Carcinoma, Non-Small-Cell Lung

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Gene ? Variant?
Alternate Names ? Chemicals ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
No VIP available No VIP available VA ABCB1 *2 (PMID: 11503014) N/A N/A N/A
No VIP available No VIP available No VIP available CYP2A6 *4C N/A N/A N/A
No VIP available CA VA CYP2D6 *1 N/A N/A N/A
No VIP available CA VA CYP2D6 *2 N/A N/A N/A
No VIP available CA No VIP available CYP2D6 *3 N/A N/A N/A
No VIP available CA No VIP available CYP2D6 *4 N/A N/A N/A
No VIP available CA No VIP available CYP2D6 *4xN N/A N/A N/A
No VIP available CA VA CYP2D6 *5 N/A N/A N/A
No VIP available CA No VIP available CYP2D6 *6 N/A N/A N/A
No VIP available CA VA CYP2D6 *10 N/A N/A N/A
No VIP available CA VA CYP2D6 *14 N/A N/A N/A
No VIP available No VIP available VA CYP2D6 *14A N/A N/A N/A
No VIP available No VIP available No VIP available CYP2D6 *36 N/A N/A N/A
No VIP available CA No VIP available CYP2D6 *41 N/A N/A N/A
No VIP available No VIP available VA CYP3A4 *1 N/A N/A N/A
No VIP available No VIP available VA CYP3A4 *1G N/A N/A N/A
No VIP available No VIP available VA CYP3A5 *1A N/A N/A N/A
No VIP available No VIP available VA CYP3A5 *3A N/A N/A N/A
No VIP available No VIP available No VIP available GSTM1 non-null N/A N/A N/A
No VIP available No VIP available No VIP available GSTM1 null N/A N/A N/A
No VIP available No Clinical Annotations available VA
rs1042858 NC_000011.10:g.4138236G>A, NC_000011.9:g.4159466G>A, NG_027992.2:g.48543G>A, NM_001033.3:c.2232G>A, NM_001033.4:c.2232G>A, NM_001318064.1:c.1941G>A, NM_001318065.1:c.1218G>A, NP_001024.1:p.Ala744=, NP_001304993.1:p.Ala647=, NP_001304994.1:p.Ala406=, XM_005253058.1:c.1989G>A, XM_005253059.1:c.1941G>A, XM_011520277.1:c.1941G>A, XM_011520278.1:c.1566G>A, XM_011520279.1:c.1218G>A, XP_005253115.1:p.Ala663=, XP_005253116.1:p.Ala647=, XP_011518579.1:p.Ala647=, XP_011518580.1:p.Ala522=, XP_011518581.1:p.Ala406=, rs17850107, rs2229195, rs2584873, rs3168060, rs57259172
G > A
No VIP available No Clinical Annotations available VA
rs1044457 NC_000001.10:g.47842777C>T, NC_000001.11:g.47377105C>T, NM_001136140.1:c.*360C>T, NM_016308.2:c.*360C>T, NR_046394.1:n.1119C>T, rs17378832, rs3184215, rs3767626
C > -
C > T
No VIP available CA VA
rs1045642 NC_000007.13:g.87138645A>G, NC_000007.14:g.87509329A>G, NG_011513.1:g.208920T>C, NM_000927.4:c.3435T>C, NP_000918.2:p.Ile1145=, rs10239679, rs11568726, rs117328163, rs17210003, rs2229108, rs386513066, rs60023214, rs9690664
A > G
No VIP available No Clinical Annotations available VA
rs1047768 NC_000013.10:g.103504517T>C, NC_000013.11:g.102852167T>C, NG_007146.1:g.11344T>C, NM_000123.3:c.138T>C, NM_001204425.1:c.1500T>C, NP_000114.2:p.His46=, NP_001191354.1:p.His500=, XR_243039.1:n.564T>C, rs17260800, rs17845958, rs17858940, rs2227868, rs2266745, rs3187785, rs4150265
T > C
No VIP available No Clinical Annotations available VA
rs1048977 NC_000001.10:g.20945055C>T, NC_000001.11:g.20618562C>T, NM_001785.2:c.435C>T, NP_001776.1:p.Thr145=, rs17846527, rs17859600, rs3189038, rs57498302
C > T
No VIP available CA VA
rs10510050 NC_000010.10:g.120626562A>G, NC_000010.11:g.118867050A>G, XR_946355.1:n.-742T>C, rs17665375, rs56784207
A > G
No VIP available CA VA
rs1051298 NC_000021.8:g.46934826G>A, NC_000021.9:g.45514912G>A, NG_011903.1:g.114721G>A, NG_028278.1:g.32560C>T, NM_001205206.1:c.*64C>T, NM_001205207.1:c.*746C>T, NM_194255.2:c.*746C>T, XM_005261163.1:c.*746C>T, XM_005261164.1:c.*746C>T, XM_005261164.2:c.*746C>T, XM_011529696.1:c.*746C>T, XM_011529697.1:c.*746C>T, XM_011529698.1:c.*746C>T, XM_011529699.1:c.*746C>T, XM_011529700.1:c.*746C>T, XM_011529701.1:c.*746C>T, XM_011529702.1:c.*746C>T, XM_011529703.1:c.*746C>T, XM_011529704.1:c.*746C>T, XM_011529705.1:c.*64C>T, XM_011529706.1:c.*746C>T, XM_011529707.1:c.1584+10905C>T, XM_011529708.1:c.*746C>T, XM_011529709.1:c.*746C>T, XM_011529710.1:c.*746C>T, rs3178001
G > A
No VIP available CA VA
rs1052555 NC_000019.10:g.45352266G>A, NC_000019.9:g.45855524G>A, NG_007067.2:g.23322C>T, NM_000400.3:c.2133C>T, NP_000391.1:p.Asp711=, XM_005258639.1:c.2061C>T, XM_005258640.1:c.1899C>T, XM_005258641.1:c.1395C>T, XM_011526611.1:c.2055C>T, XP_005258696.1:p.Asp687=, XP_005258697.1:p.Asp633=, XP_005258698.1:p.Asp465=, XP_011524913.1:p.Asp685=, rs17285183, rs3170170, rs3916880
G > A
No VIP available No Clinical Annotations available VA
rs1060896 NC_000015.10:g.45262069C>A, NC_000015.9:g.45554267C>A, NM_004212.3:c.225C>A, NP_004203.2:p.Ser75Arg, NR_120335.1:n.27-6071G>T, XM_011522198.1:c.225C>A, XM_011522199.1:c.225C>A, XM_011522200.1:c.225C>A, XM_011522201.1:c.225C>A, XP_011520500.1:p.Ser75Arg, XP_011520501.1:p.Ser75Arg, XP_011520502.1:p.Ser75Arg, XP_011520503.1:p.Ser75Arg, XR_243147.1:n.32-6071G>T, rs17215647, rs17532209, rs52828213, rs58568974
C > A
No VIP available CA VA
rs1065634 NC_000001.10:g.115259768T>C, NC_000001.11:g.114717147T>C, NG_007572.1:g.4748A>G, NM_001007553.2:c.*1022A>G, NM_001130523.2:c.*1022A>G, NM_001242891.1:c.*1022A>G, NM_001242892.1:c.*1022A>G, NM_001242893.1:c.*1022A>G, NM_002524.4:c.-507A>G, NM_007158.5:c.*1022A>G, XM_005271178.1:c.*1022A>G, rs3167734, rs57399409
T > C
No VIP available No Clinical Annotations available VA
rs10787899 NC_000010.10:g.120798655G>A, NC_000010.11:g.119039143G>A, NM_003750.2:c.3527-704C>T, XM_005270259.1:c.3497-704C>T, XM_005270260.1:c.3425-704C>T, rs61307620
G > A
No VIP available No Clinical Annotations available VA
rs10799754 NC_000001.10:g.22746686T>C, NC_000001.11:g.22420193T>C, XR_947058.1:n.-1255A>G, rs58371367
T > C
No VIP available No Clinical Annotations available VA
rs10868138 NC_000009.11:g.86917301T>C, NC_000009.12:g.84302386T>C, NM_001199633.1:c.338A>G, NM_022127.2:c.338A>G, NP_001186562.1:p.Tyr113Cys, NP_071410.1:p.Tyr113Cys, NR_037638.2:n.660A>G, XM_011518905.1:c.422A>G, XM_011518906.1:c.422A>G, XM_011518907.1:c.89A>G, XM_011518909.1:c.422A>G, XM_011518910.1:c.422A>G, XP_011517207.1:p.Tyr141Cys, XP_011517208.1:p.Tyr141Cys, XP_011517209.1:p.Tyr30Cys, XP_011517211.1:p.Tyr141Cys, XP_011517212.1:p.Tyr141Cys, XR_929832.1:n.549A>G, rs52792697, rs56686947
T > -
T > C
No VIP available CA VA
rs10878232 NC_000012.11:g.65522647T>G, NC_000012.12:g.65128867T>G
T > G
No VIP available No Clinical Annotations available VA
rs10886342 NC_000010.10:g.120690832G>A, NC_000010.11:g.118931320G>A, rs386515769, rs60264377
G > A
No VIP available CA VA
rs10981694 NC_000009.11:g.115986409T>G, NC_000009.12:g.113224129T>G, NM_001859.3:c.-36+2451T>G, rs60407897
T > G
No VIP available No Clinical Annotations available VA
rs11030918 NC_000011.10:g.4094257T>C, NC_000011.9:g.4115487T>C, NG_016277.1:g.243555T>C, NG_027992.2:g.4564T>C, NM_001033.4:c.-756T>C, NM_001318064.1:c.-869T>C, XM_005253058.1:c.-756T>C, XM_005253059.1:c.-869T>C, XM_011520277.1:c.-869T>C, rs17210557, rs17554091
T > C
No VIP available No Clinical Annotations available VA
rs11128347 NC_000003.11:g.73619561G>C, NC_000003.12:g.73570410G>C, NM_001303139.1:c.-1248C>G, NM_015009.2:c.918+31944C>G, XM_005264719.1:c.-1248C>G, rs59928417
G > C
No VIP available No Clinical Annotations available VA
rs11198804 NC_000010.10:g.120909785C>T, NC_000010.11:g.119150273C>T, NG_033895.1:g.20420G>A, NM_213649.1:c.733-2413G>A, NR_110305.1:n.751-2413G>A, XM_005269525.1:c.706-2413G>A, XM_005269525.3:c.706-2413G>A, XM_005269526.1:c.385-2413G>A, XM_005269527.1:c.385-2413G>A, XM_011539282.1:c.385-2413G>A, XR_246070.1:n.795-2413G>A, XR_246071.1:n.768-2413G>A, XR_945603.1:n.795-2413G>A, rs56640007
C > T
No VIP available No Clinical Annotations available VA
rs11211524 NC_000001.10:g.47833213A>C, NC_000001.11:g.47367541A>C, NM_001136140.1:c.172-5414A>C, NM_016308.2:c.172-928A>C, NR_046394.1:n.321-928A>C
A > C
No VIP available CA VA
rs1127687 NC_000010.10:g.115490109G>A, NC_000010.11:g.113730350G>A, NM_001227.4:c.*810G>A, NM_001267056.1:c.*810G>A, NM_001267057.1:c.*810G>A, NM_001267058.1:c.*810G>A, NM_033338.5:c.*810G>A, NM_033339.4:c.*810G>A, NM_033340.3:c.*926G>A, XM_006718017.2:c.*810G>A, XM_006718018.1:c.*810G>A, XM_011540259.1:c.*810G>A, XM_011540260.1:c.*810G>A, rs3183905, rs56449372
G > A
No VIP available CA VA
rs1128503 NC_000007.13:g.87179601A>G, NC_000007.14:g.87550285A>G, NG_011513.1:g.167964T>C, NM_000927.4:c.1236T>C, NP_000918.2:p.Gly412=, rs116989428, rs17276907, rs2032587, rs2229105, rs28365046, rs386518005, rs58257317
A > G
No VIP available No Clinical Annotations available VA
rs1130214 NC_000014.8:g.105259734C>A, NC_000014.9:g.104793397C>A, NG_012188.1:g.7348G>T, NM_001014431.1:c.-79-675G>T, NM_001014432.1:c.-163-187G>T, NM_005163.2:c.-350G>T, XM_005267401.1:c.-79-675G>T, XM_011536543.1:c.-257-93G>T, XM_011536544.1:c.-350G>T, rs36214920, rs56526192, rs57753899
C > A
No VIP available No Clinical Annotations available VA
rs1138272 NC_000011.10:g.67586108C>T, NC_000011.9:g.67353579C>T, NG_012075.1:g.7514C>T, NM_000852.3:c.341C>T, NP_000843.1:p.Ala114Val, XM_005273958.1:c.338C>T, XP_005274015.1:p.Ala113Val, rs11553894, rs17434783, rs1799811, rs1804665, rs3202011, rs4134657, rs52800258, rs61323549
C > T
No VIP available CA VA
rs1143623 NC_000002.11:g.113595829C>G, NC_000002.12:g.112838252C>G, NG_008851.1:g.3528G>C, NM_000576.2:c.-1560G>C, rs17042471, rs59448529
C > G
No VIP available CA VA
rs11545078 NC_000008.10:g.63938764G>A, NC_000008.11:g.63026205G>A, NG_028126.1:g.17847C>T, NM_003878.2:c.452C>T, NP_003869.1:p.Thr151Ile, XM_011517623.1:c.452C>T, XP_011515925.1:p.Thr151Ile, rs386518903, rs61629507
G > A
No VIP available CA No Variant Annotations available
(CA)16 > (CA)14
(CA)16 > (CA)15
(CA)16 > (CA)17
(CA)16 > (CA)18
(CA)16 > (CA)19
(CA)16 > (CA)20
(CA)16 > (CA)21
(CA)16 > (CA)22
(CA)16 > (CA)23
(CA)16 > (CA)9
No VIP available CA VA
rs11615 NC_000019.10:g.45420395A>G, NC_000019.9:g.45923653A>G, NG_015839.2:g.63434T>C, NM_001166049.1:c.354T>C, NM_001983.3:c.354T>C, NM_202001.2:c.354T>C, NP_001159521.1:p.Asn118=, NP_001974.1:p.Asn118=, NP_973730.1:p.Asn118=, XM_005258634.1:c.354T>C, XM_005258635.1:c.354T>C, XM_005258635.2:c.354T>C, XM_005258636.1:c.354T>C, XM_005258636.3:c.354T>C, XM_005258637.1:c.354T>C, XM_005258638.1:c.138T>C, XM_011526610.1:c.354T>C, XP_005258691.1:p.Asn118=, XP_005258692.1:p.Asn118=, XP_005258693.1:p.Asn118=, XP_005258694.1:p.Asn118=, XP_005258695.1:p.Asn46=, XP_011524912.1:p.Asn118=, rs1130005, rs17285882, rs17359303, rs17845191, rs17858003, rs17859564, rs2228629, rs3177700, rs3188446, rs3752251, rs59923575
A > G
No VIP available CA VA
rs11710163 NC_000003.11:g.12696288A>G, NC_000003.12:g.12654789A>G, NG_007467.1:g.14391T>C, NM_002880.3:c.-27+9024T>C, XM_005265355.1:c.-27+8580T>C, XM_005265356.1:c.-120+9024T>C, XM_005265357.1:c.-27+9024T>C, XM_005265358.1:c.-157+9024T>C, XM_005265358.3:c.-157+9024T>C, XM_005265359.1:c.-157+9024T>C, XM_005265359.3:c.-157+9024T>C, XM_005265360.1:c.-27+9024T>C, XM_011533974.1:c.-120+9024T>C, XM_011533975.1:c.-250+9024T>C, rs58836253
A > G
No VIP available CA VA
rs11854484 NC_000015.10:g.45253280C>T, NC_000015.9:g.45545478C>T, NM_004212.3:c.65C>T, NP_004203.2:p.Pro22Leu, NR_120335.1:n.180+586G>A, XM_011522198.1:c.65C>T, XM_011522199.1:c.65C>T, XM_011522200.1:c.65C>T, XM_011522201.1:c.65C>T, XP_011520500.1:p.Pro22Leu, XP_011520501.1:p.Pro22Leu, XP_011520502.1:p.Pro22Leu, XP_011520503.1:p.Pro22Leu, XR_243147.1:n.270+501G>A, rs17215661, rs17525501, rs52805892, rs61637002
C > T
No VIP available CA VA
rs11868547 NC_000017.10:g.63523603G>C, NC_000017.11:g.65527485G>C, NG_012142.1:g.39138C>G, rs56601766
G > C
No VIP available No Clinical Annotations available VA
rs11979430 NC_000007.13:g.80509256C>T, NC_000007.14:g.80879940C>T, NM_006379.3:c.103+36739G>A, XM_005250112.1:c.157+36739G>A, XM_005250113.1:c.-72+25889G>A, rs56476176, rs57935337
C > T
No VIP available No Clinical Annotations available VA
rs12090346 NC_000001.10:g.47841557C>T, NC_000001.11:g.47375885C>T, NM_001136140.1:c.498+592C>T, NM_016308.2:c.645+592C>T, NR_046394.1:n.717+592C>T
C > T
No VIP available No Clinical Annotations available VA
rs1209950 NC_000021.8:g.40173528C>T, NC_000021.9:g.38801604C>T, rs1734584
C > T
No VIP available CA VA
rs12118636 NC_000001.10:g.53076159G>A, NC_000001.11:g.52610487G>A, rs34623603
G > A
No VIP available No Clinical Annotations available VA
rs12139042 NC_000001.10:g.11167146G>A, NC_000001.11:g.11107089G>A, NG_033239.1:g.160463C>T, NM_004958.3:c.*396C>T, XM_005263438.1:c.*396C>T, XM_005263439.1:c.*396C>T, XM_005263440.1:c.5038C>T, XM_005263441.1:c.4031-300C>T, XP_005263497.1:p.Gln1680Ter, rs17229270, rs17848573
G > A
No VIP available CA VA
rs121434568 NC_000007.13:g.55259515T>G, NC_000007.14:g.55191822T>G, NG_007726.3:g.177791T>G, NM_005228.3:c.2573T>G, NP_005219.2:p.Leu858Arg, XM_005271746.1:c.2438T>G, XM_005271747.1:c.2414T>G, XP_005271803.1:p.Leu813Arg, XP_005271804.1:p.Leu805Arg
T > G
No VIP available CA VA
rs121434569 NC_000007.13:g.55249071C>T, NC_000007.14:g.55181378C>T, NG_007726.3:g.167347C>T, NM_005228.3:c.2369C>T, NP_005219.2:p.Thr790Met, NR_047551.1:n.1193G>A, XM_005271746.1:c.2234C>T, XM_005271747.1:c.2210C>T, XP_005271803.1:p.Thr745Met, XP_005271804.1:p.Thr737Met
C > T
No VIP available No Clinical Annotations available VA
rs12145722 NC_000001.10:g.22742985C>T, NC_000001.11:g.22416492C>T, XR_947058.1:n.811G>A, rs60246279
C > T
No VIP available CA VA
rs12415607 NC_000010.10:g.115438204C>A, NC_000010.11:g.113678445C>A, NM_001227.4:c.-1534C>A, NM_001267056.1:c.-905C>A, NM_001267057.1:c.-1310C>A, NM_033338.5:c.-1542C>A, NM_033339.4:c.-1608C>A, NM_033340.3:c.-905C>A, XM_006718018.1:c.-912C>A, rs34414451, rs56491430, rs60647096
C > A
No VIP available CA VA
C > T
No VIP available CA VA
rs12721627 NC_000007.13:g.99366093G>C, NC_000007.14:g.99768470G>C, NG_008421.1:g.20716C>G, NM_001202855.2:c.554C>G, NM_017460.5:c.554C>G, NP_001189784.1:p.Thr185Ser, NP_059488.2:p.Thr185Ser, XM_011515841.1:c.554C>G, XM_011515842.1:c.554C>G, XP_011514143.1:p.Thr185Ser, XP_011514144.1:p.Thr185Ser, rs28371754, rs56915287
G > C
No VIP available CA VA
rs12806698 NC_000011.10:g.4094744C>A, NC_000011.9:g.4115974C>A, NG_016277.1:g.244042C>A, NG_027992.2:g.5051C>A, NM_001033.3:c.-269C>A, NM_001033.4:c.-269C>A, NM_001318064.1:c.-382C>A, XM_005253058.1:c.-269C>A, XM_005253059.1:c.-382C>A, XM_011520277.1:c.-382C>A, rs17554111
C > A
No VIP available CA VA
rs12819505 NC_000012.11:g.1756665A>G, NC_000012.12:g.1647499A>G, NM_030775.2:c.*1247A>G, NM_032642.2:c.*1247A>G, XM_005253792.1:c.*1247A>G, XM_005253793.1:c.*1247A>G, XM_005253794.1:c.*1247A>G, XM_011521026.1:c.*1247A>G
A > G
No VIP available No Clinical Annotations available VA
rs12995526 NC_000002.11:g.216197971T>C, NC_000002.12:g.215333248T>C, NG_013002.1:g.26293T>C, NM_004044.6:c.815-102T>C, rs17513754
T > C
No VIP available CA VA
rs13181 NC_000019.10:g.45351661T>G, NC_000019.9:g.45854919T>G, NG_007067.2:g.23927A>C, NM_000400.3:c.2251A>C, NM_177417.2:c.*304T>G, NP_000391.1:p.Lys751Gln, XM_005258536.1:c.*128T>G, XM_005258536.3:c.*128T>G, XM_005258537.1:c.*128T>G, XM_005258538.1:c.*304T>G, XM_005258539.1:c.*304T>G, XM_005258639.1:c.2179A>C, XM_005258640.1:c.2017A>C, XM_005258641.1:c.1513A>C, XM_011526611.1:c.2173A>C, XP_005258696.1:p.Lys727Gln, XP_005258697.1:p.Lys673Gln, XP_005258698.1:p.Lys505Gln, XP_011524913.1:p.Lys725Gln, rs1052559, rs17285142, rs17355147, rs17359310, rs3170171, rs3859422, rs60606175
T > G
No VIP available CA VA
rs1382368 NC_000005.10:g.83155256C>T, NC_000005.9:g.82451075C>T, NM_001318012.1:c.316-40514C>T, NM_001318013.1:c.316-40514C>T, NM_003401.4:c.316-40514C>T, NM_022406.3:c.316-40514C>T, NM_022550.3:c.316-40514C>T, XM_005248595.1:c.316-40514C>T, XM_011543626.1:c.316-40514C>T, XM_011543627.1:c.316-40514C>T, XM_011543628.1:c.316-40514C>T
C > T
No VIP available CA VA
rs1409314 NC_000010.10:g.120615752A>G, NC_000010.11:g.118856240A>G, XR_946355.1:n.122+9947T>C, rs56620836, rs59117276
A > G
No VIP available No Clinical Annotations available VA
rs1453542 NC_000011.10:g.59457412G>C, NC_000011.9:g.59224885G>C, NM_001004708.1:c.452G>C, NP_001004708.1:p.Ser151Thr, rs111170546, rs17500408, rs59413929
G > C
No VIP available CA VA
rs1517114 NC_000008.10:g.69389217C>G, NC_000008.11:g.68476982C>G, NM_001195639.1:c.736+8162C>G, NM_052958.2:c.736+8162C>G, XM_005251149.1:c.736+8162C>G, XM_011517445.1:c.736+8162C>G, XM_011517446.1:c.736+8162C>G, XM_011517447.1:c.736+8162C>G, XM_011517448.1:c.608-11041C>G, XM_011517449.1:c.736+8162C>G, XM_011517450.1:c.736+8162C>G, XM_011517452.1:c.736+8162C>G, XR_928756.1:n.794+8162C>G, rs4292667, rs61127031
C > G
No VIP available No Clinical Annotations available VA
rs1560661 NC_000005.10:g.150413894C>T, NC_000005.9:g.149793457C>T, NG_029730.1:g.4043G>A, NM_001025158.2:c.-1145G>A, NM_001025159.2:c.-1145G>A, NM_004355.3:c.-1145G>A, XM_005268545.1:c.-914G>A, XM_005268546.1:c.-914G>A, rs56832097
C > T
No VIP available CA VA
rs1650697 NC_000005.10:g.80654962A>G, NC_000005.9:g.79950781A>G, NG_016607.1:g.5488A>G, NG_023304.1:g.5020T>C, NM_000791.3:c.-473T>C, NM_001290354.1:c.-579T>C, NM_001290357.1:c.-473T>C, NM_002439.4:c.235A>G, NP_002430.3:p.Ile79Val, NR_110936.1:n.20T>C, XM_005248455.1:c.-930T>C, XM_005248456.1:c.-579T>C, rs17352726, rs61225035
A > -
A > C
A > G
No VIP available No Clinical Annotations available VA
rs1656402 NC_000002.11:g.233426526C>T, NC_000002.12:g.232561816C>T, NM_001276336.1:c.271-2431C>T, NM_001276337.1:c.136-2431C>T, NM_001282958.1:c.271-2431C>T, NM_004846.3:c.271-2431C>T, XM_005246973.1:c.271-2431C>T, XM_005246974.1:c.271-2431C>T, XM_005246975.1:c.136-2431C>T, XM_005246975.2:c.136-2431C>T, XM_005246976.1:c.136-2431C>T, XM_011512206.1:c.256-2431C>T, rs2343840, rs386540451
C > T
No VIP available No Clinical Annotations available VA
rs1661167 NC_000019.10:g.44548749A>G, NC_000019.9:g.45052068G>A, NR_027754.2:n.498+149C>T, NR_027754.2:n.498+149T>C, rs111180091, rs386540506, rs57455473, rs60630023
G > A
No VIP available CA VA
rs16886403 NC_000005.10:g.56843419T>C, NC_000005.9:g.56139246T>C, NG_031884.1:g.33347T>C, NM_005921.1:c.483-13181T>C, XM_005248519.1:c.72-13181T>C, XM_005248519.3:c.105-13181T>C, XM_005248520.1:c.-7-13181T>C, XM_011543406.1:c.228-13181T>C, XM_011543407.1:c.483-13181T>C, XM_011543408.1:c.483-13181T>C, rs57623389, rs58749465
T > C
No VIP available No Clinical Annotations available VA
T > C
No VIP available No Clinical Annotations available VA
rs16930092 NC_000008.10:g.63940364T>C, NC_000008.11:g.63027805T>C, NG_028126.1:g.16247A>G, NM_003878.2:c.276-540A>G, XM_011517623.1:c.276-540A>G
T > C
No VIP available No Clinical Annotations available VA
rs16944 NC_000002.11:g.113594867A>G, NC_000002.12:g.112837290A>G, NG_008851.1:g.4490T>C, NM_000576.2:c.-598T>C, XM_006712496.1:c.-1552T>C, rs3827762
A > G
No VIP available CA VA
rs1695 NC_000011.10:g.67585218A>G, NC_000011.9:g.67352689A>G, NG_012075.1:g.6624A>G, NM_000852.3:c.313A>G, NP_000843.1:p.Ile105Val, XM_005273958.1:c.313A>G, XP_005274015.1:p.Ile105Val, rs1138257, rs11553891, rs17353321, rs17856342, rs2230827, rs4609, rs56971933, rs947894
A > G
No VIP available No Clinical Annotations available VA
rs17215836 NC_000015.10:g.84895081_84895082insTGT, NC_000015.9:g.85438312_85438313insTGT, NM_001287761.1:c.419_420insTGT, NM_001287762.1:c.419_420insTGT, NM_004213.4:c.419_420insTGT, NM_201651.2:c.419_420insTGT, NP_001274690.1:p.Leu140_Lys141insVal, NP_001274691.1:p.Leu140_Lys141insVal, NP_004204.3:p.Leu140_Lys141insVal, NP_964014.1:p.Leu140_Lys141insVal, XM_005254988.1:c.419_420insTGT, XM_005254989.1:c.419_420insTGT, XM_005254990.1:c.419_420insTGT, XM_005254991.1:c.419_420insTGT, XM_005254992.1:c.392_393insTGT, XM_005254993.1:c.419_420insTGT, XM_005254994.1:c.185_186insTGT, XM_005254995.1:c.419_420insTGT, XM_011522203.1:c.419_420insTGT, XM_011522204.1:c.419_420insTGT, XM_011522205.1:c.419_420insTGT, XM_011522206.1:c.419_420insTGT, XM_011522207.1:c.419_420insTGT, XM_011522208.1:c.392_393insTGT, XM_011522209.1:c.419_420insTGT, XM_011522210.1:c.419_420insTGT, XM_011522211.1:c.185_186insTGT, XM_011522212.1:c.419_420insTGT, XM_011522213.1:c.419_420insTGT, XM_011522214.1:c.419_420insTGT, XM_011522215.1:c.419_420insTGT, XM_011522216.1:c.185_186insTGT, XM_011522217.1:c.419_420insTGT, XM_011522218.1:c.419_420insTGT, XP_005255045.1:p.Leu140_Lys141insVal, XP_005255046.1:p.Leu140_Lys141insVal, XP_005255047.1:p.Leu140_Lys141insVal, XP_005255048.1:p.Leu140_Lys141insVal, XP_005255049.1:p.Leu131_Lys132insVal, XP_005255050.1:p.Leu140_Lys141insVal, XP_005255051.1:p.Leu62_Lys63insVal, XP_005255052.1:p.Leu140_Lys141insVal, XP_011520505.1:p.Leu140_Lys141insVal, XP_011520506.1:p.Leu140_Lys141insVal, XP_011520507.1:p.Leu140_Lys141insVal, XP_011520508.1:p.Leu140_Lys141insVal, XP_011520509.1:p.Leu140_Lys141insVal, XP_011520510.1:p.Leu131_Lys132insVal, XP_011520511.1:p.Leu140_Lys141insVal, XP_011520512.1:p.Leu140_Lys141insVal, XP_011520513.1:p.Leu62_Lys63insVal, XP_011520514.1:p.Leu140_Lys141insVal, XP_011520515.1:p.Leu140_Lys141insVal, XP_011520516.1:p.Leu140_Lys141insVal, XP_011520517.1:p.Leu140_Lys141insVal, XP_011520518.1:p.Leu62_Lys63insVal, XP_011520519.1:p.Leu140_Lys141insVal, XP_011520520.1:p.Leu140_Lys141insVal, XR_931944.1:n.625_626insTGT, XR_931945.1:n.625_626insTGT, rs45577135, rs57140500
- > TGT
No VIP available No Clinical Annotations available VA
rs17216177 NC_000010.10:g.101603522T>C, NC_000010.11:g.99843765T>C, NG_011798.1:g.66060T>C, NM_000392.4:c.3742-34T>C, XM_005269536.1:c.3463-34T>C, XM_006717630.2:c.3046-34T>C, XR_945604.1:n.3931-34T>C, XR_945605.1:n.3806-34T>C, rs45616434
T > C
No VIP available CA VA
rs17309872 NC_000020.10:g.33515788A>T, NC_000020.11:g.34927985A>T, NG_008848.1:g.32814T>A, NG_011520.1:g.58044A>T, NM_000178.2:c.*843T>A, NM_001076552.2:c.*771A>T, NM_001242393.1:c.*771A>T, NM_018677.3:c.*771A>T, XM_005260405.1:c.*843T>A, XM_005260406.1:c.*843T>A, XM_005260406.3:c.*843T>A, XM_005260454.1:c.*771A>T, XM_005260455.1:c.*771A>T, XM_005260456.1:c.*771A>T, XM_005260457.1:c.*771A>T, XM_006723826.1:c.*771A>T, XM_011528796.1:c.*843T>A, XM_011528905.1:c.*771A>T, XM_011528906.1:c.*771A>T, XM_011528907.1:c.*771A>T, XM_011528908.1:c.*771A>T, XM_011528909.1:c.*771A>T, XM_011528910.1:c.*771A>T, XM_011528911.1:c.*771A>T, XM_011528912.1:c.*771A>T
A > G
A > T
No VIP available No Clinical Annotations available VA
rs17661089 NC_000005.10:g.56810169A>G, NC_000005.9:g.56105996A>G, NG_031884.1:g.97A>G, rs57476699
A > G
No VIP available CA VA
rs1799782 NC_000019.10:g.43553422G>A, NC_000019.9:g.44057574G>A, NG_033799.1:g.27157C>T, NM_006297.2:c.580C>T, NP_006288.2:p.Arg194Trp, rs11553655, rs2229674, rs3213359, rs3826914, rs386545546
G > A
No VIP available CA VA
rs1799793 NC_000019.10:g.45364001C>T, NC_000019.9:g.45867259C>T, NG_007067.2:g.11587G>A, NM_000400.3:c.934G>A, NM_001130867.1:c.862G>A, NP_000391.1:p.Asp312Asn, NP_001124339.1:p.Asp288Asn, XM_005258639.1:c.862G>A, XM_005258640.1:c.700G>A, XM_005258641.1:c.196G>A, XM_005258642.1:c.934G>A, XM_011526611.1:c.856G>A, XP_005258696.1:p.Asp288Asn, XP_005258697.1:p.Asp234Asn, XP_005258698.1:p.Asp66Asn, XP_005258699.1:p.Asp312Asn, XP_011524913.1:p.Asp286Asn, XR_935763.1:n.981G>A, rs3916814, rs58989209
C > T
No VIP available CA VA
rs1799801 NC_000016.10:g.13948101T>C, NC_000016.9:g.14041958T>C, NG_011442.1:g.32945T>C, NM_005236.2:c.2505T>C, NP_005227.1:p.Ser835=, XM_011522424.1:c.2643T>C, XM_011522425.1:c.1962T>C, XM_011522426.1:c.1716T>C, XM_011522427.1:c.1155T>C, XP_011520726.1:p.Ser881=, XP_011520727.1:p.Ser654=, XP_011520728.1:p.Ser572=, XP_011520729.1:p.Ser385=, XR_243267.1:n.2511T>C, XR_932805.1:n.2664T>C
T > C
No VIP available CA VA
rs1800566 NC_000016.10:g.69711242G>A, NC_000016.9:g.69745145G>A, NG_011504.1:g.20389C>T, NM_000903.2:c.559C>T, NM_001025433.1:c.457C>T, NM_001025434.1:c.445C>T, NM_001286137.1:c.343C>T, NP_000894.1:p.Pro187Ser, NP_001020604.1:p.Pro153Ser, NP_001020605.1:p.Pro149Ser, NP_001273066.1:p.Pro115Ser, XM_005255830.1:c.343C>T, XP_005255887.1:p.Pro115Ser, rs4134727, rs4149351, rs57135274
G > A
No VIP available CA VA
rs1800975 NC_000009.11:g.100459578T>C, NC_000009.12:g.97697296T>C, NG_011642.1:g.5114A>G, NM_000380.3:c.-4A>G, NR_027302.1:n.114A>G, XM_006717278.1:c.-4A>G, XM_011518988.1:c.-4A>G, XR_929839.1:n.108A>G, rs13301768, rs16923638, rs3176632, rs58796599
T > -
T > C
No VIP available No Clinical Annotations available VA
rs1801131 NC_000001.10:g.11854476T>G, NC_000001.11:g.11794419T>G, NG_013351.1:g.16685A>C, NM_005957.4:c.1286A>C, NP_005948.3:p.Glu429Ala, XM_005263458.1:c.1409A>C, XM_005263458.2:c.1409A>C, XM_005263459.1:c.1355A>C, XM_005263460.1:c.1286A>C, XM_005263460.3:c.1286A>C, XM_005263461.1:c.1286A>C, XM_005263461.3:c.1286A>C, XM_005263462.1:c.1286A>C, XM_005263462.3:c.1286A>C, XM_005263463.1:c.1040A>C, XM_005263463.2:c.1040A>C, XM_011541495.1:c.1406A>C, XM_011541496.1:c.1409A>C, XP_005263515.1:p.Glu470Ala, XP_005263516.1:p.Glu452Ala, XP_005263517.1:p.Glu429Ala, XP_005263518.1:p.Glu429Ala, XP_005263519.1:p.Glu429Ala, XP_005263520.1:p.Glu347Ala, XP_011539797.1:p.Glu469Ala, XP_011539798.1:p.Glu470Ala, rs17367365, rs17857426, rs4134712
T > G
No VIP available CA VA
rs1801133 NC_000001.10:g.11856378G>A, NC_000001.11:g.11796321G>A, NG_013351.1:g.14783C>T, NM_005957.4:c.665C>T, NP_005948.3:p.Ala222Val, XM_005263458.1:c.788C>T, XM_005263458.2:c.788C>T, XM_005263459.1:c.734C>T, XM_005263460.1:c.665C>T, XM_005263460.3:c.665C>T, XM_005263461.1:c.665C>T, XM_005263461.3:c.665C>T, XM_005263462.1:c.665C>T, XM_005263462.3:c.665C>T, XM_005263463.1:c.419C>T, XM_005263463.2:c.419C>T, XM_011541495.1:c.785C>T, XM_011541496.1:c.788C>T, XP_005263515.1:p.Ala263Val, XP_005263516.1:p.Ala245Val, XP_005263517.1:p.Ala222Val, XP_005263518.1:p.Ala222Val, XP_005263519.1:p.Ala222Val, XP_005263520.1:p.Ala140Val, XP_011539797.1:p.Ala262Val, XP_011539798.1:p.Ala263Val, rs386545618, rs4134713, rs59514310
G > A
No VIP available No Clinical Annotations available VA
rs1805087 NC_000001.10:g.237048500A>G, NC_000001.11:g.236885200A>G, NG_008959.1:g.94920A>G, NM_000254.2:c.2756A>G, NM_001291939.1:c.2603A>G, NM_001291940.1:c.1535A>G, NP_000245.2:p.Asp919Gly, NP_001278868.1:p.Asp868Gly, NP_001278869.1:p.Asp512Gly, XM_005273140.1:c.2924A>G, XM_005273141.1:c.2753A>G, XM_005273141.3:c.2753A>G, XM_005273142.1:c.2666A>G, XM_005273143.1:c.2603A>G, XM_005273144.1:c.2318A>G, XM_005273145.1:c.1118A>G, XM_006711769.2:c.2756A>G, XM_006711770.1:c.1820A>G, XM_011544193.1:c.2567A>G, XM_011544194.1:c.2924A>G, XP_005273197.1:p.Asp975Gly, XP_005273198.1:p.Asp918Gly, XP_005273199.1:p.Asp889Gly, XP_005273200.1:p.Asp868Gly, XP_005273201.1:p.Asp773Gly, XP_005273202.1:p.Asp373Gly, XP_006711832.1:p.Asp919Gly, XP_006711833.1:p.Asp607Gly, XP_011542495.1:p.Asp856Gly, XP_011542496.1:p.Asp975Gly, rs17658739, rs56618494, rs61036243
A > G
No VIP available No Clinical Annotations available VA
rs183484 NC_000011.10:g.4119902C>A, NC_000011.9:g.4141132C>A, NG_027992.2:g.30209C>A, NM_001033.3:c.850C>A, NM_001033.4:c.850C>A, NM_001318064.1:c.559C>A, NM_001318065.1:c.-207C>A, NP_001024.1:p.Arg284=, NP_001304993.1:p.Arg187=, XM_005253058.1:c.607C>A, XM_005253059.1:c.559C>A, XM_011520277.1:c.559C>A, XM_011520278.1:c.184C>A, XM_011520279.1:c.-207C>A, XP_005253115.1:p.Arg203=, XP_005253116.1:p.Arg187=, XP_011518579.1:p.Arg187=, XP_011518580.1:p.Arg62=, rs17210748, rs1735058, rs17850105, rs2228122
C > A
No VIP available No Clinical Annotations available VA
rs1885301 NC_000010.10:g.101541053A>G, NC_000010.11:g.99781296A>G, NG_011798.1:g.3591A>G, NM_000392.4:c.-1549A>G, XM_005269536.1:c.-1549A>G, XM_006717631.2:c.-1549A>G, XM_011539291.1:c.-1549A>G, XR_945604.1:n.-1360A>G, XR_945605.1:n.-1358A>G, rs17216261, rs59934936
A > G
No VIP available No Clinical Annotations available VA
rs2032582 NC_000007.13:g.87160618A>C, NC_000007.13:g.87160618A>T, NC_000007.14:g.87531302A>C, NC_000007.14:g.87531302A>T, NG_011513.1:g.186947T>A, NG_011513.1:g.186947T>G, NM_000927.4:c.2677T>A, NM_000927.4:c.2677T>G, NP_000918.2:p.Ser893Ala, NP_000918.2:p.Ser893Thr, rs10228331, rs2229106, rs386553610, rs57135550, rs9641018
A > C
A > T
No VIP available CA VA
rs2072671 NC_000001.10:g.20915701A>C, NC_000001.11:g.20589208A>C, NM_001785.2:c.79A>C, NP_001776.1:p.Lys27Gln, rs57221291
A > C
No VIP available CA VA
rs2227310 NC_000010.10:g.115489152C>G, NC_000010.11:g.113729393C>G, NM_001227.4:c.765C>G, NM_001267056.1:c.765C>G, NM_001267057.1:c.1020C>G, NM_001267058.1:c.690C>G, NM_033338.5:c.864C>G, NM_033339.4:c.765C>G, NM_033340.3:c.731C>G, NP_001218.1:p.Asp255Glu, NP_001253985.1:p.Asp255Glu, NP_001253986.1:p.Asp340Glu, NP_001253987.1:p.Asp230Glu, NP_203124.1:p.Asp288Glu, NP_203125.1:p.Asp255Glu, NP_203126.1:p.Thr244Ser, XM_006718017.2:c.807C>G, XM_006718018.1:c.789C>G, XM_011540259.1:c.864C>G, XM_011540260.1:c.666C>G, XP_006718080.1:p.Asp269Glu, XP_006718081.1:p.Asp263Glu, XP_011538561.1:p.Asp288Glu, XP_011538562.1:p.Asp222Glu, rs56575824, rs58736298, rs58910029
C > G
No VIP available CA No Variant Annotations available
rs2227983 NC_000007.13:g.55229255G>A, NC_000007.14:g.55161562G>A, NG_007726.3:g.147531G>A, NM_005228.3:c.1562G>A, NM_201282.1:c.1562G>A, NM_201284.1:c.1562G>A, NP_005219.2:p.Arg521Lys, NP_958439.1:p.Arg521Lys, NP_958441.1:p.Arg521Lys, XM_005271746.1:c.1427G>A, XM_005271747.1:c.1403G>A, XM_005271748.1:c.1562G>A, XP_005271803.1:p.Arg476Lys, XP_005271804.1:p.Arg468Lys, XP_005271805.1:p.Arg521Lys, rs11543848, rs117960725, rs12234746, rs17336807, rs3752650
G > A
No VIP available CA VA
rs2231137 NC_000004.11:g.89061114C>T, NC_000004.12:g.88139962C>T, NG_032067.2:g.96361G>A, NM_001257386.1:c.34G>A, NM_004827.2:c.34G>A, NP_001244315.1:p.Val12Met, NP_004818.2:p.Val12Met, XM_005263354.1:c.34G>A, XM_005263354.2:c.34G>A, XM_005263355.1:c.34G>A, XM_005263355.2:c.34G>A, XM_005263356.1:c.34G>A, XM_005263356.2:c.34G>A, XM_011532420.1:c.34G>A, XP_005263411.1:p.Val12Met, XP_005263412.1:p.Val12Met, XP_005263413.1:p.Val12Met, XP_011530722.1:p.Val12Met
C > T
No VIP available No Clinical Annotations available VA
rs2231142 NC_000004.11:g.89052323G>T, NC_000004.12:g.88131171G>T, NG_032067.2:g.105152C>A, NM_001257386.1:c.421C>A, NM_004827.2:c.421C>A, NP_001244315.1:p.Gln141Lys, NP_004818.2:p.Gln141Lys, XM_005263354.1:c.421C>A, XM_005263354.2:c.421C>A, XM_005263355.1:c.421C>A, XM_005263355.2:c.421C>A, XM_005263356.1:c.421C>A, XM_005263356.2:c.421C>A, XM_011532420.1:c.421C>A, XP_005263411.1:p.Gln141Lys, XP_005263412.1:p.Gln141Lys, XP_005263413.1:p.Gln141Lys, XP_011530722.1:p.Gln141Lys, rs12721641, rs28365035, rs3736117, rs52809243, rs58973676
G > T
No VIP available No Clinical Annotations available VA
rs2234767 NC_000010.10:g.90749256G>A, NC_000010.11:g.88989499G>A, NG_009089.2:g.3969G>A, NG_011541.1:g.6892C>T, NM_000043.4:c.-1378G>A, NM_001141945.1:c.-24+1440C>T, NM_152871.2:c.-1378G>A, NM_152872.2:c.-1378G>A, NR_028033.2:n.-1032G>A, NR_028034.2:n.-1032G>A, NR_028035.2:n.-1032G>A, NR_028036.2:n.-1032G>A, XM_006717819.2:c.31G>A, XM_011539764.1:c.112G>A, XM_011539765.1:c.112G>A, XM_011539766.1:c.31G>A, XM_011539767.1:c.-1639G>A, XM_011540016.1:c.-24+1523C>T, XP_006717882.1:p.Ala11Thr, XP_011538066.1:p.Ala38Thr, XP_011538067.1:p.Ala38Thr, XP_011538068.1:p.Ala11Thr, XR_945732.1:n.127G>A, XR_945733.1:n.127G>A, rs3758482
G > A
G > T
No VIP available CA VA
rs2234922 NC_000001.10:g.226026406A>G, NC_000001.11:g.225838705A>G, NG_009776.1:g.33610A>G, NM_000120.3:c.416A>G, NM_001136018.3:c.416A>G, NM_001291163.1:c.416A>G, NP_000111.1:p.His139Arg, NP_001129490.1:p.His139Arg, NP_001278092.1:p.His139Arg, XM_005273085.1:c.416A>G, XP_005273142.1:p.His139Arg, rs59975602
A > G
No VIP available CA VA
rs2242046 NC_000015.10:g.84935498G>A, NC_000015.9:g.85478729G>A, NM_001287761.1:c.1084-7947G>A, NM_001287762.1:c.1561G>A, NM_004213.4:c.1561G>A, NP_001274691.1:p.Asp521Asn, NP_004204.3:p.Asp521Asn, XM_005254988.1:c.1561G>A, XM_005254989.1:c.1561G>A, XM_005254990.1:c.1561G>A, XM_005254991.1:c.1561G>A, XM_005254992.1:c.1534G>A, XM_005254993.1:c.1483G>A, XM_005254994.1:c.1327G>A, XM_005254995.1:c.1084-7947G>A, XM_011522203.1:c.1561G>A, XM_011522204.1:c.1561G>A, XM_011522205.1:c.1561G>A, XM_011522206.1:c.1561G>A, XM_011522207.1:c.1561G>A, XM_011522208.1:c.1534G>A, XM_011522209.1:c.1483G>A, XM_011522210.1:c.1561G>A, XM_011522211.1:c.1327G>A, XM_011522212.1:c.1561G>A, XM_011522213.1:c.1561G>A, XM_011522214.1:c.1561G>A, XM_011522215.1:c.1084-7947G>A, XM_011522216.1:c.1327G>A, XM_011522217.1:c.1084-7947G>A, XP_005255045.1:p.Asp521Asn, XP_005255046.1:p.Asp521Asn, XP_005255047.1:p.Asp521Asn, XP_005255048.1:p.Asp521Asn, XP_005255049.1:p.Asp512Asn, XP_005255050.1:p.Asp495Asn, XP_005255051.1:p.Asp443Asn, XP_011520505.1:p.Asp521Asn, XP_011520506.1:p.Asp521Asn, XP_011520507.1:p.Asp521Asn, XP_011520508.1:p.Asp521Asn, XP_011520509.1:p.Asp521Asn, XP_011520510.1:p.Asp512Asn, XP_011520511.1:p.Asp495Asn, XP_011520512.1:p.Asp521Asn, XP_011520513.1:p.Asp443Asn, XP_011520514.1:p.Asp521Asn, XP_011520515.1:p.Asp521Asn, XP_011520516.1:p.Asp521Asn, XP_011520518.1:p.Asp443Asn, XR_931944.1:n.1636G>A, rs17216003, rs17609392, rs386562296, rs57854627
G > A
No VIP available No Clinical Annotations available VA
rs2242047 NC_000015.10:g.84935465C>T, NC_000015.9:g.85478696C>T, NM_001287761.1:c.1084-7980C>T, NM_001287762.1:c.1528C>T, NM_004213.4:c.1528C>T, NP_001274691.1:p.Arg510Cys, NP_004204.3:p.Arg510Cys, XM_005254988.1:c.1528C>T, XM_005254989.1:c.1528C>T, XM_005254990.1:c.1528C>T, XM_005254991.1:c.1528C>T, XM_005254992.1:c.1501C>T, XM_005254993.1:c.1450C>T, XM_005254994.1:c.1294C>T, XM_005254995.1:c.1084-7980C>T, XM_011522203.1:c.1528C>T, XM_011522204.1:c.1528C>T, XM_011522205.1:c.1528C>T, XM_011522206.1:c.1528C>T, XM_011522207.1:c.1528C>T, XM_011522208.1:c.1501C>T, XM_011522209.1:c.1450C>T, XM_011522210.1:c.1528C>T, XM_011522211.1:c.1294C>T, XM_011522212.1:c.1528C>T, XM_011522213.1:c.1528C>T, XM_011522214.1:c.1528C>T, XM_011522215.1:c.1084-7980C>T, XM_011522216.1:c.1294C>T, XM_011522217.1:c.1084-7980C>T, XP_005255045.1:p.Arg510Cys, XP_005255046.1:p.Arg510Cys, XP_005255047.1:p.Arg510Cys, XP_005255048.1:p.Arg510Cys, XP_005255049.1:p.Arg501Cys, XP_005255050.1:p.Arg484Cys, XP_005255051.1:p.Arg432Cys, XP_011520505.1:p.Arg510Cys, XP_011520506.1:p.Arg510Cys, XP_011520507.1:p.Arg510Cys, XP_011520508.1:p.Arg510Cys, XP_011520509.1:p.Arg510Cys, XP_011520510.1:p.Arg501Cys, XP_011520511.1:p.Arg484Cys, XP_011520512.1:p.Arg510Cys, XP_011520513.1:p.Arg432Cys, XP_011520514.1:p.Arg510Cys, XP_011520515.1:p.Arg510Cys, XP_011520516.1:p.Arg510Cys, XP_011520518.1:p.Arg432Cys, XR_931944.1:n.1603C>T, rs17222400, rs56742164
C > T
No VIP available No Clinical Annotations available VA
rs2242048 NC_000015.10:g.84935179A>G, NC_000015.9:g.85478410A>G, NM_001287761.1:c.1084-8266A>G, NM_001287762.1:c.1368A>G, NM_004213.4:c.1368A>G, NP_001274691.1:p.Gln456=, NP_004204.3:p.Gln456=, XM_005254988.1:c.1368A>G, XM_005254989.1:c.1368A>G, XM_005254990.1:c.1368A>G, XM_005254991.1:c.1368A>G, XM_005254992.1:c.1341A>G, XM_005254993.1:c.1290A>G, XM_005254994.1:c.1134A>G, XM_005254995.1:c.1084-8266A>G, XM_011522203.1:c.1368A>G, XM_011522204.1:c.1368A>G, XM_011522205.1:c.1368A>G, XM_011522206.1:c.1368A>G, XM_011522207.1:c.1368A>G, XM_011522208.1:c.1341A>G, XM_011522209.1:c.1290A>G, XM_011522210.1:c.1368A>G, XM_011522211.1:c.1134A>G, XM_011522212.1:c.1368A>G, XM_011522213.1:c.1368A>G, XM_011522214.1:c.1368A>G, XM_011522215.1:c.1084-8266A>G, XM_011522216.1:c.1134A>G, XM_011522217.1:c.1084-8266A>G, XP_005255045.1:p.Gln456=, XP_005255046.1:p.Gln456=, XP_005255047.1:p.Gln456=, XP_005255048.1:p.Gln456=, XP_005255049.1:p.Gln447=, XP_005255050.1:p.Gln430=, XP_005255051.1:p.Gln378=, XP_011520505.1:p.Gln456=, XP_011520506.1:p.Gln456=, XP_011520507.1:p.Gln456=, XP_011520508.1:p.Gln456=, XP_011520509.1:p.Gln456=, XP_011520510.1:p.Gln447=, XP_011520511.1:p.Gln430=, XP_011520512.1:p.Gln456=, XP_011520513.1:p.Gln378=, XP_011520514.1:p.Gln456=, XP_011520515.1:p.Gln456=, XP_011520516.1:p.Gln456=, XP_011520518.1:p.Gln378=, XR_931944.1:n.1443A>G, rs17216009, rs17609296, rs386562297, rs60098916
A > G
No VIP available CA VA
rs2269577 NC_000022.10:g.29196757G>C, NC_000022.11:g.28800769G>C, NG_012266.1:g.4804C>G, NM_001079539.1:c.-245C>G, NM_005080.3:c.-245C>G, XM_011530435.1:c.-194+32G>C, XM_011530436.1:c.-262+32G>C, rs61323997
G > C
No VIP available No Clinical Annotations available VA
rs2273697 NC_000010.10:g.101563815G>A, NC_000010.11:g.99804058G>A, NG_011798.1:g.26353G>A, NM_000392.4:c.1249G>A, NP_000383.1:p.Val417Ile, XM_005269536.1:c.1249G>A, XM_006717630.2:c.553G>A, XM_006717631.2:c.1249G>A, XM_011539291.1:c.1249G>A, XP_005269593.1:p.Val417Ile, XP_006717693.1:p.Val185Ile, XP_006717694.1:p.Val417Ile, XP_011537593.1:p.Val417Ile, XR_945604.1:n.1438G>A, XR_945605.1:n.1440G>A, rs17216184, rs60620335
G > A
No VIP available No Clinical Annotations available VA
rs2275112 NC_000010.10:g.120917616G>A, NC_000010.11:g.119158104G>A, NG_033895.1:g.12589C>T, NM_213649.1:c.361-42C>T, NR_110305.1:n.379-42C>T, XM_005269525.1:c.334-42C>T, XM_005269525.3:c.334-42C>T, XM_005269526.1:c.13-42C>T, XM_005269527.1:c.13-42C>T, XM_011539282.1:c.13-42C>T, XR_246070.1:n.423-42C>T, XR_246071.1:n.396-42C>T, XR_945603.1:n.423-42C>T
G > A
No VIP available CA VA
rs2284449 NC_000011.10:g.4099619T>C, NC_000011.9:g.4120849T>C, NG_027992.2:g.9926T>C, NM_001033.3:c.20-2374T>C, NM_001033.4:c.20-2374T>C, NM_001318064.1:c.-94-2374T>C, XM_005253058.1:c.20-2374T>C, XM_005253059.1:c.-94-2374T>C, XM_011520277.1:c.-94-2374T>C, rs52806873
T > C
No VIP available No Clinical Annotations available VA
rs2289669 NC_000017.10:g.19463343G>A, NC_000017.11:g.19560030G>A, NM_018242.2:c.922-158G>A, XM_005256710.1:c.922-158G>A, XM_005256711.1:c.808-158G>A, XM_005256712.1:c.922-158G>A, XM_005256713.1:c.853-158G>A, XM_005256714.1:c.922-158G>A, XR_934310.1:n.1230C>T, rs386563823, rs56528368, rs57126832
G > A
No VIP available No Clinical Annotations available VA
rs2290272 NC_000015.10:g.84904200G>A, NC_000015.9:g.85447431G>A, NM_001287761.1:c.565G>A, NM_001287762.1:c.565G>A, NM_004213.4:c.565G>A, NP_001274690.1:p.Val189Ile, NP_001274691.1:p.Val189Ile, NP_004204.3:p.Val189Ile, XM_005254988.1:c.565G>A, XM_005254989.1:c.565G>A, XM_005254990.1:c.565G>A, XM_005254991.1:c.565G>A, XM_005254992.1:c.538G>A, XM_005254993.1:c.565G>A, XM_005254994.1:c.331G>A, XM_005254995.1:c.565G>A, XM_011522203.1:c.565G>A, XM_011522204.1:c.565G>A, XM_011522205.1:c.565G>A, XM_011522206.1:c.565G>A, XM_011522207.1:c.565G>A, XM_011522208.1:c.538G>A, XM_011522209.1:c.565G>A, XM_011522210.1:c.565G>A, XM_011522211.1:c.331G>A, XM_011522212.1:c.565G>A, XM_011522213.1:c.565G>A, XM_011522214.1:c.565G>A, XM_011522215.1:c.565G>A, XM_011522216.1:c.331G>A, XM_011522217.1:c.565G>A, XM_011522218.1:c.565G>A, XP_005255045.1:p.Val189Ile, XP_005255046.1:p.Val189Ile, XP_005255047.1:p.Val189Ile, XP_005255048.1:p.Val189Ile, XP_005255049.1:p.Val180Ile, XP_005255050.1:p.Val189Ile, XP_005255051.1:p.Val111Ile, XP_005255052.1:p.Val189Ile, XP_011520505.1:p.Val189Ile, XP_011520506.1:p.Val189Ile, XP_011520507.1:p.Val189Ile, XP_011520508.1:p.Val189Ile, XP_011520509.1:p.Val189Ile, XP_011520510.1:p.Val180Ile, XP_011520511.1:p.Val189Ile, XP_011520512.1:p.Val189Ile, XP_011520513.1:p.Val111Ile, XP_011520514.1:p.Val189Ile, XP_011520515.1:p.Val189Ile, XP_011520516.1:p.Val189Ile, XP_011520517.1:p.Val189Ile, XP_011520518.1:p.Val111Ile, XP_011520519.1:p.Val189Ile, XP_011520520.1:p.Val189Ile, XR_931944.1:n.771G>A, XR_931945.1:n.771G>A, rs17222253, rs17536477, rs386563851, rs52799974, rs58773874
G > A
No VIP available CA No Variant Annotations available
rs2293347 NC_000007.13:g.55268916C>T, NC_000007.14:g.55201223C>T, NG_007726.3:g.187192C>T, NM_005228.3:c.2982C>T, NP_005219.2:p.Asp994=, XM_005271746.1:c.2847C>T, XM_005271747.1:c.2823C>T, XP_005271803.1:p.Asp949=, XP_005271804.1:p.Asp941=, rs10435501, rs17337472, rs386564009, rs56649858, rs61150996
C > T
No VIP available CA VA
rs2299939 NC_000010.10:g.89657150C>A, NC_000010.11:g.87897393C>A, NG_007466.2:g.38955C>A, NM_000314.4:c.164+3284C>A, NM_000314.6:c.164+3284C>A, NM_001304717.2:c.683+3284C>A, NM_001304718.1:c.-542+3284C>A, XM_006717926.2:c.164+3284C>A, XM_011539981.1:c.164+3284C>A, XM_011539982.1:c.68+16955C>A, XR_945789.1:n.876+3284C>A, XR_945790.1:n.876+3284C>A, XR_945791.1:n.876+3284C>A, rs17561756, rs52816835, rs60036687
C > A
C > T
No VIP available No Clinical Annotations available VA
rs2306283 NC_000012.11:g.21329738A>G, NC_000012.12:g.21176804A>G, NG_011745.1:g.50611A>G, NM_006446.4:c.388A>G, NP_006437.3:p.Asn130Asp, rs17389242, rs52832430, rs60767041
A > G
No VIP available CA VA
rs232043 NC_000011.10:g.4117895G>A, NC_000011.9:g.4139125G>A, NG_027992.2:g.28202G>A, NM_001033.3:c.651-425G>A, NM_001033.4:c.651-425G>A, NM_001318064.1:c.360-425G>A, NM_001318065.1:c.-406-425G>A, XM_005253058.1:c.408-425G>A, XM_005253059.1:c.360-425G>A, XM_011520277.1:c.360-425G>A, XM_011520278.1:c.-16-425G>A, XM_011520279.1:c.-406-425G>A, rs1662167
G > A
No VIP available No Clinical Annotations available VA
rs238406 NC_000019.10:g.45365051T>G, NC_000019.9:g.45868309T>G, NG_007067.2:g.10537A>C, NM_000400.3:c.468A>C, NM_001130867.1:c.396A>C, NP_000391.1:p.Arg156=, NP_001124339.1:p.Arg132=, XM_005258639.1:c.396A>C, XM_005258640.1:c.361-504A>C, XM_005258641.1:c.-271A>C, XM_005258642.1:c.468A>C, XM_011526611.1:c.390A>C, XP_005258696.1:p.Arg132=, XP_005258699.1:p.Arg156=, XP_011524913.1:p.Arg130=, XR_935763.1:n.515A>C, rs11543157, rs17587147, rs3859425, rs59387636
T > G
No VIP available No Clinical Annotations available VA
rs2494750 NC_000014.8:g.105262912G>C, NC_000014.9:g.104796575G>C, NG_012188.1:g.4169C>G, NG_042073.1:g.395G>C, NM_001014431.1:c.-1172C>G, NM_001014432.1:c.-1256C>G, rs57563070
G > C
No VIP available CA VA
rs2494752 NC_000014.8:g.105263608A>G, NC_000014.9:g.104797271A>G, NG_012188.1:g.3473T>C, NG_042073.1:g.1091A>G, NM_001014431.1:c.-1868T>C, NM_001014432.1:c.-1952T>C
A > G
No VIP available No Clinical Annotations available VA
rs2498786 NC_000014.8:g.105262368C>G, NC_000014.9:g.104796031C>G, NG_012188.1:g.4713G>C, NM_001014431.1:c.-628G>C, NM_001014432.1:c.-712G>C, XM_005267401.1:c.-1992G>C, XM_011536543.1:c.-2170G>C, XM_011536544.1:c.-2984G>C
C > G
No VIP available CA VA
rs2498804 NC_000014.8:g.105233095C>A, NC_000014.9:g.104766758C>A, XR_429419.2:n.-1209C>A, rs386568280, rs56890536
C > A
No VIP available CA VA
rs25487 NC_000019.10:g.43551574T>C, NC_000019.9:g.44055726T>C, NG_033799.1:g.29005A>G, NM_006297.2:c.1196A>G, NP_006288.2:p.Gln399Arg, rs11553658, rs17435395, rs3817410, rs386493716, rs57378728
T > C
No VIP available No Clinical Annotations available VA
rs2622604 NC_000004.11:g.89078924T>C, NC_000004.12:g.88157772T>C, NG_032067.2:g.78551A>G, NM_001257386.1:c.-19-17758A>G, NM_004827.2:c.-20+614A>G, XM_005263354.1:c.-20+805A>G, XM_005263354.2:c.-20+805A>G, XM_005263355.1:c.-19-17758A>G, XM_005263355.2:c.-19-17758A>G, XM_005263356.1:c.-20+614A>G, XM_005263356.2:c.-20+614A>G, XM_011532420.1:c.-19-17758A>G, rs61481684
T > A
T > C
No VIP available CA VA
rs2699887 NC_000003.11:g.178866408C>T, NC_000003.12:g.179148620C>T, NG_012113.2:g.5098C>T, NM_006218.2:c.-77+17C>T, NR_125401.1:n.-647G>A, XM_006713658.2:c.-77+401C>T, XM_011512894.1:c.-1173C>T, XR_241620.1:n.-643G>A
C > T
No VIP available No Clinical Annotations available VA
rs2745761 NC_000020.10:g.8277943G>C, NC_000020.11:g.8297296G>C, NG_028168.1:g.169648G>C, NM_015192.3:c.178-74086G>C, NM_182734.2:c.178-74086G>C, XM_005260681.1:c.178-74086G>C, XM_011529199.1:c.178-74086G>C, XM_011529202.1:c.178-74086G>C, rs61713950
G > A
G > C
No VIP available No Clinical Annotations available VA
rs2748249 NC_000005.10:g.150413037C>A, NC_000005.9:g.149792600C>A, NG_029730.1:g.4900G>T, NM_001025158.2:c.-288G>T, NM_001025159.2:c.-288G>T, NM_004355.3:c.-288G>T, XM_005268545.1:c.-57G>T, XM_005268546.1:c.-57G>T, rs386573235
C > A
No VIP available No Clinical Annotations available VA
rs2762939 NC_000020.10:g.52781251G>C, NC_000020.11:g.54164712G>C, NG_008334.1:g.14266C>G, NM_000782.4:c.733-149C>G, NM_001128915.1:c.733-149C>G, XM_005260304.1:c.733-149C>G, XM_005260304.3:c.733-149C>G, XM_005260305.1:c.733-149C>G, rs57991016
G > C
No VIP available No Clinical Annotations available VA
C > T
No VIP available CA VA
rs316019 NC_000006.11:g.160670282A>C, NC_000006.12:g.160249250A>C, NM_003058.3:c.808T>G, NP_003049.2:p.Ser270Ala, rs1755917, rs17846267, rs17859289, rs386580336, rs52803175, rs60007366, rs666224
A > C
No VIP available CA VA
rs3212986 NC_000019.10:g.45409478C>A, NC_000019.9:g.45912736C>A, NG_015839.2:g.74351G>T, NM_001166049.1:c.*197G>T, NM_001297590.1:c.1516C>A, NM_001983.3:c.*197G>T, NM_012099.1:c.1510C>A, NP_001284519.1:p.Gln506Lys, NP_036231.1:p.Gln504Lys, XM_005258425.1:c.1516C>A, XM_005258638.1:c.*197G>T, XP_005258482.1:p.Gln506Lys, rs386580934, rs60333438
C > A
C > T
No VIP available CA VA
rs3213239 NC_000019.10:g.43576907_43576908insGGCC, NC_000019.9:g.44081059_44081060insGGCC, NG_033799.1:g.3671_3672insGGCC, NM_001193621.1:c.-18_-17insGGCC, NM_006297.2:c.-1450_-1449insGGCC, XM_011526970.1:c.-213_-212insGGCC, rs146254820
- > GGCC
No VIP available No Clinical Annotations available VA
rs34716810 NC_000019.10:g.40286682G>A, NC_000019.9:g.40792589G>A, NG_012038.2:g.3677C>T, NM_001243027.2:c.-1735C>T, NM_001243028.2:c.-1642C>T, NM_001626.5:c.-1586C>T, XM_005258648.1:c.-1319C>T, XM_005258650.1:c.-1586C>T, XM_011526617.1:c.-2299C>T, XM_011526618.1:c.-2002C>T, XM_011526620.1:c.-1319C>T, XM_011526621.1:c.-1718C>T, XM_011526622.1:c.-1586C>T, XR_935967.1:n.169+83G>A, rs62107592
G > A
No VIP available CA VA
rs3738948 NC_000002.11:g.128018063A>G, NC_000002.12:g.127260487A>G, NG_007454.1:g.38690T>C, NM_000122.1:c.2064+741T>C, NM_001303416.1:c.1872+741T>C, NM_001303418.1:c.1872+741T>C, XM_005263618.1:c.1872+741T>C, XM_005263619.1:c.1872+741T>C, XM_011510794.1:c.2082+741T>C, XM_011510795.1:c.1626+741T>C, rs57713975
A > G
No VIP available CA VA
rs3740066 NC_000010.10:g.101604207C>T, NC_000010.11:g.99844450C>T, NG_011798.1:g.66745C>T, NM_000392.4:c.3972C>T, NP_000383.1:p.Ile1324=, XM_005269536.1:c.3693C>T, XM_006717630.2:c.3276C>T, XP_005269593.1:p.Ile1231=, XP_006717693.1:p.Ile1092=, XR_945604.1:n.4161C>T, XR_945605.1:n.4036C>T, rs12780340, rs17216303, rs59292214
C > T
No VIP available No Clinical Annotations available VA
rs3740556 NC_000010.10:g.120840195G>A, NC_000010.11:g.119080683G>A, NM_003750.2:c.-7C>T, XM_005270259.1:c.-7C>T, XM_005270260.1:c.-357C>T
G > A
No VIP available No Clinical Annotations available VA
rs3775289 NC_000004.11:g.71862674T>C, NC_000004.12:g.70996957T>C, NG_023303.1:g.8410T>C, NM_000788.2:c.92-1110T>C, rs58983292
T > C
No VIP available CA No Variant Annotations available
rs3780126 NC_000008.10:g.63949912G>A, NC_000008.11:g.63037353G>A, NG_028126.1:g.6699C>T, NM_003878.2:c.109+1307C>T, XM_011517623.1:c.109+1307C>T, rs58946583
G > A
No VIP available No Clinical Annotations available VA
rs3787554 NC_000020.10:g.52782680G>A, NC_000020.11:g.54166141G>A, NG_008334.1:g.12837C>T, NM_000782.4:c.641-308C>T, NM_001128915.1:c.641-308C>T, XM_005260304.1:c.641-308C>T, XM_005260304.3:c.641-308C>T, XM_005260305.1:c.641-308C>T
G > A
No VIP available CA VA
rs3788189 NC_000021.8:g.46936583T>G, NC_000021.9:g.45516669T>G, NG_028278.1:g.30803A>C, NM_001205206.1:c.1294-1517A>C, NM_001205207.1:c.1174-529A>C, NM_194255.2:c.1294-529A>C, XM_005261163.1:c.1294-529A>C, XM_005261164.1:c.940-529A>C, XM_005261164.2:c.940-529A>C, XM_011529696.1:c.1585-529A>C, XM_011529697.1:c.1585-529A>C, XM_011529698.1:c.1360-529A>C, XM_011529699.1:c.1321-529A>C, XM_011529700.1:c.1294-529A>C, XM_011529701.1:c.1294-529A>C, XM_011529702.1:c.1294-529A>C, XM_011529703.1:c.1294-529A>C, XM_011529704.1:c.1294-529A>C, XM_011529705.1:c.1585-1517A>C, XM_011529706.1:c.1156-529A>C, XM_011529707.1:c.1584+9148A>C, XM_011529708.1:c.1294-529A>C, XM_011529709.1:c.940-529A>C, XM_011529710.1:c.940-529A>C, rs57533517
T > G
No VIP available No Clinical Annotations available VA
rs3803304 NC_000014.8:g.105239146C>G, NC_000014.9:g.104772809C>G, NG_012188.1:g.27936G>C, NM_001014431.1:c.1172+69G>C, NM_001014432.1:c.1172+69G>C, NM_005163.2:c.1172+69G>C, XM_005267401.1:c.1172+69G>C, XM_005267402.1:c.1169+69G>C, XM_011536543.1:c.1172+69G>C, XM_011536544.1:c.1172+69G>C
C > G
No VIP available No Clinical Annotations available VA
rs3817657 NC_000011.10:g.4121362T>C, NC_000011.9:g.4142592T>C, NG_027992.2:g.31669T>C, NM_001033.3:c.877-242T>C, NM_001033.4:c.877-242T>C, NM_001318064.1:c.586-242T>C, NM_001318065.1:c.-138-242T>C, XM_005253058.1:c.634-242T>C, XM_005253059.1:c.586-242T>C, XM_011520277.1:c.586-242T>C, XM_011520278.1:c.211-242T>C, XM_011520279.1:c.-138-242T>C, rs57325561
T > C
No VIP available CA VA
rs3832043 NC_000002.11:g.234580454delT, NC_000002.12:g.233671808delT, NG_002601.2:g.87065delT, NM_019075.2:c.855+34431del, NM_019075.2:c.855+34431delT, NM_019076.4:c.855+53246del, NM_019076.4:c.855+53246delT, NM_021027.2:c.-127del, NM_021027.2:c.-127delT, XR_241241.1:n.-41delT, rs150487502, rs35426722, rs371526135, rs57111427, rs67695772, rs67695773
T > -
No VIP available No Clinical Annotations available VA
rs4124874 NC_000002.11:g.234665659T>G, NC_000002.12:g.233757013T>G, NG_002601.2:g.172270T>G, NG_033238.1:g.1741T>G, NM_001072.3:c.862-10021T>G, NM_007120.2:c.868-10021T>G, NM_019075.2:c.856-10021T>G, NM_019076.4:c.856-10021T>G, NM_019077.2:c.856-10021T>G, NM_019078.1:c.868-10021T>G, NM_019093.2:c.868-10021T>G, NM_021027.2:c.856-10021T>G, NM_205862.1:c.61-10021T>G, NR_037694.1:n.-1668A>C, NR_037695.1:n.-1668A>C, NR_037696.1:n.-1668A>C, XR_241238.1:n.924-10021T>G, XR_241240.1:n.1023-10021T>G, XR_241241.1:n.942-10021T>G, rs57409706
T > G
No VIP available No Clinical Annotations available VA
rs4148323 NC_000002.11:g.234669144G>A, NC_000002.12:g.233760498G>A, NG_002601.2:g.175755G>A, NG_033238.1:g.5226G>A, NM_000463.2:c.211G>A, NM_001072.3:c.862-6536G>A, NM_007120.2:c.868-6536G>A, NM_019075.2:c.856-6536G>A, NM_019076.4:c.856-6536G>A, NM_019077.2:c.856-6536G>A, NM_019078.1:c.868-6536G>A, NM_019093.2:c.868-6536G>A, NM_021027.2:c.856-6536G>A, NM_205862.1:c.61-6536G>A, NP_000454.1:p.Gly71Arg, XR_241238.1:n.924-6536G>A, XR_241239.1:n.233G>A, XR_241240.1:n.1023-6536G>A, XR_241241.1:n.942-6536G>A, rs113525835, rs34360183, rs58105808, rs58585123
G > A
No VIP available CA VA
rs4149015 NC_000012.11:g.21283322G>A, NC_000012.12:g.21130388G>A, NG_011745.1:g.4195G>A, NM_006446.4:c.-910G>A
G > A
No VIP available CA VA
rs4149056 NC_000012.11:g.21331549T>C, NC_000012.12:g.21178615T>C, NG_011745.1:g.52422T>C, NM_006446.4:c.521T>C, NP_006437.3:p.Val174Ala, rs52816141, rs60037639
T > C
No VIP available No Clinical Annotations available VA
rs4149117 NC_000012.11:g.21011480T>G, NC_000012.12:g.20858546T>G, NG_032071.1:g.52843T>G, NM_019844.3:c.334T>G, NP_062818.1:p.Ser112Ala, XM_005253347.1:c.334T>G, XP_005253404.1:p.Ser112Ala, rs52800447, rs58702833
T > G
No VIP available CA VA
rs430397 NC_000009.11:g.128001119C>T, NC_000009.12:g.125238840C>T, NG_027761.1:g.7548G>A, NM_005347.4:c.997-13G>A, rs11567635, rs35719250, rs3765559, rs52822178, rs60157411
C > T
No VIP available CA VA
rs4353229 NC_000010.10:g.115489589T>C, NC_000010.11:g.113729830T>C, NM_001227.4:c.*290T>C, NM_001267056.1:c.*290T>C, NM_001267057.1:c.*290T>C, NM_001267058.1:c.*290T>C, NM_033338.5:c.*290T>C, NM_033339.4:c.*290T>C, NM_033340.3:c.*406T>C, XM_006718017.2:c.*290T>C, XM_006718018.1:c.*290T>C, XM_011540259.1:c.*290T>C, XM_011540260.1:c.*290T>C, rs57355355
T > C
No VIP available CA VA
rs4413407 NC_000004.11:g.105393361A>G, NC_000004.12:g.104472204A>G, NM_025212.3:c.*118T>C, NR_132741.1:n.440T>C, XM_011532284.1:c.*118T>C
A > -
A > G
No VIP available CA VA
rs442767 NC_000005.10:g.80655677G>T, NC_000005.9:g.79951496G>T, NG_016607.1:g.6203G>T, NG_023304.1:g.4305C>A, NM_000791.3:c.-1188C>A, NM_001290354.1:c.-1294C>A, NM_001290357.1:c.-1188C>A, NM_002439.4:c.237+713G>T, NR_110936.1:n.-696C>A, XM_005248455.1:c.-1645C>A, XM_005248456.1:c.-1294C>A, rs36231429
G > T
No VIP available CA VA
rs4492666 NC_000001.10:g.47800845A>C, NC_000001.11:g.47335173A>C, NM_001136140.1:c.171+1057A>C, NM_016308.2:c.171+1057A>C, NR_046394.1:n.320+1057A>C, NR_046395.1:n.320+1057A>C, rs61400292
A > C
A > T
No VIP available CA VA
rs451774 NC_000006.11:g.28502550A>G, NC_000006.12:g.28534773A>G, NM_001509.2:c.*606A>G, NM_003996.3:c.*851A>G, NT_113891.2:g.24754A>G, NT_113891.3:g.24654A>G, XM_011514527.1:c.*606A>G, XM_011514528.1:c.*606A>G, XM_011514529.1:c.*606A>G, XM_011514530.1:c.*606A>G, XM_011547233.1:c.*606A>G, XM_011547234.1:c.*606A>G, XM_011547235.1:c.*606A>G, XM_011547236.1:c.*606A>G, rs115878751, rs118080793, rs60258350
A > G
No VIP available CA VA
rs4541111 NC_000017.10:g.63534538C>A, NC_000017.11:g.65538420C>A, NG_012142.1:g.28203G>T, NM_004655.3:c.1060-77G>T, XM_005257716.1:c.1060-77G>T, XM_005257717.1:c.1060-77G>T, XM_005257718.1:c.1060-77G>T, XM_005257719.1:c.1060-77G>T, XM_011525319.1:c.1060-77G>T, XM_011525320.1:c.1060-77G>T, XM_011525321.1:c.1060-77G>T, XM_011525322.1:c.1060-77G>T, rs59628788
C > A
No VIP available No Clinical Annotations available VA
rs45445694 NC_000018.10:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NC_000018.9:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NG_028255.1:g.5043_5070CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NM_001012716.2:c.*34+169_*34+196CGGGACGGAGGCAGGCCAAGTGGCGCGG[2][3][4][7][8][9], NM_001071.2:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258137.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258138.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], rs34743033 (retired)
No VIP available No Clinical Annotations available VA
rs4742 NC_000004.11:g.183815688A>G, NC_000004.12:g.182894535A>G, NM_001012732.1:c.348T>C, NM_001921.2:c.315T>C, NP_001012750.1:p.Val116=, NP_001912.2:p.Val105=, XM_005262778.1:c.348T>C, XM_005262778.2:c.348T>C, XM_005262779.1:c.315T>C, XM_005262779.2:c.315T>C, XM_005262780.1:c.315T>C, XM_005262780.2:c.315T>C, XM_005262781.1:c.138T>C, XM_005262781.3:c.138T>C, XM_005262782.1:c.138T>C, XM_005262782.2:c.138T>C, XM_006714115.2:c.138T>C, XM_006714116.2:c.138T>C, XM_011531674.1:c.315T>C, XM_011531675.1:c.138T>C, XM_011531676.1:c.138T>C, XM_011531677.1:c.138T>C, XP_005262835.1:p.Val116=, XP_005262836.1:p.Val105=, XP_005262837.1:p.Val105=, XP_005262838.1:p.Val46=, XP_005262839.1:p.Val46=, XP_006714178.1:p.Val46=, XP_006714179.1:p.Val46=, XP_011529976.1:p.Val105=, XP_011529977.1:p.Val46=, XP_011529978.1:p.Val46=, XP_011529979.1:p.Val46=, rs1130879, rs117549811, rs17849459, rs3190286, rs57636648, rs7663494
A > G
No VIP available CA VA
rs4752219 NC_000010.10:g.120615561C>T, NC_000010.11:g.118856049C>T, XR_946355.1:n.122+10138G>A, rs56609528, rs60729048
C > T
No VIP available CA VA
rs4752220 NC_000010.10:g.120615609A>G, NC_000010.11:g.118856097A>G, XR_946355.1:n.122+10090T>C, rs60249979
A > G
No VIP available No Clinical Annotations available VA
rs4752269 NC_000010.10:g.121037952C>T, NC_000010.11:g.119278440C>T, NM_005308.2:c.53-48076C>T, XM_005269707.1:c.53-48076C>T, XM_005269708.1:c.52+70471C>T, rs17606964, rs57284838
C > T
No VIP available No Clinical Annotations available VA
rs487989 NC_000011.10:g.65297219G>A, NC_000011.9:g.65064690G>A, NM_002689.3:c.1747G>A, NP_002680.2:p.Gly583Arg, XM_011544877.1:c.1647+1229G>A, XM_011544878.1:c.1647+1229G>A, XM_011544879.1:c.*114G>A, XM_011544880.1:c.*14+1229G>A, XM_011544881.1:c.*15-453G>A, rs1211593, rs3881265, rs57424239
G > A
No VIP available CA VA
A > G
No VIP available CA VA
rs518329 NC_000023.10:g.23695236T>C, NC_000023.11:g.23677119T>C, NG_012563.1:g.14592T>C, NM_006406.1:c.476+2013T>C, XM_005274438.1:c.434+2013T>C, rs1033051, rs57824784
T > C
No VIP available No Clinical Annotations available VA
C > A
C > G
C > T
No VIP available No Clinical Annotations available VA
rs5925720 NC_000023.10:g.23019317G>T, NC_000023.11:g.23001200G>T, NG_021439.1:g.6231G>T, NM_182699.3:c.1143G>T, NP_874358.2:p.Met381Ile, NR_073010.1:n.343+62838C>A, rs58250497
G > T
No VIP available CA VA
rs61734430 NC_000011.10:g.72139084C>T, NC_000011.9:g.71850130C>T, NG_032935.1:g.8360C>T, NM_000804.3:c.292C>T, NM_001318045.1:c.19C>T, NP_000795.2:p.Arg98Cys, NP_001304974.1:p.Arg7Cys, XM_011544873.1:c.292C>T, XM_011544874.1:c.292C>T, XM_011544875.1:c.19C>T, XM_011544876.1:c.81+24C>T, XP_011543175.1:p.Arg98Cys, XP_011543176.1:p.Arg98Cys, XP_011543177.1:p.Arg7Cys
C > T
No VIP available No Clinical Annotations available VA
rs62107593 NC_000019.10:g.40287019C>G, NC_000019.9:g.40792926C>G, NG_012038.2:g.3340G>C, NM_001243027.2:c.-2072G>C, NM_001243028.2:c.-1979G>C, NM_001626.5:c.-1923G>C, XM_005258648.1:c.-1656G>C, XM_005258650.1:c.-1923G>C, XM_011526620.1:c.-1656G>C, XM_011526621.1:c.-2055G>C, XM_011526622.1:c.-1923G>C, XR_935967.1:n.169+420C>G
C > G
No VIP available No Clinical Annotations available VA
G > A
No VIP available CA VA
rs7091672 NC_000010.10:g.120596421T>C, NC_000010.11:g.118836909T>C, XR_946355.1:n.122+29278A>G, rs57277727
T > C
No VIP available No Clinical Annotations available VA
rs712829 NC_000007.13:g.55086755G>T, NC_000007.14:g.55019062G>T, NG_007726.3:g.5031G>T, NM_005228.3:c.-216G>T, NM_201282.1:c.-216G>T, NM_201283.1:c.-216G>T, NM_201284.1:c.-216G>T, XM_005271746.1:c.-216G>T, XM_005271748.1:c.-216G>T, rs17288931
G > T
No VIP available CA VA
G > T
No VIP available No Clinical Annotations available VA
rs717620 NC_000010.10:g.101542578C>T, NC_000010.11:g.99782821C>T, NG_011798.1:g.5116C>T, NM_000392.4:c.-24C>T, XM_005269536.1:c.-24C>T, XM_006717631.2:c.-24C>T, XM_011539291.1:c.-24C>T, XR_945604.1:n.166C>T, XR_945605.1:n.168C>T, rs17216163, rs386485129, rs58371376
C > T
No VIP available CA VA
rs720106 NC_000011.10:g.4118748T>C, NC_000011.9:g.4139978T>C, NG_027992.2:g.29055T>C, NM_001033.3:c.792+287T>C, NM_001033.4:c.792+287T>C, NM_001318064.1:c.501+287T>C, NM_001318065.1:c.-265+287T>C, XM_005253058.1:c.549+287T>C, XM_005253059.1:c.501+287T>C, XM_011520277.1:c.501+287T>C, XM_011520278.1:c.126+287T>C, XM_011520279.1:c.-265+287T>C
T > C
No VIP available No Clinical Annotations available VA
rs725518 NC_000011.10:g.4107615G>A, NC_000011.9:g.4128845G>A, NG_027992.2:g.17922G>A, NM_001033.3:c.387+80G>A, NM_001033.4:c.387+80G>A, NM_001318064.1:c.96+80G>A, XM_005253058.1:c.202+1476G>A, XM_005253059.1:c.96+80G>A, XM_011520277.1:c.96+80G>A, rs17423023, rs386608733, rs61333041
G > A
No VIP available No Clinical Annotations available VA
rs726501 NC_000005.10:g.56832039G>A, NC_000005.9:g.56127866G>A, NG_031884.1:g.21967G>A, NM_005921.1:c.482+15984G>A, XM_005248519.1:c.71+11223G>A, XM_005248519.3:c.104+11223G>A, XM_005248520.1:c.-8+14923G>A, XM_011543406.1:c.227+15704G>A, XM_011543407.1:c.482+15984G>A, XM_011543408.1:c.482+15984G>A, rs57031684
G > A
No VIP available CA VA
rs7311358 NC_000012.11:g.21015760G>A, NC_000012.12:g.20862826G>A, NG_032071.1:g.57123G>A, NM_019844.3:c.699G>A, NP_062818.1:p.Met233Ile, XM_005253347.1:c.699G>A, XP_005253404.1:p.Met233Ile, rs60001963
G > A
No VIP available No Clinical Annotations available VA
rs74090038 NC_000014.8:g.105262781C>T, NC_000014.9:g.104796444C>T, NG_012188.1:g.4300G>A, NG_042073.1:g.264C>T, NM_001014431.1:c.-1041G>A, NM_001014432.1:c.-1125G>A, XM_005267401.1:c.-2405G>A, XM_011536543.1:c.-2583G>A, XM_011536544.1:c.-3397G>A
C > T
No VIP available No Clinical Annotations available VA
rs763110 NC_000001.10:g.172627498C=, NC_000001.10:g.172627498C>T, NC_000001.11:g.172658358C=, NC_000001.11:g.172658358C>T, NG_007269.1:g.4314C=, NG_007269.1:g.4314C>T, NM_000639.2:c.-157-687C>T, NM_000639.2:c.-844C=, NM_001302746.1:c.-844C=, NM_001302746.1:c.-844C>T, rs59042607
C > T
No VIP available No Clinical Annotations available VA
A > C
A > G
No VIP available No Clinical Annotations available VA
A > G
No VIP available No Clinical Annotations available VA
rs776746 NC_000007.13:g.99270539C>T, NC_000007.14:g.99672916T>C, NG_007938.1:g.12083G=, NG_007938.1:g.12083G>A, NM_000777.4:c.219-237A>G, NM_000777.4:c.219-237G>A, NM_001190484.2:c.219-237A>G, NM_001190484.2:c.219-237G>A, NM_001291829.1:c.-253-1A>G, NM_001291829.1:c.-253-1G>A, NM_001291830.1:c.189-237A>G, NM_001291830.1:c.189-237G>A, NR_033807.2:n.717-1A>G, NR_033807.2:n.717-1G>A, NR_033808.1:n.689-1G>A, NR_033809.1:n.581-237G>A, NR_033810.1:n.689-1G>A, NR_033811.1:n.321-1G>A, NR_033812.1:n.321-1G>A, XM_005250169.1:c.189-237G>A, XM_005250170.1:c.-357-1G>A, XM_005250171.1:c.-253-1G>A, XM_005250172.1:c.-254G>A, XM_005250173.1:c.-331-237G>A, XM_005250198.1:c.806-4288C>T, XM_006715859.2:c.219-237A>G, XM_011515843.1:c.-254A>G, XM_011515844.1:c.-229-237A>G, XM_011515845.1:c.-463-1A>G, XM_011515846.1:c.-331-237A>G, XM_011515847.1:c.-571-1A>G, XR_927383.1:n.344-237A>G, XR_927402.1:n.1466+48736T>C, rs10361242, rs11266830, rs386613022, rs58244770
C > T
No VIP available CA VA
rs7779029 NC_000007.13:g.80532112T>C, NC_000007.14:g.80902796T>C, NM_006379.3:c.103+13883A>G, XM_005250112.1:c.157+13883A>G, XM_005250113.1:c.-72+3033A>G, rs61425409
T > C
No VIP available CA VA
rs7851395 NC_000009.11:g.116002464A>G, NC_000009.12:g.113240184A>G, NM_001859.3:c.-35-15930A>G
A > G
No VIP available CA VA
rs7921977 NC_000010.10:g.115439569C>T, NC_000010.11:g.113679810C>T, NM_001227.4:c.-169C>T, NM_001267056.1:c.-1+461C>T, NM_001267057.1:c.56C>T, NM_033338.5:c.-177C>T, NM_033339.4:c.-243C>T, NM_033340.3:c.-1+461C>T, NP_001253986.1:p.Thr19Ile, XM_006718018.1:c.-8+461C>T, rs386479493, rs56841072
C > T
No VIP available No Clinical Annotations available VA
rs7940013 NC_000011.10:g.4117074C>T, NC_000011.9:g.4138304C>T, NG_027992.2:g.27381C>T, NM_001033.3:c.651-1246C>T, NM_001033.4:c.651-1246C>T, NM_001318064.1:c.360-1246C>T, NM_001318065.1:c.-407+714C>T, XM_005253058.1:c.408-1246C>T, XM_005253059.1:c.360-1246C>T, XM_011520277.1:c.360-1246C>T, XM_011520278.1:c.-17+714C>T, XM_011520279.1:c.-407+714C>T, rs59381386, rs61670155
C > T
No VIP available No Clinical Annotations available VA
(TA)6 > (TA)5
(TA)6 > (TA)7
(TA)6 > (TA)8
No VIP available No Clinical Annotations available VA
rs8187710 NC_000010.10:g.101611294G>A, NC_000010.11:g.99851537G>A, NG_011798.1:g.73832G>A, NM_000392.4:c.4544G>A, NP_000383.1:p.Cys1515Tyr, XM_005269536.1:c.4265G>A, XM_006717630.2:c.3848G>A, XP_005269593.1:p.Cys1422Tyr, XP_006717693.1:p.Cys1283Tyr, XR_945605.1:n.4608G>A, rs17222568, rs52804507, rs58135906
G > A
No VIP available No Clinical Annotations available VA
rs8187758 NC_000015.10:g.84905644C>A, NC_000015.9:g.85448875C>A, NM_001287761.1:c.709C>A, NM_001287762.1:c.709C>A, NM_004213.4:c.709C>A, NP_001274690.1:p.Gln237Lys, NP_001274691.1:p.Gln237Lys, NP_004204.3:p.Gln237Lys, XM_005254988.1:c.709C>A, XM_005254989.1:c.709C>A, XM_005254990.1:c.709C>A, XM_005254991.1:c.709C>A, XM_005254992.1:c.682C>A, XM_005254993.1:c.709C>A, XM_005254994.1:c.475C>A, XM_005254995.1:c.709C>A, XM_011522203.1:c.709C>A, XM_011522204.1:c.709C>A, XM_011522205.1:c.709C>A, XM_011522206.1:c.709C>A, XM_011522207.1:c.709C>A, XM_011522208.1:c.682C>A, XM_011522209.1:c.709C>A, XM_011522210.1:c.709C>A, XM_011522211.1:c.475C>A, XM_011522212.1:c.709C>A, XM_011522213.1:c.709C>A, XM_011522214.1:c.709C>A, XM_011522215.1:c.709C>A, XM_011522216.1:c.475C>A, XM_011522217.1:c.709C>A, XM_011522218.1:c.709C>A, XP_005255045.1:p.Gln237Lys, XP_005255046.1:p.Gln237Lys, XP_005255047.1:p.Gln237Lys, XP_005255048.1:p.Gln237Lys, XP_005255049.1:p.Gln228Lys, XP_005255050.1:p.Gln237Lys, XP_005255051.1:p.Gln159Lys, XP_005255052.1:p.Gln237Lys, XP_011520505.1:p.Gln237Lys, XP_011520506.1:p.Gln237Lys, XP_011520507.1:p.Gln237Lys, XP_011520508.1:p.Gln237Lys, XP_011520509.1:p.Gln237Lys, XP_011520510.1:p.Gln228Lys, XP_011520511.1:p.Gln237Lys, XP_011520512.1:p.Gln237Lys, XP_011520513.1:p.Gln159Lys, XP_011520514.1:p.Gln237Lys, XP_011520515.1:p.Gln237Lys, XP_011520516.1:p.Gln237Lys, XP_011520517.1:p.Gln237Lys, XP_011520518.1:p.Gln159Lys, XP_011520519.1:p.Gln237Lys, XP_011520520.1:p.Gln237Lys, XR_931944.1:n.915C>A, XR_931945.1:n.915C>A, rs17222323, rs52791431, rs60871224
C > A
No VIP available No Clinical Annotations available VA
rs861539 NC_000014.8:g.104165753G>A, NC_000014.9:g.103699416G>A, NG_011516.1:g.21071C>T, NG_012307.1:g.75229G>A, NM_001100118.1:c.722C>T, NM_001100119.1:c.722C>T, NM_001130107.1:c.1782-1239G>A, NM_005432.3:c.722C>T, NM_182923.3:c.1651-1239G>A, NP_001093588.1:p.Thr241Met, NP_001093589.1:p.Thr241Met, NP_005423.1:p.Thr241Met, XM_005267599.1:c.1924-1239G>A, XM_005267600.1:c.*17-1239G>A, XM_005267602.1:c.1897-1239G>A, XM_005267603.1:c.*17-1239G>A, XM_005267604.1:c.1857-1239G>A, XM_005267605.1:c.1849-1239G>A, XM_005267606.1:c.*17-1239G>A, XM_005267607.1:c.1830-1239G>A, XM_005267608.1:c.1825-1239G>A, XM_005267609.1:c.1822-1239G>A, XM_005267610.1:c.*46-1239G>A, XM_005267612.1:c.*17-1239G>A, XM_005267613.1:c.1758-1239G>A, XM_005267614.1:c.1755-1239G>A, XM_005267615.1:c.1726-1239G>A, XM_005267616.1:c.*17-1239G>A, XM_005267617.1:c.1699-1239G>A, XM_005267618.1:c.*17-1239G>A, XM_005267624.1:c.1624-1239G>A, XM_005268045.1:c.722C>T, XM_005268046.1:c.722C>T, XM_005268047.1:c.722C>T, XM_011537138.1:c.722C>T, XP_005268102.1:p.Thr241Met, XP_005268103.1:p.Thr241Met, XP_005268104.1:p.Thr241Met, XP_011535440.1:p.Thr241Met, rs1734804, rs17435402, rs17850783, rs3212111, rs56934996
G > A
No VIP available CA VA
rs870995 NC_000003.11:g.178913006C>A, NC_000003.12:g.179195218C>A, NG_012113.2:g.51696C>A, NM_006218.2:c.-76-3532C>A, XM_006713658.2:c.-76-3532C>A, XM_011512894.1:c.-76-3532C>A, rs59793299
C > A
No VIP available CA VA
rs914232 NC_000021.8:g.46952750T>C, NC_000021.9:g.45532836T>C, NG_028278.1:g.14636A>G, NM_001205206.1:c.190-688A>G, NM_001205207.1:c.70-688A>G, NM_194255.2:c.190-688A>G, XM_005261163.1:c.190-688A>G, XM_005261164.1:c.-165-688A>G, XM_005261164.2:c.-165-688A>G, XM_011529696.1:c.481-688A>G, XM_011529697.1:c.481-688A>G, XM_011529698.1:c.256-688A>G, XM_011529699.1:c.217-688A>G, XM_011529700.1:c.190-688A>G, XM_011529701.1:c.190-688A>G, XM_011529702.1:c.190-688A>G, XM_011529703.1:c.190-688A>G, XM_011529704.1:c.190-688A>G, XM_011529705.1:c.481-688A>G, XM_011529706.1:c.52-688A>G, XM_011529707.1:c.481-688A>G, XM_011529708.1:c.190-688A>G, XM_011529709.1:c.-165-688A>G, XM_011529710.1:c.-165-688A>G, rs56615950
T > C
No VIP available CA VA
rs9597 NC_000016.10:g.1324950C>G, NC_000016.9:g.1374951C>G, NM_003345.4:c.*157C>G, NM_194259.2:c.*157C>G, NM_194260.2:c.*157C>G, NM_194261.2:c.*157C>G, XM_005255544.1:c.*157C>G, rs74248366
C > G
No VIP available No Clinical Annotations available VA
rs9937 NC_000011.10:g.4138227A>G, NC_000011.9:g.4159457A>G, NG_027992.2:g.48534A>G, NM_001033.3:c.2223A>G, NM_001033.4:c.2223A>G, NM_001318064.1:c.1932A>G, NM_001318065.1:c.1209A>G, NP_001024.1:p.Thr741=, NP_001304993.1:p.Thr644=, NP_001304994.1:p.Thr403=, XM_005253058.1:c.1980A>G, XM_005253059.1:c.1932A>G, XM_011520277.1:c.1932A>G, XM_011520278.1:c.1557A>G, XM_011520279.1:c.1209A>G, XP_005253115.1:p.Thr660=, XP_005253116.1:p.Thr644=, XP_011518579.1:p.Thr644=, XP_011518580.1:p.Thr519=, XP_011518581.1:p.Thr403=, rs1042857, rs17295553, rs17349998, rs17398272, rs17850106, rs2228120, rs3177016, rs59628733
A > G
No VIP available CA VA
rs9981861 NC_000021.8:g.41415044T>C, NC_000021.9:g.40043117T>C, NM_001271534.1:c.5384-444A>G, NM_001389.3:c.5384-444A>G, NR_073202.1:n.5645-444A>G, XM_011529481.1:c.3020-444A>G, rs57793011
T > C
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 147


Alternate Names: 
Carcinoma, Non Small Cell Lung; Carcinoma, Non-Small Cell Lung; Carcinomas, Non-Small-Cell Lung; Lung Carcinoma, Non-Small-Cell; Lung Carcinomas, Non-Small-Cell; NSCLC; Non Small Cell Lung Carcinoma; Non-Small-Cell Lung Carcinoma; Non-Small-Cell Lung Carcinomas; Non-small cell lung cancer
PharmGKB Accession Id: PA443622
External Vocabularies

Curated Information ?

Curated Information ?

Relationships from National Drug File - Reference Terminology (NDF-RT)

May Treat
No related diseases are available

Publications related to Carcinoma, Non-Small-Cell Lung: 210

No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association Between SLC16A5 Genetic Variation and Cisplatin-Induced Ototoxic Effects in Adult Patients With Testicular Cancer. JAMA oncology. 2017. Drögemöller Britt I, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The role of germline variants in chemotherapy outcome in brain tumors: a systematic review of pharmacogenetic studies. Pharmacogenomics. 2017. Klumpers Marije J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Clinical-pharmacogenetic models for personalized cancer treatment: application to malignant mesothelioma. Scientific reports. 2017. Goričar Katja, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Influence of the KDM4A rs586339 polymorphism on overall survival in Asian non-small-cell lung cancer patients. Pharmacogenetics and genomics. 2017. Marvalim Charlie, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic variants associated with outcome in patients with advanced gastric cancer treated with fluoropyrimidine and platinum-based triplet combinations: a pooled analysis of three prospective studies. The pharmacogenomics journal. 2016. Meulendijks D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
RICTOR polymorphisms affect efficiency of platinum-based chemotherapy in Chinese non-small-cell lung cancer patients. Pharmacogenomics. 2016. Wang Shiming, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic predictors of toxicity to platinum based chemotherapy in non-small cell lung cancer patients. Pharmacological research. 2016. Pérez-Ramírez Cristina, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
miRNAs: mediators of ErbB family targeted therapy resistance. Pharmacogenomics. 2016. Adem Bárbara Filipa, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacogenomics of platinum-based chemotherapy response in NSCLC: a genotyping study and a pooled analysis. Oncotarget. 2016. Chen Juan, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Determinants of Gefitinib toxicity in advanced non-small cell lung cancer (NSCLC): a pharmacogenomic study of metabolic enzymes and transporters. The pharmacogenomics journal. 2016. Ma Y, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of pharmacokinetics and pharmacogenomics with safety and efficacy of gefitinib in patients with EGFR mutation positive advanced non-small cell lung cancer. Lung cancer (Amsterdam, Netherlands). 2016. Hirose Takashi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The potential anticancer effect of beta-blockers and the genetic variations involved in the interindividual difference. Pharmacogenomics. 2016. He Ruo-Hui, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Associations of genetic polymorphisms of the transporters organic cation transporter 2 (OCT2), multidrug and toxin extrusion 1 (MATE1), and ATP-binding cassette subfamily C member 2 (ABCC2) with platinum-based chemotherapy response and toxicity in non-small cell lung cancer patients. Chinese journal of cancer. 2016. Qian Chen-Yue, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic analysis of advanced non-small-cell lung cancer patients treated with first-line paclitaxel and carboplatin chemotherapy. Pharmacogenetics and genomics. 2015. Park Hyung Soon, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Ceritinib for the treatment of patients with anaplastic lymphoma kinase (ALK)-positive metastatic non-small cell lung cancer. Expert review of clinical pharmacology. 2015. Landi Lorenza, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Impact of single nucleotide polymorphisms on severe hepatotoxicity induced by EGFR tyrosine kinase inhibitors in patients with non-small cell lung cancer harboring EGFR mutations. Lung cancer (Amsterdam, Netherlands). 2015. Sugiyama Eri, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PTEN and PI3K/AKT in non-small-cell lung cancer. Pharmacogenomics. 2015. Pérez-Ramírez Cristina, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Comparison of clinical outcomes of patients with non-small-cell lung cancer harbouring epidermal growth factor receptor exon 19 or exon 21 mutations after tyrosine kinase inhibitors treatment: a meta-analysis. European journal of clinical pharmacology. 2015. Sheng Miaomiao, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics in the treatment of lung cancer: an update. Pharmacogenomics. 2015. Morales-Espinosa Daniela, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Using whole exome sequencing to identify genetic markers for carboplatin and gemcitabine-induced toxicities. Clinical cancer research : an official journal of the American Association for Cancer Research. 2015. Green Henrik, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Relationship Among Gefitinib Exposure, Polymorphisms of Its Metabolizing Enzymes and Transporters, and Side Effects in Japanese Patients With Non-Small-Cell Lung Cancer. Clinical lung cancer. 2015. Kobayashi Hiroyuki, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Meta-analysis of the risks of hypertension and QTc prolongation in patients with advanced non-small cell lung cancer who were receiving vandetanib. European journal of clinical pharmacology. 2015. Liu Ying, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of positively selected eIF3a polymorphisms with toxicity of platinum-based chemotherapy in NSCLC patients. Acta pharmacologica Sinica. 2015. Yin Ji-ye, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The next-generation ALK inhibitors. Current opinion in oncology. 2015. Pall Georg. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Prognostic and predictive significance of thymidylate synthase protein expression in non-small cell lung cancer: a systematic review and meta-analysis. Cancer biomarkers : section A of Disease markers. 2015. Liu Qingyun, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Phase II trial of carboplatin and pemetrexed as first-line chemotherapy for non-squamous non-small cell lung cancer, and correlation between the efficacy/toxicity and genetic polymorphisms associated with pemetrexed metabolism: Hokkaido Lung Cancer Clinical Study Group Trial (HOT) 0902. Cancer chemotherapy and pharmacology. 2014. Kanazawa Kenya, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Novel targeted therapies for resistant ALK-rearranged non-small-cell lung cancer: ceritinib and beyond. OncoTargets and therapy. 2015. Kanaan Zeyad, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Assessment of high-sensitive methods for the detection of EGFR mutations in circulating free tumor DNA from NSCLC patients. Pharmacogenomics. 2015. Pasquale Raffaella, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Correlation of genetic polymorphisms with clinical outcomes in pemetrexed-treated advanced lung adenocarcinoma patients. Pharmacogenomics. 2015. Woo Hye In, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MET: a new promising biomarker in non-small-cell lung carcinoma. Pharmacogenomics. 2015. Pérez-Ramírez Cristina, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinicopathological characteristics of patients with non-small-cell lung cancer who harbor EML4-ALK fusion gene: a meta-analysis. PloS one. 2015. Zhao Fengzhi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Differential Activity of Nivolumab, Pembrolizumab and MPDL3280A according to the Tumor Expression of Programmed Death-Ligand-1 (PD-L1): Sensitivity Analysis of Trials in Melanoma, Lung and Genitourinary Cancers. PloS one. 2015. Carbognin Luisa, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Wnt signaling pathway pharmacogenetics in non-small cell lung cancer. The pharmacogenomics journal. 2014. Stewart D J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetics of the DNA repair pathways in advanced non-small cell lung cancer patients treated with platinum-based chemotherapy. Cancer letters. 2014. Sullivan Ivana, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetics of pemetrexed combination therapy in lung cancer: pathway analysis reveals novel toxicity associations. The pharmacogenomics journal. 2014. Corrigan A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
The prognostic impact of KRAS, its codon and amino acid specific mutations, on survival in resected stage I lung adenocarcinoma. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2014. Izar Benjamin, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of solute carrier transporters in pancreatic cancer: a review. Pharmacogenomics. 2014. Lemstrová Radmila, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenomic assessment of cisplatin-based chemotherapy outcomes in ovarian cancer. Pharmacogenomics. 2014. Khrunin Andrey V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Novel association between CD74 polymorphisms and hematologic toxicity in patients with NSCLC after platinum-based chemotherapy. Clinical lung cancer. 2014. Tan Xiaoming, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetics of DNA repair gene polymorphisms in non-small-cell lung carcinoma patients on platinum-based chemotherapy. Genetics and molecular research : GMR. 2014. Zhang L, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Multi-loci analysis reveals the importance of genetic variations in sensitivity of platinum-based chemotherapy in non-small-cell lung cancer. Molecular carcinogenesis. 2013. Liu Li, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
ERCC1 Cys8092Ala and XRCC1 Arg399Gln polymorphisms predict progression-free survival after curative radiotherapy for nasopharyngeal carcinoma. PloS one. 2014. Jin Hekun, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Oxidative stress-related genetic polymorphisms are associated with the prognosis of metastatic gastric cancer patients treated with epirubicin, oxaliplatin and 5-Fluorouracil combination chemotherapy. PloS one. 2014. Geng Ruixuan, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ALK as a paradigm of oncogenic promiscuity: different mechanisms of activation and different fusion partners drive tumors of different lineages. Cancer genetics. 2013. Mariño-Enríquez Adrian, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Polymorphisms of CYP2D6 gene and gefitinib-induced hepatotoxicity. Clinical lung cancer. 2013. Takimoto Takayuki, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
ERCC1 C8092A (rs3212986) polymorphism as a predictive marker in esophageal cancer patients treated with cisplatin/5-FU-based neoadjuvant therapy. Pharmacogenetics and genomics. 2013. Rumiato Enrica, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
PharmGKB summary: very important pharmacogene information for the epidermal growth factor receptor. Pharmacogenetics and genomics. 2013. Hodoglugil Ugur, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Intergenic polymorphisms in the amphiregulin gene region as biomarkers in metastatic colorectal cancer patients treated with anti-EGFR plus irinotecan. The pharmacogenomics journal. 2013. Sebio A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenomic assessment of outcomes of pemetrexed-treated patients with adenocarcinoma of the lung. Yonsei medical journal. 2013. Jung Minkyu, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
XBP1 promoter polymorphism modulates platinum-based chemotherapy gastrointestinal toxicity for advanced non-small cell lung cancer patients. Lung cancer (Amsterdam, Netherlands). 2013. Peng J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Implications of Genome-Wide Association Studies in Cancer Therapeutics. British journal of clinical pharmacology. 2013. Patel Jai N, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
A phase I/II pharmacokinetic and pharmacogenomic study of calcitriol in combination with cisplatin and docetaxel in advanced non-small-cell lung cancer. Cancer chemotherapy and pharmacology. 2013. Ramnath N, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Challenges in pharmacogenetics. European journal of clinical pharmacology. 2013. Cascorbi Ingolf, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DNA repair and cytotoxic drugs: the potential role of RAD51 in clinical outcome of non-small-cell lung cancer patients. Pharmacogenomics. 2013. Nogueira Augusto, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Association between eIF3alpha polymorphism and severe toxicity caused by platinum-based chemotherapy in non-small cell lung cancer patients. British journal of clinical pharmacology. 2013. Xu Xiaojing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The A/G allele of eIF3a rs3740556 predicts platinum-based chemotherapy resistance in lung cancer patients. Lung cancer (Amsterdam, Netherlands). 2013. Xu Xiaojing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
XRCC3 Thr241Met polymorphism and clinical outcomes of NSCLC patients receiving platinum-based chemotherapy: a systematic review and meta-analysis. PloS one. 2013. Shen Xiao-yong, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Impact of Systematic EGFR and KRAS Mutation Evaluation on Progression-Free Survival and Overall Survival in Patients with Advanced Non-Small-Cell Lung Cancer Treated by Erlotinib in a French Prospective Cohort (ERMETIC Project-Part 2). Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2012. Cadranel Jacques, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of CASP7 polymorphisms and survival of patients with non-small cell lung cancer with platinum-based chemotherapy treatment. Chest. 2012. Qian Ji, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Efficacy of EGFR tyrosine kinase inhibitors for non-adenocarcinoma NSCLC patients with EGFR mutation. Cancer chemotherapy and pharmacology. 2012. Cho Su-Hee, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
High incidence of severe neutropenia after gemcitabine-based chemotherapy in Chinese cancer patients with CDA 79A>C mutation. Clinica chimica acta; international journal of clinical chemistry. 2012. Xu Jialin, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics and pharmacogenomics: role of mutational analysis in anti-cancer targeted therapy. The pharmacogenomics journal. 2012. Savonarola A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
An intronic polymorphism in GRP78 improves chemotherapeutic prediction in non-small cell lung cancer. Chest. 2012. Zhu Xiao, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic polymorphism of copper transporter protein 1 is related to platinum resistance in Chinese non-small cell lung carcinoma patients. Clinical and experimental pharmacology & physiology. 2012. Xu Xiaojing, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A genome-wide association study for irinotecan-related severe toxicities in patients with advanced non-small-cell lung cancer. The pharmacogenomics journal. 2012. Han J-Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Associations Between ABCC2 Polymorphisms and Cisplatin Disposition and Efficacy. Clinical pharmacology and therapeutics. 2012. Sprowl J A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ROS1 as a 'druggable' receptor tyrosine kinase: lessons learned from inhibiting the ALK pathway. Expert review of anticancer therapy. 2012. Ou Sai-Hong Ignatius, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
First-SIGNAL: first-line single-agent iressa versus gemcitabine and cisplatin trial in never-smokers with adenocarcinoma of the lung. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2012. Han Ji-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Prediction of copper transport protein 1 (CTR1) genotype on severe cisplatin induced toxicity in non-small cell lung cancer (NSCLC) patients. Lung cancer (Amsterdam, Netherlands). 2012. Xu Xiaojing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Association of ABCB1 polymorphisms with erlotinib pharmacokinetics and toxicity in Japanese patients with non-small-cell lung cancer. Pharmacogenomics. 2012. Hamada Akinobu, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Plasma epidermal growth factor receptor mutation analysis and possible clinical applications in pulmonary adenocarcinoma patients treated with erlotinib. Oncology letters. 2012. Chen Yuh-Min, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association between polymorphisms of ERCC1 and survival in epithelial ovarian cancer patients with chemotherapy. Pharmacogenomics. 2012. Yan Li, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Erlotinib versus standard chemotherapy as first-line treatment for European patients with advanced EGFR mutation-positive non-small-cell lung cancer (EURTAC): a multicentre, open-label, randomised phase 3 trial. The lancet oncology. 2012. Rosell Rafael, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pretreatment epidermal growth factor receptor (EGFR) T790M mutation predicts shorter EGFR tyrosine kinase inhibitor response duration in patients with non-small-cell lung cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2012. Su Kang-Yi, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic analysis of BR.21, a placebo-controlled randomized phase III clinical trial of erlotinib in advanced non-small cell lung cancer. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2012. Liu Geoffrey, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Gene polymorphisms, pharmacokinetics, and hematological toxicity in advanced non-small-cell lung cancer patients receiving cisplatin/gemcitabine. Cancer chemotherapy and pharmacology. 2012. Joerger M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Epidermal growth factor receptor mutation status in circulating free DNA in serum: from IPASS, a phase III study of gefitinib or carboplatin/paclitaxel in non-small cell lung cancer. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2012. Goto Koichi, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The influence of gemcitabine pathway polymorphisms on treatment outcome in patients with malignant mesothelioma. Pharmacogenetics and genomics. 2012. Er¿ulj Nina, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenomics of cisplatin-based chemotherapy in ovarian cancer patients of different ethnic origins. Pharmacogenomics. 2012. Khrunin Andrey, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variants in the PI3K/PTEN/AKT/mTOR pathway predict platinum-based chemotherapy response of advanced non-small cell lung cancers in a Chinese population. Asian Pacific journal of cancer prevention : APJCP. 2012. Xu Jia-Li, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Reduced CYP2D6 function is associated with gefitinib-induced rash in patients with non-small cell lung cancer. BMC cancer. 2012. Suzumura Tomohiro, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Two minor NQO1 and NQO2 alleles predict poor response of breast cancer patients to adjuvant doxorubicin and cyclophosphamide therapy. Pharmacogenetics and genomics. 2011. Jamieson David, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association between DNA-repair polymorphisms and survival in pancreatic cancer patients treated with combination chemotherapy. Pharmacogenomics. 2011. Giovannetti Elisa, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Meta-analysis on pharmacogenetics of platinum-based chemotherapy in non small cell lung cancer (NSCLC) patients. PloS one. 2012. Yin Ji-Ye, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Quality of life with gefitinib in patients with EGFR-mutated non-small cell lung cancer: quality of life analysis of North East Japan Study Group 002 Trial. The oncologist. 2012. Oizumi Satoshi, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic predictors for EGFR-inhibitor-associated skin toxicity. The pharmacogenomics journal. 2011. Parmar S, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Prospective molecular marker analyses of EGFR and KRAS from a randomized, placebo-controlled study of erlotinib maintenance therapy in advanced non-small-cell lung cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2011. Brugger Wolfram, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A noninvasive system for monitoring resistance to epidermal growth factor receptor tyrosine kinase inhibitors with plasma DNA. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2011. Nakamura Tomomi, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic analyses of cisplatin-induced nephrotoxicity indicate a renoprotective effect of ERCC1 polymorphisms. Pharmacogenomics. 2011. Tzvetkov Mladen V, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Differential effect of polymorphisms of CMPK1 and RRM1 on survival in advanced non-small cell lung cancer patients treated with gemcitabine or taxane/cisplatinum. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2011. Ryu Jeong-Seon, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Erlotinib versus chemotherapy as first-line treatment for patients with advanced EGFR mutation-positive non-small-cell lung cancer (OPTIMAL, CTONG-0802): a multicentre, open-label, randomised, phase 3 study. The lancet oncology. 2011. Zhou Caicun, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Safe and successful treatment with erlotinib after gefitinib-induced hepatotoxicity: difference in metabolism as a possible mechanism. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2011. Kijima Takashi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Interstitial lung disease in gefitinib-treated Japanese patients with non-small-cell lung cancer: genome-wide analysis of genetic data. Pharmacogenomics. 2011. Nyberg Fredrik, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variations in multiple drug action pathways and survival in advanced stage non-small cell lung cancer treated with chemotherapy. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Li Yafei, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The NQO1*2/*2 polymorphism is associated with poor overall survival in patients following resection of stages II and IIIa non-small cell lung cancer. Oncology reports. 2011. Kolesar Jill M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Influence of polymorphisms in MTHFR 677 C¿T, TYMS 3R¿2R and MTR 2756 A¿G on NSCLC risk and response to platinum-based chemotherapy in advanced NSCLC. Pharmacogenomics. 2011. Cui Lian-Hua, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Cytidine deaminase single-nucleotide polymorphism is predictive of toxicity from gemcitabine in patients with pancreatic cancer: RTOG 9704. The pharmacogenomics journal. 2011. Farrell J J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pretreatment EGFR T790M mutation and BRCA1 mRNA expression in erlotinib-treated advanced non-small-cell lung cancer patients with EGFR mutations. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Rosell Rafael, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Rebiopsy of lung cancer patients with acquired resistance to EGFR inhibitors and enhanced detection of the T790M mutation using a locked nucleic acid-based assay. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Arcila Maria E, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genotypic and histological evolution of lung cancers acquiring resistance to EGFR inhibitors. Science translational medicine. 2011. Sequist Lecia V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Copy number variants in pharmacogenetic genes. Trends in molecular medicine. 2011. He Yijing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Functional EGFR germline polymorphisms may confer risk for EGFR somatic mutations in non-small cell lung cancer, with a predominant effect on exon 19 microdeletions. Cancer research. 2011. Liu Wanqing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Impact of ABCG2 polymorphisms on the clinical outcome and toxicity of gefitinib in non-small-cell lung cancer patients. Pharmacogenomics. 2011. Lemos Clara, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genome-wide association study on overall survival of advanced non-small cell lung cancer patients treated with carboplatin and paclitaxel. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2011. Sato Yasunori, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
PI3K/PTEN/AKT/mTOR pathway genetic variation predicts toxicity and distant progression in lung cancer patients receiving platinum-based chemotherapy. Lung cancer (Amsterdam, Netherlands). 2011. Pu Xia, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Multiple genetic polymorphisms in the prediction of clinical outcome of metastatic colorectal cancer patients treated with first-line FOLFOX-4 chemotherapy. Pharmacogenetics and genomics. 2011. Huang Ming-Yii, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Practical recommendations for pharmacogenomics-based prescription: 2010 ESF-UB Conference on Pharmacogenetics and Pharmacogenomics. Pharmacogenomics. 2011. Becquemont Laurent, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Crizotinib: a novel and first-in-class multitargeted tyrosine kinase inhibitor for the treatment of anaplastic lymphoma kinase rearranged non-small cell lung cancer and beyond. Drug design, development and therapy. 2011. Ou Sai-Hong Ignatius. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Use of epidermal growth factor receptor mutation analysis in patients with advanced non-small-cell lung cancer to determine erlotinib use as first-line therapy. PLoS currents. 2011. Ishibe Naoko, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PIK3CA mutations frequently coexist with RAS and BRAF mutations in patients with advanced cancers. PloS one. 2011. Janku Filip, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Gemcitabine metabolic and transporter gene polymorphisms are associated with drug toxicity and efficacy in patients with locally advanced pancreatic cancer. Cancer. 2010. Tanaka Motofumi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC19A1 pharmacogenomics summary. Pharmacogenetics and genomics. 2010. Yee Sook Wah, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Systematic review of pharmacoeconomic studies of pharmacogenomic tests. Pharmacogenomics. 2010. Beaulieu Mathieu, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic predictors of adverse events and response to chemotherapy in metastatic colorectal cancer: results from North American Gastrointestinal Intergroup Trial N9741. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2010. McLeod Howard L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Blood-based CHRNA3 single nucleotide polymorphism and outcome in advanced non-small-cell lung cancer patients. Lung cancer (Amsterdam, Netherlands). 2010. Carcereny Enric, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Gefitinib or chemotherapy for non-small-cell lung cancer with mutated EGFR. The New England journal of medicine. 2010. Maemondo Makoto, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Expression of gemcitabine- and cisplatin-related genes in non-small-cell lung cancer. The pharmacogenomics journal. 2010. Toffalorio F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Targeted cancer therapies in the twenty-first century: lessons from imatinib. Clinical pharmacology and therapeutics. 2010. Stegmeier F, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Acquired resistance to gefitinib: the contribution of mechanisms other than the T790M, MET, and HGF status. Lung cancer (Amsterdam, Netherlands). 2010. Onitsuka Takamitsu, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of SUMO1 and UBC9 genotypes with tumor response in non-small-cell lung cancer treated with irinotecan-based chemotherapy. The pharmacogenomics journal. 2010. Han Ji-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Predictors of gefitinib outcomes in advanced non-small cell lung cancer (NSCLC): study of a comprehensive panel of molecular markers. Lung cancer (Amsterdam, Netherlands). 2010. Tiseo Marcello, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Molecular predictors of outcome with gefitinib and docetaxel in previously treated non-small-cell lung cancer: data from the randomized phase III INTEREST trial. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2010. Douillard Jean-Yves, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Phase II trial of pemetrexed plus bevacizumab for second-line therapy of patients with advanced non-small-cell lung cancer: NCCTG and SWOG study N0426. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2010. Adjei Alex A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Gefitinib versus cisplatin plus docetaxel in patients with non-small-cell lung cancer harbouring mutations of the epidermal growth factor receptor (WJTOG3405): an open label, randomised phase 3 trial. The lancet oncology. 2010. Mitsudomi Tetsuya, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms and the efficacy and toxicity of cisplatin-based chemotherapy in ovarian cancer patients. The pharmacogenomics journal. 2010. Khrunin A V, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SNPs in genes coding for ROS metabolism and signalling in association with docetaxel clearance. The pharmacogenomics journal. 2010. Edvardsen H, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Preexistence and clonal selection of MET amplification in EGFR mutant NSCLC. Cancer cell. 2010. Turke Alexa B, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Effects of excision repair cross-complementation group 1 (ERCC1) single nucleotide polymorphisms on the prognosis of non-small cell lung cancer patients. Lung cancer (Amsterdam, Netherlands). 2010. Takenaka Tomoyoshi, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
RRM1 single nucleotide polymorphism -37C-->A correlates with progression-free survival in NSCLC patients after gemcitabine-based chemotherapy. Journal of hematology & oncology. 2010. Dong Song, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Clinicopathologic and molecular features of epidermal growth factor receptor T790M mutation and c-MET amplification in tyrosine kinase inhibitor-resistant Chinese non-small cell lung cancer. Pathology oncology research : POR. 2009. Chen Hua-Jun, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphisms of EGFR predict clinical outcome in advanced non-small-cell lung cancer patients treated with Gefitinib. Lung cancer (Amsterdam, Netherlands). 2009. Ma Fei, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Gefitinib or carboplatin-paclitaxel in pulmonary adenocarcinoma. The New England journal of medicine. 2009. Mok Tony S, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Screening for epidermal growth factor receptor mutations in lung cancer. The New England journal of medicine. 2009. Rosell Rafael, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Cisplatin pharmacogenetics, DNA repair polymorphisms, and esophageal cancer outcomes. Pharmacogenetics and genomics. 2009. Bradbury Penelope A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Prospective phase II study of gefitinib in non-small cell lung cancer with epidermal growth factor receptor gene mutations. Lung cancer (Amsterdam, Netherlands). 2009. Sugio Kenji, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms affecting clinical outcomes in epithelial ovarian cancer patients treated with taxanes and platinum compounds: a Korean population-based study. Gynecologic oncology. 2009. Kim Hee Seung, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Randomized phase II and pharmacogenetic study of pemetrexed compared with pemetrexed plus carboplatin in pretreated patients with advanced non-small-cell lung cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2009. Smit Egbert F, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
DNA repair gene polymorphisms predict favorable clinical outcome in advanced non-small-cell lung cancer. Clinical lung cancer. 2009. Kalikaki Aristea, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Distribution of gemcitabine pathway genotypes in ethnic Asians and their association with outcome in non-small cell lung cancer patients. Lung cancer (Amsterdam, Netherlands). 2009. Soo Ross A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Integrated pharmacogenetic prediction of irinotecan pharmacokinetics and toxicity in patients with advanced non-small cell lung cancer. Lung cancer (Amsterdam, Netherlands). 2009. Han Ji-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Resistance gene expression determines the in vitro chemosensitivity of non-small cell lung cancer (NSCLC). BMC cancer. 2009. Glaysher Sharon, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Effects of erlotinib in EGFR mutated non-small cell lung cancers with resistance to gefitinib. Clinical cancer research : an official journal of the American Association for Cancer Research. 2008. Costa Daniel B, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
NAD(P)H:quinone oxidoreductase 1 NQO1*2 genotype (P187S) is a strong prognostic and predictive factor in breast cancer. Nature genetics. 2008. Fagerholm Rainer, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Detection of mutations in EGFR in circulating lung-cancer cells. The New England journal of medicine. 2008. Maheswaran Shyamala, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Correlation between cytidine deaminase genotype and gemcitabine deamination in blood samples. Nucleosides, nucleotides & nucleic acids. 2008. Giovannetti E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Efficacy of gemcitabine in patients with non-small cell lung cancer according to promoter polymorphisms of the ribonucleotide reductase M1 gene. Clinical cancer research : an official journal of the American Association for Cancer Research. 2008. Kim Soo-Ok, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
First-line gefitinib in patients with advanced non-small-cell lung cancer harboring somatic EGFR mutations. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2008. Sequist Lecia V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The CYP2A6*4 allele is determinant of S-1 pharmacokinetics in Japanese patients with non-small-cell lung cancer. Clinical pharmacology and therapeutics. 2008. Kaida Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Tumor suppressor FUS1 signaling pathway. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2008. Ji Lin, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Epidermal growth factor receptor polymorphisms and clinical outcomes in non-small-cell lung cancer patients treated with gefitinib. The pharmacogenomics journal. 2008. Liu G, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Correlation of CDA, ERCC1, and XPD polymorphisms with response and survival in gemcitabine/cisplatin-treated advanced non-small cell lung cancer patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2008. Tibaldi Carmelo, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Molecular characteristics of bronchioloalveolar carcinoma and adenocarcinoma, bronchioloalveolar carcinoma subtype, predict response to erlotinib. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2008. Miller Vincent A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomic and pharmacokinetic determinants of erlotinib toxicity. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2008. Rudin Charles M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Enhancement of antitumor activity of cisplatin in human lung cancer cells by tumor suppressor FUS1. Cancer gene therapy. 2008. Deng W-G, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Loss and reduction of FUS1 protein expression is a frequent phenomenon in the pathogenesis of lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2008. Prudkin Ludmila, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
MET amplification occurs with or without T790M mutations in EGFR mutant lung tumors with acquired resistance to gefitinib or erlotinib. Proceedings of the National Academy of Sciences of the United States of America. 2007. Bean James, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Relationship of EGFR mutations, expression, amplification, and polymorphisms to epidermal growth factor receptor inhibitors in the NCI60 cell lines. Clinical cancer research : an official journal of the American Association for Cancer Research. 2007. Liu Wanqing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Efficacy and safety of single-agent pertuzumab, a human epidermal receptor dimerization inhibitor, in patients with non small cell lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2007. Herbst Roy S, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The epidermal growth factor receptor intron1 (CA) n microsatellite polymorphism is a potential predictor of treatment outcome in patients with advanced lung cancer treated with Gefitinib. European journal of pharmacology. 2007. Nie Qiang, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Epidermal growth factor receptor mutations and their correlation with gefitinib therapy in patients with non-small cell lung cancer: a meta-analysis based on updated individual patient data from six medical centers in mainland China. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2007. Wu Yi-Long, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Intron 1 CA dinucleotide repeat polymorphism and mutations of epidermal growth factor receptor and gefitinib responsiveness in non-small-cell lung cancer. Pharmacogenetics and genomics. 2007. Han Sae-Won, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MET amplification leads to gefitinib resistance in lung cancer by activating ERBB3 signaling. Science (New York, N.Y.). 2007. Engelman Jeffrey A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Combination of EGFR gene copy number and protein expression predicts outcome for advanced non-small-cell lung cancer patients treated with gefitinib. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO. 2007. Hirsch F R, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Predictive factors associated with prolonged survival in patients with advanced non-small-cell lung cancer (NSCLC) treated with gefitinib. British journal of cancer. 2007. Satouchi M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic profiling in patients with advanced colorectal cancer treated with first-line FOLFOX-4 chemotherapy. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2007. Ruzzo Annamaria, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The impact of epidermal growth factor receptor gene status on gefitinib-treated Japanese patients with non-small-cell lung cancer. International journal of cancer. Journal international du cancer. 2007. Ichihara Shuji, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Vandetanib (ZD6474): an orally available receptor tyrosine kinase inhibitor that selectively targets pathways critical for tumor growth and angiogenesis. Expert opinion on investigational drugs. 2007. Herbst Roy S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Synergistic tumor suppression by coexpression of FUS1 and p53 is associated with down-regulation of murine double minute-2 and activation of the apoptotic protease-activating factor 1-dependent apoptotic pathway in human non-small cell lung cancer cells. Cancer research. 2007. Deng Wu-Guo, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacokinetics of gemcitabine in Japanese cancer patients: the impact of a cytidine deaminase polymorphism. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2007. Sugiyama Emiko, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Response to treatment and survival of patients with non-small cell lung cancer undergoing somatic EGFR mutation testing. The oncologist. 2007. Sequist Lecia V, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Gefitinib for non-small-cell lung cancer patients with epidermal growth factor receptor gene mutations screened by peptide nucleic acid-locked nucleic acid PCR clamp. British journal of cancer. 2006. Sutani A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
XRCC1 R399Q polymorphism is associated with response to platinum-based neoadjuvant chemotherapy in bulky cervical cancer. Gynecologic oncology. 2006. Chung Hyun Hoon, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of ABCG2 and adverse reactions to gefitinib. Journal of the National Cancer Institute. 2006. Cusatis George, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Novel D761Y and common secondary T790M mutations in epidermal growth factor receptor-mutant lung adenocarcinomas with acquired resistance to kinase inhibitors. Clinical cancer research : an official journal of the American Association for Cancer Research. 2006. Balak Marissa N, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A phase II study of irinotecan and carboplatin in advanced non-small cell lung cancer with pharmacogenomic analysis: final report. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2006. Pillot Giancarlo A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Clinical predictors versus epidermal growth factor receptor mutation in gefitinib-treated non-small-cell lung cancer patients. Lung cancer (Amsterdam, Netherlands). 2006. Han Sae-Won, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Novel heteroduplex method using small cytology specimens with a remarkably high success rate for analysing EGFR gene mutations with a significant correlation to gefitinib efficacy in non-small-cell lung cancer. British journal of cancer. 2006. Oshita F, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Analysis of epidermal growth factor receptor gene mutation in patients with non-small cell lung cancer and acquired resistance to gefitinib. Clinical cancer research : an official journal of the American Association for Cancer Research. 2006. Kosaka Takayuki, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Vandetanib, a novel multitargeted kinase inhibitor, in cancer therapy. Drugs of today (Barcelona, Spain : 1998). 2006. Sathornsumetee Sith, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Glutathione-S-transferase P1 isoenzyme polymorphisms, platinum-based chemotherapy, and non-small cell lung cancer. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2006. Booton Richard, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Evaluation of the epidermal growth factor receptor gene mutation and copy number in non-small cell lung cancer with gefitinib therapy. Oncology reports. 2006. Endo Katsuhiko, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DNA repair by ERCC1 in non-small-cell lung cancer and cisplatin-based adjuvant chemotherapy. The New England journal of medicine. 2006. Olaussen Ken A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Presence of epidermal growth factor receptor gene T790M mutation as a minor clone in non-small cell lung cancer. Cancer research. 2006. Inukai Michio, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Impact of the haplotype CYP3A4*16B harboring the Thr185Ser substitution on paclitaxel metabolism in Japanese patients with cancer. Clinical pharmacology and therapeutics. 2006. Nakajima Yukiko, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Cyclin D1 and epidermal growth factor polymorphisms associated with survival in patients with advanced colorectal cancer treated with Cetuximab. Pharmacogenetics and genomics. 2006. Zhang Wu, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Glutathione S-transferase P1 polymorphism (Ile105Val) predicts cumulative neuropathy in patients receiving oxaliplatin-based chemotherapy. Clinical cancer research : an official journal of the American Association for Cancer Research. 2006. Lecomte Thierry, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Comprehensive analysis of UGT1A polymorphisms predictive for pharmacokinetics and treatment outcome in patients with non-small-cell lung cancer treated with irinotecan and cisplatin. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2006. Han Ji-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Gemcitabine pharmacogenomics: cytidine deaminase and deoxycytidylate deaminase gene resequencing and functional genomics. Clinical cancer research : an official journal of the American Association for Cancer Research. 2006. Gilbert Judith A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Exploring the relationship between expression of cytochrome P450 enzymes and gefitinib pharmacokinetics. Clinical pharmacokinetics. 2006. Swaisland Helen C, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Inherited susceptibility to lung cancer may be associated with the T790M drug resistance mutation in EGFR. Nature genetics. 2005. Bell Daphne W, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Epidermal growth factor receptor mutations and gene amplification in non-small-cell lung cancer: molecular analysis of the IDEAL/INTACT gefitinib trials. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2005. Bell Daphne W, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Clinicopathologic significance of the mutations of the epidermal growth factor receptor gene in patients with non-small cell lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2005. Tomizawa Yoshio, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Mutations in the epidermal growth factor receptor and in KRAS are predictive and prognostic indicators in patients with non-small-cell lung cancer treated with chemotherapy alone and in combination with erlotinib. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2005. Eberhard David A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
cN-II expression predicts survival in patients receiving gemcitabine for advanced non-small cell lung cancer. Lung cancer (Amsterdam, Netherlands). 2005. Sève Pascal, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Activating mutations in the tyrosine kinase domain of the epidermal growth factor receptor are associated with improved survival in gefitinib-treated chemorefractory lung adenocarcinomas. Clinical cancer research : an official journal of the American Association for Cancer Research. 2005. Taron Miguel, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Mutation in the tyrosine kinase domain of epidermal growth factor receptor is a predictive and prognostic factor for gefitinib treatment in patients with non-small cell lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2005. Chou Teh-Ying, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Overexpression of the aldo-keto reductase family protein AKR1B10 is highly correlated with smokers' non-small cell lung carcinomas. Clinical cancer research : an official journal of the American Association for Cancer Research. 2005. Fukumoto Shin-ichi, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Acquired resistance of lung adenocarcinomas to gefitinib or erlotinib is associated with a second mutation in the EGFR kinase domain. PLoS medicine. 2005. Pao William, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Ribonucleotide reductase M1 gene promoter activity, polymorphisms, population frequencies, and clinical relevance. Lung cancer (Amsterdam, Netherlands). 2005. Bepler Gerold, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Determinants of sensitivity and resistance to gemcitabine: the roles of human equilibrative nucleoside transporter 1 and deoxycytidine kinase in non-small cell lung cancer. Cancer science. 2004. Achiwa Hiroyuki, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A multivariate analysis of genomic polymorphisms: prediction of clinical outcome to 5-FU/oxaliplatin combination chemotherapy in refractory colorectal cancer. British journal of cancer. 2004. Stoehlmacher J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
XPD and XRCC1 genetic polymorphisms are prognostic factors in advanced non-small-cell lung cancer patients treated with platinum chemotherapy. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2004. Gurubhagavatula Sarada, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy. Science (New York, N.Y.). 2004. Paez J Guillermo, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. The New England journal of medicine. 2004. Lynch Thomas J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Ribonucleotide reductase messenger RNA expression and survival in gemcitabine/cisplatin-treated advanced non-small cell lung cancer patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2004. Rosell Rafael, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Evaluation of NQO1 gene expression and variant allele in human NSCLC tumors and matched normal lung tissue. International journal of oncology. 2002. Kolesar Jill M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Overexpression of candidate tumor suppressor gene FUS1 isolated from the 3p21.3 homozygous deletion region leads to G1 arrest and growth inhibition of lung cancer cells. Oncogene. 2001. Kondo M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Rapid polyubiquitination and proteasomal degradation of a mutant form of NAD(P)H:quinone oxidoreductase 1. Molecular pharmacology. 2001. Siegel D, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genotype-phenotype relationships in studies of a polymorphism in NAD(P)H:quinone oxidoreductase 1. Pharmacogenetics. 1999. Siegel D, et al. PubMed