Chemical: Prodrug
tegafur
Available Prescribing Info
- Annotation of CPIC Guideline for tegafur and DPYD
- Annotation of DPWG Guideline for tegafur and DPYD
1. Annotation of CPIC Guideline for tegafur and DPYD
Summary
The CPIC Dosing Guidelines for fluoropyrimidines (i.e. 5-fluorouracil, capecitabine or tegafur) recommends an alternative drug for patients who are homozygous for DPYD non-functional variants - *2A (rs3918290), *13 (rs55886062), and rs67376798 A (on the positive chromosomal strand) - as these patients are typically DPD deficient. Consider a 50% reduction in starting dose for heterozygous patients (intermediate activity).
Annotation
This annotation is based on the CPIC® guideline for fluoropyrimidines and DPYD.
May 2014 Update on PharmGKB
- The CPIC authors recommend that the DPYD*4, *5, *6 and *9A alleles be categorized as "normal" activity, in part based upon the recent publication Comparative Functional Analysis of DPYD Variants of Potential Clinical Relevance to Dihydropyrimidine Dehydrogenase Activity.
December 2013 Publication
Accepted article preview online August 2013; Advance online publication October 2013.
- Guidelines regarding the use of pharmacogenomic tests in dosing for fluoropyrimidines have been published in Clinical Pharmacology and Therapeutics by the Clinical Pharmacogenetics Implementation Consortium (CPIC).
- These guidelines are applicable to:
- at the time of this writing, there are no data available on the possible role of DPYD*2A, *13, or rs67376798 in 5-fluorouracil toxicities in pediatric patient populations; however, there is no reason to suspect that DPYD variant alleles would affect 5-fluorouracil metabolism differently in children compared to adults.
- Excerpt from the fluoropyrimidine dosing guideline based on DPYD genotype:
- "The strength of the dosing recommendations is based on the fact that some variants (DPYD*2A, *13, and rs67376798) clearly affect DPD activity, and DPD activity is clearly related to 5-fluorouracil clearance, and 5-fluorouracil exposure is associated with its toxic effects. Therefore, reduction of fluoropyrimidine dosage in patients with these variants may prevent severe and possibly life-threatening toxicities. However, available evidence does not clearly indicate a degree of dose reduction needed to prevent fluoropyrimidine related toxicities...[Based on literature review (see full manuscript),] our recommendation is to start with at least a 50% reduction of the starting dose followed by an increase in dose in patients experiencing no or clinically tolerable toxicity to maintain efficacy, a decrease in dose in patients who do not tolerate the starting dose to minimize toxicities or pharmacokinetic guided dose adjustments (if available). Patients who are homozygous for DPYD*2A, *13, or rs67376798 may demonstrate complete DPD deficiency and the use of 5-fluorouracil or capecitabine is not recommended in these patients."
- Download and read:
Table 1: Recommended dosing of fluoropyrimidines by genotype/phenotype.
Adapted from Tables 1 and 2 of the 2013 guideline manuscript.
| Phenotype (genotype) | Examples of diplotypes | Implications for phenotypic measures | Dosing recommendations | Classification of recommendations a |
|---|---|---|---|---|
| Homozygous wild-type or normal, high DPD activity (two or more functional *1 alleles) | *1/*1 | Normal DPD activity and "normal" risk for fluoropyrimidine toxicity | Use label-recommended dosage and administration | Moderate |
| Heterozygous or intermediate activity (~3-5% of patients), may have partial DPD deficiency, at risk for toxicity with drug exposure (one functional allele *1, plus one nonfunctional allele - *2A, *13 or rs67376798A c) | *1/*2A; *1/*13; *1/ rs67376798A c) | Decreased DPD activity (leukocyte DPD activity at 30% to 70% that of the normal population) and increased risk for severe or even fatal drug toxicity when treated with fluoropyrimidine drugs | Start with at least a 50% reduction in starting dose followed by titration of dose based on toxicity b or pharmacokinetic test (if available) | Moderate |
| Homozygous variant, DPD deficiency (~0.2% of patients), at risk for toxicity with drug exposure (2 nonfunctional alleles - *2A, *13 or rs67376798A c) | *2A/*2A; *13/*13; rs67376798A c / rs67376798A c | Complete DPD deficiency and increased risk for severe or even fatal drug toxicity when treated with fluoropyrimidine drugs | Select alternate drug | Strong |
a Rating scheme described in 2013 supplement.
b Increase the dose in patients experiencing no or clinically tolerable toxicity to maintain efficacy; decrease the dose in patients who do not tolerate the starting dose to minimize toxicities.
c Note that the rs67376798A allele refers to the allele on the positive chromosomal strand. This is important because DPYD is on the minus chromosomal strand and rs67376798 is a T/A snp. Therefore, the T allele on the gene confers the deficiency, while the complement on the positive chromosomal strand (A allele) is indicative of deficiency.
2. Annotation of DPWG Guideline for tegafur and DPYD
Summary
Select an alternate drug (that is not metabolized by DPYD) rather than tegafur for DPYD poor metabolizers.
Annotation
The Royal Dutch Pharmacists Association - Pharmacogenetics Working Group has evaluated therapeutic dose recommendations for tegafur/uracil combination based on DPYD genotype [Article:21412232]. They recommend that an alternate drug be used for poor metabolizer patients, but do not provide a recommendation for intermediate metabolizer patients.
| Phenotype (Genotype) | Therapeutic Dose Recommendation | Level of Evidence | Clinical Relevance |
|---|---|---|---|
| PM (2 inactive alleles, 2 decreased activity alleles, or one inactive and one decreased activity alleles) | Select alterantive drug. Fluorouracil or capecitabine are not suitable alternatives because both are also metabolized by DPD. | Published controlled studies of moderate quality* relating to phenotyped and/or genotyped patients or healthy volunteers, and having relevant pharmacokinetic or clinical endpoints. | Clinical effect (NS). Kinetic effect (NS). |
| IM (1 active allele and 1 inactive or decreased activity allele) | None. | Published controlled studies of moderate quality* relating to phenotyped and/or genotyped patients or healthy volunteers, and having relevant pharmacokinetic or clinical endpoints. | Clinical effect (NS). Kinetic effect (NS). |
| Allele Type | Alleles |
|---|---|
| active | *1, *4, *5, *6, *9A |
| decreased activity | *9B, *10 |
| inactive | *2A, *3, *7, *8, *11, *12, *13, 496A>G, IVS10-15T>C, 1156G>T, 1845G>T |
PharmGKB has no annotated drug labels with pharmacogenomic information for this . If you know of a drug label with PGx, send us a message.
Clinical Variants that meet the highest level of criteria, manually curated by PharmGKB, are shown below.
To see more Clinical Variants with lower levels of criteria, click the button at the bottom of the page.
Clinical Annotation for rs67376798 (DPYD), capecitabine, fluorouracil, Pyrimidine analogues, tegafur and Neoplasms (level 1A Toxicity/ADR, Metabolism/PK)
- Type
- Toxicity/ADR, Metabolism/PK
- Variant
- rs67376798
- Genes
- DPYD
- Phenotypes
- Neoplasms
- OMB Race
- Mixed Population
To see the rest of this clinical annotation please register or sign in.
Clinical Annotation for rs3918290 (DPYD), capecitabine, fluorouracil, Pyrimidine analogues, tegafur and Neoplasms (level 1A Toxicity/ADR, Metabolism/PK)
To see the rest of this clinical annotation please register or sign in.
Clinical Annotation for rs55886062 (DPYD), capecitabine, fluorouracil, Pyrimidine analogues, tegafur and Neoplasms (level 1A Toxicity/ADR)
- Type
- Toxicity/ADR
- Variant
- rs55886062
- Genes
- DPYD
- Phenotypes
- Neoplasms
- OMB Race
- Mixed Population
To see the rest of this clinical annotation please register or sign in.
Disclaimer: The PharmGKB's clinical annotations reflect expert consensus based on clinical evidence and peer-reviewed literature available at the time they are written and are intended only to assist clinicians in decision-making and to identify questions for further research. New evidence may have emerged since the time an annotation was submitted to the PharmGKB. The annotations are limited in scope and are not applicable to interventions or diseases that are not specifically identified.
The annotations do not account for individual variations among patients, and cannot be considered inclusive of all proper methods of care or exclusive of other treatments. It remains the responsibility of the health-care provider to determine the best course of treatment for a patient. Adherence to any guideline is voluntary, with the ultimate determination regarding its application to be made solely by the clinician and the patient. PharmGKB assumes no responsibility for any injury or damage to persons or property arising out of or related to any use of the PharmGKB clinical annotations, or for any errors or omissions.
The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.
The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.
Links in the "Gene" column lead to PharmGKB Gene Pages.
List of all variant annotations for tegafur
| Gene ? |
Variant?
(147) |
Alternate Names ? | Chemicals ? |
Alleles
?
(+ chr strand) |
Function ? |
Amino Acid?
Translation |
|
|---|---|---|---|---|---|---|---|
|
|
CYP2A6 | *1A | N/A | N/A | N/A | ||
|
VIP
|
CYP2A6 | *1B1 | N/A | N/A | N/A | ||
| VIP CA VA | CYP2A6 | *4A | N/A | N/A | N/A | ||
|
|
CYP2A6 | *4C | N/A | N/A | N/A | ||
| VIP CA VA | CYP2A6 | *7 | N/A | N/A | N/A | ||
|
|
CYP2A6 | *9 | N/A | N/A | N/A | ||
| VIP CA VA | CYP2A6 | *9A | N/A | N/A | N/A | ||
|
VIP
CA
|
CYP2A6 | *10 | N/A | N/A | N/A | ||
|
|
CYP2A6 | *11 | N/A | N/A | N/A | ||
|
|
CYP2A6 | *18A | N/A | N/A | N/A | ||
|
|
CYP2A6 | *19 | N/A | N/A | N/A | ||
|
|
DPYD | *1 | N/A | N/A | N/A | ||
|
|
DPYD | *2A | N/A | N/A | N/A | ||
|
|
DPYD | *4 | N/A | N/A | N/A | ||
|
|
DPYD | *5 | N/A | N/A | N/A | ||
|
|
DPYD | *9A | N/A | N/A | N/A | ||
|
|
DPYD | *13 | N/A | N/A | N/A | ||
| rs111033610 | NC_000019.10:g.40847036A>G, NC_000019.9:g.41352941A>G, NG_008377.1:g.8412T>C, NM_000762.5:c.670T>C, NP_000753.3:p.Ser224Pro, XM_005258568.1:c.517T>C, XP_005258625.1:p.Ser173Pro |
A > G
|
SNP |
S224P
|
|||
| rs1801019 | NC_000003.11:g.124456742G>C, NC_000003.12:g.124737895G>C, NG_017037.1:g.12530G>C, NM_000373.3:c.638G>C, NP_000364.1:p.Gly213Ala, NR_033434.1:n.590G>C, NR_033437.1:n.843G>C, XM_005247741.1:c.362G>C, XM_005247742.1:c.104G>C, XM_005247743.1:c.124-20G>C, XM_005247744.1:c.104G>C, XP_005247798.1:p.Gly121Ala, XP_005247799.1:p.Gly35Ala, XP_005247801.1:p.Gly35Ala, rs17843818, rs199469590, rs3172286, rs3772805, rs52826107, rs58177968 |
G > C
|
SNP |
G213A
|
|||
| rs1801159 | NC_000001.10:g.97981395T>C, NC_000001.11:g.97515839T>C, NG_008807.2:g.410221A>G, NM_000110.3:c.1627A>G, NP_000101.2:p.Ile543Val, XM_005270561.1:c.1516A>G, XM_005270562.1:c.1524+33721A>G, XM_005270562.3:c.1524+33721A>G, XM_005270563.1:c.1627A>G, XM_005270564.1:c.1627A>G, XM_006710397.2:c.1627A>G, XP_005270618.1:p.Ile506Val, XP_005270620.1:p.Ile543Val, XP_005270621.1:p.Ile543Val, XP_006710460.1:p.Ile543Val, rs117999026, rs17116825, rs199469541, rs386545620, rs58945530 |
T > C
|
SNP |
I543V
|
|||
| rs1801394 | NC_000005.10:g.7870860A>G, NC_000005.9:g.7870973A>G, NG_008856.1:g.6757A>G, NG_033101.1:g.3178T>C, NM_002454.2:c.66A>G, NM_024010.2:c.147A>G, NM_024091.3:c.-1995T>C, NP_002445.2:p.Ile22Met, NP_076915.2:p.Ile49Met, NR_036553.1:n.-1823T>C, NR_073608.1:n.-1823T>C, NR_134480.1:n.203A>G, NR_134481.1:n.203A>G, NR_134482.1:n.203A>G, XM_005248304.1:c.111A>G, XM_005248305.1:c.66A>G, XM_006714474.2:c.147A>G, XM_006714498.1:c.-1906T>C, XM_011514043.1:c.147A>G, XM_011514044.1:c.66A>G, XM_011514045.1:c.147A>G, XP_005248361.1:p.Ile37Met, XP_005248362.1:p.Ile22Met, XP_006714537.1:p.Ile49Met, XP_011512345.1:p.Ile49Met, XP_011512346.1:p.Ile22Met, XP_011512347.1:p.Ile49Met, XR_241701.1:n.169A>G, XR_241702.1:n.169A>G, XR_241703.1:n.162A>G, XR_427664.1:n.-1823T>C, XR_925614.1:n.169A>G, XR_925615.1:n.169A>G, rs52813630 |
A > G
|
SNP |
I22M
|
|||
| rs183205964 | NC_000018.10:g.657657G>C, NC_000018.9:g.657657G>C, NG_028255.1:g.5054G>C, NM_001012716.2:c.*34+185C>G, NM_001071.2:c.-86G>C, XM_005258137.1:c.-86G>C, XM_005258138.1:c.-86G>C |
G > C
|
SNP | ||||
| rs28399433 | NC_000019.10:g.40850474A>C, NC_000019.9:g.41356379A>C, NG_008377.1:g.4974T>G, NM_000762.5:c.-48T>G, XM_005258568.1:c.-48T>G, rs386508632, rs58538938 |
A > C
|
SNP | ||||
| rs28399468 | NC_000019.10:g.40843827C>A, NC_000019.9:g.41349732C>A, NG_008377.1:g.11621G>T, NM_000762.5:c.1454G>T, NP_000753.3:p.Arg485Leu, XM_005258568.1:c.1301G>T, XP_005258625.1:p.Arg434Leu, rs386574980 |
C > A
|
SNP |
R485L
|
|||
| rs3918290 | NC_000001.10:g.97915614C>T, NC_000001.11:g.97450058C>T, NG_008807.2:g.476002G>A, NM_000110.3:c.1905+1G>A, XM_005270561.1:c.1794+1G>A, XM_005270562.1:c.1689+1G>A, XM_005270562.3:c.1689+1G>A, XM_005270563.1:c.1905+1G>A, XM_006710397.2:c.1905+1G>A, rs199469548, rs386589337 |
C > G
C > T
|
SNP | ||||
| rs45445694 | NC_000018.10:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NC_000018.9:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NG_028255.1:g.5043_5070CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NM_001012716.2:c.*34+169_*34+196CGGGACGGAGGCAGGCCAAGTGGCGCGG[2][3][4][7][8][9], NM_001071.2:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258137.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258138.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], rs34743033 (retired) |
(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2
(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)4
(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)7
(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)8
(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)9
|
microsatellite | ||||
| rs55886062 | NC_000001.10:g.97981343A>C, NC_000001.11:g.97515787A>C, NG_008807.2:g.410273T>G, NM_000110.3:c.1679T>G, NP_000101.2:p.Ile560Ser, XM_005270561.1:c.1568T>G, XM_005270562.1:c.1524+33773T>G, XM_005270562.3:c.1524+33773T>G, XM_005270563.1:c.1679T>G, XM_005270564.1:c.1679T>G, XM_006710397.2:c.1679T>G, XP_005270618.1:p.Ile523Ser, XP_005270620.1:p.Ile560Ser, XP_005270621.1:p.Ile560Ser, XP_006710460.1:p.Ile560Ser, rs199469542 |
A > C
|
SNP |
I560S
|
|||
| rs56038477 | NC_000001.10:g.98039419C>T, NC_000001.11:g.97573863C>T, NG_008807.2:g.352197G>A, NM_000110.3:c.1236G>A, NP_000101.2:p.Glu412=, XM_005270561.1:c.1125G>A, XM_005270562.1:c.1236G>A, XM_005270562.3:c.1236G>A, XM_005270563.1:c.1236G>A, XM_005270564.1:c.1236G>A, XM_006710397.2:c.1236G>A, XP_005270618.1:p.Glu375=, XP_005270619.1:p.Glu412=, XP_005270619.2:p.Glu412=, XP_005270620.1:p.Glu412=, XP_005270621.1:p.Glu412=, XP_006710460.1:p.Glu412=, rs199469533, rs61730901 |
C > T
|
SNP |
E412E
|
|||
| rs67376798 | NC_000001.10:g.97547947T>A, NC_000001.11:g.97082391T>A, NG_008807.2:g.843669A>T, NM_000110.3:c.2846A>T, NP_000101.2:p.Asp949Val, XM_005270561.1:c.2735A>T, XM_005270562.1:c.2630A>T, XM_005270562.3:c.2630A>T, XP_005270618.1:p.Asp912Val, XP_005270619.1:p.Asp877Val, XP_005270619.2:p.Asp877Val, rs199469564, rs386467430, rs67376799 |
T > A
|
SNP |
D949V
|
|||
| rs712830 | NC_000007.13:g.55086780A>C, NC_000007.14:g.55019087A>C, NG_007726.3:g.5056A>C, NM_005228.3:c.-191A>C, NM_201282.1:c.-191A>C, NM_201283.1:c.-191A>C, NM_201284.1:c.-191A>C, XM_005271746.1:c.-191A>C, XM_005271748.1:c.-191A>C, rs17288938 |
A > C
|
SNP | ||||
| rs8192720 | NC_000019.10:g.40850405G>A, NC_000019.9:g.41356310G>A, NG_008377.1:g.5043C>T, NM_000762.5:c.22C>T, NP_000753.3:p.Leu8=, XM_005258568.1:c.22C>T, XP_005258625.1:p.Leu8= |
G > A
|
SNP |
L8L
|
|||
| rs8192725 | NC_000019.10:g.40848807A>G, NC_000019.9:g.41354712A>G, NG_008377.1:g.6641T>C, NM_000762.5:c.344-44T>C, XM_005258568.1:c.191-44T>C, rs12973939 |
A > G
|
SNP |
Overview
PharmGKB Accession Id
PA452620
Type(s):
Prodrug
Other Vocabularies
- UMLS: Tegafur (C0016778)
- RxNorm: Tegafur (4582)
- NDFRT: Tegafur [Chemical/Ingredient] (N0000167181)
PharmGKB Curated Pathways
Pathways created internally by PharmGKB based primarily on literature evidence.
-
Fluoropyrimidine Pathway, Pharmacodynamics
Model non-tissue-specific cancer cell displaying genes which may be involved in the pharmacodynamics of the fluoropyrimidines, 5-fluorouracil (5-FU), capecitabine and tegafur.
-
Fluoropyrimidine Pathway, Pharmacokinetics
Representation of the metabolic pathways for fluoropyrimidines.
Publications related to tegafur: 136
LinkOuts
Clinical Trials
These are trials that mention tegafur and are related to either pharmacogenetics or pharmacogenomics.
NURSA Datasets
No NURSA datasets available.


