Carcinoma, Non-Small-Cell Lung

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Gene ? Variant?
Alternate Names ? Drugs ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
No VIP available No VIP available VA ABCB1 *2 (PMID: 11503014) N/A N/A N/A
No VIP available No VIP available No VIP available CYP2A6 *4C N/A N/A N/A
No VIP available No Clinical Annotations available VA
rs1042858 2232G>A, 4099466G>A, 4159466G>A, 48543G>A, Ala744=, RRM1:2464G>A, rs1042858
G > A
No VIP available No Clinical Annotations available VA
rs1044457 *360C>T, 1119C>T, 17814695C>T, 47842777C>T
C > T
Not Available
No VIP available No Clinical Annotations available VA
rs1045642 208920T>A, 208920T>C, 25171488A>G, 25171488A>T, 3435T>A, 3435T>C, 87138645A>G, 87138645A>T, ABCB1*6, ABCB1: 3435C>T, ABCB1: C3435T, ABCB1: c.3435C>T, ABCB1:3435C>T, Ile1145=, Ile1145Ile, MDR1 3435C>T, MDR1 C3435T, PGP C3435T, c.3435C>T, mRNA 3853C>T
A > T
A > G
No VIP available No Clinical Annotations available VA
rs1047768 103504517T>C, 11344T>C, 138T>C, 1500T>C, 16594193T>C, His46=, His500=
T > C
No VIP available No Clinical Annotations available VA
rs1048977 20618562C>T, 20945055C>T, 435C>T, CDA:435C>T, T145T, Thr145=, mRNA 614C>T
C > T
No VIP available CA VA
rs1051298 *64C>T, *746C>T, 114721G>A, 2522C>T, 32560C>T, 3929267G>A, 46934826G>A
G > A
3' UTR
No VIP available CA VA
rs1052555 18123742G>A, 2133C>T, 23322C>T, 45855524G>A, Asp711=
C > G
C > A
No VIP available No Clinical Annotations available VA
rs1060896 16344824C>A, 225A>C, 225C>A, 45554267C>A, R75S, SLC28A2:283A>C, Ser75Arg, mRNA 284A>C
C > A
No VIP available No Clinical Annotations available VA
rs1065634 *1022A>G, -507A>G, 115259768T>C, 4748A>G, 85231686T>C
T > C
5' Flanking
No VIP available No Clinical Annotations available VA
rs10799754 22746686T>C, 9426774T>C
T > C
Not Available
No VIP available No Clinical Annotations available VA
rs10868138 16081833T>C, 338A>G, 660A>G, 86917301T>C, Tyr113Cys
T > C
Not Available
No VIP available CA VA
rs10878232 27665953T>G, 65522647T>G
T > G
Not Available
No VIP available CA VA
rs10981694 -36+2451T>G, 115986409T>G, 45150941T>G
T > G
No VIP available No Clinical Annotations available VA
rs11030918 -756T>C, 243555T>C, 4055487T>C, 4115487T>C, 4564T>C
T > C
5' Flanking
No VIP available No Clinical Annotations available VA
rs11128347 7349291G>C, 73619561G>C, 918+31944C>G
G > C
Not Available
No VIP available No Clinical Annotations available VA
rs11211524 172-5414A>C, 172-928A>C, 17805131A>C, 321-928A>C, 47833213A>C
A > C
No VIP available CA VA
rs1127687 *810G>A, *926G>A, 115490109G>A, 66294573G>A
G > A
3' UTR
No VIP available No Clinical Annotations available VA
rs1128503 1236T>C, 167964T>C, 87179601A>G, 87550285A>G, ABCB1 1236C>T, ABCB1*8, ABCB1: c.1236T>C, ABCB1:1236C>T, ABCB1:1236T>C, Gly412=, Gly412Gly, mRNA 1654T>C, p.Gly412Gly
A > G
No VIP available No Clinical Annotations available VA
rs1138272 12659374C>T, 341C>T, 67353579C>T, 7514C>T, A114V, Ala114Val, GSTP1: A114V, GSTP1: C341T
C > T
No VIP available CA VA
rs11545078 15803165G>A, 17847C>T, 452C>T, 63938764G>A, GGH: 452C>T, GGH: c.452C>T, Thr151Ile, p.Thr127Ile, p.Thr151Ile
G > A
No VIP available CA No Variant Annotations available
rs11568315 55020563_55020564CA[9][14][15][16][17][18][19][20][21][22][23], 55088256_55088257CA[9][14][15][16][17][18][19][20][21][22][23], 6532_6533CA[9][14][15][16][17][18][19][20][21][22][23], 88+1198_88+1199CA[9][14][15][16][17][18][19][20][21][22][23]
CA > 19
CA > 15
CA > 16
CA > 17
CA > 18
CA > 22
CA > 23
CA > 14
CA > (CA)9
CA > 20
CA > 21
No VIP available CA VA
rs11615 18191871A>G, 354T>C, 45923653A>G, 63434T>C, Asn118=, ERCC1:19007T>C, ERCC1:Asn118Asn
A > G
No VIP available No Clinical Annotations available VA
rs11710163 -27+9024T>C, 12636288A>G, 12696288A>G, 14391T>C
A > G
No VIP available No Clinical Annotations available VA
rs11854484 16336035C>T, 45545478C>T, 65C>T, Pro22Leu
C > T
No VIP available CA VA
rs11868547 28797755G>C, 39138C>G, 63523603G>C
G > C
Not Available
No VIP available No Clinical Annotations available VA
rs11979430 103+36739G>A, 18542099C>T, 80509256C>T
C > T
No VIP available No Clinical Annotations available VA
rs12090346 17813475C>T, 47841557C>T, 498+592C>T, 645+592C>T, 717+592C>T
C > T
No VIP available No Clinical Annotations available VA
rs1209950 25835399C>T, 40173528C>T
C > T
Not Available
No VIP available No Clinical Annotations available VA
rs12118636 23048077G>A, 53076159G>A
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs12139042 *396C>T, 11167146G>A, 7171878G>A
G > A
3' UTR
No VIP available CA VA
rs121434568 177791T>G, 2573T>G, 55181822T>G, 55191822T>G, Leu858Arg
T > G
Not Available
No VIP available CA VA
rs121434569 1193G>A, 167347C>T, 2369C>T, 55171378C>T, 55181378C>T, Thr790Met
C > T
Not Available
No VIP available No Clinical Annotations available VA
rs12145722 22742985C>T, 9423073C>T
C > T
Not Available
No VIP available CA VA
rs12415607 -1310C>A, -1534C>A, -1542C>A, -1608C>A, -905C>A, 115438204C>A, 66242668C>A
C > A
5' Flanking
No VIP available CA VA
rs12721627 20716C>G, 37398936G>C, 554C>G, 99366093G>C, CYP3A4*16, CYP3A4*16A, CYP3A4:185 Thr>Ser, CYP3A4:554C>G, CYP3A4:658 C>G, CYP3A4:T185S, CYP3A4:Thr185Ser, Thr185Ser
G > C
No VIP available No Clinical Annotations available VA
rs12806698 -269C>A, 244042C>A, 4055974C>A, 4115974C>A, 5051C>A
C > A
5' UTR
No VIP available CA VA
rs12819505 *1247A>G, 1696665A>G, 1756665A>G
A > G
3' Flanking
No VIP available CA VA
rs13181 *304T>G, 18123137T>G, 2251A>C, 23927A>C, 45854919T>G, ERCC2 Lys751Gln, ERCC2:2251A>C, ERCC2:Lys751Gln, Lys751Gln, rs13181:T>G
T > G
No VIP available CA VA
rs1382368 316-40514C>T, 33045434C>T, 82451075C>T
C > T
No VIP available CA VA
rs1517114 21253618C>G, 69389217C>G, 736+8162C>G
C > G
No VIP available CA VA
rs1650697 -473T>A, -473T>C, -473T>G, 235A>C, 235A>G, 235A>T, 30545140A>C, 30545140A>G, 30545140A>T, 5020T>A, 5020T>C, 5020T>G, 5488A>C, 5488A>G, 5488A>T, 79950781A>C, 79950781A>G, 79950781A>T, Ile79Leu, Ile79Val
A > G
5' UTR
No VIP available No Clinical Annotations available VA
rs1656402 233426526C>T, 271-2431C>T, 83635944C>T
C > T
No VIP available No Clinical Annotations available VA
rs1661167 17320286G>A, 45052068G>A, 498+149C>T
G > A
No VIP available No Clinical Annotations available VA
rs16886403 33347T>C, 483-13181T>C, 56139246T>C, 6733605T>C
T > C
No VIP available CA VA
rs1695 12658484A>G, 313A>G, 6624A>G, 67352689A>G, GSTP1*2, GSTP1*B, GSTP1: I105V, GSTP1:A313G, GSTP1:I105V, GSTP1:Ile105Val, Ile105Val, Part of haplotypes GSTP1*B and GSTP1*C, rs1695:A>G
A > G
No VIP available No Clinical Annotations available VA
rs17215836 403839_403840insTGT, 419_420insTGT, 85438312_85438313insTGT, Leu140delinsLeuVal
- > TGT
- > TTG
Not Available
No VIP available No Clinical Annotations available VA
rs17216177 -34T>C, 101603522T>C, 3742-34T>C, 52407986T>C, 66060T>C
T > C
No VIP available No Clinical Annotations available VA
rs17309872 *771A>T, *843T>A, 32814T>A, 33515788A>T, 3711880A>T, 58044A>T
A > T
3' Flanking
No VIP available No Clinical Annotations available VA
rs17661089 56105996A>G, 6700355A>G, 97A>G
A > G
Not Available
No VIP available CA VA
rs1799782 16325792G>A, 44057574G>A, 580C>T, Arg194Trp
G > A
No VIP available CA VA
rs1799793 11587G>A, 18135477C>T, 45867259C>T, 862G>A, 934G>A, Asp288Asn, Asp312Asn, XPD Asp312Asn, XPD:Asp312Asn
C > T
No VIP available CA VA
rs1799801 13981958T>C, 14041958T>C, 2505T>C, 32945T>C, Ser835=
T > C
No VIP available CA VA
rs1800566 20389C>T, 23359344G>A, 445C>T, 457C>T, 559C>T, 69745145G>A, NQO1*2, NQO1:C609T, NQO1:P187S, NQO1:c.558C>T, Pro149Ser, Pro153Ser, Pro187Ser, rs1800566 C>T
G > A
No VIP available CA VA
rs1800975 -4A>G, 100459578T>C, 114A>G, 29624110T>C, 5114A>G
T > C
Not Available
No VIP available No Clinical Annotations available VA
rs1801131 1040A>C, 11208431T>G, 11794419T>G, 1286A>C, 1409A>C, 16685A>C, A1298C, Glu347Ala, Glu429Ala, Glu470Ala, MTHFR:1298A>C
T > G
Not Available
No VIP available CA VA
rs1801133 11210333G>A, 11796321G>A, 14783C>T, 419C>T, 665C>T, 677C>T, 788C>T, A222V, Ala140Val, Ala222Val, Ala263Val, C677T, MTHFR: c.677C>T, MTHFR:667C>T, p.A222V
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs1805087 237048500A>G, 2756A>G, 30566279A>G, 94920A>G, Asp919Gly, MS 2756A>G, MS D919G, MTR:2756A>G, MTR:Asp919Gly
A > G
No VIP available No Clinical Annotations available VA
rs183484 30209C>A, 4081132C>A, 4141132C>A, 850C>A, Arg284=
C > A
No VIP available No Clinical Annotations available VA
rs1885301 -1358A>G, -1360A>G, -1549A>G, -1549G>A, 101541053A>G, 3591A>G, 99781296A>G
A > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs2032582 186947T>A, 186947T>G, 2677A, 2677G, 2677T, 2677T>A, 2677T>G, 3095G>T/A, 87160618A>C, 87160618A>T, 87531302A>C, 87531302A>T, 893 Ala, 893 Ser, 893 Thr, ABCB1*7, ABCB1: 2677G>T/A, ABCB1: 2677T/A>G, ABCB1: A893S, ABCB1: G2677T/A, ABCB1: c.2677G>T/A, ABCB1:2677G>A/T, ABCB1:2677G>T/A, ABCB1:A893T, Ala893Ser/Thr, MDR1, MDR1 G2677T/A, Ser893Ala, Ser893Thr, mRNA 3095G>T/A, p.Ala893Ser/Thr
A > T
A > C
No VIP available No Clinical Annotations available VA
rs2072671 20589208A>C, 20915701A>C, 79A>C, CDA: c.79A>C, CDA:79A>C, K27Q, Lys27Gln, p.Lys27Gln
A > C
No VIP available CA VA
rs2227310 1020C>G, 115489152C>G, 66293616C>G, 690C>G, 731C>G, 765C>G, 864C>G, Asp230Glu, Asp255Glu, Asp288Glu, Asp340Glu, Thr244Ser
C > G
No VIP available CA No Variant Annotations available
rs2227983 147531G>A, 147531G>C, 147531G>T, 1562G>A, 1562G>C, 1562G>T, 4818624G>A, 4818624G>C, 4818624G>T, 55229255G>A, 55229255G>C, 55229255G>T, Arg521Lys, Arg521Met, Arg521Thr, EGFR: 497G/A, EGFR:1562G>A, EGFR:R497K, R497K, R521K
G > A
G > T
G > C
No VIP available CA VA
rs2231137 13608835C>T, 23898G>A, 34G>A, 89061114C>T, ABCG2:V12M, Val12Met
C > T
No VIP available No Clinical Annotations available VA
rs2231142 13600044G>T, 32689C>A, 421C>A, 89052323G>T, ABCG2: Q141K, ABCG2:421C>A, ABCG2:Q141K, ABCG2:c.421C>A, Gln141Lys, rs2231142
G > T
No VIP available No Clinical Annotations available VA
rs2234767 -1032G>A, -1378G>A, -24+1440C>T, 3969G>A, 41553720G>A, 6892C>T, 90749256G>A
G > A
5' Flanking
No VIP available CA VA
rs2234922 19544185A>G, 226026406A>G, 33610A>G, 416A>G, EPHX1: H139R, His139Arg, NM_000120.2: c.416A>G, NT_004559.13: g.2228559A>G, mRNA 457A>G, mRNA 691A>G, p.His139Arg
A > G
No VIP available No Clinical Annotations available VA
rs2242046 1561G>A, 444256G>A, 85478729G>A, Asp521Asn, N521D, SLC28A1:1576T>C
G > A
No VIP available No Clinical Annotations available VA
rs2242047 1528C>T, 444223C>T, 85478696C>T, Arg510Cys, R510C, SLC28A1:1543G>A
C > T
No VIP available No Clinical Annotations available VA
rs2242048 1368G>G, 443937A>G, 85478410A>G, Gln456=, SLC28A1:1383C>T
A > G
Not Available
No VIP available CA VA
rs2269577 -245C>G, 29196757G>C, 4804C>G, 8587326G>C
G > C
5' Flanking
No VIP available No Clinical Annotations available VA
rs2273697 101563815G>A, 1249G>A, 1438G>A, 1440G>A, 26353G>A, 553G>A, 99804058G>A, ABCC2: c.1249G>A, ABCC2:1249G>A, ABCC2:V417I, ABCC2:c.1249G>A, Val185Ile, Val417Ile, p.V417I
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs2284449 20-2374T>C, 4060849T>C, 4120849T>C, 9926T>C
T > C
No VIP available No Clinical Annotations available VA
rs2290272 412958G>A, 565G>A, 85447431G>A, SLC28A1: V189I, Val189Ile
G > A
No VIP available No Clinical Annotations available VA
rs2306283 14089862A>G, 21329738A>G, 388A>G, 50611A>G, Asn130Asp, SLCO1B1*1B
A > G
No VIP available No Clinical Annotations available VA
rs232043 28202G>A, 4079125G>A, 4139125G>A, 651-425G>A
G > A
No VIP available No Clinical Annotations available VA
rs238406 10537A>C, 18136527T>G, 396A>C, 45868309T>G, 468A>C, Arg132=, Arg156=
A > T
A > G
No VIP available No Clinical Annotations available VA
rs2494750 -1172C>G, -1256C>G, 105262912G>C, 4169C>G, 86262912G>C
G > C
5' Flanking
No VIP available CA VA
rs2494752 -1868T>C, -1952T>C, 105263608A>G, 3473T>C, 86263608A>G
A > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs2498786 -628G>C, -712G>C, 105262368C>G, 4713G>C, 86262368C>G
C > G
5' Flanking
No VIP available CA VA
rs25487 1196A>G, 16323944T>C, 44055726T>C, Gln399Arg, XRCC1 Arg399Gln, XRCC1:Arg399Gln
T > C
No VIP available No Clinical Annotations available VA
rs2622604 -19-17758A>G, -20+614A>G, 13626645T>C, 6088A>G, 89078924T>C, ABCG2 SNP in intron 1, rs2622604 C>T
T > C
No VIP available No Clinical Annotations available VA
rs2699887 -77+17C>T, 178866408C>T, 5098C>T, 85361554C>T
C > T
No VIP available No Clinical Annotations available VA
rs2745761 169648G>C, 178-74086G>C, 8217943G>C, 8277943G>C
G > C
No VIP available No Clinical Annotations available VA
rs2762939 14266C>G, 22977343G>C, 52781251G>C, 733-149C>G
G > C
No VIP available CA VA
rs3212986 *197G>T, 1510C>A, 18180954C>A, 45912736C>A, 74351G>T, ERCC1 C8092A, ERCC1:8090C>A, ERCC1:8092C>A, Gln504Lys
C > A
3' UTR
No VIP available CA VA
rs3213239 -1450_-1449insGGCC, -18_-17insGGCC, -213_-212insGGCC, 3671_3672insGGCC, 43576907_43576908insGGCC, 44081059_44081060insGGCC
- > CCGG
5' Flanking
No VIP available No Clinical Annotations available VA
rs34716810 -1586C>T, -1642C>T, -1735C>T, 13060807G>A, 3677C>T, 40792589G>A
G > A
5' Flanking
No VIP available No Clinical Annotations available VA
rs34743033 28-bp tandem repeats, CCGCGCCACTTGGCCTGCCTCCGTCCCG, TSER*2, TSER*3, TYMS: 28 bp tandem repeat, TYMS: 2R, TYMS: TSER *2/*3, TYMS:TSER 28-basepair 5'UTR enhancer region repeat
Not Available
No VIP available CA VA
rs3738948 128018063A>G, 17766726A>G, 2064+741T>C, 38690T>C
A > G
No VIP available CA VA
rs3740066 101604207C>T, 3972C>T, 52408671C>T, 66745C>T, ABCC2:3972C>T, I1324I, Ile1324=
C > T
No VIP available No Clinical Annotations available VA
rs3740556 -7C>T, 120840195G>A, 71644659G>A
G > A
5' UTR
No VIP available No Clinical Annotations available VA
rs3775289 12073341T>C, 71862674T>C, 8410T>C, 92-1110T>C, DCK:IVS1-1110T>C
T > C
No VIP available No Clinical Annotations available VA
rs3787554 12837C>T, 22978772G>A, 52782680G>A, 641-308C>T
G > A
No VIP available CA VA
rs3788189 1174-529A>C, 1294-1517A>C, 1294-529A>C, 30803A>C, 3931024T>G, 46936583T>G
T > G
No VIP available No Clinical Annotations available VA
rs3817657 31669T>C, 4082592T>C, 4142592T>C, 877-242T>C
T > C
No VIP available CA VA
rs3832043 -127delT, -41delT, 10, 233671808delT, 234580454delT, 855+34431delT, 855+53246delT, 87065delT, 9/, T, UGT1A9*22, UGT1A9:
T > -
5' Flanking
No VIP available No Clinical Annotations available VA
rs4124874 -1668A>C, 172270T>G, 234665659T>G, 61-10021T>G, 611918T>G, 856-10021T>G, 862-10021T>G, 868-10021T>G, UGT1A1*60, UGT1A1:-3263T>G, UGT1A1:-3279T>G
T > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs4148323 175755G>A, 211G>A, 234669144G>A, 61-6536G>A, 615403G>A, 856-6536G>A, 862-6536G>A, 868-6536G>A, Gly71Arg, UGT1A1*6, UGT1A1: G71R, UGT1A1:211G>A, UGT1A1:G211A, UGT1A1:Gly71Arg
G > A
No VIP available CA VA
rs4149015 -910G>A, 14043446G>A, 21283322G>A, 4195G>A, SLCO1B1:11187G>A, SLCO1B1:G-11187A
G > A
5' Flanking
No VIP available CA VA
rs4149056 14091673T>C, 21331549T>C, 521T>C, 52422T>C, SLCO1B1*5, Val174Ala
T > C
No VIP available CA VA
rs430397 128001119C>T, 57165651C>T, 7548G>A, 997-13G>A
C > T
No VIP available CA VA
rs4353229 *290T>C, *406T>C, 115489589T>C, 66294053T>C
T > C
3' UTR
No VIP available CA VA
rs4413407 *118T>C, 105393361A>G, 29941082A>G
A > G
3' UTR
No VIP available CA VA
rs442767 -1188C>A, 237+713G>T, 30545855G>T, 4305C>A, 6203G>T, 79951496G>T
G > T
5' Flanking
No VIP available No Clinical Annotations available VA
rs4492666 171+1057A>C, 17772763A>C, 320+1057A>C, 47800845A>C
A > C
No VIP available No Clinical Annotations available VA
rs451774 *606A>G, *851A>G, 24754A>G, 28442550A>G, 28502550A>G
A > G
3' UTR
No VIP available CA VA
rs4541111 1060-77G>T, 28203G>T, 28808690C>A, 63534538C>A
C > A
No VIP available No Clinical Annotations available VA
rs45445694 *34+169_*34+196CGGGACGGAGGCAGGCCAAGTGGCGCGG[2][3][4][7][8][9], -97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], 2, 28-bp tandem repeats located in the TS enhancer region of 5'UTR, 5043_5070CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], 657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], TYMS:*2
5' UTR
No VIP available No Clinical Annotations available VA
rs4742 108363409A>C, 108363409A>G, 108363409A>T, 183815688A>C, 183815688A>G, 183815688A>T, 315T>A, 315T>C, 315T>G, 348T>A, 348T>C, 348T>G, DCTD:315T>C, V105V, V116V, Val105=, Val116=, mRNA 489T>C, mRNA 512T>C
A > T
A > C
A > G
No VIP available No Clinical Annotations available VA
rs487989 10370485G>A, 1747G>A, 65064690G>A, G583R, Gly583Arg, POLA2:2089G>A
G > A
No VIP available CA VA
rs518329 14592T>C, 21576998T>C, 23695236T>C, 476+2013T>C
T > C
No VIP available CA VA
rs61734430 17155925C>T, 292C>T, 71850130C>T, 8360C>T, Arg98Cys
C > T
No VIP available No Clinical Annotations available VA
rs62107593 -1923G>C, -1979G>C, -2072G>C, 13061144C>G, 3340G>C, 40792926C>G
C > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs712829 -216G>T, 216G>T, 4676124G>T, 5031G>T, 55086755G>T, EGFR:-216G>T
G > T
5' UTR
No VIP available No Clinical Annotations available VA
rs717620 -24C>T, 101542578C>T, 5116C>T, 52347042C>T, ABCC2: 5'UTR, ABCC2:(-24)C>T, mRNA 118C>T
C > T
5' UTR
No VIP available No Clinical Annotations available VA
rs720106 29055T>C, 4079978T>C, 4139978T>C, 792+287T>C
T > C
No VIP available No Clinical Annotations available VA
rs725518 17922G>A, 387+80G>A, 4068845G>A, 4128845G>A
G > A
No VIP available No Clinical Annotations available VA
rs726501 21967G>A, 482+15984G>A, 56127866G>A, 6722225G>A
G > A
No VIP available No Clinical Annotations available VA
rs74090038 -1041G>A, -1125G>A, 105262781C>T, 4300G>A, 86262781C>T
C > T
5' Flanking
No VIP available No Clinical Annotations available VA
rs763110 -157-687T>C, 172627498C>C, 24116140C>C, 4314C>C
C > T
5' Flanking
No VIP available No Clinical Annotations available VA
rs776746 -229-237G>A, -253-1G>A, -254A=, -254A>G, -254G>A, -331-237G>A, -357-1G>A, -463-1G>A, -571-1G>A, 12083G>A, 1466+48736C>T, 189-237G>A, 219-237G>A, 321-1G>A, 344-237G>A, 581-237G>A, 689-1G>A, 717-1G>A, 806-4288C>T, 99270539C>T, 99672916T=, 99672916T>C, CYP3A5*1, CYP3A5*3, CYP3A5*3C, CYP3A5:6986A>G, g.6986A>G, intron 3 splicing defect, rs776746 A>G
T > C
No VIP available CA VA
rs7779029 103+13883A>G, 18564955T>C, 80532112T>C
T > C
No VIP available CA VA
rs7851395 -35-15930A>G, 116002464A>G, 45166996A>G
A > G
No VIP available CA VA
rs7921977 -1+461C>T, -169C>T, -177C>T, -243C>T, 115439569C>T, 56C>T, 66244033C>T, Thr19Ile
C > T
No VIP available No Clinical Annotations available VA
rs7940013 27381C>T, 4078304C>T, 4138304C>T, 651-1246C>T
C > T
No VIP available No Clinical Annotations available VA
rs8175347 233760235_233760236TA[5][6][7][8], 5-TA insertion in promoter, 7-TA insertion in promoter, 8-TA insertion in promoter, UGT1A1*28, UGT1A1*36, UGT1A1*37, microsatellite, short tandem repeat
(TA)6 > (TA)8
(TA)6 > (TA)5
(TA)6 > (TA)7
Not Available
No VIP available No Clinical Annotations available VA
rs8187710 101611294G>A, 4544G>A, 52415758G>A, 73832G>A, ABCC2 rs8187710, Cys1515Tyr, MRP2 Cys1515Tyr
G > A
No VIP available No Clinical Annotations available VA
rs8187758 414402C>A, 709C>A, 85448875C>A, Gln237Lys
C > A
No VIP available No Clinical Annotations available VA
rs861539 104165753G>A, 1651-1239G>A, 1782-1239G>A, 21071C>T, 722C>T, 75229G>A, 85165753G>A, Thr241Met
G > A
No VIP available CA VA
rs870995 -76-3532C>A, 178913006C>A, 51696C>A, 85408152C>A
C > A
No VIP available CA VA
rs914232 14636A>G, 190-688A>G, 3947191T>C, 46952750T>C, 70-688A>G
T > C
No VIP available CA VA
rs9597 *157C>G, 1314951C>G, 1374951C>G
C > G
3' UTR
No VIP available No Clinical Annotations available VA
rs9937 2223A>G, 4099457A>G, 4159457A>G, 48534A>G, RRM1:2455A>G, Thr741=, rs3177016
A > G
No VIP available CA VA
rs9981861 27076915T>C, 41415044T>C, 5384-444A>G, 5645-444A>G
T > C
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 144


Alternate Names: 
Carcinoma, Non Small Cell Lung; Carcinoma, Non-Small Cell Lung; Carcinomas, Non-Small-Cell Lung; Lung Carcinoma, Non-Small-Cell; Lung Carcinomas, Non-Small-Cell; Non Small Cell Lung Carcinoma; Non-Small-Cell Lung Carcinoma; Non-Small-Cell Lung Carcinomas; Non-small cell lung cancer
PharmGKB Accession Id: PA443622
External Vocabularies

Curated Information ?

Curated Information ?

Relationships from National Drug File - Reference Terminology (NDF-RT)

May Treat
No related diseases are available

Publications related to Carcinoma, Non-Small-Cell Lung: 156

No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Wnt signaling pathway pharmacogenetics in non-small cell lung cancer. The pharmacogenomics journal. 2014. Stewart D J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetics of the DNA repair pathways in advanced non-small cell lung cancer patients treated with platinum-based chemotherapy. Cancer letters. 2014. Sullivan Ivana, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetics of pemetrexed combination therapy in lung cancer: pathway analysis reveals novel toxicity associations. The pharmacogenomics journal. 2014. Corrigan A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of solute carrier transporters in pancreatic cancer: a review. Pharmacogenomics. 2014. Lemstrová Radmila, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenomic assessment of cisplatin-based chemotherapy outcomes in ovarian cancer. Pharmacogenomics. 2014. Khrunin Andrey V, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetics of DNA repair gene polymorphisms in non-small-cell lung carcinoma patients on platinum-based chemotherapy. Genetics and molecular research : GMR. 2014. Zhang L, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Multi-loci analysis reveals the importance of genetic variations in sensitivity of platinum-based chemotherapy in non-small-cell lung cancer. Molecular carcinogenesis. 2013. Liu Li, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
ERCC1 Cys8092Ala and XRCC1 Arg399Gln polymorphisms predict progression-free survival after curative radiotherapy for nasopharyngeal carcinoma. PloS one. 2014. Jin Hekun, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Oxidative stress-related genetic polymorphisms are associated with the prognosis of metastatic gastric cancer patients treated with epirubicin, oxaliplatin and 5-Fluorouracil combination chemotherapy. PloS one. 2014. Geng Ruixuan, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
ERCC1 C8092A (rs3212986) polymorphism as a predictive marker in esophageal cancer patients treated with cisplatin/5-FU-based neoadjuvant therapy. Pharmacogenetics and genomics. 2013. Rumiato Enrica, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
PharmGKB summary: very important pharmacogene information for the epidermal growth factor receptor. Pharmacogenetics and genomics. 2013. Hodoglugil Ugur, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Intergenic polymorphisms in the amphiregulin gene region as biomarkers in metastatic colorectal cancer patients treated with anti-EGFR plus irinotecan. The pharmacogenomics journal. 2013. Sebio A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenomic assessment of outcomes of pemetrexed-treated patients with adenocarcinoma of the lung. Yonsei medical journal. 2013. Jung Minkyu, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
XBP1 promoter polymorphism modulates platinum-based chemotherapy gastrointestinal toxicity for advanced non-small cell lung cancer patients. Lung cancer (Amsterdam, Netherlands). 2013. Peng J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Implications of Genome-Wide Association Studies in Cancer Therapeutics. British journal of clinical pharmacology. 2013. Patel Jai N, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
A phase I/II pharmacokinetic and pharmacogenomic study of calcitriol in combination with cisplatin and docetaxel in advanced non-small-cell lung cancer. Cancer chemotherapy and pharmacology. 2013. Ramnath N, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Challenges in pharmacogenetics. European journal of clinical pharmacology. 2013. Cascorbi Ingolf, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DNA repair and cytotoxic drugs: the potential role of RAD51 in clinical outcome of non-small-cell lung cancer patients. Pharmacogenomics. 2013. Nogueira Augusto, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Association between eIF3alpha polymorphism and severe toxicity caused by platinum-based chemotherapy in non-small cell lung cancer patients. British journal of clinical pharmacology. 2013. Xu Xiaojing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The A/G allele of eIF3a rs3740556 predicts platinum-based chemotherapy resistance in lung cancer patients. Lung cancer (Amsterdam, Netherlands). 2013. Xu Xiaojing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
XRCC3 Thr241Met polymorphism and clinical outcomes of NSCLC patients receiving platinum-based chemotherapy: a systematic review and meta-analysis. PloS one. 2013. Shen Xiao-yong, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Impact of Systematic EGFR and KRAS Mutation Evaluation on Progression-Free Survival and Overall Survival in Patients with Advanced Non-Small-Cell Lung Cancer Treated by Erlotinib in a French Prospective Cohort (ERMETIC Project-Part 2). Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2012. Cadranel Jacques, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of CASP7 polymorphisms and survival of patients with non-small cell lung cancer with platinum-based chemotherapy treatment. Chest. 2012. Qian Ji, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Efficacy of EGFR tyrosine kinase inhibitors for non-adenocarcinoma NSCLC patients with EGFR mutation. Cancer chemotherapy and pharmacology. 2012. Cho Su-Hee, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics and pharmacogenomics: role of mutational analysis in anti-cancer targeted therapy. The pharmacogenomics journal. 2012. Savonarola A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
An intronic polymorphism in GRP78 improves chemotherapeutic prediction in non-small cell lung cancer. Chest. 2012. Zhu Xiao, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic polymorphism of copper transporter protein 1 is related to platinum resistance in Chinese non-small cell lung carcinoma patients. Clinical and experimental pharmacology & physiology. 2012. Xu Xiaojing, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A genome-wide association study for irinotecan-related severe toxicities in patients with advanced non-small-cell lung cancer. The pharmacogenomics journal. 2012. Han J-Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Associations Between ABCC2 Polymorphisms and Cisplatin Disposition and Efficacy. Clinical pharmacology and therapeutics. 2012. Sprowl J A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ROS1 as a 'druggable' receptor tyrosine kinase: lessons learned from inhibiting the ALK pathway. Expert review of anticancer therapy. 2012. Ou Sai-Hong Ignatius, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
First-SIGNAL: first-line single-agent iressa versus gemcitabine and cisplatin trial in never-smokers with adenocarcinoma of the lung. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2012. Han Ji-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Prediction of copper transport protein 1 (CTR1) genotype on severe cisplatin induced toxicity in non-small cell lung cancer (NSCLC) patients. Lung cancer (Amsterdam, Netherlands). 2012. Xu Xiaojing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Association of ABCB1 polymorphisms with erlotinib pharmacokinetics and toxicity in Japanese patients with non-small-cell lung cancer. Pharmacogenomics. 2012. Hamada Akinobu, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Plasma epidermal growth factor receptor mutation analysis and possible clinical applications in pulmonary adenocarcinoma patients treated with erlotinib. Oncology letters. 2012. Chen Yuh-Min, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association between polymorphisms of ERCC1 and survival in epithelial ovarian cancer patients with chemotherapy. Pharmacogenomics. 2012. Yan Li, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Erlotinib versus standard chemotherapy as first-line treatment for European patients with advanced EGFR mutation-positive non-small-cell lung cancer (EURTAC): a multicentre, open-label, randomised phase 3 trial. The lancet oncology. 2012. Rosell Rafael, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pretreatment epidermal growth factor receptor (EGFR) T790M mutation predicts shorter EGFR tyrosine kinase inhibitor response duration in patients with non-small-cell lung cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2012. Su Kang-Yi, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic analysis of BR.21, a placebo-controlled randomized phase III clinical trial of erlotinib in advanced non-small cell lung cancer. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2012. Liu Geoffrey, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Epidermal growth factor receptor mutation status in circulating free DNA in serum: from IPASS, a phase III study of gefitinib or carboplatin/paclitaxel in non-small cell lung cancer. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2012. Goto Koichi, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenomics of cisplatin-based chemotherapy in ovarian cancer patients of different ethnic origins. Pharmacogenomics. 2012. Khrunin Andrey, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variants in the PI3K/PTEN/AKT/mTOR pathway predict platinum-based chemotherapy response of advanced non-small cell lung cancers in a Chinese population. Asian Pacific journal of cancer prevention : APJCP. 2012. Xu Jia-Li, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Two minor NQO1 and NQO2 alleles predict poor response of breast cancer patients to adjuvant doxorubicin and cyclophosphamide therapy. Pharmacogenetics and genomics. 2011. Jamieson David, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association between DNA-repair polymorphisms and survival in pancreatic cancer patients treated with combination chemotherapy. Pharmacogenomics. 2011. Giovannetti Elisa, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Meta-analysis on pharmacogenetics of platinum-based chemotherapy in non small cell lung cancer (NSCLC) patients. PloS one. 2012. Yin Ji-Ye, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Quality of life with gefitinib in patients with EGFR-mutated non-small cell lung cancer: quality of life analysis of North East Japan Study Group 002 Trial. The oncologist. 2012. Oizumi Satoshi, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic predictors for EGFR-inhibitor-associated skin toxicity. The pharmacogenomics journal. 2011. Parmar S, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Prospective molecular marker analyses of EGFR and KRAS from a randomized, placebo-controlled study of erlotinib maintenance therapy in advanced non-small-cell lung cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2011. Brugger Wolfram, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A noninvasive system for monitoring resistance to epidermal growth factor receptor tyrosine kinase inhibitors with plasma DNA. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2011. Nakamura Tomomi, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic analyses of cisplatin-induced nephrotoxicity indicate a renoprotective effect of ERCC1 polymorphisms. Pharmacogenomics. 2011. Tzvetkov Mladen V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Differential effect of polymorphisms of CMPK1 and RRM1 on survival in advanced non-small cell lung cancer patients treated with gemcitabine or taxane/cisplatinum. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2011. Ryu Jeong-Seon, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Erlotinib versus chemotherapy as first-line treatment for patients with advanced EGFR mutation-positive non-small-cell lung cancer (OPTIMAL, CTONG-0802): a multicentre, open-label, randomised, phase 3 study. The lancet oncology. 2011. Zhou Caicun, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Interstitial lung disease in gefitinib-treated Japanese patients with non-small-cell lung cancer: genome-wide analysis of genetic data. Pharmacogenomics. 2011. Nyberg Fredrik, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genetic variations in multiple drug action pathways and survival in advanced stage non-small cell lung cancer treated with chemotherapy. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Li Yafei, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The NQO1*2/*2 polymorphism is associated with poor overall survival in patients following resection of stages II and IIIa non-small cell lung cancer. Oncology reports. 2011. Kolesar Jill M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Influence of polymorphisms in MTHFR 677 C¿T, TYMS 3R¿2R and MTR 2756 A¿G on NSCLC risk and response to platinum-based chemotherapy in advanced NSCLC. Pharmacogenomics. 2011. Cui Lian-Hua, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pretreatment EGFR T790M mutation and BRCA1 mRNA expression in erlotinib-treated advanced non-small-cell lung cancer patients with EGFR mutations. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Rosell Rafael, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Rebiopsy of lung cancer patients with acquired resistance to EGFR inhibitors and enhanced detection of the T790M mutation using a locked nucleic acid-based assay. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Arcila Maria E, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genotypic and histological evolution of lung cancers acquiring resistance to EGFR inhibitors. Science translational medicine. 2011. Sequist Lecia V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Copy number variants in pharmacogenetic genes. Trends in molecular medicine. 2011. He Yijing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Functional EGFR germline polymorphisms may confer risk for EGFR somatic mutations in non-small cell lung cancer, with a predominant effect on exon 19 microdeletions. Cancer research. 2011. Liu Wanqing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Impact of ABCG2 polymorphisms on the clinical outcome and toxicity of gefitinib in non-small-cell lung cancer patients. Pharmacogenomics. 2011. Lemos Clara, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genome-wide association study on overall survival of advanced non-small cell lung cancer patients treated with carboplatin and paclitaxel. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2011. Sato Yasunori, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
PI3K/PTEN/AKT/mTOR pathway genetic variation predicts toxicity and distant progression in lung cancer patients receiving platinum-based chemotherapy. Lung cancer (Amsterdam, Netherlands). 2011. Pu Xia, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Multiple genetic polymorphisms in the prediction of clinical outcome of metastatic colorectal cancer patients treated with first-line FOLFOX-4 chemotherapy. Pharmacogenetics and genomics. 2011. Huang Ming-Yii, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Practical recommendations for pharmacogenomics-based prescription: 2010 ESF-UB Conference on Pharmacogenetics and Pharmacogenomics. Pharmacogenomics. 2011. Becquemont Laurent, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Use of epidermal growth factor receptor mutation analysis in patients with advanced non-small-cell lung cancer to determine erlotinib use as first-line therapy. PLoS currents. 2011. Ishibe Naoko, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC19A1 pharmacogenomics summary. Pharmacogenetics and genomics. 2010. Yee Sook Wah, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Systematic review of pharmacoeconomic studies of pharmacogenomic tests. Pharmacogenomics. 2010. Beaulieu Mathieu, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic predictors of adverse events and response to chemotherapy in metastatic colorectal cancer: results from North American Gastrointestinal Intergroup Trial N9741. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2010. McLeod Howard L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Blood-based CHRNA3 single nucleotide polymorphism and outcome in advanced non-small-cell lung cancer patients. Lung cancer (Amsterdam, Netherlands). 2010. Carcereny Enric, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Gefitinib or chemotherapy for non-small-cell lung cancer with mutated EGFR. The New England journal of medicine. 2010. Maemondo Makoto, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Expression of gemcitabine- and cisplatin-related genes in non-small-cell lung cancer. The pharmacogenomics journal. 2010. Toffalorio F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Targeted cancer therapies in the twenty-first century: lessons from imatinib. Clinical pharmacology and therapeutics. 2010. Stegmeier F, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Acquired resistance to gefitinib: the contribution of mechanisms other than the T790M, MET, and HGF status. Lung cancer (Amsterdam, Netherlands). 2010. Onitsuka Takamitsu, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of SUMO1 and UBC9 genotypes with tumor response in non-small-cell lung cancer treated with irinotecan-based chemotherapy. The pharmacogenomics journal. 2010. Han Ji-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Predictors of gefitinib outcomes in advanced non-small cell lung cancer (NSCLC): study of a comprehensive panel of molecular markers. Lung cancer (Amsterdam, Netherlands). 2010. Tiseo Marcello, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Molecular predictors of outcome with gefitinib and docetaxel in previously treated non-small-cell lung cancer: data from the randomized phase III INTEREST trial. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2010. Douillard Jean-Yves, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Gefitinib versus cisplatin plus docetaxel in patients with non-small-cell lung cancer harbouring mutations of the epidermal growth factor receptor (WJTOG3405): an open label, randomised phase 3 trial. The lancet oncology. 2010. Mitsudomi Tetsuya, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms and the efficacy and toxicity of cisplatin-based chemotherapy in ovarian cancer patients. The pharmacogenomics journal. 2010. Khrunin A V, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SNPs in genes coding for ROS metabolism and signalling in association with docetaxel clearance. The pharmacogenomics journal. 2010. Edvardsen H, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Preexistence and clonal selection of MET amplification in EGFR mutant NSCLC. Cancer cell. 2010. Turke Alexa B, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
RRM1 single nucleotide polymorphism -37C-->A correlates with progression-free survival in NSCLC patients after gemcitabine-based chemotherapy. Journal of hematology & oncology. 2010. Dong Song, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Clinicopathologic and molecular features of epidermal growth factor receptor T790M mutation and c-MET amplification in tyrosine kinase inhibitor-resistant Chinese non-small cell lung cancer. Pathology oncology research : POR. 2009. Chen Hua-Jun, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphisms of EGFR predict clinical outcome in advanced non-small-cell lung cancer patients treated with Gefitinib. Lung cancer (Amsterdam, Netherlands). 2009. Ma Fei, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Gefitinib or carboplatin-paclitaxel in pulmonary adenocarcinoma. The New England journal of medicine. 2009. Mok Tony S, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Screening for epidermal growth factor receptor mutations in lung cancer. The New England journal of medicine. 2009. Rosell Rafael, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Cisplatin pharmacogenetics, DNA repair polymorphisms, and esophageal cancer outcomes. Pharmacogenetics and genomics. 2009. Bradbury Penelope A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Prospective phase II study of gefitinib in non-small cell lung cancer with epidermal growth factor receptor gene mutations. Lung cancer (Amsterdam, Netherlands). 2009. Sugio Kenji, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms affecting clinical outcomes in epithelial ovarian cancer patients treated with taxanes and platinum compounds: a Korean population-based study. Gynecologic oncology. 2009. Kim Hee Seung, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Randomized phase II and pharmacogenetic study of pemetrexed compared with pemetrexed plus carboplatin in pretreated patients with advanced non-small-cell lung cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2009. Smit Egbert F, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
DNA repair gene polymorphisms predict favorable clinical outcome in advanced non-small-cell lung cancer. Clinical lung cancer. 2009. Kalikaki Aristea, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Distribution of gemcitabine pathway genotypes in ethnic Asians and their association with outcome in non-small cell lung cancer patients. Lung cancer (Amsterdam, Netherlands). 2009. Soo Ross A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Integrated pharmacogenetic prediction of irinotecan pharmacokinetics and toxicity in patients with advanced non-small cell lung cancer. Lung cancer (Amsterdam, Netherlands). 2009. Han Ji-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Resistance gene expression determines the in vitro chemosensitivity of non-small cell lung cancer (NSCLC). BMC cancer. 2009. Glaysher Sharon, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Effects of erlotinib in EGFR mutated non-small cell lung cancers with resistance to gefitinib. Clinical cancer research : an official journal of the American Association for Cancer Research. 2008. Costa Daniel B, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
NAD(P)H:quinone oxidoreductase 1 NQO1*2 genotype (P187S) is a strong prognostic and predictive factor in breast cancer. Nature genetics. 2008. Fagerholm Rainer, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Detection of mutations in EGFR in circulating lung-cancer cells. The New England journal of medicine. 2008. Maheswaran Shyamala, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Correlation between cytidine deaminase genotype and gemcitabine deamination in blood samples. Nucleosides, nucleotides & nucleic acids. 2008. Giovannetti E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Efficacy of gemcitabine in patients with non-small cell lung cancer according to promoter polymorphisms of the ribonucleotide reductase M1 gene. Clinical cancer research : an official journal of the American Association for Cancer Research. 2008. Kim Soo-Ok, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
First-line gefitinib in patients with advanced non-small-cell lung cancer harboring somatic EGFR mutations. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2008. Sequist Lecia V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The CYP2A6*4 allele is determinant of S-1 pharmacokinetics in Japanese patients with non-small-cell lung cancer. Clinical pharmacology and therapeutics. 2008. Kaida Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Tumor suppressor FUS1 signaling pathway. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2008. Ji Lin, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Epidermal growth factor receptor polymorphisms and clinical outcomes in non-small-cell lung cancer patients treated with gefitinib. The pharmacogenomics journal. 2008. Liu G, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Correlation of CDA, ERCC1, and XPD polymorphisms with response and survival in gemcitabine/cisplatin-treated advanced non-small cell lung cancer patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2008. Tibaldi Carmelo, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Molecular characteristics of bronchioloalveolar carcinoma and adenocarcinoma, bronchioloalveolar carcinoma subtype, predict response to erlotinib. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2008. Miller Vincent A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomic and pharmacokinetic determinants of erlotinib toxicity. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2008. Rudin Charles M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Enhancement of antitumor activity of cisplatin in human lung cancer cells by tumor suppressor FUS1. Cancer gene therapy. 2008. Deng W-G, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Loss and reduction of FUS1 protein expression is a frequent phenomenon in the pathogenesis of lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2008. Prudkin Ludmila, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
MET amplification occurs with or without T790M mutations in EGFR mutant lung tumors with acquired resistance to gefitinib or erlotinib. Proceedings of the National Academy of Sciences of the United States of America. 2007. Bean James, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Relationship of EGFR mutations, expression, amplification, and polymorphisms to epidermal growth factor receptor inhibitors in the NCI60 cell lines. Clinical cancer research : an official journal of the American Association for Cancer Research. 2007. Liu Wanqing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Efficacy and safety of single-agent pertuzumab, a human epidermal receptor dimerization inhibitor, in patients with non small cell lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2007. Herbst Roy S, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The epidermal growth factor receptor intron1 (CA) n microsatellite polymorphism is a potential predictor of treatment outcome in patients with advanced lung cancer treated with Gefitinib. European journal of pharmacology. 2007. Nie Qiang, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Epidermal growth factor receptor mutations and their correlation with gefitinib therapy in patients with non-small cell lung cancer: a meta-analysis based on updated individual patient data from six medical centers in mainland China. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2007. Wu Yi-Long, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Intron 1 CA dinucleotide repeat polymorphism and mutations of epidermal growth factor receptor and gefitinib responsiveness in non-small-cell lung cancer. Pharmacogenetics and genomics. 2007. Han Sae-Won, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MET amplification leads to gefitinib resistance in lung cancer by activating ERBB3 signaling. Science (New York, N.Y.). 2007. Engelman Jeffrey A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Combination of EGFR gene copy number and protein expression predicts outcome for advanced non-small-cell lung cancer patients treated with gefitinib. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO. 2007. Hirsch F R, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Predictive factors associated with prolonged survival in patients with advanced non-small-cell lung cancer (NSCLC) treated with gefitinib. British journal of cancer. 2007. Satouchi M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic profiling in patients with advanced colorectal cancer treated with first-line FOLFOX-4 chemotherapy. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2007. Ruzzo Annamaria, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The impact of epidermal growth factor receptor gene status on gefitinib-treated Japanese patients with non-small-cell lung cancer. International journal of cancer. Journal international du cancer. 2007. Ichihara Shuji, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Synergistic tumor suppression by coexpression of FUS1 and p53 is associated with down-regulation of murine double minute-2 and activation of the apoptotic protease-activating factor 1-dependent apoptotic pathway in human non-small cell lung cancer cells. Cancer research. 2007. Deng Wu-Guo, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Response to treatment and survival of patients with non-small cell lung cancer undergoing somatic EGFR mutation testing. The oncologist. 2007. Sequist Lecia V, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Gefitinib for non-small-cell lung cancer patients with epidermal growth factor receptor gene mutations screened by peptide nucleic acid-locked nucleic acid PCR clamp. British journal of cancer. 2006. Sutani A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
XRCC1 R399Q polymorphism is associated with response to platinum-based neoadjuvant chemotherapy in bulky cervical cancer. Gynecologic oncology. 2006. Chung Hyun Hoon, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of ABCG2 and adverse reactions to gefitinib. Journal of the National Cancer Institute. 2006. Cusatis George, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Novel D761Y and common secondary T790M mutations in epidermal growth factor receptor-mutant lung adenocarcinomas with acquired resistance to kinase inhibitors. Clinical cancer research : an official journal of the American Association for Cancer Research. 2006. Balak Marissa N, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A phase II study of irinotecan and carboplatin in advanced non-small cell lung cancer with pharmacogenomic analysis: final report. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2006. Pillot Giancarlo A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Clinical predictors versus epidermal growth factor receptor mutation in gefitinib-treated non-small-cell lung cancer patients. Lung cancer (Amsterdam, Netherlands). 2006. Han Sae-Won, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Novel heteroduplex method using small cytology specimens with a remarkably high success rate for analysing EGFR gene mutations with a significant correlation to gefitinib efficacy in non-small-cell lung cancer. British journal of cancer. 2006. Oshita F, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Analysis of epidermal growth factor receptor gene mutation in patients with non-small cell lung cancer and acquired resistance to gefitinib. Clinical cancer research : an official journal of the American Association for Cancer Research. 2006. Kosaka Takayuki, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Glutathione-S-transferase P1 isoenzyme polymorphisms, platinum-based chemotherapy, and non-small cell lung cancer. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2006. Booton Richard, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Evaluation of the epidermal growth factor receptor gene mutation and copy number in non-small cell lung cancer with gefitinib therapy. Oncology reports. 2006. Endo Katsuhiko, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DNA repair by ERCC1 in non-small-cell lung cancer and cisplatin-based adjuvant chemotherapy. The New England journal of medicine. 2006. Olaussen Ken A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Presence of epidermal growth factor receptor gene T790M mutation as a minor clone in non-small cell lung cancer. Cancer research. 2006. Inukai Michio, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Impact of the haplotype CYP3A4*16B harboring the Thr185Ser substitution on paclitaxel metabolism in Japanese patients with cancer. Clinical pharmacology and therapeutics. 2006. Nakajima Yukiko, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Cyclin D1 and epidermal growth factor polymorphisms associated with survival in patients with advanced colorectal cancer treated with Cetuximab. Pharmacogenetics and genomics. 2006. Zhang Wu, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Glutathione S-transferase P1 polymorphism (Ile105Val) predicts cumulative neuropathy in patients receiving oxaliplatin-based chemotherapy. Clinical cancer research : an official journal of the American Association for Cancer Research. 2006. Lecomte Thierry, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Comprehensive analysis of UGT1A polymorphisms predictive for pharmacokinetics and treatment outcome in patients with non-small-cell lung cancer treated with irinotecan and cisplatin. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2006. Han Ji-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Inherited susceptibility to lung cancer may be associated with the T790M drug resistance mutation in EGFR. Nature genetics. 2005. Bell Daphne W, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Epidermal growth factor receptor mutations and gene amplification in non-small-cell lung cancer: molecular analysis of the IDEAL/INTACT gefitinib trials. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2005. Bell Daphne W, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Clinicopathologic significance of the mutations of the epidermal growth factor receptor gene in patients with non-small cell lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2005. Tomizawa Yoshio, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Mutations in the epidermal growth factor receptor and in KRAS are predictive and prognostic indicators in patients with non-small-cell lung cancer treated with chemotherapy alone and in combination with erlotinib. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2005. Eberhard David A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
cN-II expression predicts survival in patients receiving gemcitabine for advanced non-small cell lung cancer. Lung cancer (Amsterdam, Netherlands). 2005. Sève Pascal, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Activating mutations in the tyrosine kinase domain of the epidermal growth factor receptor are associated with improved survival in gefitinib-treated chemorefractory lung adenocarcinomas. Clinical cancer research : an official journal of the American Association for Cancer Research. 2005. Taron Miguel, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Mutation in the tyrosine kinase domain of epidermal growth factor receptor is a predictive and prognostic factor for gefitinib treatment in patients with non-small cell lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2005. Chou Teh-Ying, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Overexpression of the aldo-keto reductase family protein AKR1B10 is highly correlated with smokers' non-small cell lung carcinomas. Clinical cancer research : an official journal of the American Association for Cancer Research. 2005. Fukumoto Shin-ichi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Ribonucleotide reductase M1 gene promoter activity, polymorphisms, population frequencies, and clinical relevance. Lung cancer (Amsterdam, Netherlands). 2005. Bepler Gerold, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Determinants of sensitivity and resistance to gemcitabine: the roles of human equilibrative nucleoside transporter 1 and deoxycytidine kinase in non-small cell lung cancer. Cancer science. 2004. Achiwa Hiroyuki, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A multivariate analysis of genomic polymorphisms: prediction of clinical outcome to 5-FU/oxaliplatin combination chemotherapy in refractory colorectal cancer. British journal of cancer. 2004. Stoehlmacher J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
XPD and XRCC1 genetic polymorphisms are prognostic factors in advanced non-small-cell lung cancer patients treated with platinum chemotherapy. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2004. Gurubhagavatula Sarada, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy. Science (New York, N.Y.). 2004. Paez J Guillermo, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. The New England journal of medicine. 2004. Lynch Thomas J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Ribonucleotide reductase messenger RNA expression and survival in gemcitabine/cisplatin-treated advanced non-small cell lung cancer patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2004. Rosell Rafael, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Overexpression of candidate tumor suppressor gene FUS1 isolated from the 3p21.3 homozygous deletion region leads to G1 arrest and growth inhibition of lung cancer cells. Oncogene. 2001. Kondo M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Rapid polyubiquitination and proteasomal degradation of a mutant form of NAD(P)H:quinone oxidoreductase 1. Molecular pharmacology. 2001. Siegel D, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genotype-phenotype relationships in studies of a polymorphism in NAD(P)H:quinone oxidoreductase 1. Pharmacogenetics. 1999. Siegel D, et al. PubMed