib-induced hepatotoxicity: difference in metabolism as a possible mechanism. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2011. Kijima Takashi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Interstitial lung disease in gefitinib-treated Japanese patients with non-small-cell lung cancer: genome-wide analysis of genetic data. Pharmacogenomics. 2011. Nyberg Fredrik, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variations in multiple drug action pathways and survival in advanced stage non-small cell lung cancer treated with chemotherapy. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Li Yafei, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The NQO1*2/*2 polymorphism is associated with poor overall survival in patients following resection of stages II and IIIa non-small cell lung cancer. Oncology reports. 2011. Kolesar Jill M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Influence of polymorphisms in MTHFR 677 C¿T, TYMS 3R¿2R and MTR 2756 A¿G on NSCLC risk and response to platinum-based chemotherapy in advanced NSCLC. Pharmacogenomics. 2011. Cui Lian-Hua, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Cytidine deaminase single-nucleotide polymorphism is predictive of toxicity from gemcitabine in patients with pancreatic cancer: RTOG 9704. The pharmacogenomics journal. 2011. Farrell J J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pretreatment EGFR T790M mutation and BRCA1 mRNA expression in erlotinib-treated advanced non-small-cell lung cancer patients with EGFR mutations. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Rosell Rafael, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Rebiopsy of lung cancer patients with acquired resistance to EGFR inhibitors and enhanced detection of the T790M mutation using a locked nucleic acid-based assay. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Arcila Maria E, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genotypic and histological evolution of lung cancers acquiring resistance to EGFR inhibitors. Science translational medicine. 2011. Sequist Lecia V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Copy number variants in pharmacogenetic genes. Trends in molecular medicine. 2011. He Yijing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Functional EGFR germline polymorphisms may confer risk for EGFR somatic mutations in non-small cell lung cancer, with a predominant effect on exon 19 microdeletions. Cancer research. 2011. Liu Wanqing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Impact of ABCG2 polymorphisms on the clinical outcome and toxicity of gefitinib in non-small-cell lung cancer patients. Pharmacogenomics. 2011. Lemos Clara, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
THYMIDYLATE SYNTHASE AND EXCISION REPAIR-CROSS-COMPLEMENTING GROUP-1 AS PREDICTORS OF RESPONSIVENESS IN MESOTHELIOMA PATIENTS TREATED WITH PEMETREXED-CARBOPLATIN. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Zucali Paolo Andrea, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genome-wide association study on overall survival of advanced non-small cell lung cancer patients treated with carboplatin and paclitaxel. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2011. Sato Yasunori, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
PI3K/PTEN/AKT/mTOR pathway genetic variation predicts toxicity and distant progression in lung cancer patients receiving platinum-based chemotherapy. Lung cancer (Amsterdam, Netherlands). 2011. Pu Xia, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Multiple genetic polymorphisms in the prediction of clinical outcome of metastatic colorectal cancer patients treated with first-line FOLFOX-4 chemotherapy. Pharmacogenetics and genomics. 2011. Huang Ming-Yii, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Practical recommendations for pharmacogenomics-based prescription: 2010 ESF-UB Conference on Pharmacogenetics and Pharmacogenomics. Pharmacogenomics. 2011. Becquemont Laurent, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Use of epidermal growth factor receptor mutation analysis in patients with advanced non-small-cell lung cancer to determine erlotinib use as first-line therapy. PLoS currents. 2011. Ishibe Naoko, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Gemcitabine metabolic and transporter gene polymorphisms are associated with drug toxicity and efficacy in patients with locally advanced pancreatic cancer. Cancer. 2010. Tanaka Motofumi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC19A1 pharmacogenomics summary. Pharmacogenetics and genomics. 2010. Yee Sook Wah, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Systematic review of pharmacoeconomic studies of pharmacogenomic tests. Pharmacogenomics. 2010. Beaulieu Mathieu, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic predictors of adverse events and response to chemotherapy in metastatic colorectal cancer: results from North American Gastrointestinal Intergroup Trial N9741. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2010. McLeod Howard L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Blood-based CHRNA3 single nucleotide polymorphism and outcome in advanced non-small-cell lung cancer patients. Lung cancer (Amsterdam, Netherlands). 2010. Carcereny Enric, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Gefitinib or chemotherapy for non-small-cell lung cancer with mutated EGFR. The New England journal of medicine. 2010. Maemondo Makoto, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Expression of gemcitabine- and cisplatin-related genes in non-small-cell lung cancer. The pharmacogenomics journal. 2010. Toffalorio F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Targeted cancer therapies in the twenty-first century: lessons from imatinib. Clinical pharmacology and therapeutics. 2010. Stegmeier F, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Acquired resistance to gefitinib: the contribution of mechanisms other than the T790M, MET, and HGF status. Lung cancer (Amsterdam, Netherlands). 2010. Onitsuka Takamitsu, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of SUMO1 and UBC9 genotypes with tumor response in non-small-cell lung cancer treated with irinotecan-based chemotherapy. The pharmacogenomics journal. 2010. Han Ji-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Predictors of gefitinib outcomes in advanced non-small cell lung cancer (NSCLC): study of a comprehensive panel of molecular markers. Lung cancer (Amsterdam, Netherlands). 2010. Tiseo Marcello, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Molecular predictors of outcome with gefitinib and docetaxel in previously treated non-small-cell lung cancer: data from the randomized phase III INTEREST trial. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2010. Douillard Jean-Yves, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Phase II trial of pemetrexed plus bevacizumab for second-line therapy of patients with advanced non-small-cell lung cancer: NCCTG and SWOG study N0426. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2010. Adjei Alex A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Gefitinib versus cisplatin plus docetaxel in patients with non-small-cell lung cancer harbouring mutations of the epidermal growth factor receptor (WJTOG3405): an open label, randomised phase 3 trial. The lancet oncology. 2010. Mitsudomi Tetsuya, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms and the efficacy and toxicity of cisplatin-based chemotherapy in ovarian cancer patients. The pharmacogenomics journal. 2010. Khrunin A V, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SNPs in genes coding for ROS metabolism and signalling in association with docetaxel clearance. The pharmacogenomics journal. 2010. Edvardsen H, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Preexistence and clonal selection of MET amplification in EGFR mutant NSCLC. Cancer cell. 2010. Turke Alexa B, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Effects of excision repair cross-complementation group 1 (ERCC1) single nucleotide polymorphisms on the prognosis of non-small cell lung cancer patients. Lung cancer (Amsterdam, Netherlands). 2010. Takenaka Tomoyoshi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
RRM1 single nucleotide polymorphism -37C-->A correlates with progression-free survival in NSCLC patients after gemcitabine-based chemotherapy. Journal of hematology & oncology. 2010. Dong Song, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Clinicopathologic and molecular features of epidermal growth factor receptor T790M mutation and c-MET amplification in tyrosine kinase inhibitor-resistant Chinese non-small cell lung cancer. Pathology oncology research : POR. 2009. Chen Hua-Jun, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphisms of EGFR predict clinical outcome in advanced non-small-cell lung cancer patients treated with Gefitinib. Lung cancer (Amsterdam, Netherlands). 2009. Ma Fei, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Gefitinib or carboplatin-paclitaxel in pulmonary adenocarcinoma. The New England journal of medicine. 2009. Mok Tony S, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Screening for epidermal growth factor receptor mutations in lung cancer. The New England journal of medicine. 2009. Rosell Rafael, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Cisplatin pharmacogenetics, DNA repair polymorphisms, and esophageal cancer outcomes. Pharmacogenetics and genomics. 2009. Bradbury Penelope A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Prospective phase II study of gefitinib in non-small cell lung cancer with epidermal growth factor receptor gene mutations. Lung cancer (Amsterdam, Netherlands). 2009. Sugio Kenji, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms affecting clinical outcomes in epithelial ovarian cancer patients treated with taxanes and platinum compounds: a Korean population-based study. Gynecologic oncology. 2009. Kim Hee Seung, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Randomized phase II and pharmacogenetic study of pemetrexed compared with pemetrexed plus carboplatin in pretreated patients with advanced non-small-cell lung cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2009. Smit Egbert F, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
DNA repair gene polymorphisms predict favorable clinical outcome in advanced non-small-cell lung cancer. Clinical lung cancer. 2009. Kalikaki Aristea, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Distribution of gemcitabine pathway genotypes in ethnic Asians and their association with outcome in non-small cell lung cancer patients. Lung cancer (Amsterdam, Netherlands). 2009. Soo Ross A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Integrated pharmacogenetic prediction of irinotecan pharmacokinetics and toxicity in patients with advanced non-small cell lung cancer. Lung cancer (Amsterdam, Netherlands). 2009. Han Ji-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Resistance gene expression determines the in vitro chemosensitivity of non-small cell lung cancer (NSCLC). BMC cancer. 2009. Glaysher Sharon, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Effects of erlotinib in EGFR mutated non-small cell lung cancers with resistance to gefitinib. Clinical cancer research : an official journal of the American Association for Cancer Research. 2008. Costa Daniel B, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
NAD(P)H:quinone oxidoreductase 1 NQO1*2 genotype (P187S) is a strong prognostic and predictive factor in breast cancer. Nature genetics. 2008. Fagerholm Rainer, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Detection of mutations in EGFR in circulating lung-cancer cells. The New England journal of medicine. 2008. Maheswaran Shyamala, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Correlation between cytidine deaminase genotype and gemcitabine deamination in blood samples. Nucleosides, nucleotides & nucleic acids. 2008. Giovannetti E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Efficacy of gemcitabine in patients with non-small cell lung cancer according to promoter polymorphisms of the ribonucleotide reductase M1 gene. Clinical cancer research : an official journal of the American Association for Cancer Research. 2008. Kim Soo-Ok, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
First-line gefitinib in patients with advanced non-small-cell lung cancer harboring somatic EGFR mutations. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2008. Sequist Lecia V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The CYP2A6*4 allele is determinant of S-1 pharmacokinetics in Japanese patients with non-small-cell lung cancer. Clinical pharmacology and therapeutics. 2008. Kaida Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Tumor suppressor FUS1 signaling pathway. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2008. Ji Lin, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Epidermal growth factor receptor polymorphisms and clinical outcomes in non-small-cell lung cancer patients treated with gefitinib. The pharmacogenomics journal. 2008. Liu G, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Correlation of CDA, ERCC1, and XPD polymorphisms with response and survival in gemcitabine/cisplatin-treated advanced non-small cell lung cancer patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2008. Tibaldi Carmelo, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Molecular characteristics of bronchioloalveolar carcinoma and adenocarcinoma, bronchioloalveolar carcinoma subtype, predict response to erlotinib. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2008. Miller Vincent A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomic and pharmacokinetic determinants of erlotinib toxicity. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2008. Rudin Charles M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Enhancement of antitumor activity of cisplatin in human lung cancer cells by tumor suppressor FUS1. Cancer gene therapy. 2008. Deng W-G, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Loss and reduction of FUS1 protein expression is a frequent phenomenon in the pathogenesis of lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2008. Prudkin Ludmila, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
MET amplification occurs with or without T790M mutations in EGFR mutant lung tumors with acquired resistance to gefitinib or erlotinib. Proceedings of the National Academy of Sciences of the United States of America. 2007. Bean James, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Relationship of EGFR mutations, expression, amplification, and polymorphisms to epidermal growth factor receptor inhibitors in the NCI60 cell lines. Clinical cancer research : an official journal of the American Association for Cancer Research. 2007. Liu Wanqing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Efficacy and safety of single-agent pertuzumab, a human epidermal receptor dimerization inhibitor, in patients with non small cell lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2007. Herbst Roy S, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The epidermal growth factor receptor intron1 (CA) n microsatellite polymorphism is a potential predictor of treatment outcome in patients with advanced lung cancer treated with Gefitinib. European journal of pharmacology. 2007. Nie Qiang, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Epidermal growth factor receptor mutations and their correlation with gefitinib therapy in patients with non-small cell lung cancer: a meta-analysis based on updated individual patient data from six medical centers in mainland China. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2007. Wu Yi-Long, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Intron 1 CA dinucleotide repeat polymorphism and mutations of epidermal growth factor receptor and gefitinib responsiveness in non-small-cell lung cancer. Pharmacogenetics and genomics. 2007. Han Sae-Won, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MET amplification leads to gefitinib resistance in lung cancer by activating ERBB3 signaling. Science (New York, N.Y.). 2007. Engelman Jeffrey A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Combination of EGFR gene copy number and protein expression predicts outcome for advanced non-small-cell lung cancer patients treated with gefitinib. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO. 2007. Hirsch F R, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Predictive factors associated with prolonged survival in patients with advanced non-small-cell lung cancer (NSCLC) treated with gefitinib. British journal of cancer. 2007. Satouchi M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic profiling in patients with advanced colorectal cancer treated with first-line FOLFOX-4 chemotherapy. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2007. Ruzzo Annamaria, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The impact of epidermal growth factor receptor gene status on gefitinib-treated Japanese patients with non-small-cell lung cancer. International journal of cancer. Journal international du cancer. 2007. Ichihara Shuji, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Vandetanib (ZD6474): an orally available receptor tyrosine kinase inhibitor that selectively targets pathways critical for tumor growth and angiogenesis. Expert opinion on investigational drugs. 2007. Herbst Roy S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Synergistic tumor suppression by coexpression of FUS1 and p53 is associated with down-regulation of murine double minute-2 and activation of the apoptotic protease-activating factor 1-dependent apoptotic pathway in human non-small cell lung cancer cells. Cancer research. 2007. Deng Wu-Guo, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacokinetics of gemcitabine in Japanese cancer patients: the impact of a cytidine deaminase polymorphism. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2007. Sugiyama Emiko, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Response to treatment and survival of patients with non-small cell lung cancer undergoing somatic EGFR mutation testing. The oncologist. 2007. Sequist Lecia V, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Gefitinib for non-small-cell lung cancer patients with epidermal growth factor receptor gene mutations screened by peptide nucleic acid-locked nucleic acid PCR clamp. British journal of cancer. 2006. Sutani A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
XRCC1 R399Q polymorphism is associated with response to platinum-based neoadjuvant chemotherapy in bulky cervical cancer. Gynecologic oncology. 2006. Chung Hyun Hoon, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of ABCG2 and adverse reactions to gefitinib. Journal of the National Cancer Institute. 2006. Cusatis George, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Novel D761Y and common secondary T790M mutations in epidermal growth factor receptor-mutant lung adenocarcinomas with acquired resistance to kinase inhibitors. Clinical cancer research : an official journal of the American Association for Cancer Research. 2006. Balak Marissa N, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A phase II study of irinotecan and carboplatin in advanced non-small cell lung cancer with pharmacogenomic analysis: final report. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2006. Pillot Giancarlo A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Clinical predictors versus epidermal growth factor receptor mutation in gefitinib-treated non-small-cell lung cancer patients. Lung cancer (Amsterdam, Netherlands). 2006. Han Sae-Won, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Novel heteroduplex method using small cytology specimens with a remarkably high success rate for analysing EGFR gene mutations with a significant correlation to gefitinib efficacy in non-small-cell lung cancer. British journal of cancer. 2006. Oshita F, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Analysis of epidermal growth factor receptor gene mutation in patients with non-small cell lung cancer and acquired resistance to gefitinib. Clinical cancer research : an official journal of the American Association for Cancer Research. 2006. Kosaka Takayuki, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Vandetanib, a novel multitargeted kinase inhibitor, in cancer therapy. Drugs of today (Barcelona, Spain : 1998). 2006. Sathornsumetee Sith, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Glutathione-S-transferase P1 isoenzyme polymorphisms, platinum-based chemotherapy, and non-small cell lung cancer. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2006. Booton Richard, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Evaluation of the epidermal growth factor receptor gene mutation and copy number in non-small cell lung cancer with gefitinib therapy. Oncology reports. 2006. Endo Katsuhiko, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DNA repair by ERCC1 in non-small-cell lung cancer and cisplatin-based adjuvant chemotherapy. The New England journal of medicine. 2006. Olaussen Ken A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Presence of epidermal growth factor receptor gene T790M mutation as a minor clone in non-small cell lung cancer. Cancer research. 2006. Inukai Michio, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Impact of the haplotype CYP3A4*16B harboring the Thr185Ser substitution on paclitaxel metabolism in Japanese patients with cancer. Clinical pharmacology and therapeutics. 2006. Nakajima Yukiko, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Cyclin D1 and epidermal growth factor polymorphisms associated with survival in patients with advanced colorectal cancer treated with Cetuximab. Pharmacogenetics and genomics. 2006. Zhang Wu, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Glutathione S-transferase P1 polymorphism (Ile105Val) predicts cumulative neuropathy in patients receiving oxaliplatin-based chemotherapy. Clinical cancer research : an official journal of the American Association for Cancer Research. 2006. Lecomte Thierry, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Comprehensive analysis of UGT1A polymorphisms predictive for pharmacokinetics and treatment outcome in patients with non-small-cell lung cancer treated with irinotecan and cisplatin. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2006. Han Ji-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Gemcitabine pharmacogenomics: cytidine deaminase and deoxycytidylate deaminase gene resequencing and functional genomics. Clinical cancer research : an official journal of the American Association for Cancer Research. 2006. Gilbert Judith A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Exploring the relationship between expression of cytochrome P450 enzymes and gefitinib pharmacokinetics. Clinical pharmacokinetics. 2006. Swaisland Helen C, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Inherited susceptibility to lung cancer may be associated with the T790M drug resistance mutation in EGFR. Nature genetics. 2005. Bell Daphne W, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Epidermal growth factor receptor mutations and gene amplification in non-small-cell lung cancer: molecular analysis of the IDEAL/INTACT gefitinib trials. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2005. Bell Daphne W, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Clinicopathologic significance of the mutations of the epidermal growth factor receptor gene in patients with non-small cell lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2005. Tomizawa Yoshio, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Mutations in the epidermal growth factor receptor and in KRAS are predictive and prognostic indicators in patients with non-small-cell lung cancer treated with chemotherapy alone and in combination with erlotinib. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2005. Eberhard David A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
cN-II expression predicts survival in patients receiving gemcitabine for advanced non-small cell lung cancer. Lung cancer (Amsterdam, Netherlands). 2005. Sève Pascal, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Activating mutations in the tyrosine kinase domain of the epidermal growth factor receptor are associated with improved survival in gefitinib-treated chemorefractory lung adenocarcinomas. Clinical cancer research : an official journal of the American Association for Cancer Research. 2005. Taron Miguel, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Mutation in the tyrosine kinase domain of epidermal growth factor receptor is a predictive and prognostic factor for gefitinib treatment in patients with non-small cell lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2005. Chou Teh-Ying, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Overexpression of the aldo-keto reductase family protein AKR1B10 is highly correlated with smokers' non-small cell lung carcinomas. Clinical cancer research : an official journal of the American Association for Cancer Research. 2005. Fukumoto Shin-ichi, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Acquired resistance of lung adenocarcinomas to gefitinib or erlotinib is associated with a second mutation in the EGFR kinase domain. PLoS medicine. 2005. Pao William, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Ribonucleotide reductase M1 gene promoter activity, polymorphisms, population frequencies, and clinical relevance. Lung cancer (Amsterdam, Netherlands). 2005. Bepler Gerold, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Determinants of sensitivity and resistance to gemcitabine: the roles of human equilibrative nucleoside transporter 1 and deoxycytidine kinase in non-small cell lung cancer. Cancer science. 2004. Achiwa Hiroyuki, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A multivariate analysis of genomic polymorphisms: prediction of clinical outcome to 5-FU/oxaliplatin combination chemotherapy in refractory colorectal cancer. British journal of cancer. 2004. Stoehlmacher J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
XPD and XRCC1 genetic polymorphisms are prognostic factors in advanced non-small-cell lung cancer patients treated with platinum chemotherapy. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2004. Gurubhagavatula Sarada, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy. Science (New York, N.Y.). 2004. Paez J Guillermo, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. The New England journal of medicine. 2004. Lynch Thomas J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Ribonucleotide reductase messenger RNA expression and survival in gemcitabine/cisplatin-treated advanced non-small cell lung cancer patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2004. Rosell Rafael, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Evaluation of NQO1 gene expression and variant allele in human NSCLC tumors and matched normal lung tissue. International journal of oncology. 2002. Kolesar Jill M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Overexpression of candidate tumor suppressor gene FUS1 isolated from the 3p21.3 homozygous deletion region leads to G1 arrest and growth inhibition of lung cancer cells. Oncogene. 2001. Kondo M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Rapid polyubiquitination and proteasomal degradation of a mutant form of NAD(P)H:quinone oxidoreductase 1. Molecular pharmacology. 2001. Siegel D, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genotype-phenotype relationships in studies of a polymorphism in NAD(P)H:quinone oxidoreductase 1. Pharmacogenetics. 1999. Siegel D, et al. PubMed