Chemical: Drug

PharmGKB contains no prescribing info for this . Contact us to report known genotype-based dosing guidelines, or if you are interested in developing guidelines.

Annotated Labels

  1. Annotation of FDA Label for trastuzumab and ERBB2
  2. Annotation of EMA Label for trastuzumab and ERBB2
  3. Annotation of PMDA Label for trastuzumab and ERBB2
  4. Annotation of HCSC Label for trastuzumab and ERBB2

last updated 10/25/2013

1. Annotation of FDA Label for trastuzumab and ERBB2

Testing required


Trastuzumab (Herceptin) is used for the treatment of HER2 overexpressing node positive or node negative breast cancer, metastatic breast cancer and metastatic gastric cancer. The FDA requires test results demonstrating HER2 protein overexpression prior to initiating therapy.

There's more of this label. Read more.

last updated 12/05/2013

2. Annotation of EMA Label for trastuzumab and ERBB2

Testing required


The EMA European Public Assessment Report (EPAR) for trastuzumab (Herceptin) requires testing of tumours for HER2 overexpression or gene amplification prior to initiating therapy. Trastuzumab (Herceptin) targets human epidermal growth factor receptor 2 (HER2) to inhibit growth of HER2 overexpressing cancer cells.

There's more of this label. Read more.

4. Annotation of HCSC Label for trastuzumab and ERBB2

Testing required


The product monograph for trastuzumab (HERCEPTIN) states that it is indicated for patients with early or metastatic breast cancer, or metastatic adenocarcinoma of the stomach or gastroesophageal junction, whose tumors are HER2 positive.

There's more of this label. Read more.

PharmGKB contains no Clinical Variants that meet the highest level of criteria.

To see more Clinical Variants with lower levels of criteria, click the button at the bottom of the page.

Disclaimer: The PharmGKB's clinical annotations reflect expert consensus based on clinical evidence and peer-reviewed literature available at the time they are written and are intended only to assist clinicians in decision-making and to identify questions for further research. New evidence may have emerged since the time an annotation was submitted to the PharmGKB. The annotations are limited in scope and are not applicable to interventions or diseases that are not specifically identified.

The annotations do not account for individual variations among patients, and cannot be considered inclusive of all proper methods of care or exclusive of other treatments. It remains the responsibility of the health-care provider to determine the best course of treatment for a patient. Adherence to any guideline is voluntary, with the ultimate determination regarding its application to be made solely by the clinician and the patient. PharmGKB assumes no responsibility for any injury or damage to persons or property arising out of or related to any use of the PharmGKB clinical annotations, or for any errors or omissions.

? = Mouse-over for quick help

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Links in the "Gene" column lead to PharmGKB Gene Pages.

List of all variant annotations for trastuzumab

Gene ? Variant?
Alternate Names ? Chemicals ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
No VIP available No VIP available VA CYP3A4 *1 N/A N/A N/A
No VIP available No VIP available VA CYP3A4 *22 N/A N/A N/A
No VIP available No VIP available VA CYP3A5 *1A N/A N/A N/A
No VIP available No VIP available VA CYP3A5 *3A N/A N/A N/A
No VIP available No VIP available VA GSTM1 non-null N/A N/A N/A
No VIP available No VIP available VA GSTM1 null N/A N/A N/A
No VIP available No VIP available VA GSTT1 non-null N/A N/A N/A
No VIP available No VIP available VA GSTT1 null N/A N/A N/A
No VIP available CA VA
rs1136201 NC_000017.10:g.37879588A>G, NC_000017.11:g.39723335A>G, NG_007503.1:g.40196A>G, NM_001005862.2:c.1873A>G, NM_001289936.1:c.1918A>G, NM_001289937.1:c.1963A>G, NM_004448.3:c.1963A>G, NP_001005862.1:p.Ile625Val, NP_001276865.1:p.Ile640Val, NP_001276866.1:p.Ile655Val, NP_004439.2:p.Ile655Val, NR_110535.1:n.2287A>G, XM_005257139.1:c.1918A>G, XM_005257140.1:c.1873A>G, XP_005257196.1:p.Ile640Val, XP_005257197.1:p.Ile625Val, rs17606815, rs1801200, rs2006406, rs2230699, rs59955961
A > -
A > G
No VIP available No Clinical Annotations available VA
rs11479 NC_000022.10:g.50964236G>A, NC_000022.11:g.50525807G>A, NG_011860.1:g.9279C>T, NG_016235.1:g.5633C>T, NG_021419.1:g.22592G>A, NM_001113755.2:c.1412C>T, NM_001113756.2:c.1412C>T, NM_001169109.1:c.-14+439C>T, NM_001169110.1:c.-14+194C>T, NM_001169111.1:c.-379C>T, NM_001257988.1:c.1412C>T, NM_001257989.1:c.1427C>T, NM_001953.4:c.1412C>T, NM_005138.2:c.-349C>T, NP_001107227.1:p.Ser471Leu, NP_001107228.1:p.Ser471Leu, NP_001244917.1:p.Ser471Leu, NP_001244918.1:p.Ser476Leu, NP_001944.1:p.Ser471Leu, rs17846490, rs17859554, rs3202233, rs3829983
G > A
No VIP available No Clinical Annotations available VA
rs11615 NC_000019.10:g.45420395A>G, NC_000019.9:g.45923653A>G, NG_015839.2:g.63434T>C, NM_001166049.1:c.354T>C, NM_001983.3:c.354T>C, NM_202001.2:c.354T>C, NP_001159521.1:p.Asn118=, NP_001974.1:p.Asn118=, NP_973730.1:p.Asn118=, XM_005258634.1:c.354T>C, XM_005258635.1:c.354T>C, XM_005258635.2:c.354T>C, XM_005258636.1:c.354T>C, XM_005258636.3:c.354T>C, XM_005258637.1:c.354T>C, XM_005258638.1:c.138T>C, XM_011526610.1:c.354T>C, XP_005258691.1:p.Asn118=, XP_005258692.1:p.Asn118=, XP_005258693.1:p.Asn118=, XP_005258694.1:p.Asn118=, XP_005258695.1:p.Asn46=, XP_011524912.1:p.Asn118=, rs1130005, rs17285882, rs17359303, rs17845191, rs17858003, rs17859564, rs2228629, rs3177700, rs3188446, rs3752251, rs59923575
A > G
No VIP available No Clinical Annotations available VA
rs13181 NC_000019.10:g.45351661T>G, NC_000019.9:g.45854919T>G, NG_007067.2:g.23927A>C, NM_000400.3:c.2251A>C, NM_177417.2:c.*304T>G, NP_000391.1:p.Lys751Gln, XM_005258536.1:c.*128T>G, XM_005258536.3:c.*128T>G, XM_005258537.1:c.*128T>G, XM_005258538.1:c.*304T>G, XM_005258539.1:c.*304T>G, XM_005258639.1:c.2179A>C, XM_005258640.1:c.2017A>C, XM_005258641.1:c.1513A>C, XM_011526611.1:c.2173A>C, XP_005258696.1:p.Lys727Gln, XP_005258697.1:p.Lys673Gln, XP_005258698.1:p.Lys505Gln, XP_011524913.1:p.Lys725Gln, rs1052559, rs17285142, rs17355147, rs17359310, rs3170171, rs3859422, rs60606175
T > G
No VIP available No Clinical Annotations available VA
rs151264360 NC_000018.10:g.673444_673449delTTAAAG, NC_000018.9:g.673444_673449delTTAAAG, NG_028255.1:g.20841_20846delTTAAAG, NM_001071.2:c.*447_*452delTTAAAG, NM_001126123.3:c.*145-373_*145-368del, NM_001126123.3:c.*145-373_*145-368delCTTTAA, NM_001318759.1:c.*145-373_*145-368del, NM_001318759.1:c.*145-373_*145-368delCTTTAA, NM_001318760.1:c.*446+410_*446+415delCTTTAA, NM_001318760.1:c.*856_*861del, NM_017512.5:c.*856_*861delCTTTAA, NM_202758.3:c.*856_*861delCTTTAA, XM_005258111.1:c.*856_*861delCTTTAA, XM_005258112.1:c.*856_*861delCTTTAA, XM_005258113.1:c.*856_*861delCTTTAA, XM_005258114.1:c.*856_*861delCTTTAA, XM_005258115.1:c.*856_*861delCTTTAA, XM_005258116.1:c.*856_*861delCTTTAA, XM_005258117.1:c.*856_*861delCTTTAA, XM_005258118.1:c.*856_*861delCTTTAA, XM_005258118.2:c.*856_*861del, XM_005258120.1:c.*856_*861delCTTTAA, XM_005258137.1:c.*447_*452delTTAAAG, XM_005258138.1:c.*447_*452delTTAAAG, XM_011525677.1:c.*856_*861del, XM_011525678.1:c.*856_*861del, XM_011525679.1:c.*856_*861del, XM_011525680.1:c.*856_*861del, XM_011525681.1:c.*856_*861del, XM_011525682.1:c.*856_*861del, XM_011525683.1:c.*856_*861del, XM_011525684.1:c.*856_*861del, XM_011525685.1:c.*856_*861del, XM_011525686.1:c.*856_*861del, XM_011525687.1:c.*856_*861del, XM_011525688.1:c.*856_*861del, XM_011525689.1:c.*856_*861del, XM_011525690.1:c.*856_*861del, XM_011525691.1:c.*856_*861del, XM_011525692.1:c.*856_*861del, XM_011525693.1:c.*856_*861del, XM_011525694.1:c.*856_*861del, XM_011525695.1:c.*856_*861del, XM_011525696.1:c.*856_*861del, XM_011525697.1:c.*856_*861del, XM_011525698.1:c.*856_*861del, XM_011525699.1:c.*856_*861del, XR_243810.1:n.1672-373_1672-368delCTTTAA, XR_243810.3:n.1513-373_1513-368del, XR_243811.1:n.1538-373_1538-368delCTTTAA, XR_243811.2:n.1538-373_1538-368del, XR_243812.1:n.2112_2117delCTTTAA, XR_430041.2:n.1633-373_1633-368del, XR_935066.1:n.2109_2114del, XR_935067.1:n.1967_1972del
No VIP available No Clinical Annotations available VA
rs1695 NC_000011.10:g.67585218A>G, NC_000011.9:g.67352689A>G, NG_012075.1:g.6624A>G, NM_000852.3:c.313A>G, NP_000843.1:p.Ile105Val, XM_005273958.1:c.313A>G, XP_005274015.1:p.Ile105Val, rs1138257, rs11553891, rs17353321, rs17856342, rs2230827, rs4609, rs56971933, rs947894
A > G
No VIP available No Clinical Annotations available VA
rs1799793 NC_000019.10:g.45364001C>T, NC_000019.9:g.45867259C>T, NG_007067.2:g.11587G>A, NM_000400.3:c.934G>A, NM_001130867.1:c.862G>A, NP_000391.1:p.Asp312Asn, NP_001124339.1:p.Asp288Asn, XM_005258639.1:c.862G>A, XM_005258640.1:c.700G>A, XM_005258641.1:c.196G>A, XM_005258642.1:c.934G>A, XM_011526611.1:c.856G>A, XP_005258696.1:p.Asp288Asn, XP_005258697.1:p.Asp234Asn, XP_005258698.1:p.Asp66Asn, XP_005258699.1:p.Asp312Asn, XP_011524913.1:p.Asp286Asn, XR_935763.1:n.981G>A, rs3916814, rs58989209
C > T
No VIP available No Clinical Annotations available VA
rs1801133 NC_000001.10:g.11856378G>A, NC_000001.11:g.11796321G>A, NG_013351.1:g.14783C>T, NM_005957.4:c.665C>T, NP_005948.3:p.Ala222Val, XM_005263458.1:c.788C>T, XM_005263458.2:c.788C>T, XM_005263459.1:c.734C>T, XM_005263460.1:c.665C>T, XM_005263460.3:c.665C>T, XM_005263461.1:c.665C>T, XM_005263461.3:c.665C>T, XM_005263462.1:c.665C>T, XM_005263462.3:c.665C>T, XM_005263463.1:c.419C>T, XM_005263463.2:c.419C>T, XM_011541495.1:c.785C>T, XM_011541496.1:c.788C>T, XP_005263515.1:p.Ala263Val, XP_005263516.1:p.Ala245Val, XP_005263517.1:p.Ala222Val, XP_005263518.1:p.Ala222Val, XP_005263519.1:p.Ala222Val, XP_005263520.1:p.Ala140Val, XP_011539797.1:p.Ala262Val, XP_011539798.1:p.Ala263Val, rs386545618, rs4134713, rs59514310
G > A
No VIP available No Clinical Annotations available VA
rs1801158 NC_000001.10:g.97981421C>T, NC_000001.11:g.97515865C>T, NG_008807.2:g.410195G>A, NM_000110.3:c.1601G>A, NP_000101.2:p.Ser534Asn, XM_005270561.1:c.1490G>A, XM_005270562.1:c.1524+33695G>A, XM_005270562.3:c.1524+33695G>A, XM_005270563.1:c.1601G>A, XM_005270564.1:c.1601G>A, XM_006710397.2:c.1601G>A, XP_005270618.1:p.Ser497Asn, XP_005270620.1:p.Ser534Asn, XP_005270621.1:p.Ser534Asn, XP_006710460.1:p.Ser534Asn, rs199469539, rs52824375, rs59516208
C > T
No VIP available CA VA
rs1801274 NC_000001.10:g.161479745A>G, NC_000001.11:g.161509955A>G, NG_012066.1:g.9541A>G, NM_001136219.1:c.500A>G, NM_021642.3:c.497A>G, NP_001129691.1:p.His167Arg, NP_067674.2:p.His166Arg, XM_005244960.1:c.500A>G, XM_011509287.1:c.500A>G, XM_011509288.1:c.497A>G, XM_011509289.1:c.500A>G, XM_011509290.1:c.500A>G, XM_011509291.1:c.500A>G, XP_005245017.1:p.His167Arg, XP_011507589.1:p.His167Arg, XP_011507590.1:p.His166Arg, XP_011507591.1:p.His167Arg, XP_011507592.1:p.His167Arg, XP_011507593.1:p.His167Arg, rs16830404, rs17851761, rs386545630, rs52796393, rs58440466
A > G
No VIP available No Clinical Annotations available VA
rs2072671 NC_000001.10:g.20915701A>C, NC_000001.11:g.20589208A>C, NM_001785.2:c.79A>C, NP_001776.1:p.Lys27Gln, rs57221291
A > C
No VIP available No Clinical Annotations available VA
rs2612091 NC_000018.10:g.683607C>T, NC_000018.9:g.683607C>T, NM_001126123.3:c.496-227G>A, NM_001318759.1:c.742-227G>A, NM_001318760.1:c.199-227G>A, NM_017512.5:c.742-227G>A, NM_202758.3:c.805-227G>A, XM_005258111.1:c.886-227G>A, XM_005258112.1:c.661-227G>A, XM_005258113.1:c.658-227G>A, XM_005258114.1:c.514-227G>A, XM_005258115.1:c.496-227G>A, XM_005258116.1:c.496-227G>A, XM_005258117.1:c.310-227G>A, XM_005258118.1:c.199-227G>A, XM_005258118.2:c.199-227G>A, XM_005258120.1:c.157-227G>A, XM_011525677.1:c.769-212G>A, XM_011525678.1:c.760-212G>A, XM_011525679.1:c.769-227G>A, XM_011525680.1:c.742-212G>A, XM_011525681.1:c.730-212G>A, XM_011525682.1:c.703-212G>A, XM_011525683.1:c.580-212G>A, XM_011525684.1:c.553-212G>A, XM_011525685.1:c.541-212G>A, XM_011525686.1:c.517-212G>A, XM_011525687.1:c.514-227G>A, XM_011525688.1:c.496-212G>A, XM_011525689.1:c.364-212G>A, XM_011525690.1:c.364-212G>A, XM_011525691.1:c.310-212G>A, XM_011525692.1:c.310-212G>A, XM_011525693.1:c.310-212G>A, XM_011525694.1:c.310-227G>A, XM_011525695.1:c.271-212G>A, XM_011525696.1:c.199-212G>A, XM_011525697.1:c.157-212G>A, XM_011525698.1:c.157-212G>A, XM_011525699.1:c.157-212G>A, XR_243810.1:n.937-227G>A, XR_243810.3:n.778-227G>A, XR_243811.1:n.803-227G>A, XR_243811.2:n.803-227G>A, XR_243812.1:n.938-227G>A, XR_430041.2:n.940-227G>A, XR_935066.1:n.778-212G>A, XR_935067.1:n.778-212G>A, rs61671949
C > T
No VIP available No Clinical Annotations available VA
rs3212986 NC_000019.10:g.45409478C>A, NC_000019.9:g.45912736C>A, NG_015839.2:g.74351G>T, NM_001166049.1:c.*197G>T, NM_001297590.1:c.1516C>A, NM_001983.3:c.*197G>T, NM_012099.1:c.1510C>A, NP_001284519.1:p.Gln506Lys, NP_036231.1:p.Gln504Lys, XM_005258425.1:c.1516C>A, XM_005258638.1:c.*197G>T, XP_005258482.1:p.Gln506Lys, rs386580934, rs60333438
C > A
C > T
No VIP available CA VA
rs396991 NC_000001.10:g.161514542A>C, NC_000001.11:g.161544752A>C, NG_009066.1:g.10872T>G, NM_000569.6:c.634T>G, NM_001127592.1:c.631T>G, NM_001127593.1:c.526T>G, NM_001127595.1:c.526T>G, NM_001127596.1:c.523T>G, NP_000560.5:p.Phe212Val, NP_001121064.1:p.Phe211Val, NP_001121065.1:p.Phe176Val, NP_001121067.1:p.Phe176Val, NP_001121068.1:p.Phe175Val, XM_011509293.1:c.428-1553T>G, rs17857127, rs2229097, rs3171040, rs4151086, rs61228128
A > C
A > G
No VIP available No Clinical Annotations available VA
rs45445694 NC_000018.10:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NC_000018.9:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NG_028255.1:g.5043_5070CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NM_001012716.2:c.*34+169_*34+196CGGGACGGAGGCAGGCCAAGTGGCGCGG[2][3][4][7][8][9], NM_001071.2:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258137.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258138.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], rs34743033 (retired)
No VIP available No Clinical Annotations available VA
rs56038477 NC_000001.10:g.98039419C>T, NC_000001.11:g.97573863C>T, NG_008807.2:g.352197G>A, NM_000110.3:c.1236G>A, NP_000101.2:p.Glu412=, XM_005270561.1:c.1125G>A, XM_005270562.1:c.1236G>A, XM_005270562.3:c.1236G>A, XM_005270563.1:c.1236G>A, XM_005270564.1:c.1236G>A, XM_006710397.2:c.1236G>A, XP_005270618.1:p.Glu375=, XP_005270619.1:p.Glu412=, XP_005270619.2:p.Glu412=, XP_005270620.1:p.Glu412=, XP_005270621.1:p.Glu412=, XP_006710460.1:p.Glu412=, rs199469533, rs61730901
C > T
No VIP available No Clinical Annotations available VA
rs67376798 NC_000001.10:g.97547947T>A, NC_000001.11:g.97082391T>A, NG_008807.2:g.843669A>T, NM_000110.3:c.2846A>T, NP_000101.2:p.Asp949Val, XM_005270561.1:c.2735A>T, XM_005270562.1:c.2630A>T, XM_005270562.3:c.2630A>T, XP_005270618.1:p.Asp912Val, XP_005270619.1:p.Asp877Val, XP_005270619.2:p.Asp877Val, rs199469564, rs386467430, rs67376799
T > A
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 147


Generic Names
  • Anti HER2
  • Ig gamma-1 chain C region
Trade Names
  • Herceptin
  • Herceptin (Genentech)
Brand Mixture Names

PharmGKB Accession Id





A recombinant IgG1 kappa, humanized monoclonal antibody that selectively binds with high affinity in a cell-based assay (Kd = 5 nM) to the extracellular domain of the human epidermal growth factor receptor protein. Produced in CHO cell culture.*

Source: Drug Bank


For treatment of early stage HER2-positive breast cancer, or metastatic breast cancer that substantially overexpress HER2.

Source: Drug Bank

Other Vocabularies

Information pulled from DrugBank has not been reviewed by PharmGKB.

Pharmacology, Interactions, and Contraindications

Mechanism of Action

Trastuzumab binds to the HER2 (or c-erbB2) proto-oncogene, an EGF receptor-like protein found on 20-30% of breast cancer cells. The binding leads to antibody mediated (complement mediated) killing of the HER2 positive cells.

Source: Drug Bank


Used in the treatment of HER2-positive breast cancer. HER2 protein overexpression is observed in 25%-30% of primary breast cancers.Trastuzumab has been shown, in both in vitro assays and in animals, to inhibit the proliferation of human tumorcells that overexpress HER2. It is a mediator of antibody dependent cellular cytotoxicity, in that the binding of the antibody to HER2 overexpressing cells leads to preferential cell death.

Source: Drug Bank

Absorption, Distribution, Metabolism, Elimination & Toxicity


Most likely removed by opsonization via the reticuloendothelial system.

Source: Drug Bank


average 28.5 days

Source: Drug Bank


Administration of trastuzumab can result in ventricular dysfunction and congestive heart failure. Risk of cardiotocity is especially elevated in patients recieving concurrent anthracycline or cyclophosphamide therapy.

Source: Drug Bank

Volume of Distribution

* 44 mL/kg

Source: Drug Bank

Chemical Properties

Chemical Formula


Source: Drug Bank

Canonical SMILES

Not Available

Source: Drug Bank

Average Molecular Weight


Source: Drug Bank

Genes that are associated with this drug in PharmGKB's database based on (1) variant annotations, (2) literature review, (3) pathways or (4) information automatically retrieved from DrugBank, depending on the "evidence" and "source" listed below.

Curated Information ?

Drug Targets

Gene Description
C1QA (source: Drug Bank )
C1QB (source: Drug Bank )
C1QC (source: Drug Bank )
C1R (source: Drug Bank )
C1S (source: Drug Bank )
EGFR (source: Drug Bank )
ERBB2 (source: Drug Bank )
FCGR1A (source: Drug Bank )
FCGR2A (source: Drug Bank )
FCGR2B (source: Drug Bank )
FCGR2C (source: Drug Bank )
FCGR3A (source: Drug Bank )
FCGR3B (source: Drug Bank )

Drug Interactions

Interaction Description
trastuzumab - abatacept Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - abciximab Abciximab may increase the risk of a hypersensitivy reaction to Trastuzumab. (source: Drug Bank )
trastuzumab - adalimumab Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - alemtuzumab Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - altretamine Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - amsacrine Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - anakinra Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - asparaginase Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - azacitidine Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - azathioprine Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - basiliximab Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - betamethasone Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - bleomycin Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - busulfan Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - capecitabine Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - carboplatin Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - carmustine Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - chlorambucil Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - cisplatin Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - cladribine Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - clofarabine Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - corticotropin Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - cyclophosphamide Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - cyclosporine Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - cytarabine Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - dacarbazine Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - daclizumab Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - dactinomycin Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - daunorubicin Trastuzumab may increase the cardiotoxicity of Daunorubicin. Signs and symptoms of cardiac dysfunction should be monitored for frequently. Increased risk of heart failure. Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - dexamethasone Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - docetaxel Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - doxorubicin Trastuzumab may increase the cardiotoxicity of Doxorubicin. Signs and symptoms of cardiac dysfunction should be monitored for frequently. Increased risk of heart failure. Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - efalizumab Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - epirubicin Trastuzumab may increase the cardiotoxicity of Epirubicin. Signs and symptoms of cardiac dysfunction should be monitored for frequently. Increased risk of heart failure. Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - erlotinib Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - estramustine Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - etanercept Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - etoposide Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - floxuridine Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - fludarabine Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - fludrocortisone Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - fluorouracil Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - gefitinib Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - gemcitabine Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - hydrocortisone Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - hydroxyurea Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - ibritumomab Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - idarubicin Trastuzumab may increase the cardiotoxicity of Idarubicin. Signs and symptoms of cardiac dysfunction should be monitored for frequently. Increased risk of heart failure. Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - ifosfamide Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - imatinib Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - infliximab Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - irinotecan Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - lenalidomide Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - lomustine Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - mechlorethamine Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - melphalan Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - mercaptopurine Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - methotrexate Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - methylprednisolone Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - mitomycin Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - mitoxantrone Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - muromonab Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - natalizumab Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - nelarabine Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - nilotinib Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - oxaliplatin Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - paclitaxel Trastuzumab may increase the risk of neutropenia and anemia. Concomitant therapy may also increase Trastuzumab serum concentration and decrease Paclitaxel serum concentrations. Monitor closely for adverse events and therapeutic response. (source: Drug Bank )
trastuzumab - pegaspargase Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - pentostatin Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - prednisolone Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - prednisone Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - procarbazine Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - rituximab Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - sirolimus Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - sorafenib Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - streptozocin Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - sunitinib Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - tacrolimus Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - temozolomide Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - temsirolimus Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - teniposide Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - thalidomide Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - thioguanine Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - thiotepa Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - topotecan Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - tositumomab Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - tretinoin Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - triamcinolone Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - valrubicin Trastuzumab may increase the cardiotoxicity of Valrubicin. Signs and symptoms of cardiac dysfunction should be monitored for frequently. Increased risk of heart failure. Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - vinblastine Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - vincristine Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trastuzumab - vinorelbine Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
valrubicin - trastuzumab Trastuzumab may increase the cardiotoxicity of Valrubicin. Consider alternate therapy or monitor for signs and symptoms of cardiac dysfunction. (source: Drug Bank )

Curated Information ?

No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Arrhythmias, Cardiac
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Arthritis, Rheumatoid
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Atrial Fibrillation
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Attention Deficit Disorder with Hyperactivity
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Bipolar Disorder
No Dosing Guideline available DL CA VA No VIP available No VIP available
Breast Neoplasms
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Carcinoma, Non-Small-Cell Lung
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Carcinoma, Renal Cell
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Colonic Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Colorectal Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Crohn Disease
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cystadenocarcinoma, Papillary
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cystadenocarcinoma, Serous
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cystic Fibrosis
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Diabetes Mellitus, Type 2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Drug Resistance
No Dosing Guideline available DL CA VA No VIP available No VIP available
Drug Toxicity
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Endometrial Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Esophageal Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gastrointestinal Stromal Tumors
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gilbert's syndrome
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
hand-foot syndrome
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Heart Failure
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Hereditary Breast/Ovarian Cancer Syndrome
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HIV Infections
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Hypereosinophilic Syndrome
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Hyperlipoproteinemia Type II
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Inflammatory Bowel Diseases
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Kidney Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Kidney Transplantation
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukemia, Lymphocytic, Chronic, B-Cell
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukemia, Myelogenous, Chronic, BCR-ABL Positive
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukemia, Myeloid
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukemia, Myeloid, Acute
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukemia, Nonlymphocytic, Acute
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukemia, Promyelocytic, Acute
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Lung Diseases, Interstitial
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Lung Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Lymphoma, Large-Cell, Anaplastic
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Myelodysplastic Syndromes
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Neoplasm Metastasis
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Ocular Hypertension
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Ovarian Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pancreatic Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Peripheral Vascular Diseases
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Precursor Cell Lymphoblastic Leukemia-Lymphoma
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
progression-free survival
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pulmonary Disease, Chronic Obstructive
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pulmonary Fibrosis
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Sjogren's Syndrome
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
Stomach Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thyroid Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Toxic liver disease
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Tuberculosis, Pulmonary
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Tumor Lysis Syndrome
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Urinary Incontinence
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Uterine Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available

Relationships from National Drug File - Reference Terminology (NDF-RT)

May Treat
Contraindicated With

Publications related to trastuzumab: 43

No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacogenetic variants associated with outcome in patients with advanced gastric cancer treated with fluoropyrimidine and platinum-based triplet combinations: a pooled analysis of three prospective studies. The pharmacogenomics journal. 2016. Meulendijks D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics driving personalized medicine: analysis of genetic polymorphisms related to breast cancer medications in Italian isolated populations. Journal of translational medicine. 2016. Cocca Massimiliano, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
In situ single-cell analysis identifies heterogeneity for PIK3CA mutation and HER2 amplification in HER2-positive breast cancer. Nature genetics. 2015. Janiszewska Michalina, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Systems biology approaches to adverse drug effects: the example of cardio-oncology. Nature reviews. Clinical oncology. 2015. Brown Sherry-Ann, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Influence of the HER2 Ile655Val polymorphism on trastuzumab-induced cardiotoxicity in HER2-positive breast cancer patients: a meta-analysis. Pharmacogenetics and genomics. 2015. Gómez Peña Celia, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
De novo resistance biomarkers to anti-HER2 therapies in HER2-positive breast cancer. Pharmacogenomics. 2015. Madrid-Paredes Adela, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PIK3CA mutations are associated with lower rates of pathologic complete response to anti-human epidermal growth factor receptor 2 (her2) therapy in primary HER2-overexpressing breast cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2014. Loibl Sibylle, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
EMA Initiatives and Perspectives on Pharmacogenomics. British journal of clinical pharmacology. 2014. Ehmann Falk, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinical Implementation of Germline Cancer Pharmacogenetic Variants during the Next-Generation Sequencing Era. Clinical pharmacology and therapeutics. 2013. Gillis Nancy K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Emerging landscape of oncogenic signatures across human cancers. Nature genetics. 2013. Ciriello Giovanni, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Challenges in pharmacogenetics. European journal of clinical pharmacology. 2013. Cascorbi Ingolf, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics as a risk mitigation strategy for chemotherapeutic cardiotoxicity. Pharmacogenomics. 2013. Jensen Brian C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genomic approach towards personalized anticancer drug therapy. Pharmacogenomics. 2012. Midorikawa Yutaka, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
FcgammaR2A and 3A polymorphisms predict clinical outcome of trastuzumab in both neoadjuvant and metastatic settings in patients with HER2-positive breast cancer. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO. 2011. Tamura K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
HER2-amplified breast cancer: mechanisms of trastuzumab resistance and novel targeted therapies. Expert review of anticancer therapy. 2011. Gajria Devika, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomic contribution to drug response. Cancer journal (Sudbury, Mass.). 2011. Watson Roshawn G, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CLEOPATRA: a phase III evaluation of pertuzumab and trastuzumab for HER2-positive metastatic breast cancer. Clinical breast cancer. 2010. Baselga José, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Efficacy and cardiac safety of adjuvant trastuzumab-based chemotherapy regimens for HER2-positive early breast cancer. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO. 2010. Costa R B, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Systematic review of pharmacoeconomic studies of pharmacogenomic tests. Pharmacogenomics. 2010. Beaulieu Mathieu, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Trastuzumab and beyond: sequencing cancer genomes and predicting molecular networks. The pharmacogenomics journal. 2010. Roukos D H. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Targeted cancer therapies in the twenty-first century: lessons from imatinib. Clinical pharmacology and therapeutics. 2010. Stegmeier F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Effective global drug development strategy for obtaining regulatory approval in Japan in the context of ethnicity-related drug response factors. Clinical pharmacology and therapeutics. 2010. Ichimaru K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Heterotrimerization of the growth factor receptors erbB2, erbB3, and insulin-like growth factor-i receptor in breast cancer cells resistant to herceptin. Cancer research. 2010. Huang Xiaoping, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
In vitro activity of pertuzumab in combination with trastuzumab in uterine serous papillary adenocarcinoma. British journal of cancer. 2010. El-Sahwi K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Phase II trial of trastuzumab in women with advanced or recurrent, HER2-positive endometrial carcinoma: a Gynecologic Oncology Group study. Gynecologic oncology. 2010. Fleming Gini F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Grb7 upregulation is a molecular adaptation to HER2 signaling inhibition due to removal of Akt-mediated gene repression. PloS one. 2010. Nencioni Alessio, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Evolving novel anti-HER2 strategies. The lancet oncology. 2009. Jones Kellie L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of breast cancer therapies. Breast (Edinburgh, Scotland). 2009. Hertz Daniel L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinically available pharmacogenomics tests. Clinical pharmacology and therapeutics. 2009. Flockhart D A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Beyond trastuzumab: overcoming resistance to targeted HER-2 therapy in breast cancer. Current cancer drug targets. 2009. Bedard Philippe L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Variants of the antibody herceptin that interact with HER2 and VEGF at the antigen binding site. Science (New York, N.Y.). 2009. Bostrom Jenny, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Immunoglobulin G fragment C receptor polymorphisms and clinical efficacy of trastuzumab-based therapy in patients with HER-2/neu-positive metastatic breast cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2008. Musolino Antonino, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HER-2/neu overexpression and amplification in uterine serous papillary carcinoma: comparative analysis of immunohistochemistry, real-time reverse transcription-polymerase chain reaction, and fluorescence in situ hybridization. International journal of gynecological cancer : official journal of the International Gynecological Cancer Society. 2008. Odicino F E, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Role of the HER2 [Ile655Val] genetic polymorphism in tumorogenesis and in the risk of trastuzumab-related cardiotoxicity. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO. 2007. Beauclair S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Trastuzumab--mechanism of action and use in clinical practice. The New England journal of medicine. 2007. Hudis Clifford A. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The role of trastuzumab in early stage breast cancer: current data and treatment recommendations. Current treatment options in oncology. 2007. Lin Amy, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Anthracycline cardiotoxicity in breast cancer patients: synergism with trastuzumab and taxanes. Cardiovascular toxicology. 2007. Gianni Luca, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Overview of the pharmacoeconomics of pharmacogenetics. Pharmacogenomics. 2006. Dervieux Thierry, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PTEN activation contributes to tumor inhibition by trastuzumab, and loss of PTEN predicts trastuzumab resistance in patients. Cancer cell. 2004. Nagata Yoichi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Synergistic interactions between tamoxifen and trastuzumab (Herceptin). Clinical cancer research : an official journal of the American Association for Cancer Research. 2004. Argiris Athanassios, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Histone deacetylase inhibitor LAQ824 down-regulates Her-2 and sensitizes human breast cancer cells to trastuzumab, taxotere, gemcitabine, and epothilone B. Molecular cancer therapeutics. 2003. Fuino Lianne, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2. The New England journal of medicine. 2001. Slamon D J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics at work. Nature biotechnology. 1998. PubMed


Web Resource:
National Drug Code Directory:
PubChem Substance:
Drugs Product Database (DPD):
Therapeutic Targets Database:
FDA Drug Label at DailyMed:

Clinical Trials

These are trials that mention trastuzumab and are related to either pharmacogenetics or pharmacogenomics.

No trials loaded.

NURSA Datasets

provided by

No NURSA datasets available.

Common Searches

Search PubMed
Search Medline Plus
Search PubChem
Search CTD

Sources for PharmGKB drug information: DrugBank, PubChem.