Chemical: Prodrug
tegafur

Available Guidelines

  1. CPIC Guideline for tegafur and DPYD
  2. DPWG Guideline for tegafur and DPYD

last updated 07/30/2014

1. CPIC Guideline for tegafur and DPYD

Summary

The CPIC Dosing Guidelines for fluoropyrimidines (i.e. 5-fluorouracil, capecitabine or tegafur) recommends an alternative drug for patients who are homozygous for DPYD non-functional variants - *2A (rs3918290), *13 (rs55886062), and rs67376798 A (on the positive chromosomal strand) - as these patients are typically DPD deficient. Consider a 50% reduction in starting dose for heterozygous patients (intermediate activity).

Annotation

May 2014 Update on PharmGKB

December 2013 Publication

Accepted article preview online August 2013; Advance online publication October 2013.

  • Guidelines regarding the use of pharmacogenomic tests in dosing for fluoropyrimidines have been published in Clinical Pharmacology and Therapeutics by the Clinical Pharmacogenetics Implementation Consortium (CPIC).
  • These guidelines are applicable to:
    • at the time of this writing, there are no data available on the possible role of DPYD*2A, *13, or rs67376798 in 5-fluorouracil toxicities in pediatric patient populations; however, there is no reason to suspect that DPYD variant alleles would affect 5-fluorouracil metabolism differently in children compared to adults.
  • Excerpt from the fluoropyrimidine dosing guideline based on DPYD genotype:
    • "The strength of the dosing recommendations is based on the fact that some variants (DPYD*2A, *13, and rs67376798) clearly affect DPD activity, and DPD activity is clearly related to 5-fluorouracil clearance, and 5-fluorouracil exposure is associated with its toxic effects. Therefore, reduction of fluoropyrimidine dosage in patients with these variants may prevent severe and possibly life-threatening toxicities. However, available evidence does not clearly indicate a degree of dose reduction needed to prevent fluoropyrimidine related toxicities...[Based on literature review (see full manuscript),] our recommendation is to start with at least a 50% reduction of the starting dose followed by an increase in dose in patients experiencing no or clinically tolerable toxicity to maintain efficacy, a decrease in dose in patients who do not tolerate the starting dose to minimize toxicities or pharmacokinetic guided dose adjustments (if available). Patients who are homozygous for DPYD*2A, *13, or rs67376798 may demonstrate complete DPD deficiency and the use of 5-fluorouracil or capecitabine is not recommended in these patients."
  • Download and read:

Table 1: Recommended dosing of fluoropyrimidines by genotype/phenotype.

Adapted from Tables 1 and 2 of the 2013 guideline manuscript.

Phenotype (genotype)Examples of diplotypesImplications for phenotypic measuresDosing recommendationsClassification of recommendations a
Homozygous wild-type or normal, high DPD activity (two or more functional *1 alleles)*1/*1Normal DPD activity and "normal" risk for fluoropyrimidine toxicityUse label-recommended dosage and administrationModerate
Heterozygous or intermediate activity (~3-5% of patients), may have partial DPD deficiency, at risk for toxicity with drug exposure (one functional allele *1, plus one nonfunctional allele - *2A, *13 or rs67376798A c)*1/*2A; *1/*13; *1/ rs67376798A c)Decreased DPD activity (leukocyte DPD activity at 30% to 70% that of the normal population) and increased risk for severe or even fatal drug toxicity when treated with fluoropyrimidine drugsStart with at least a 50% reduction in starting dose followed by titration of dose based on toxicity b or pharmacokinetic test (if available)Moderate
Homozygous variant, DPD deficiency (~0.2% of patients), at risk for toxicity with drug exposure (2 nonfunctional alleles - *2A, *13 or rs67376798A c)*2A/*2A; *13/*13; rs67376798A c / rs67376798A cComplete DPD deficiency and increased risk for severe or even fatal drug toxicity when treated with fluoropyrimidine drugsSelect alternate drugStrong

a Rating scheme described in 2013 supplement.

b Increase the dose in patients experiencing no or clinically tolerable toxicity to maintain efficacy; decrease the dose in patients who do not tolerate the starting dose to minimize toxicities.

c Note that the rs67376798A allele refers to the allele on the positive chromosomal strand. This is important because DPYD is on the minus chromosomal strand and rs67376798 is a T/A snp. Therefore, the T allele on the gene confers the deficiency, while the complement on the positive chromosomal strand (A allele) is indicative of deficiency.


last updated 08/25/2016

2. DPWG Guideline for tegafur and DPYD

Summary

Select an alternate drug (that is not metabolized by DPYD) rather than tegafur for DPYD poor metabolizers.

Annotation

The Royal Dutch Pharmacists Association - Pharmacogenetics Working Group has evaluated therapeutic dose recommendations for tegafur/uracil combination based on DPYD genotype [Article:21412232]. They recommend that an alternate drug be used for poor metabolizer patients, but do not provide a recommendation for intermediate metabolizer patients.

Phenotype (Genotype)Therapeutic Dose RecommendationLevel of EvidenceClinical Relevance
PM (2 inactive alleles, 2 decreased activity alleles, or one inactive and one decreased activity alleles)Select alterantive drug. Fluorouracil or capecitabine are not suitable alternatives because both are also metabolized by DPD.Published controlled studies of moderate quality* relating to phenotyped and/or genotyped patients or healthy volunteers, and having relevant pharmacokinetic or clinical endpoints.Clinical effect (NS). Kinetic effect (NS).
IM (1 active allele and 1 inactive or decreased activity allele)None.Published controlled studies of moderate quality* relating to phenotyped and/or genotyped patients or healthy volunteers, and having relevant pharmacokinetic or clinical endpoints.Clinical effect (NS). Kinetic effect (NS).
Allele TypeAlleles
active*1, *4, *5, *6, *9A
decreased activity*9B, *10
inactive*2A, *3, *7, *8, *11, *12, *13, 496A>G, IVS10-15T>C, 1156G>T, 1845G>T
  • *See Methods or [Article:18253145] for definition of "moderate" quality.
  • NS: not statistically significant difference.

PharmGKB has no annotated drug labels with pharmacogenomic information for this . If you know of a drug label with PGx, send us a message.

Clinical Variants that meet the highest level of criteria, manually curated by PharmGKB, are shown below.

To see more Clinical Variants with lower levels of criteria, click the button at the bottom of the page.

Clinical Annotation for rs45445694 (TYMS), capecitabine, fluorouracil, Pyrimidine analogues, tegafur, Colorectal Neoplasms, Neoplasms, Pancreatic Neoplasms and Rectal Neoplasms (level 3 Efficacy, Toxicity/ADR)

Level of Evidence
Level 3
Type
Efficacy, Toxicity/ADR
Variant
rs45445694
Genes
TYMS
Phenotypes
Colorectal Neoplasms, Neoplasms, Pancreatic Neoplasms, Rectal Neoplasms
OMB Race
Mixed Population
Race Notes
White, Asian, Mixed, unknown

To see the rest of this clinical annotation please register or sign in.

Disclaimer: The PharmGKB's clinical annotations reflect expert consensus based on clinical evidence and peer-reviewed literature available at the time they are written and are intended only to assist clinicians in decision-making and to identify questions for further research. New evidence may have emerged since the time an annotation was submitted to the PharmGKB. The annotations are limited in scope and are not applicable to interventions or diseases that are not specifically identified.

The annotations do not account for individual variations among patients, and cannot be considered inclusive of all proper methods of care or exclusive of other treatments. It remains the responsibility of the health-care provider to determine the best course of treatment for a patient. Adherence to any guideline is voluntary, with the ultimate determination regarding its application to be made solely by the clinician and the patient. PharmGKB assumes no responsibility for any injury or damage to persons or property arising out of or related to any use of the PharmGKB clinical annotations, or for any errors or omissions.

? = Mouse-over for quick help

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Links in the "Gene" column lead to PharmGKB Gene Pages.

List of all variant annotations for tegafur

Gene ? Variant?
(147)
Alternate Names ? Chemicals ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
Translation
No VIP available CA VA CYP2A6 *1A N/A N/A N/A
No VIP available CA VA CYP2A6 *4A N/A N/A N/A
No VIP available CA VA CYP2A6 *4C N/A N/A N/A
VIP CA VA CYP2A6 *7 N/A N/A N/A
No VIP available No VIP available VA CYP2A6 *9 N/A N/A N/A
VIP CA VA CYP2A6 *9A N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *10 N/A N/A N/A
No VIP available CA No VIP available CYP2A6 *11 N/A N/A N/A
No VIP available CA VA CYP2A6 *18A N/A N/A N/A
No VIP available CA VA CYP2A6 *19 N/A N/A N/A
VIP No VIP available VA CYP2A6 *1B1 N/A N/A N/A
No VIP available No VIP available VA DPYD *1 N/A N/A N/A
No VIP available No VIP available VA DPYD *2A N/A N/A N/A
No VIP available No VIP available VA DPYD *4 N/A N/A N/A
No VIP available No VIP available VA DPYD *5 N/A N/A N/A
No VIP available No VIP available VA DPYD *9A N/A N/A N/A
No VIP available No VIP available VA DPYD *13 N/A N/A N/A
No VIP available CA VA
rs111033610 NC_000019.10:g.40847036A>G, NC_000019.9:g.41352941A>G, NG_008377.1:g.8412T>C, NM_000762.5:c.670T>C, NP_000753.3:p.Ser224Pro, XM_005258568.1:c.517T>C, XP_005258625.1:p.Ser173Pro
A > G
SNP
S224P
No VIP available CA VA
rs1801019 NC_000003.11:g.124456742G>C, NC_000003.12:g.124737895G>C, NG_017037.1:g.12530G>C, NM_000373.3:c.638G>C, NP_000364.1:p.Gly213Ala, NR_033434.1:n.590G>C, NR_033437.1:n.843G>C, XM_005247741.1:c.362G>C, XM_005247742.1:c.104G>C, XM_005247743.1:c.124-20G>C, XM_005247744.1:c.104G>C, XP_005247798.1:p.Gly121Ala, XP_005247799.1:p.Gly35Ala, XP_005247801.1:p.Gly35Ala, rs17843818, rs199469590, rs3172286, rs3772805, rs52826107, rs58177968
G > C
SNP
G213A
No VIP available CA No Variant Annotations available
rs1801159 NC_000001.10:g.97981395T>C, NC_000001.11:g.97515839T>C, NG_008807.2:g.410221A>G, NM_000110.3:c.1627A>G, NP_000101.2:p.Ile543Val, XM_005270561.1:c.1516A>G, XM_005270562.1:c.1524+33721A>G, XM_005270562.3:c.1524+33721A>G, XM_005270563.1:c.1627A>G, XM_005270564.1:c.1627A>G, XM_006710397.2:c.1627A>G, XP_005270618.1:p.Ile506Val, XP_005270620.1:p.Ile543Val, XP_005270621.1:p.Ile543Val, XP_006710460.1:p.Ile543Val, rs117999026, rs17116825, rs199469541, rs386545620, rs58945530
T > C
SNP
I543V
No VIP available No Clinical Annotations available VA
rs1801394 NC_000005.10:g.7870860A>G, NC_000005.9:g.7870973A>G, NG_008856.1:g.6757A>G, NG_033101.1:g.3178T>C, NM_002454.2:c.66A>G, NM_024010.2:c.147A>G, NM_024091.3:c.-1995T>C, NP_002445.2:p.Ile22Met, NP_076915.2:p.Ile49Met, NR_036553.1:n.-1823T>C, NR_073608.1:n.-1823T>C, NR_134480.1:n.203A>G, NR_134481.1:n.203A>G, NR_134482.1:n.203A>G, XM_005248304.1:c.111A>G, XM_005248305.1:c.66A>G, XM_006714474.2:c.147A>G, XM_006714498.1:c.-1906T>C, XM_011514043.1:c.147A>G, XM_011514044.1:c.66A>G, XM_011514045.1:c.147A>G, XP_005248361.1:p.Ile37Met, XP_005248362.1:p.Ile22Met, XP_006714537.1:p.Ile49Met, XP_011512345.1:p.Ile49Met, XP_011512346.1:p.Ile22Met, XP_011512347.1:p.Ile49Met, XR_241701.1:n.169A>G, XR_241702.1:n.169A>G, XR_241703.1:n.162A>G, XR_427664.1:n.-1823T>C, XR_925614.1:n.169A>G, XR_925615.1:n.169A>G, rs52813630
A > G
SNP
I22M
No VIP available CA VA
rs183205964 NC_000018.10:g.657657G>C, NC_000018.9:g.657657G>C, NG_028255.1:g.5054G>C, NM_001012716.2:c.*34+185C>G, NM_001071.2:c.-86G>C, XM_005258137.1:c.-86G>C, XM_005258138.1:c.-86G>C
G > C
SNP
No VIP available CA VA
rs28399433 NC_000019.10:g.40850474A>C, NC_000019.9:g.41356379A>C, NG_008377.1:g.4974T>G, NM_000762.5:c.-48T>G, XM_005258568.1:c.-48T>G, rs386508632, rs58538938
A > C
SNP
No VIP available CA VA
rs3918290 NC_000001.10:g.97915614C>T, NC_000001.11:g.97450058C>T, NG_008807.2:g.476002G>A, NM_000110.3:c.1905+1G>A, XM_005270561.1:c.1794+1G>A, XM_005270562.1:c.1689+1G>A, XM_005270562.3:c.1689+1G>A, XM_005270563.1:c.1905+1G>A, XM_006710397.2:c.1905+1G>A, rs199469548, rs386589337
C > G
C > T
SNP
No VIP available CA VA
rs45445694 NC_000018.10:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NC_000018.9:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NG_028255.1:g.5043_5070CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NM_001012716.2:c.*34+169_*34+196CGGGACGGAGGCAGGCCAAGTGGCGCGG[2][3][4][7][8][9], NM_001071.2:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258137.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258138.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9]
CCGCGC(CACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2
CCGCGC(CACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)4
CCGCGC(CACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)7
CCGCGC(CACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)8
CCGCGC(CACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)9
microsatellite
No VIP available CA VA
rs55886062 NC_000001.10:g.97981343A>C, NC_000001.11:g.97515787A>C, NG_008807.2:g.410273T>G, NM_000110.3:c.1679T>G, NP_000101.2:p.Ile560Ser, XM_005270561.1:c.1568T>G, XM_005270562.1:c.1524+33773T>G, XM_005270562.3:c.1524+33773T>G, XM_005270563.1:c.1679T>G, XM_005270564.1:c.1679T>G, XM_006710397.2:c.1679T>G, XP_005270618.1:p.Ile523Ser, XP_005270620.1:p.Ile560Ser, XP_005270621.1:p.Ile560Ser, XP_006710460.1:p.Ile560Ser, rs199469542
A > C
SNP
I560S
No VIP available No Clinical Annotations available VA
rs56038477 NC_000001.10:g.98039419C>T, NC_000001.11:g.97573863C>T, NG_008807.2:g.352197G>A, NM_000110.3:c.1236G>A, NP_000101.2:p.Glu412=, XM_005270561.1:c.1125G>A, XM_005270562.1:c.1236G>A, XM_005270562.3:c.1236G>A, XM_005270563.1:c.1236G>A, XM_005270564.1:c.1236G>A, XM_006710397.2:c.1236G>A, XP_005270618.1:p.Glu375=, XP_005270619.1:p.Glu412=, XP_005270619.2:p.Glu412=, XP_005270620.1:p.Glu412=, XP_005270621.1:p.Glu412=, XP_006710460.1:p.Glu412=, rs199469533, rs61730901
C > T
SNP
E412E
No VIP available CA VA
rs67376798 NC_000001.10:g.97547947T>A, NC_000001.11:g.97082391T>A, NG_008807.2:g.843669A>T, NM_000110.3:c.2846A>T, NP_000101.2:p.Asp949Val, XM_005270561.1:c.2735A>T, XM_005270562.1:c.2630A>T, XM_005270562.3:c.2630A>T, XP_005270618.1:p.Asp912Val, XP_005270619.1:p.Asp877Val, XP_005270619.2:p.Asp877Val, rs199469564, rs386467430, rs67376799
T > A
SNP
D949V
No VIP available CA VA
rs712830 NC_000007.13:g.55086780A>C, NC_000007.14:g.55019087A>C, NG_007726.3:g.5056A>C, NM_005228.3:c.-191A>C, NM_201282.1:c.-191A>C, NM_201283.1:c.-191A>C, NM_201284.1:c.-191A>C, XM_005271746.1:c.-191A>C, XM_005271748.1:c.-191A>C, rs17288938
A > C
SNP
No VIP available CA VA
rs8192720 NC_000019.10:g.40850405G>A, NC_000019.9:g.41356310G>A, NG_008377.1:g.5043C>T, NM_000762.5:c.22C>T, NP_000753.3:p.Leu8=, XM_005258568.1:c.22C>T, XP_005258625.1:p.Leu8=
G > A
SNP
L8L
No VIP available CA VA
rs8192725 NC_000019.10:g.40848807A>G, NC_000019.9:g.41354712A>G, NG_008377.1:g.6641T>C, NM_000762.5:c.344-44T>C, XM_005258568.1:c.191-44T>C, rs12973939
A > G
SNP
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 147

Overview

Generic Names
Trade Names
Brand Mixture Names

PharmGKB Accession Id

PA452620

Type(s):

Prodrug

Other Vocabularies

PharmGKB Curated Pathways

Pathways created internally by PharmGKB based primarily on literature evidence.

  1. Fluoropyrimidine Pathway, Pharmacodynamics
    Model non-tissue-specific cancer cell displaying genes which may be involved in the pharmacodynamics of the fluoropyrimidines, 5-fluorouracil (5-FU), capecitabine and tegafur.
  1. Fluoropyrimidine Pathway, Pharmacokinetics
    Representation of the metabolic pathways for fluoropyrimidines.

External Pathways

Links to non-PharmGKB pathways.

PharmGKB contains no links to external pathways for this drug. To report a pathway, click here.

Genes that are associated with this drug in PharmGKB's database based on (1) variant annotations, (2) literature review, (3) pathways or (4) information automatically retrieved from DrugBank, depending on the "evidence" and "source" listed below.

Curated Information ?

Curated Information ?

EvidenceDrug
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available PW
fluorouracil

Curated Information ?

Publications related to tegafur: 121

No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Lethal 5-fluorouracil toxicity in a colorectal patient with severe dihydropyrimidine dehydrogenase (DPD) deficiency. International journal of colorectal disease. 2016. Dhelens Carole, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
DPYD gene polymorphisms are associated with risk and chemotherapy prognosis in pediatric patients with acute lymphoblastic leukemia. Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine. 2016. Zhao Xiao-Qiang, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Phenotypic and clinical implications of variants in the dihydropyrimidine dehydrogenase gene. Biochimica et biophysica acta. 2016. Kuilenburg André B P van, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Increased risk of severe fluoropyrimidine-associated toxicity in patients carrying a G to C substitution in the first 28-bp tandem repeat of the thymidylate synthase 2R allele. International journal of cancer. Journal international du cancer. 2016. Meulendijks Didier, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
DPYD Genotyping to Predict Adverse Events Following Treatment With Flourouracil-Based Adjuvant Chemotherapy in Patients With Stage III Colon Cancer: A Secondary Analysis of the PETACC-8 Randomized Clinical Trial. JAMA oncology. 2016. Boige Valérie, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Clinical validity of a DPYD-based pharmacogenetic test to predict severe toxicity to fluoropyrimidines. International journal of cancer. Journal international du cancer. 2015. Toffoli Giuseppe, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Clinical relevance of DPYD variants c.1679T>G, c.1236G>A/HapB3, and c.1601G>A as predictors of severe fluoropyrimidine-associated toxicity: a systematic review and meta-analysis of individual patient data. The Lancet. Oncology. 2015. Meulendijks Didier, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genotyping of a family with a novel deleterious DPYD mutation supports the pretherapeutic screening of DPD deficiency with dihydrouracil/uracil ratio. Clinical pharmacology and therapeutics. 2015. Thomas F, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genotype-phenotype correlations in 5-fluorouracil metabolism: a candidate DPYD haplotype to improve toxicity prediction. The pharmacogenomics journal. 2015. Gentile G, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Germline TYMS genotype is highly predictive in patients with metastatic gastrointestinal malignancies receiving capecitabine-based chemotherapy. Cancer chemotherapy and pharmacology. 2015. Joerger M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
DPYD Variants as Predictors of 5-fluorouracil Toxicity in Adjuvant Colon Cancer Treatment (NCCTG N0147). Journal of the National Cancer Institute. 2014. Lee Adam M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Clinical importance of risk variants in the dihydropyrimidine dehydrogenase gene for the prediction of early-onset fluoropyrimidine toxicity. International journal of cancer. Journal international du cancer. 2014. Froehlich Tanja K, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Comparative Functional Analysis of DPYD Variants of Potential Clinical Relevance to Dihydropyrimidine Dehydrogenase Activity. Cancer research. 2014. Offer Steven M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The role of IVS14+1 G > A genotype detection in the dihydropyrimidine dehydrogenase gene and pharmacokinetic monitoring of 5-fluorouracil in the individualized adjustment of 5-fluorouracil for patients with local advanced and metastatic colorectal cancer: a preliminary report. European review for medical and pharmacological sciences. 2014. Cai X, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A candidate gene study of capecitabine-related toxicity in colorectal cancer identifies new toxicity variants at DPYD and a putative role for ENOSF1 rather than TYMS. Gut. 2014. Rosmarin Dan, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic Markers of Toxicity From Capecitabine and Other Fluorouracil-Based Regimens: Investigation in the QUASAR2 Study, Systematic Review, and Meta-Analysis. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2014. Rosmarin Dan, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A Case of 5-FU-Related Severe Toxicity Associated with the p.Y186C DPYD Variant. Clinical pharmacology and therapeutics. 2014. Zaanan A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A rare cause of susceptibility to neutropenic sepsis in a patient with metastatic pancreas cancer. BMJ case reports. 2014. Suarez Martinez-Falero Beatriz, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thymidylate synthase genotype-directed chemotherapy for patients with gastric and gastroesophageal junction cancers. PloS one. 2014. Goff Laura W, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Potential of dihydropyrimidine dehydrogenase genotypes in personalizing 5-fluorouracil therapy among colorectal cancer patients. Therapeutic drug monitoring. 2013. Teh Lay Kek, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphism of TS 3'-UTR predicts survival of Chinese advanced gastric cancer patients receiving first-line capecitabine plus paclitaxel. Clinical & translational oncology : official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico. 2013. Gao J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinical Pharmacogenetics Implementation Consortium Guidelines for Dihydropyrimidine Dehydrogenase Genotype and Fluoropyrimidine Dosing. Clinical pharmacology and therapeutics. 2013. Caudle Kelly E, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
DPYD IVS14+1G>A and 2846A>T genotyping for the prediction of severe fluoropyrimidine-related toxicity: a meta-analysis. Pharmacogenomics. 2013. Terrazzino Salvatore, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic variants in the DPYD, TYMS, CDA and MTHFR genes are clinically significant predictors of fluoropyrimidine toxicity. British journal of cancer. 2013. Loganayagam A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms of enzymes related to oral tegafur/uracil therapeutic efficacy in patients with hepatocellular carcinoma. Anti-cancer drugs. 2013. Fushiya Nao, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Fixed-dose capecitabine is feasible: results from a pharmacokinetic and pharmacogenetic study in metastatic breast cancer. Breast cancer research and treatment. 2013. Rudek Michelle A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A DPYD Variant (Y186C) in Individuals of African Ancestry Is Associated With Reduced DPD Enzyme Activity. Clinical pharmacology and therapeutics. 2013. Offer S M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Fluoropyrimidine toxicity in patients with dihydropyrimidine dehydrogenase splice site variant: the need for further revision of dose and schedule. Internal and emergency medicine. 2013. Magnani Elena, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Phenotypic profiling of DPYD variations relevant to 5-fluorouracil sensitivity using real-time cellular analysis and in vitro measurement of enzyme activity. Cancer research. 2013. Offer Steven M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic variability & chemotoxicity of 5-fluorouracil & cisplatin in head & neck cancer patients: a preliminary study. The Indian journal of medical research. 2013. Dhawan Dipali, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Dihydropyrimidine Dehydrogenase Gene (DPYD) Polymorphism among Caucasian and non-Caucasian Patients with 5-FU- and Capecitabine-related Toxicity Using Full Sequencing of DPYD. Cancer genomics & proteomics. 2013. Saif Muhammad Wasif. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Evaluating predictive pharmacogenetic signatures of adverse events in colorectal cancer patients treated with fluoropyrimidines. PloS one. 2013. Jennings Barbara A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Multifactorial pharmacogenetic analysis in colorectal cancer patients receiving 5-fluorouracil-based therapy together with cetuximab-irinotecan. British journal of clinical pharmacology. 2012. Etienne-Grimaldi Marie-Christine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
PharmGKB summary: very important pharmacogene information for cytochrome P-450, family 2, subfamily A, polypeptide 6. Pharmacogenetics and genomics. 2012. McDonagh Ellen M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphisms of dihydropyrimidine dehydrogenase gene and clinical outcomes of gastric cancer patients treated with fluorouracil-based adjuvant chemotherapy in Chinese population. Chinese medical journal. 2012. Zhang Xiao-ping, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A bilateral cicatricial ectropion and bilateral upper lid shortening caused by 5-fluorouracil toxicity in a patient with dihydropyrimidine dehydrogenase deficiency. Cutaneous and ocular toxicology. 2011. Obi Ebube E, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Relationship between single nucleotide polymorphisms and haplotypes in DPYD and toxicity and efficacy of capecitabine in advanced colorectal cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Deenen Maarten J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association analysis of CYP2A6 genotypes and haplotypes with 5-fluorouracil formation from tegafur in human liver microsomes. Pharmacogenomics. 2011. Wang Huijuan, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics: From Bench to Byte- An Update of Guidelines. Clinical pharmacology and therapeutics. 2011. Swen J J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Copy number variants in pharmacogenetic genes. Trends in molecular medicine. 2011. He Yijing, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Associations of various gene polymorphisms with toxicity in colorectal cancer patients receiving oral uracil and tegafur plus leucovorin: a prospective study. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO. 2011. Tsunoda A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Phase II study of S-1 combined with oxaliplatin as therapy for patients with metastatic biliary tract cancer: influence of the CYP2A6 polymorphism on pharmacokinetics and clinical activity. British journal of cancer. 2011. Kim K-p, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A POLYMORPHISM IN THE CYTIDINE DEAMINASE PROMOTER PREDICTS SEVERE CAPECITABINE-INDUCED HAND-FOOT SYNDROME. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Caronia Daniela, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic Tailoring of Irinotecan-based First-line Chemotherapy in Metastatic Colorectal Cancer: Results of a Pilot Study. Anticancer research. 2011. Freyer Gilles, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Associations between gene polymorphisms of thymidylate synthase with its protein expression and chemosensitivity to 5-fluorouracil in pancreatic carcinoma cells. Chinese medical journal. 2011. Zhang Qiang, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Phase II study of preoperative radiation plus concurrent daily tegafur-uracil (UFT) with leucovorin for locally advanced rectal cancer. BMC cancer. 2011. Cellier Patrice, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
X-Ray Cross-Complementing Group 1 and Thymidylate Synthase Polymorphisms Might Predict Response to Chemoradiotherapy in Rectal Cancer Patients. International journal of radiation oncology, biology, physics. 2010. Lamas Maria J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Value of gene polymorphisms as markers of 5-FU therapy response in stage III colon carcinoma: a pilot study. Cancer chemotherapy and pharmacology. 2010. Fariña-Sarasqueta Arantza, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Intragenic deletions and a deep intronic mutation affecting pre-mRNA splicing in the dihydropyrimidine dehydrogenase gene as novel mechanisms causing 5-fluorouracil toxicity. Human genetics. 2010. van Kuilenburg André B P, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thymidylate synthase germline polymorphisms in rectal cancer patients treated with neoadjuvant chemoradiotherapy based on 5-fluorouracil. Journal of cancer research and clinical oncology. 2010. Páez David, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Distribution of TYMS, MTHFR, p53 and MDR1 gene polymorphisms in patients with breast cancer treated with neoadjuvant chemotherapy. Cancer epidemiology. 2010. Henríquez-Hernández Luis Alberto, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thymidylate Synthase Gene Polymorphism Affects the Response to Preoperative 5-Fluorouracil Chemoradiation Therapy in Patients With Rectal Cancer. International journal of radiation oncology, biology, physics. 2010. Hur Hyuk, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Can the 2-(13)C-uracil breath test be used to predict the effect of the antitumor drug S-1?. Cancer chemotherapy and pharmacology. 2010. Ishii Yukimoto, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PharmGKB summary: fluoropyrimidine pathways. Pharmacogenetics and genomics. 2010. Thorn Caroline F, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Investigation of IVS14 + 1G > A polymorphism of DPYD gene in a group of Bosnian patients treated with 5-Fluorouracil and capecitabine. Bosnian journal of basic medical sciences / Udru¿enje basi¿nih mediciniskih znanosti = Association of Basic Medical Sciences. 2010. Ceri¿ Timur, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic assessment of toxicity and outcome in patients with metastatic colorectal cancer treated with LV5FU2, FOLFOX, and FOLFIRI: FFCD 2000-05. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2010. Boige Valérie, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The contribution of deleterious DPYD gene sequence variants to fluoropyrimidine toxicity in British cancer patients. Cancer chemotherapy and pharmacology. 2010. Loganayagam Aathavan, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Promoter methylation and large intragenic rearrangements of DPYD are not implicated in severe toxicity to 5-fluorouracil-based chemotherapy in gastrointestinal cancer patients. BMC cancer. 2010. Savva-Bordalo Joana, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms associated with 5-Fluorouracil-induced neurotoxicity. Chemotherapy. 2010. Kim Suk-Ran, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Variants in the dihydropyrimidine dehydrogenase, methylenetetrahydrofolate reductase and thymidylate synthase genes predict early toxicity of 5-fluorouracil in colorectal cancer patients. The Journal of international medical research. 2010. Kristensen M H, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association of molecular markers with toxicity outcomes in a randomized trial of chemotherapy for advanced colorectal cancer: the FOCUS trial. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2009. Braun Michael S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Structure, function, regulation and polymorphism of human cytochrome P450 2A6. Current drug metabolism. 2009. Di Yuan Ming, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Association of CYP2A6 polymorphisms with S-1 plus docetaxel therapy outcomes in metastatic gastric cancer. Pharmacogenomics. 2009. Kong Sun-Young, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Dihydropyrimidine dehydrogenase gene variation and severe 5-fluorouracil toxicity: a haplotype assessment. Pharmacogenomics. 2009. Amstutz Ursula, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Predictors of survival and toxicity in patients on adjuvant therapy with 5-fluorouracil for colorectal cancer. British journal of cancer. 2009. Gusella M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Interaction between two independent CNR1 variants increases risk for cocaine dependence in European Americans: a replication study in family-based sample and population-based sample. Neuropsychopharmacology : official publication of the American College of Neuropsychopharmacology. 2009. Zuo Lingjun, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Influence of dihydropyrimidine dehydrogenase gene (DPYD) coding sequence variants on the development of fluoropyrimidine-related toxicity in patients with high-grade toxicity and patients with excellent tolerance of fluoropyrimidine-based chemotherapy. Neoplasma. 2009. Kleibl Z, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Dihydropyrimidine dehydrogenases and cytidine-deaminase gene polymorphisms as outcome predictors in resected gastric cancer patients treated with fluoropyrimidine adjuvant chemotherapy. Journal of surgical oncology. 2008. Grau Juan J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The influence of fluorouracil outcome parameters on tolerance and efficacy in patients with advanced colorectal cancer. The pharmacogenomics journal. 2008. Capitain O, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Analysis of the DPYD gene implicated in 5-fluorouracil catabolism in Chinese cancer patients. Journal of clinical pharmacy and therapeutics. 2008. He Y-F, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacokinetics of 5-fluorouracil in patients heterozygous for the IVS14+1G > A mutation in the dihydropyrimidine dehydrogenase gene. Nucleosides, nucleotides & nucleic acids. 2008. van Kuilenburg A B P, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CYP2A6 and the plasma level of 5-chloro-2, 4-dihydroxypyridine are determinants of the pharmacokinetic variability of tegafur and 5-fluorouracil, respectively, in Japanese patients with cancer given S-1. Cancer science. 2008. Fujita Ken-ichi, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Role of genetic and nongenetic factors for fluorouracil treatment-related severe toxicity: a prospective clinical trial by the German 5-FU Toxicity Study Group. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2008. Schwab Matthias, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The CYP2A6*4 allele is determinant of S-1 pharmacokinetics in Japanese patients with non-small-cell lung cancer. Clinical pharmacology and therapeutics. 2008. Kaida Y, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
5-Fluorouracil toxicity-attributable IVS14 + 1G > A mutation of the dihydropyrimidine dehydrogenase gene in Polish colorectal cancer patients. Pharmacological reports : PR. 2008. Sulzyc-Bielicka Violetta, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Strong association of a common dihydropyrimidine dehydrogenase gene polymorphism with fluoropyrimidine-related toxicity in cancer patients. PloS one. 2008. Gross Eva, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
DPYD*2A mutation: the most common mutation associated with DPD deficiency. Cancer chemotherapy and pharmacology. 2007. Saif M W, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Dihydropyrimidine dehydrogenase activity and the IVS14+1G>A mutation in patients developing 5FU-related toxicity. British journal of clinical pharmacology. 2007. Magné Nicolas, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
5-Fluorouracil-related severe toxicity: a comparison of different methods for the pretherapeutic detection of dihydropyrimidine dehydrogenase deficiency. Cancer letters. 2007. Boisdron-Celle M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thymidylate synthase (TYMS) and dihydropyrimidine dehydrogenase (DPYD) polymorphisms in the Korean population for prediction of 5-fluorouracil-associated toxicity. Therapeutic drug monitoring. 2007. Cho Hyun-Jung, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphisms in the thymidylate synthase and dihydropyrimidine dehydrogenase genes predict response and toxicity to capecitabine-raltitrexed in colorectal cancer. Oncology reports. 2007. Salgado Josefa, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
DPYD*5 gene mutation contributes to the reduced DPYD enzyme activity and chemotherapeutic toxicity of 5-FU: results from genotyping study on 75 gastric carcinoma and colon carcinoma patients. Medical oncology (Northwood, London, England). 2007. Zhang Hong, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Clinical relevance of different dihydropyrimidine dehydrogenase gene single nucleotide polymorphisms on 5-fluorouracil tolerance. Molecular cancer therapeutics. 2006. Morel Alain, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of capecitabine in advanced breast cancer patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2006. Largillier Rémy, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Orotate phosphoribosyltransferase gene polymorphism predicts toxicity in patients treated with bolus 5-fluorouracil regimen. Clinical cancer research : an official journal of the American Association for Cancer Research. 2006. Ichikawa Wataru, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Methylation of the DPYD promoter: an alternative mechanism for dihydropyrimidine dehydrogenase deficiency in cancer patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2005. Ezzeldin Hany H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cancer treatment and pharmacogenetics of cytochrome P450 enzymes. Investigational new drugs. 2005. van Schaik Ron H N. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphic tandem repeat sequences of the thymidylate synthase gene correlates with cellular-based sensitivity to fluoropyrimidine antitumor agents. Cancer chemotherapy and pharmacology. 2005. Yawata Ayako, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of extraordinary responses to 5-FU/cisplatin chemotherapy in advanced gastric cancer -- report of 2 cases. Onkologie. 2005. Wolschke Christine, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Relationships between promoter polymorphisms in the thymidylate synthase gene and mRNA levels in colorectal cancers. European journal of cancer (Oxford, England : 1990). 2005. Morganti Maria, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Analysis of the DPYD gene implicated in 5-fluorouracil catabolism in a cohort of Caucasian individuals. Clinical cancer research : an official journal of the American Association for Cancer Research. 2005. Seck Katharina, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Characterization of novel CYP2A6 polymorphic alleles (CYP2A6*18 and CYP2A6*19) that affect enzymatic activity. Drug metabolism and disposition: the biological fate of chemicals. 2005. Fukami Tatsuki, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
5-Fluorouracil/irinotecan induced lethal toxicity as a result of a combined pharmacogenetic syndrome: report of a case. Journal of clinical pathology. 2005. Steiner M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Dihydropyrimidine dehydrogenase deficiency presenting at birth. Journal of inherited metabolic disease. 2005. Al-Sanna'a N A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Multiple organ failure due to 5-fluorouracil chemotherapy in a patient with a rare dihydropyrimidine dehydrogenase gene variant. Onkologie. 2004. Lazar A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Dihydropyrimidine dehydrogenase pharmacogenetics in the Taiwanese population. Cancer chemotherapy and pharmacology. 2004. Hsiao Hui-Hua, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Mutations in exon 14 of dihydropyrimidine dehydrogenase and 5-Fluorouracil toxicity in Portuguese colorectal cancer patients. Genetics in medicine : official journal of the American College of Medical Genetics. 2004. Salgueiro Natália, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Detailed analysis of five mutations in dihydropyrimidine dehydrogenase detected in cancer patients with 5-fluorouracil-related side effects. Human mutation. 2003. Gross Eva, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Identification and functional analysis of single nucleotide polymorphism in the tandem repeat sequence of thymidylate synthase gene. Cancer research. 2003. Kawakami Kazuyuki, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The contribution of cytochrome P450 to the metabolism of tegafur in human liver. Drug metabolism and pharmacokinetics. 2003. Kajita Jiro, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
High prevalence of the IVS14 + 1G>A mutation in the dihydropyrimidine dehydrogenase gene of patients with severe 5-fluorouracil-associated toxicity. Pharmacogenetics. 2002. Van Kuilenburg André B, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Increased risk of grade IV neutropenia after administration of 5-fluorouracil due to a dihydropyrimidine dehydrogenase deficiency: high prevalence of the IVS14+1g>a mutation. International journal of cancer. Journal international du cancer. 2002. Van Kuilenburg André B P, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A novel mutant allele of the CYP2A6 gene (CYP2A6*11 ) found in a cancer patient who showed poor metabolic phenotype towards tegafur. Pharmacogenetics. 2002. Daigo Satoshi, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Novel disease-causing mutations in the dihydropyrimidine dehydrogenase gene interpreted by analysis of the three-dimensional protein structure. The Biochemical journal. 2002. van Kuilenburg André B P, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Reduced 5-FU clearance in a patient with low DPD activity due to heterozygosity for a mutant allele of the DPYD gene. British journal of cancer. 2002. Maring J G, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Profound dihydropyrimidine dehydrogenase deficiency resulting from a novel compound heterozygote genotype. Clinical cancer research : an official journal of the American Association for Cancer Research. 2002. Johnson Martin R, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Prevalence of a common point mutation in the dihydropyrimidine dehydrogenase (DPD) gene within the 5'-splice donor site of intron 14 in patients with severe 5-fluorouracil (5-FU)- related toxicity compared with controls. Clinical cancer research : an official journal of the American Association for Cancer Research. 2001. Raida M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Lethal outcome of a patient with a complete dihydropyrimidine dehydrogenase (DPD) deficiency after administration of 5-fluorouracil: frequency of the common IVS14+1G>A mutation causing DPD deficiency. Clinical cancer research : an official journal of the American Association for Cancer Research. 2001. van Kuilenburg A B, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Clinical implications of dihydropyrimidine dehydrogenase (DPD) deficiency in patients with severe 5-fluorouracil-associated toxicity: identification of new mutations in the DPD gene. Clinical cancer research : an official journal of the American Association for Cancer Research. 2000. van Kuilenburg A B, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Roles of cytochromes P450 1A2, 2A6, and 2C8 in 5-fluorouracil formation from tegafur, an anticancer prodrug, in human liver microsomes. Drug metabolism and disposition: the biological fate of chemicals. 2000. Komatsu T, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thymidylate synthase gene polymorphism determines response and toxicity of 5-FU chemotherapy. The pharmacogenomics journal. 2001. Pullarkat S T, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Bioactivation of tegafur to 5-fluorouracil is catalyzed by cytochrome P-450 2A6 in human liver microsomes in vitro. Clinical cancer research : an official journal of the American Association for Cancer Research. 2000. Ikeda K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
The tegafur-based dihydropyrimidine dehydrogenase inhibitory fluoropyrimidines, UFT/leucovorin (ORZEL) and S-1: a review of their clinical development and therapeutic potential. Investigational new drugs. 2000. Hoff P M. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Known variant DPYD alleles do not explain DPD deficiency in cancer patients. Pharmacogenetics. 2000. Collie-Duguid E S, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genotype and phenotype in patients with dihydropyrimidine dehydrogenase deficiency. Human genetics. 1999. Van Kuilenburg A B, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Polymorphic tandem repeats in the thymidylate synthase gene is associated with its protein expression in human gastrointestinal cancers. Anticancer research. 1999. Kawakami K, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Dihydropyrimidine dehydrogenase pharmacogenetics in patients with colorectal cancer. British journal of cancer. 1998. Ridge S A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Dihydropyrimidine dehydrogenase (DPD) deficiency: identification and expression of missense mutations C29R, R886H and R235W. Human genetics. 1997. Vreken P, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Heterozygosity for a point mutation in an invariant splice donor site of dihydropyrimidine dehydrogenase and severe 5-fluorouracil related toxicity. European journal of cancer (Oxford, England : 1990). 1997. Van Kuilenburg A B, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Partial epilepsy in a girl with a symptom-free sister: first two Finnish patients with dihydropyrimidine dehydrogenase deficiency. Journal of inherited metabolic disease. 1997. Holopainen I, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Molecular basis of the human dihydropyrimidine dehydrogenase deficiency and 5-fluorouracil toxicity. The Journal of clinical investigation. 1996. Wei X, et al. PubMed

LinkOuts

Clinical Trials

These are trials that mention tegafur and are related to either pharmacogenetics or pharmacogenomics.

No trials loaded.

NURSA Datasets

provided by nursa.org

No NURSA datasets available.

Common Searches

Search PubMed
Search Medline Plus
Search PubChem
Search CTD

Sources for PharmGKB drug information: DrugBank, PubChem.