Chemical: Drug

PharmGKB contains no dosing guidelines for this . To report known genotype-based dosing guidelines, or if you are interested in developing guidelines, click here.

1. FDA Label for methotrexate

Full label available at DailyMed

Genes and/or phenotypes found in this label

PharmGKB contains no Clinical Variants that meet the highest level of criteria.

To see more Clinical Variants with lower levels of criteria, click the button at the bottom of the page.

Clinical Annotation for rs1801133 (MTHFR), methotrexate, Arthritis, Juvenile Rheumatoid, Arthritis, Psoriatic, Arthritis, Rheumatoid and Drug Toxicity (level 3 Efficacy, Toxicity/ADR)

Level of Evidence
Level 3
Efficacy, Toxicity/ADR
Arthritis, Juvenile Rheumatoid, Arthritis, Psoriatic, Arthritis, Rheumatoid, Drug Toxicity
OMB Race
Mixed Population
Race Notes
White pediatric group, Asian group, and an unknown group, several mixed populations, Black or African American, White.

To see the rest of this clinical annotation please register or sign in.

Disclaimer: The PharmGKB's clinical annotations reflect expert consensus based on clinical evidence and peer-reviewed literature available at the time they are written and are intended only to assist clinicians in decision-making and to identify questions for further research. New evidence may have emerged since the time an annotation was submitted to the PharmGKB. The annotations are limited in scope and are not applicable to interventions or diseases that are not specifically identified.

The annotations do not account for individual variations among patients, and cannot be considered inclusive of all proper methods of care or exclusive of other treatments. It remains the responsibility of the health-care provider to determine the best course of treatment for a patient. Adherence to any guideline is voluntary, with the ultimate determination regarding its application to be made solely by the clinician and the patient. PharmGKB assumes no responsibility for any injury or damage to persons or property arising out of or related to any use of the PharmGKB clinical annotations, or for any errors or omissions.

? = Mouse-over for quick help

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Links in the "Gene" column lead to PharmGKB Gene Pages.

List of all variant annotations for methotrexate

Gene ? Variant?
Alternate Names ? Chemicals ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
No VIP available No VIP available VA SLCO1B1 *1A N/A N/A N/A
No VIP available No VIP available VA SLCO1B1 *1B N/A N/A N/A
No VIP available No VIP available VA SLCO1B1 *5 N/A N/A N/A
No VIP available No VIP available VA SLCO1B1 *14 N/A N/A N/A
No VIP available No VIP available VA SLCO1B1 *15 N/A N/A N/A
No VIP available No VIP available VA SLCO1B1 *23 N/A N/A N/A
No VIP available No VIP available VA SLCO1B1 *31 N/A N/A N/A
No VIP available No VIP available VA SLCO1B1 *35 N/A N/A N/A
No VIP available No VIP available VA TPMT *1 N/A N/A N/A
No VIP available No VIP available VA TPMT *2 N/A N/A N/A
No VIP available No VIP available VA TPMT *3A N/A N/A N/A
No VIP available No VIP available VA TPMT *3B N/A N/A N/A
No VIP available No VIP available VA TPMT *3C N/A N/A N/A
No VIP available No VIP available VA TPMT *12 N/A N/A N/A
No VIP available No Clinical Annotations available VA
No VIP available No Clinical Annotations available VA
TPMT intermediate metabolizer phenotype N/A N/A N/A
No VIP available No Clinical Annotations available VA
rs10035440 NC_000005.10:g.31539356T>C, NC_000005.9:g.31539463T>C, NM_018356.2:c.807+667T>C, NR_134298.1:n.710+667T>C, XM_005248319.1:c.12+667T>C, XM_005248319.2:c.12+667T>C, XM_006714479.1:c.555+667T>C, XM_006714480.2:c.12+667T>C, XM_011514062.1:c.900+667T>C, XR_241704.1:n.934+667T>C, rs13155198, rs56434987, rs58924525, rs59453111
T > C
No VIP available No Clinical Annotations available VA
rs10061133 NC_000005.10:g.55170716A>G, NC_000005.9:g.54466544A>G, NM_001145734.2:c.126+1872T>C, NM_001170402.1:c.126+1872T>C, NM_152623.2:c.126+1872T>C, NR_029960.1:n.-94T>C, NR_030387.1:n.27T>C, XM_005248450.1:c.126+1872T>C, XM_011543218.1:c.126+1872T>C
A > C
A > T
No VIP available No Clinical Annotations available VA
rs10072026 NC_000005.10:g.80649321T>C, NC_000005.9:g.79945140T>C, NG_023304.1:g.10661A>G, NM_000791.3:c.242+68A>G, NM_001290354.1:c.86+68A>G, NM_001290357.1:c.242+68A>G, NR_110936.1:n.684+68A>G, XM_005248455.1:c.131+68A>G, XM_005248456.1:c.86+68A>G, rs59805063
T > C
No VIP available No Clinical Annotations available VA
rs10106 NC_000009.11:g.130576075T>C, NC_000009.12:g.127813796T>C, NG_009551.1:g.45973A>G, NG_023245.1:g.15922T>C, NM_001018078.2:c.*192T>C, NM_001288803.1:c.*192T>C, NM_004957.5:c.*192T>C, NR_110170.1:n.2004T>C, XM_005251863.1:c.*192T>C, XM_005251864.1:c.1484-412T>C, XM_005251864.2:c.1484-412T>C, XM_005251865.1:c.*192T>C, XM_011518437.1:c.*192T>C, XM_011518438.1:c.*192T>C, XM_011518439.1:c.*192T>C, XR_242581.1:n.1834T>C, XR_242581.2:n.1853T>C, XR_242582.1:n.1362-412T>C, XR_242582.2:n.1381-412T>C, rs16930111, rs3181756
T > -
T > C
No VIP available No Clinical Annotations available VA
rs1017860 NC_000018.10:g.79412206T>C, NC_000018.9:g.77172206T>C, NG_029226.1:g.21435T>C, NM_001278669.1:c.1226+705T>C, NM_001278670.1:c.1226+705T>C, NM_001278672.1:c.1187+705T>C, NM_001278673.1:c.-191+11727T>C, NM_001278675.1:c.1187+705T>C, NM_006162.4:c.1226+705T>C, NM_172387.2:c.1187+705T>C, NM_172388.2:c.-191+15855T>C, NM_172389.2:c.1187+705T>C, NM_172390.2:c.1226+705T>C, XM_005266701.1:c.1193+705T>C, XM_005266702.1:c.1226+705T>C, rs59239647
T > C
No VIP available CA VA
rs10197559 NC_000002.11:g.216185825C>T, NC_000002.12:g.215321102C>T, NG_013002.1:g.14147C>T, NM_004044.6:c.290+1371C>T, rs13417729, rs59040650
C > T
No VIP available CA VA
rs10276036 NC_000007.13:g.87180198C>T, NC_000007.14:g.87550882C>T, NG_011513.1:g.167367G>A, NM_000927.4:c.1000-44G>A, rs10488634, rs111193439, rs17276942, rs57688958, rs58206924
C > A
C > T
No VIP available No Clinical Annotations available VA
rs10280623 NC_000007.13:g.87202544T>C, NC_000007.14:g.87573228T>C, NG_011513.1:g.145021A>G, NM_000927.4:c.287-3005A>G, rs56464124
T > C
rs1045642 NC_000007.13:g.87138645A>G, NC_000007.14:g.87509329A>G, NG_011513.1:g.208920T>C, NM_000927.4:c.3435T>C, NP_000918.2:p.Ile1145=, rs10239679, rs11568726, rs117328163, rs17210003, rs2229108, rs386513066, rs60023214, rs9690664
A > G
No VIP available No Clinical Annotations available VA
rs10505168 NC_000008.10:g.113655752T>C, NC_000008.11:g.112643523T>C, NM_052900.2:c.2998+1586A>G, NM_198123.1:c.3310+1586A>G, NM_198124.1:c.3190+1586A>G, NR_031745.1:n.31T>C, XM_005250771.1:c.3190+1586A>G, XM_011516808.1:c.3112+1586A>G, XM_011516809.1:c.2872+1586A>G, XM_011516810.1:c.2800+1586A>G, XM_011516811.1:c.1414+1586A>G, XM_011516812.1:c.3190+1586A>G, XM_011516813.1:c.586+1586A>G, XM_011516814.1:c.3190+1586A>G, XM_011516816.1:c.2998+1586A>G, rs60368931
T > A
T > G
rs1051266 NC_000021.8:g.46957794T>C, NC_000021.9:g.45537880T>C, NG_028278.1:g.9592A>G, NM_001205206.1:c.80A>G, NM_194255.2:c.80A>G, NP_001192135.1:p.His27Arg, NP_919231.1:p.His27Arg, XM_005261163.1:c.80A>G, XM_005261164.1:c.-279A>G, XM_005261164.2:c.-279A>G, XM_011529696.1:c.371A>G, XM_011529697.1:c.371A>G, XM_011529698.1:c.146A>G, XM_011529699.1:c.-1639A>G, XM_011529700.1:c.80A>G, XM_011529701.1:c.80A>G, XM_011529702.1:c.80A>G, XM_011529703.1:c.80A>G, XM_011529704.1:c.80A>G, XM_011529705.1:c.371A>G, XM_011529707.1:c.371A>G, XM_011529708.1:c.80A>G, XM_011529709.1:c.-279A>G, XM_011529710.1:c.-165-5732A>G, XP_005261220.1:p.His27Arg, XP_011527998.1:p.His124Arg, XP_011527999.1:p.His124Arg, XP_011528000.1:p.His49Arg, XP_011528002.1:p.His27Arg, XP_011528003.1:p.His27Arg, XP_011528004.1:p.His27Arg, XP_011528005.1:p.His27Arg, XP_011528006.1:p.His27Arg, XP_011528007.1:p.His124Arg, XP_011528009.1:p.His124Arg, XP_011528010.1:p.His27Arg, rs17844977, rs17857726, rs3171496, rs386514057, rs61510559
T > C
No VIP available CA VA
rs1053129 NC_000005.10:g.80626901C>A, NC_000005.9:g.79922720C>A, NG_023304.1:g.33081G>T, NM_000791.3:c.*2186G>T, NM_001290354.1:c.*2186G>T, NM_001290357.1:c.*2244G>T, NR_110936.1:n.3065G>T, XM_005248455.1:c.*2186G>T, XM_005248456.1:c.*2186G>T, rs11550956, rs1643629, rs16877939, rs3175968, rs374534748, rs3991272
C > -
C > A
No VIP available No Clinical Annotations available VA
rs1054774 NC_000009.11:g.130554998T>A, NC_000009.12:g.127792719T>A, NG_033942.1:g.11694T>A, rs3195291, rs58852618
T > A
No VIP available CA VA
rs1059150 NC_000020.10:g.57605439T>G, NC_000020.11:g.59030384T>G, NG_031871.1:g.6984A>C, NM_006886.3:c.78A>C, NP_008817.1:p.Ala26=, NR_037929.1:n.782A>C, NR_037930.1:n.523A>C, rs3199795
T > -
T > G
No VIP available No Clinical Annotations available VA
rs10760502 NC_000009.11:g.130565267A>G, NC_000009.12:g.127802988A>G, NG_023245.1:g.5114A>G, NM_001018078.2:c.-429A>G, NM_001288803.1:c.64A>G, NM_004957.5:c.64A>G, NP_001275732.1:p.Ile22Val, NP_004948.4:p.Ile22Val, NR_110170.1:n.131A>G, XM_005251863.1:c.64A>G, XM_005251864.1:c.64A>G, XM_005251864.2:c.64A>G, XM_005251865.1:c.-1659A>G, XM_011518437.1:c.-570A>G, XM_011518438.1:c.-181A>G, XP_005251920.1:p.Ile22Val, XP_005251921.1:p.Ile22Val, XR_242581.1:n.90A>G, XR_242581.2:n.109A>G, XR_242582.1:n.90A>G, XR_242582.2:n.109A>G, rs17855899, rs56845445
A > -
A > G
No VIP available CA VA
rs10821936 NC_000010.10:g.63723577C>T, NC_000010.11:g.61963818C>T, NG_030027.1:g.67565C>T, NM_032199.2:c.502+23410C>T, XM_005270215.1:c.247+23410C>T, XM_011540262.1:c.502+23410C>T, rs57005548, rs58668073
C > T
No VIP available No Clinical Annotations available VA
rs10868138 NC_000009.11:g.86917301T>C, NC_000009.12:g.84302386T>C, NM_001199633.1:c.338A>G, NM_022127.2:c.338A>G, NP_001186562.1:p.Tyr113Cys, NP_071410.1:p.Tyr113Cys, NR_037638.2:n.660A>G, XM_011518905.1:c.422A>G, XM_011518906.1:c.422A>G, XM_011518907.1:c.89A>G, XM_011518909.1:c.422A>G, XM_011518910.1:c.422A>G, XP_011517207.1:p.Tyr141Cys, XP_011517208.1:p.Tyr141Cys, XP_011517209.1:p.Tyr30Cys, XP_011517211.1:p.Tyr141Cys, XP_011517212.1:p.Tyr141Cys, XR_929832.1:n.549A>G, rs52792697, rs56686947
T > -
T > C
No VIP available CA VA
rs10994982 NC_000010.10:g.63710104A>G, NC_000010.11:g.61950345A>G, NG_030027.1:g.54092A>G, NM_032199.2:c.502+9937A>G, XM_005270215.1:c.247+9937A>G, XM_011540262.1:c.502+9937A>G, rs60395283
A > G
No VIP available CA VA
rs11045821 NC_000012.11:g.21332423G>A, NC_000012.12:g.21179489G>A, NG_011745.1:g.53296G>A, NM_006446.4:c.727+469G>A, rs17389758
G > A
No VIP available CA VA
rs11045872 NC_000012.11:g.21372344A>G, NC_000012.12:g.21219410A>G, NG_011745.1:g.93217A>G, NM_006446.4:c.1682+2107A>G, rs56493741, rs57270127, rs58461013
A > G
No VIP available CA VA
rs11045879 NC_000012.11:g.21382619T>C, NC_000012.12:g.21229685T>C, NG_011745.1:g.103492T>C, NM_006446.4:c.1865+4846T>C, rs60471795
T > C
No VIP available CA VA
rs1105525 NC_000005.10:g.80654689C>T, NC_000005.9:g.79950508C>T, NG_016607.1:g.5215C>T, NG_023304.1:g.5293G>A, NM_000791.3:c.-200G>A, NM_001290354.1:c.-306G>A, NM_001290357.1:c.-200G>A, NM_002439.4:c.-39C>T, NR_110936.1:n.293G>A, XM_005248455.1:c.-657G>A, XM_005248456.1:c.-306G>A, rs4382147
C > -
C > A
C > T
No VIP available CA VA
rs11231809 NC_000011.10:g.64535478T>A, NC_000011.9:g.64302950T>A, rs60605965
T > A
No VIP available CA VA
rs1127354 NC_000020.10:g.3193842C>A, NC_000020.11:g.3213196C>A, NG_012093.1:g.8787C>A, NM_001267623.1:c.67-789C>A, NM_033453.3:c.94C>A, NM_181493.2:c.43C>A, NP_258412.1:p.Pro32Thr, NP_852470.1:p.Pro15Thr, NR_052000.1:n.194C>A, NR_052001.1:n.49-62C>A, NR_052002.1:n.286C>A, XM_006723564.2:c.94C>A, XM_006723565.2:c.67-789C>A, XM_011529234.1:c.94C>A, XM_011529235.1:c.94C>A, XP_006723627.1:p.Pro32Thr, XP_011527536.1:p.Pro32Thr, XP_011527537.1:p.Pro32Thr, rs111069069, rs11565932, rs117814751, rs16988347, rs3177087, rs3183216, rs41320251, rs52834049
C > -
C > A
No VIP available CA VA
rs1128503 NC_000007.13:g.87179601A>G, NC_000007.14:g.87550285A>G, NG_011513.1:g.167964T>C, NM_000927.4:c.1236T>C, NP_000918.2:p.Gly412=, rs116989428, rs17276907, rs2032587, rs2229105, rs28365046, rs386518005, rs58257317
A > G
No VIP available No Clinical Annotations available VA
rs1131596 NC_000021.8:g.46957916G>A, NC_000021.9:g.45538002G>A, NG_028278.1:g.9470C>T, NM_001205206.1:c.-43C>T, NM_194255.2:c.-43C>T, XM_005261163.1:c.-43C>T, XM_005261164.1:c.-401C>T, XM_005261164.2:c.-401C>T, XM_011529696.1:c.249C>T, XM_011529697.1:c.249C>T, XM_011529698.1:c.24C>T, XM_011529699.1:c.-1761C>T, XM_011529700.1:c.-43C>T, XM_011529701.1:c.-43C>T, XM_011529702.1:c.-43C>T, XM_011529703.1:c.-43C>T, XM_011529704.1:c.-43C>T, XM_011529705.1:c.249C>T, XM_011529707.1:c.249C>T, XM_011529708.1:c.-43C>T, XM_011529709.1:c.-401C>T, XM_011529710.1:c.-165-5854C>T, XP_011527998.1:p.Ser83=, XP_011527999.1:p.Ser83=, XP_011528000.1:p.Ser8=, XP_011528007.1:p.Ser83=, XP_011528009.1:p.Ser83=, rs117417996, rs3177999, rs3191633, rs36178135
G > A
No VIP available No Clinical Annotations available VA
rs1142345 NC_000006.11:g.18130918T>C, NC_000006.12:g.18130687T>C, NG_012137.2:g.29457A>G, NM_000367.3:c.719A>G, NP_000358.1:p.Tyr240Cys, XM_011514839.1:c.674A>G, XM_011514840.1:c.650A>G, XP_011513141.1:p.Tyr225Cys, XP_011513142.1:p.Tyr217Cys, rs16880254, rs1801205, rs29001646, rs52798150, rs61510596
T > C
No VIP available CA VA
rs11545078 NC_000008.10:g.63938764G>A, NC_000008.11:g.63026205G>A, NG_028126.1:g.17847C>T, NM_003878.2:c.452C>T, NP_003869.1:p.Thr151Ile, XM_011517623.1:c.452C>T, XP_011515925.1:p.Thr151Ile, rs386518903, rs61629507
G > A
No VIP available No Clinical Annotations available VA
rs11702425 NC_000021.8:g.46908355T>C, NC_000021.9:g.45488441T>C, NG_011903.1:g.88259T>C, NM_030582.3:c.2460T>C, NM_130444.2:c.3165T>C, NM_130445.2:c.1920T>C, NM_130445.3:c.1920T>C, NP_085059.2:p.Leu820=, NP_569711.2:p.Leu1055=, NP_569712.2:p.Leu640=, XM_005261178.1:c.2460T>C, XM_005261179.1:c.2460T>C, XM_005261180.1:c.2361T>C, XM_005261181.1:c.1920T>C, XM_005261182.1:c.1896T>C, XP_005261235.1:p.Leu820=, XP_005261236.1:p.Leu820=, XP_005261237.1:p.Leu787=, XP_005261238.1:p.Leu640=, XP_005261239.1:p.Leu632=, rs60194184
T > C
No VIP available CA VA
rs117532069 NC_000020.10:g.53301068G>A, NC_000020.11:g.54684529G>A
G > A
No VIP available No Clinical Annotations available VA
rs11866002 NC_000016.10:g.58553833C>T, NC_000016.9:g.58587737C>T, NM_001265612.1:c.2904G>A, NM_016284.4:c.2919G>A, NM_206999.2:c.2919G>A, NP_001252541.1:p.Gln968=, NP_057368.3:p.Gln973=, NP_996882.1:p.Gln973=, NR_049763.1:n.3237G>A, XM_005255845.1:c.2919G>A, XM_005255846.1:c.2919G>A, XM_005255847.1:c.2916G>A, XM_005255848.1:c.2904G>A, XM_005255849.1:c.2916G>A, XM_005255850.1:c.2919G>A, XM_005255851.1:c.2919G>A, XP_005255902.1:p.Gln973=, XP_005255903.1:p.Gln973=, XP_005255904.1:p.Gln972=, XP_005255905.1:p.Gln968=, XP_005255906.1:p.Gln972=, XP_005255907.1:p.Gln973=, XP_005255908.1:p.Gln973=, XR_243400.1:n.3197G>A, rs59053850
C > -
C > T
No VIP available No Clinical Annotations available VA
rs1232027 NC_000005.10:g.80619201G>A, NC_000005.9:g.79915020G>A, NR_125754.1:n.117+3207C>T, rs1643642, rs56526453, rs61665333
G > A
No VIP available No Clinical Annotations available VA
rs12517451 NC_000005.10:g.80624254C>T, NC_000005.9:g.79920073C>T, NG_023304.1:g.35728G>A, NR_125754.1:n.-1730G>A, rs57318660
C > T
No VIP available CA VA
rs1264457 NC_000006.11:g.30458064G=, NC_000006.11:g.30458064G>A, NC_000006.12:g.30490287G=, NC_000006.12:g.30490287G>A, NM_005516.5:c.382G=, NM_005516.5:c.382G>A, NP_005507.3:p.Gly128=, NP_005507.3:p.Gly128Arg, NT_113891.2:g.1970128A=, NT_113891.2:g.1970128A>G, NT_113891.3:g.1970022A=, NT_113891.3:g.1970022A>G, NT_167245.1:g.1751704A=, NT_167245.1:g.1751704A>G, NT_167245.2:g.1746119A=, NT_167245.2:g.1746119A>G, NT_167246.1:g.1806142G=, NT_167246.1:g.1806142G>A, NT_167246.2:g.1800522G=, NT_167246.2:g.1800522G>A, NT_167247.1:g.1839928G=, NT_167247.1:g.1839928G>A, NT_167247.2:g.1834343G=, NT_167247.2:g.1834343G>A, NT_167248.1:g.1750979A=, NT_167248.1:g.1750979A>G, NT_167248.2:g.1745383A=, NT_167248.2:g.1745383A>G, NT_167249.1:g.1790354A=, NT_167249.1:g.1790354A>G, NT_167249.2:g.1791056A=, NT_167249.2:g.1791056A>G, rs115492845, rs117192178, rs17195355, rs7767992
G > A
No VIP available No Clinical Annotations available VA
rs12681874 NC_000008.10:g.63942342C>T, NC_000008.11:g.63029783C>T, NG_028126.1:g.14269G>A, NM_003878.2:c.275+384G>A, XM_011517623.1:c.275+384G>A, rs60682287
C > T
No VIP available No Clinical Annotations available VA
rs12894467 NC_000014.8:g.101507727C>T, NC_000014.9:g.101041390C>T, NR_030582.1:n.28C>T, NR_031575.1:n.-1587C>T, rs60410947
C > T
No VIP available No Clinical Annotations available VA
rs12995526 NC_000002.11:g.216197971T>C, NC_000002.12:g.215333248T>C, NG_013002.1:g.26293T>C, NM_004044.6:c.815-102T>C, rs17513754
T > C
No VIP available CA VA
rs13120400 NC_000004.11:g.89033527T>C, NC_000004.12:g.88112375T>C, NG_032067.2:g.123948A>G, NM_001257386.1:c.1194+928A>G, NM_004827.2:c.1194+928A>G, XM_005263354.1:c.1194+928A>G, XM_005263354.2:c.1194+928A>G, XM_005263355.1:c.1194+928A>G, XM_005263355.2:c.1194+928A>G, XM_005263356.1:c.1188+928A>G, XM_005263356.2:c.1188+928A>G, XM_011532420.1:c.1194+928A>G
T > C
No VIP available No Clinical Annotations available VA
rs13181 NC_000019.10:g.45351661T>G, NC_000019.9:g.45854919T>G, NG_007067.2:g.23927A>C, NM_000400.3:c.2251A>C, NM_177417.2:c.*304T>G, NP_000391.1:p.Lys751Gln, XM_005258536.1:c.*128T>G, XM_005258536.3:c.*128T>G, XM_005258537.1:c.*128T>G, XM_005258538.1:c.*304T>G, XM_005258539.1:c.*304T>G, XM_005258639.1:c.2179A>C, XM_005258640.1:c.2017A>C, XM_005258641.1:c.1513A>C, XM_011526611.1:c.2173A>C, XP_005258696.1:p.Lys727Gln, XP_005258697.1:p.Lys673Gln, XP_005258698.1:p.Lys505Gln, XP_011524913.1:p.Lys725Gln, rs1052559, rs17285142, rs17355147, rs17359310, rs3170171, rs3859422, rs60606175
T > G
No VIP available CA VA
rs141059755 NC_000008.10:g.66107605A>C, NC_000008.10:g.66107605A>G, NC_000008.11:g.65195370A>C, NC_000008.11:g.65195370A>G
A > C
A > G
No VIP available CA VA
rs1476413 NC_000001.10:g.11852300C>T, NC_000001.11:g.11792243C>T, NG_013351.1:g.18861G>A, NM_005957.4:c.1632+35G>A, XM_005263458.1:c.1755+35G>A, XM_005263458.2:c.1755+35G>A, XM_005263459.1:c.1701+35G>A, XM_005263460.1:c.1632+35G>A, XM_005263460.3:c.1632+35G>A, XM_005263461.1:c.1632+35G>A, XM_005263461.3:c.1632+35G>A, XM_005263462.1:c.1632+35G>A, XM_005263462.3:c.1632+35G>A, XM_005263463.1:c.1386+35G>A, XM_005263463.2:c.1386+35G>A, XM_011541495.1:c.1752+35G>A, XM_011541496.1:c.1755+35G>A, rs17367345, rs386533606, rs58018465
C > T
No VIP available CA VA
rs1544105 NC_000009.11:g.130562725C>T, NC_000009.12:g.127800446C>T, NG_023245.1:g.2572C>T, rs56775301, rs60601426
C > T
No VIP available CA VA
rs1643650 NC_000005.10:g.80644324T>C, NC_000005.9:g.79940143T>C, NG_023304.1:g.15658A>G, NM_000791.3:c.242+5065A>G, NM_001290354.1:c.86+5065A>G, NM_001290357.1:c.242+5065A>G, NR_110936.1:n.684+5065A>G, XM_005248455.1:c.131+5065A>G, XM_005248456.1:c.86+5065A>G, rs59943495
T > C
No VIP available No Clinical Annotations available VA
rs1643657 NC_000005.10:g.80640598T>C, NC_000005.9:g.79936417T>C, NG_023304.1:g.19384A>G, NM_000791.3:c.243-2589A>G, NM_001290354.1:c.87-2589A>G, NM_001290357.1:c.243-2589A>G, NR_110936.1:n.685-6606A>G, XM_005248455.1:c.132-2589A>G, XM_005248456.1:c.87-2589A>G, rs11566743, rs386540277, rs59951426
T > C
No VIP available CA VA
rs1650723 NC_000005.10:g.80626211C>T, NC_000005.9:g.79922030C>T, NG_023304.1:g.33771G>A, NM_000791.3:c.*2876G>A, NM_001290354.1:c.*2876G>A, NM_001290357.1:c.*2934G>A, NR_110936.1:n.3755G>A, XM_005248455.1:c.*2876G>A, XM_005248456.1:c.*2876G>A, rs17790092, rs386540357
C > T
No VIP available CA VA
rs16853826 NC_000002.11:g.216205167G>A, NC_000002.12:g.215340444G>A, NG_013002.1:g.33489G>A, NM_004044.6:c.1227+1537G>A, rs60936288
G > A
No VIP available No Clinical Annotations available VA
rs16853834 NC_000002.11:g.216210236C>T, NC_000002.12:g.215345513C>T, NG_013002.1:g.38558C>T, NM_004044.6:c.1320+642C>T, rs58088616
C > T
No VIP available CA VA
rs1695 NC_000011.10:g.67585218A>G, NC_000011.9:g.67352689A>G, NG_012075.1:g.6624A>G, NM_000852.3:c.313A>G, NP_000843.1:p.Ile105Val, XM_005273958.1:c.313A>G, XP_005274015.1:p.Ile105Val, rs1138257, rs11553891, rs17353321, rs17856342, rs2230827, rs4609, rs56971933, rs947894
A > G
No VIP available CA VA
rs17021408 NC_000001.10:g.213943238T>C, NC_000001.11:g.213769895T>C, XR_922586.1:n.137-24489T>C, XR_922587.1:n.136+38337T>C
T > C
No VIP available CA VA
rs1703794 NC_000015.10:g.99069944T>C, NC_000015.9:g.99613173T>C, NW_003871084.1:g.85897A>G, rs56586848, rs59536856
T > C
No VIP available No Clinical Annotations available VA
rs17222723 NC_000010.10:g.101595996T>A, NC_000010.11:g.99836239T>A, NG_011798.1:g.58534T>A, NM_000392.4:c.3563T>A, NP_000383.1:p.Val1188Glu, XM_005269536.1:c.3284T>A, XM_006717630.2:c.2867T>A, XP_005269593.1:p.Val1095Glu, XP_006717693.1:p.Val956Glu, XR_945604.1:n.3752T>A, XR_945605.1:n.3754T>A, rs52837755, rs59106280
T > A
No VIP available No Clinical Annotations available VA
rs17264736 NC_000016.10:g.16022699G=, NC_000016.10:g.16022699G>T, NC_000016.9:g.16116556G>T, NG_028268.1:g.78123G=, NG_028268.1:g.78123G>T, NM_004996.3:c.615+6078G>T, NM_004996.3:c.615+6078T>G, NT_187607.1:g.1680578T=, NT_187607.1:g.1680578T>G, XM_005255326.1:c.615+6078G>T, XM_005255327.1:c.489+8071G>T, XM_005255328.1:c.477+6078G>T, XM_005255329.1:c.615+6078G>T, XM_011522497.1:c.591+6078G>T, XM_011522497.1:c.591+6078T>G, XM_011522498.1:c.669+6078G>T, XM_011522498.1:c.669+6078T>G, rs386543216, rs60563196
G > T
No VIP available CA VA
rs17421511 NC_000001.10:g.11857788G>A, NC_000001.11:g.11797731G>A, NG_013351.1:g.13373C>T, NM_005957.4:c.587-1332C>T, XM_005263458.1:c.710-1332C>T, XM_005263458.2:c.710-1332C>T, XM_005263459.1:c.656-1332C>T, XM_005263460.1:c.587-1332C>T, XM_005263460.3:c.587-1332C>T, XM_005263461.1:c.587-1332C>T, XM_005263461.3:c.587-1332C>T, XM_005263462.1:c.587-1332C>T, XM_005263462.3:c.587-1332C>T, XM_005263463.1:c.341-1332C>T, XM_005263463.2:c.341-1332C>T, XM_011541495.1:c.707-1332C>T, XM_011541496.1:c.710-1332C>T, rs386543626, rs52805472
G > A
No VIP available No Clinical Annotations available VA
rs17514110 NC_000002.11:g.216205484C>T, NC_000002.12:g.215340761C>T, NG_013002.1:g.33806C>T, NM_004044.6:c.1227+1854C>T, rs60876088
C > T
No VIP available CA VA
rs17602729 NC_000001.10:g.115236057G>A, NC_000001.11:g.114693436G>A, NG_008012.1:g.7120C>T, NM_000036.2:c.133C>T, NM_001172626.1:c.121+2014C>T, NP_000027.2:p.Gln45Ter, rs52833197
G > A
No VIP available CA VA
rs17731538 NC_000004.11:g.89055379G>A, NC_000004.12:g.88134227G>A, NG_032067.2:g.102096C>T, NM_001257386.1:c.204-1592C>T, NM_004827.2:c.204-1592C>T, XM_005263354.1:c.204-1592C>T, XM_005263354.2:c.204-1592C>T, XM_005263355.1:c.204-1592C>T, XM_005263355.2:c.204-1592C>T, XM_005263356.1:c.204-1592C>T, XM_005263356.2:c.204-1592C>T, XM_011532420.1:c.204-1592C>T, rs57419238
G > A
No VIP available No Clinical Annotations available VA
rs1799793 NC_000019.10:g.45364001C>T, NC_000019.9:g.45867259C>T, NG_007067.2:g.11587G>A, NM_000400.3:c.934G>A, NM_001130867.1:c.862G>A, NP_000391.1:p.Asp312Asn, NP_001124339.1:p.Asp288Asn, XM_005258639.1:c.862G>A, XM_005258640.1:c.700G>A, XM_005258641.1:c.196G>A, XM_005258642.1:c.934G>A, XM_011526611.1:c.856G>A, XP_005258696.1:p.Asp288Asn, XP_005258697.1:p.Asp234Asn, XP_005258698.1:p.Asp66Asn, XP_005258699.1:p.Asp312Asn, XP_011524913.1:p.Asp286Asn, XR_935763.1:n.981G>A, rs3916814, rs58989209
C > T
No VIP available CA VA
rs1799983 NC_000007.13:g.150696111T>G, NC_000007.14:g.150999023T>G, NG_011992.1:g.12965T>G, NM_000603.4:c.894T>G, NM_001160109.1:c.894T>G, NM_001160110.1:c.894T>G, NM_001160111.1:c.894T>G, NP_000594.2:p.Asp298Glu, NP_001153581.1:p.Asp298Glu, NP_001153582.1:p.Asp298Glu, NP_001153583.1:p.Asp298Glu, XM_006716002.2:c.894T>G, XP_006716065.1:p.Asp298Glu, rs11266811, rs13238975, rs13305983, rs13308813, rs17173672, rs3730304, rs57135373
T > G
No VIP available No Clinical Annotations available VA
rs1800460 NC_000006.11:g.18139228C>T, NC_000006.12:g.18138997C>T, NG_012137.2:g.21147G>A, NM_000367.3:c.460G>A, NP_000358.1:p.Ala154Thr, XM_011514839.1:c.460G>A, XM_011514840.1:c.391G>A, XP_011513141.1:p.Ala154Thr, XP_011513142.1:p.Ala131Thr, rs11568060, rs16880273, rs386545583, rs57650974
C > T
No VIP available No Clinical Annotations available VA
rs1800566 NC_000016.10:g.69711242G>A, NC_000016.9:g.69745145G>A, NG_011504.1:g.20389C>T, NM_000903.2:c.559C>T, NM_001025433.1:c.457C>T, NM_001025434.1:c.445C>T, NM_001286137.1:c.343C>T, NP_000894.1:p.Pro187Ser, NP_001020604.1:p.Pro153Ser, NP_001020605.1:p.Pro149Ser, NP_001273066.1:p.Pro115Ser, XM_005255830.1:c.343C>T, XP_005255887.1:p.Pro115Ser, rs4134727, rs4149351, rs57135274
G > A
No VIP available CA VA
rs1800909 NC_000008.10:g.63951312A>G, NC_000008.11:g.63038753A>G, NG_028126.1:g.5299T>C, NM_003878.2:c.16T>C, NP_003869.1:p.Cys6Arg, XM_011517623.1:c.16T>C, XP_011515925.1:p.Cys6Arg
A > G
rs1801131 NC_000001.10:g.11854476T>G, NC_000001.11:g.11794419T>G, NG_013351.1:g.16685A>C, NM_005957.4:c.1286A>C, NP_005948.3:p.Glu429Ala, XM_005263458.1:c.1409A>C, XM_005263458.2:c.1409A>C, XM_005263459.1:c.1355A>C, XM_005263460.1:c.1286A>C, XM_005263460.3:c.1286A>C, XM_005263461.1:c.1286A>C, XM_005263461.3:c.1286A>C, XM_005263462.1:c.1286A>C, XM_005263462.3:c.1286A>C, XM_005263463.1:c.1040A>C, XM_005263463.2:c.1040A>C, XM_011541495.1:c.1406A>C, XM_011541496.1:c.1409A>C, XP_005263515.1:p.Glu470Ala, XP_005263516.1:p.Glu452Ala, XP_005263517.1:p.Glu429Ala, XP_005263518.1:p.Glu429Ala, XP_005263519.1:p.Glu429Ala, XP_005263520.1:p.Glu347Ala, XP_011539797.1:p.Glu469Ala, XP_011539798.1:p.Glu470Ala, rs17367365, rs17857426, rs4134712
T > G
rs1801133 NC_000001.10:g.11856378G>A, NC_000001.11:g.11796321G>A, NG_013351.1:g.14783C>T, NM_005957.4:c.665C>T, NP_005948.3:p.Ala222Val, XM_005263458.1:c.788C>T, XM_005263458.2:c.788C>T, XM_005263459.1:c.734C>T, XM_005263460.1:c.665C>T, XM_005263460.3:c.665C>T, XM_005263461.1:c.665C>T, XM_005263461.3:c.665C>T, XM_005263462.1:c.665C>T, XM_005263462.3:c.665C>T, XM_005263463.1:c.419C>T, XM_005263463.2:c.419C>T, XM_011541495.1:c.785C>T, XM_011541496.1:c.788C>T, XP_005263515.1:p.Ala263Val, XP_005263516.1:p.Ala245Val, XP_005263517.1:p.Ala222Val, XP_005263518.1:p.Ala222Val, XP_005263519.1:p.Ala222Val, XP_005263520.1:p.Ala140Val, XP_011539797.1:p.Ala262Val, XP_011539798.1:p.Ala263Val, rs386545618, rs4134713, rs59514310
G > A
No VIP available CA VA
rs1801394 NC_000005.10:g.7870860A>G, NC_000005.9:g.7870973A>G, NG_008856.1:g.6757A>G, NG_033101.1:g.3178T>C, NM_002454.2:c.66A>G, NM_024010.2:c.147A>G, NM_024091.3:c.-1995T>C, NP_002445.2:p.Ile22Met, NP_076915.2:p.Ile49Met, NR_036553.1:n.-1823T>C, NR_073608.1:n.-1823T>C, NR_134480.1:n.203A>G, NR_134481.1:n.203A>G, NR_134482.1:n.203A>G, XM_005248304.1:c.111A>G, XM_005248305.1:c.66A>G, XM_006714474.2:c.147A>G, XM_006714498.1:c.-1906T>C, XM_011514043.1:c.147A>G, XM_011514044.1:c.66A>G, XM_011514045.1:c.147A>G, XP_005248361.1:p.Ile37Met, XP_005248362.1:p.Ile22Met, XP_006714537.1:p.Ile49Met, XP_011512345.1:p.Ile49Met, XP_011512346.1:p.Ile22Met, XP_011512347.1:p.Ile49Met, XR_241701.1:n.169A>G, XR_241702.1:n.169A>G, XR_241703.1:n.162A>G, XR_427664.1:n.-1823T>C, XR_925614.1:n.169A>G, XR_925615.1:n.169A>G, rs52813630
A > -
A > G
No VIP available CA VA
rs1805087 NC_000001.10:g.237048500A>G, NC_000001.11:g.236885200A>G, NG_008959.1:g.94920A>G, NM_000254.2:c.2756A>G, NM_001291939.1:c.2603A>G, NM_001291940.1:c.1535A>G, NP_000245.2:p.Asp919Gly, NP_001278868.1:p.Asp868Gly, NP_001278869.1:p.Asp512Gly, XM_005273140.1:c.2924A>G, XM_005273141.1:c.2753A>G, XM_005273141.3:c.2753A>G, XM_005273142.1:c.2666A>G, XM_005273143.1:c.2603A>G, XM_005273144.1:c.2318A>G, XM_005273145.1:c.1118A>G, XM_006711769.2:c.2756A>G, XM_006711770.1:c.1820A>G, XM_011544193.1:c.2567A>G, XM_011544194.1:c.2924A>G, XP_005273197.1:p.Asp975Gly, XP_005273198.1:p.Asp918Gly, XP_005273199.1:p.Asp889Gly, XP_005273200.1:p.Asp868Gly, XP_005273201.1:p.Asp773Gly, XP_005273202.1:p.Asp373Gly, XP_006711832.1:p.Asp919Gly, XP_006711833.1:p.Asp607Gly, XP_011542495.1:p.Asp856Gly, XP_011542496.1:p.Asp975Gly, rs17658739, rs56618494, rs61036243
A > G
No VIP available CA VA
rs1891059 NC_000001.10:g.213946009G>A, NC_000001.11:g.213772666G>A, XR_922586.1:n.137-21718G>A, XR_922587.1:n.136+41108G>A
G > A
No VIP available CA VA
rs1901633 NC_000010.10:g.4810561A>G, NC_000010.11:g.4768369A>G, XR_930599.1:n.-1817T>C, rs17373082, rs58749271
A > G
No VIP available No Clinical Annotations available VA
rs197388 NC_000001.10:g.112297482A>T, NC_000001.11:g.111754860A>T, NM_007204.4:c.-1065A>T, NM_198926.2:c.12+841T>A, NR_125963.1:n.222+428T>A, XR_246395.1:n.249+428T>A, XR_246396.1:n.-1300T>A, rs59798432
A > T
No VIP available CA VA
rs1979277 NC_000017.10:g.18232096G>A, NC_000017.11:g.18328782G>A, NG_017111.1:g.39761C>T, NM_001281786.1:c.1006C>T, NM_004169.4:c.1420C>T, NM_148918.2:c.1303C>T, NP_001268715.1:p.Leu336Phe, NP_004160.3:p.Leu474Phe, NP_683718.1:p.Leu435Phe, XM_005256767.1:c.1420C>T, XM_005256767.2:c.1420C>T, XM_005256768.1:c.1006C>T, XM_011523992.1:c.1180C>T, XP_005256824.1:p.Leu474Phe, XP_005256825.1:p.Leu336Phe, XP_011522294.1:p.Leu394Phe, rs17850285, rs2230025, rs3183766, rs57933897
G > A
No VIP available No Clinical Annotations available VA
rs2032582 NC_000007.13:g.87160618A>C, NC_000007.13:g.87160618A>T, NC_000007.14:g.87531302A>C, NC_000007.14:g.87531302A>T, NG_011513.1:g.186947T>A, NG_011513.1:g.186947T>G, NM_000927.4:c.2677T>A, NM_000927.4:c.2677T>G, NP_000918.2:p.Ser893Ala, NP_000918.2:p.Ser893Thr, rs10228331, rs2229106, rs386553610, rs57135550, rs9641018
A > C
No VIP available CA No Variant Annotations available
rs2070744 NC_000007.13:g.150690079C=, NC_000007.13:g.150690079C>T, NC_000007.14:g.150992991C=, NC_000007.14:g.150992991C>T, NG_011992.1:g.6933C=, NG_011992.1:g.6933C>T, NM_000603.4:c.-51-762C=, NM_000603.4:c.-51-762C>T, NM_001160109.1:c.-813C=, NM_001160109.1:c.-813C>T, NM_001160110.1:c.-813C=, NM_001160110.1:c.-813C>T, NM_001160111.1:c.-813C=, NM_001160111.1:c.-813C>T, XM_006716002.2:c.-813C=, XM_006716002.2:c.-813C>T, rs10333298, rs34629525, rs61324345
C > T
No VIP available No Clinical Annotations available VA
rs2114358 NC_000008.10:g.129021179G>A, NC_000008.11:g.128008933G>A, NR_003367.3:n.1212+19642G>A, NR_031611.1:n.36G>A, rs13269734, rs61088727
G > C
G > T
No VIP available No Clinical Annotations available VA
rs2177735 NC_000002.11:g.216207875G>A, NC_000002.12:g.215343152G>A, NG_013002.1:g.36197G>A, NM_004044.6:c.1228-1627G>A, rs4499424
G > A
No VIP available CA VA
rs2229109 NC_000007.13:g.87179809C>T, NC_000007.14:g.87550493C>T, NG_011513.1:g.167756G>A, NM_000927.4:c.1199G>A, NP_000918.2:p.Ser400Asn, rs17276921, rs2235031, rs386561706, rs59635509
C > T
No VIP available CA VA
rs2231135 NC_000004.11:g.89079994A>G, NC_000004.12:g.88158842A>G, NG_032067.2:g.77481T>C, NM_001257386.1:c.-19-18828T>C, NM_004827.2:c.-476T>C, XM_005263354.1:c.-285T>C, XM_005263354.2:c.-285T>C, XM_005263355.1:c.-19-18828T>C, XM_005263355.2:c.-19-18828T>C, XM_005263356.1:c.-476T>C, XM_005263356.2:c.-476T>C, XM_011532420.1:c.-19-18828T>C, rs57106183
A > G
No VIP available No Clinical Annotations available VA
rs2231137 NC_000004.11:g.89061114C>T, NC_000004.12:g.88139962C>T, NG_032067.2:g.96361G>A, NM_001257386.1:c.34G>A, NM_004827.2:c.34G>A, NP_001244315.1:p.Val12Met, NP_004818.2:p.Val12Met, XM_005263354.1:c.34G>A, XM_005263354.2:c.34G>A, XM_005263355.1:c.34G>A, XM_005263355.2:c.34G>A, XM_005263356.1:c.34G>A, XM_005263356.2:c.34G>A, XM_011532420.1:c.34G>A, XP_005263411.1:p.Val12Met, XP_005263412.1:p.Val12Met, XP_005263413.1:p.Val12Met, XP_011530722.1:p.Val12Met
C > T
No VIP available No Clinical Annotations available VA
rs2231142 NC_000004.11:g.89052323G>T, NC_000004.12:g.88131171G>T, NG_032067.2:g.105152C>A, NM_001257386.1:c.421C>A, NM_004827.2:c.421C>A, NP_001244315.1:p.Gln141Lys, NP_004818.2:p.Gln141Lys, XM_005263354.1:c.421C>A, XM_005263354.2:c.421C>A, XM_005263355.1:c.421C>A, XM_005263355.2:c.421C>A, XM_005263356.1:c.421C>A, XM_005263356.2:c.421C>A, XM_011532420.1:c.421C>A, XP_005263411.1:p.Gln141Lys, XP_005263412.1:p.Gln141Lys, XP_005263413.1:p.Gln141Lys, XP_011530722.1:p.Gln141Lys, rs12721641, rs28365035, rs3736117, rs52809243, rs58973676
G > T
No VIP available CA VA
rs2236225 NC_000014.8:g.64908845G>A, NC_000014.9:g.64442127G>A, NG_012450.1:g.59087G>A, NM_005956.3:c.1958G>A, NP_005947.3:p.Arg653Gln, XM_005267693.1:c.2126G>A, XP_005267750.1:p.Arg709Gln, rs117048039, rs17751608, rs17850560, rs52810262, rs56503831, rs58065500
G > A
No VIP available CA VA
rs2236624 NC_000022.10:g.24836024T>C, NC_000022.11:g.24440056T>C, NM_000675.5:c.333-527T>C, NM_001278497.1:c.333-527T>C, NM_001278498.1:c.333-527T>C, NM_001278499.1:c.333-527T>C, NM_001278500.1:c.333-527T>C, NR_028483.2:n.1271-489A>G, NR_028484.2:n.833+1936A>G, NR_103543.1:n.186-527T>C, NR_103544.1:n.166-527T>C, NR_103546.1:n.4512-527T>C, rs386562087, rs59907471
T > C
No VIP available CA VA
rs2238476 NC_000016.10:g.16120015G>A, NC_000016.9:g.16213872G>A, NG_028268.1:g.175439G>A, NM_004996.3:c.3391-1960G>A, NT_187607.1:g.1777880G>A, XM_005255326.1:c.3421-1960G>A, XM_005255327.1:c.3265-1960G>A, XM_005255328.1:c.3253-1960G>A, XM_005255329.1:c.3214-1960G>A, XM_011522497.1:c.3367-1960G>A, XM_011522498.1:c.3298-1960G>A, rs59331160
G > A
No VIP available CA VA
rs2267076 NC_000022.10:g.24830595T>C, NC_000022.11:g.24434627T>C, NM_000675.5:c.332+891T>C, NM_001278497.1:c.332+891T>C, NM_001278498.1:c.332+891T>C, NM_001278499.1:c.332+891T>C, NM_001278500.1:c.332+891T>C, NR_028484.2:n.834-2193A>G, NR_103543.1:n.186-5956T>C, NR_103544.1:n.166-5956T>C, NR_103546.1:n.4511+891T>C
T > C
No VIP available No Clinical Annotations available VA
rs2273697 NC_000010.10:g.101563815G>A, NC_000010.11:g.99804058G>A, NG_011798.1:g.26353G>A, NM_000392.4:c.1249G>A, NP_000383.1:p.Val417Ile, XM_005269536.1:c.1249G>A, XM_006717630.2:c.553G>A, XM_006717631.2:c.1249G>A, XM_011539291.1:c.1249G>A, XP_005269593.1:p.Val417Ile, XP_006717693.1:p.Val185Ile, XP_006717694.1:p.Val417Ile, XP_011537593.1:p.Val417Ile, XR_945604.1:n.1438G>A, XR_945605.1:n.1440G>A, rs17216184, rs60620335
G > A
No VIP available No Clinical Annotations available VA
rs2274407 NC_000013.10:g.95859035C>A, NC_000013.11:g.95206781C>A, NM_001105515.2:c.912G>T, NM_001301829.1:c.912G>T, NM_001301830.1:c.687G>T, NM_005845.4:c.912G>T, NP_001098985.1:p.Lys304Asn, NP_001288758.1:p.Lys304Asn, NP_001288759.1:p.Lys229Asn, NP_005836.2:p.Lys304Asn, XM_005254025.1:c.783G>T, XM_005254025.2:c.783G>T, XM_005254026.1:c.912G>T, XM_005254027.1:c.687G>T, XM_005254028.1:c.687G>T, XM_006719914.1:c.912G>T, XM_011521047.1:c.363G>T, XP_005254082.1:p.Lys261Asn, XP_005254083.1:p.Lys304Asn, XP_005254084.1:p.Lys229Asn, XP_005254085.1:p.Lys229Asn, XP_006719977.1:p.Lys304Asn, XP_011519349.1:p.Lys121Asn, rs117944872, rs52813831, rs58221897
C > A
No VIP available No Clinical Annotations available VA
rs2274808 NC_000021.8:g.46906627C>T, NC_000021.9:g.45486713C>T, NG_011903.1:g.86531C>T, NM_030582.3:c.2242-148C>T, NM_130444.2:c.2947-148C>T, NM_130445.2:c.1702-148C>T, NM_130445.3:c.1702-148C>T, XM_005261178.1:c.2242-148C>T, XM_005261179.1:c.2242-148C>T, XM_005261180.1:c.2143-148C>T, XM_005261181.1:c.1702-148C>T, XM_005261182.1:c.1678-148C>T, rs13046404, rs60892202
C > T
No VIP available No Clinical Annotations available VA
rs2274976 NC_000001.10:g.11850927C>T, NC_000001.11:g.11790870C>T, NG_013351.1:g.20234G>A, NM_005957.4:c.1781G>A, NP_005948.3:p.Arg594Gln, XM_005263458.1:c.1904G>A, XM_005263458.2:c.1904G>A, XM_005263459.1:c.1822-154G>A, XM_005263460.1:c.1781G>A, XM_005263460.3:c.1781G>A, XM_005263461.1:c.1781G>A, XM_005263461.3:c.1781G>A, XM_005263462.1:c.1781G>A, XM_005263462.3:c.1781G>A, XM_005263463.1:c.1535G>A, XM_005263463.2:c.1535G>A, XM_011541495.1:c.1901G>A, XM_011541496.1:c.1876-154G>A, XP_005263515.1:p.Arg635Gln, XP_005263517.1:p.Arg594Gln, XP_005263518.1:p.Arg594Gln, XP_005263519.1:p.Arg594Gln, XP_005263520.1:p.Arg512Gln, XP_011539797.1:p.Arg634Gln, rs17854807, rs386563247, rs52829200, rs58316272
C > T
No VIP available No Clinical Annotations available VA
rs2278293 NC_000007.13:g.128040752C>T, NC_000007.14:g.128400698C>T, NG_009194.1:g.14285G>A, NM_000883.3:c.579+119G>A, NM_001102605.1:c.549+119G>A, NM_001142573.1:c.324+119G>A, NM_001142574.1:c.309+134G>A, NM_001142575.1:c.250-159G>A, NM_001142576.1:c.480+119G>A, NM_001304521.1:c.372+119G>A, NM_183243.2:c.471+119G>A, XM_005250313.1:c.372+119G>A, XM_005250314.1:c.348+119G>A, XM_005250315.1:c.324+119G>A, XM_005250316.1:c.-62+119G>A, XM_006715967.1:c.579+119G>A, XM_006715968.1:c.549+119G>A, XM_006715969.1:c.471+119G>A, XM_006715970.2:c.372+119G>A, XM_006715971.1:c.348+119G>A, XM_011516156.1:c.-220G>A, XM_011516157.1:c.-220G>A, rs10348032, rs60861084
C > T
No VIP available No Clinical Annotations available VA
rs2287584 NC_000005.10:g.31422900T>C, NC_000005.9:g.31423007T>C, NM_001100412.1:c.3195A>G, NM_013235.4:c.3306A>G, NP_001093882.1:p.Pro1065=, NP_037367.3:p.Pro1102=, XM_005248291.1:c.3306A>G, XM_005248291.2:c.3306A>G, XM_005248292.1:c.3282A>G, XM_005248292.2:c.3282A>G, XM_005248293.1:c.3213A>G, XM_005248293.2:c.3213A>G, XM_005248294.1:c.3102A>G, XM_005248294.2:c.3102A>G, XM_011514033.1:c.3306A>G, XP_005248348.1:p.Pro1102=, XP_005248349.1:p.Pro1094=, XP_005248350.1:p.Pro1071=, XP_005248351.1:p.Pro1034=, XP_011512335.1:p.Pro1102=, rs57044049
T > C
No VIP available No Clinical Annotations available VA
rs2289030 NC_000012.11:g.95228286G>C, NC_000012.12:g.94834510G>C, NR_030171.1:n.113G>C, NR_036685.1:n.57G>C, rs59816854
G > C
No VIP available CA VA
rs2298383 NC_000022.10:g.24825511C>T, NC_000022.11:g.24429543C>T, NM_000675.5:c.-275+1797C>T, NM_001278499.1:c.-275+1817C>T, NM_001278500.1:c.-274-3588C>T, NR_028484.2:n.2494G>A, NR_103543.1:n.185+1797C>T, NR_103544.1:n.165+1817C>T, NR_103546.1:n.3906-3588C>T, rs59635240
C > A
C > G
rs2306283 NC_000012.11:g.21329738A>G, NC_000012.12:g.21176804A>G, NG_011745.1:g.50611A>G, NM_006446.4:c.388A>G, NP_006437.3:p.Asn130Asp, rs17389242, rs52832430, rs60767041
A > G
No VIP available No Clinical Annotations available VA
rs2368393 NC_000010.10:g.29833998A>G, NC_000010.11:g.29545069A>G, NG_033998.1:g.195733T>C, NM_003174.3:c.827+5528T>C, NM_021738.2:c.827+5528T>C, NR_030335.1:n.29T>C, XM_005252564.1:c.1061+5528T>C, XM_005252565.1:c.1061+5528T>C, XM_005252566.1:c.1061+5528T>C, XM_005252567.1:c.1061+5528T>C, XM_005252568.1:c.1061+5528T>C, XM_005252569.1:c.1061+5528T>C, XM_005252570.1:c.827+5528T>C, XM_005252570.2:c.827+5528T>C, XM_005252571.1:c.827+5528T>C, XM_005252571.2:c.827+5528T>C, XM_005252572.1:c.827+5528T>C, XM_005252573.1:c.827+5528T>C, XM_005252573.2:c.827+5528T>C, XM_011519630.1:c.827+5528T>C, XM_011519631.1:c.827+5528T>C, XM_011519632.1:c.827+5528T>C, XM_011519633.1:c.827+5528T>C, XM_011519634.1:c.827+5528T>C, XM_011519635.1:c.827+5528T>C, XM_011519636.1:c.827+5528T>C, XM_011519637.1:c.827+5528T>C, XM_011519638.1:c.827+5528T>C, XM_011519639.1:c.827+5528T>C, XM_011519640.1:c.827+5528T>C
A > G
No VIP available CA VA
rs2372536 NC_000002.11:g.216190020C>G, NC_000002.12:g.215325297C>G, NG_013002.1:g.18342C>G, NM_004044.6:c.347C>G, NP_004035.2:p.Thr116Ser, rs3821352, rs52824931
C > G
No VIP available CA VA
rs2413739 NC_000022.10:g.43397036C>T, NC_000022.11:g.43001030C>T, NM_001184970.1:c.-78+13991G>A, XM_005261319.1:c.-78+13991G>A, XM_005261319.3:c.-78+13991G>A, XM_011529846.1:c.-78+13991G>A, XM_011529852.1:c.-64+13991G>A, XM_011529853.1:c.-78+13991G>A
C > T
No VIP available No Clinical Annotations available VA
rs2413775 NC_000015.10:g.45252090T>A, NC_000015.9:g.45544288T>A, NM_004212.3:c.-205T>A, NR_120335.1:n.181-18A>T, XM_011522198.1:c.-230T>A, XM_011522199.1:c.-205T>A, XM_011522200.1:c.-205T>A, XM_011522201.1:c.-205T>A, XR_243147.1:n.271-18A>T, rs3759897, rs59171024
T > A
No VIP available No Clinical Annotations available VA
rs244076 NC_000020.10:g.43252915T>C, NC_000020.11:g.44624274T>C, NG_007385.1:g.32462A>G, NM_000022.2:c.534A>G, NP_000013.2:p.Val178=, XM_005260236.1:c.534A>G, XM_005260236.2:c.534A>G, XM_005260237.1:c.534A>G, XM_005260238.1:c.129A>G, XM_011528478.1:c.129A>G, XM_011528479.1:c.129A>G, XP_005260293.1:p.Val178=, XP_005260294.1:p.Val178=, XP_005260295.1:p.Val43=, XP_011526780.1:p.Val43=, XP_011526781.1:p.Val43=, XR_244129.1:n.588A>G, rs117526070, rs3171232
T > C
No VIP available CA VA
rs246240 NC_000016.10:g.16025167A>G, NC_000016.9:g.16119024A>G, NG_028268.1:g.80591A>G, NM_004996.3:c.616-7942A>G, NT_187607.1:g.1683048A>G, XM_005255326.1:c.616-7942A>G, XM_005255327.1:c.490-7942A>G, XM_005255328.1:c.478-7942A>G, XM_005255329.1:c.616-7942A>G, XM_011522497.1:c.592-7942A>G, XM_011522498.1:c.670-7942A>G, rs1173277, rs248402, rs435989, rs59152122, rs601879
A > G
No VIP available No Clinical Annotations available VA
rs2476601 NC_000001.10:g.114377568A=, NC_000001.10:g.114377568A>G, NC_000001.11:g.113834946A=, NC_000001.11:g.113834946A>G, NG_011432.1:g.41808C=, NG_011432.1:g.41808C>T, NM_001193431.2:c.1858C=, NM_001193431.2:c.1858C>T, NM_001308297.1:c.1786C=, NM_001308297.1:c.1786C>T, NM_012411.5:c.1693C=, NM_012411.5:c.1693C>T, NM_015967.5:c.1858C>T, NM_015967.6:c.1858C=, NM_015967.6:c.1858C>T, NP_001180360.1:p.Arg620=, NP_001180360.1:p.Arg620Trp, NP_001295226.1:p.Arg596=, NP_001295226.1:p.Arg596Trp, NP_036543.4:p.Arg565=, NP_036543.4:p.Arg565Trp, NP_057051.3:p.Arg620=, NP_057051.3:p.Arg620Trp, NR_125965.1:n.414+19474A>G, NR_125965.1:n.414+19474G>A, XM_005270738.1:c.1786T=, XM_005270738.1:c.1786T>C, XM_005270738.2:c.1786T=, XM_005270738.2:c.1786T>C, XM_011541221.1:c.1780T=, XM_011541221.1:c.1780T>C, XM_011541222.1:c.1858T=, XM_011541222.1:c.1858T>C, XM_011541223.1:c.1858T=, XM_011541223.1:c.1858T>C, XM_011541224.1:c.1414T=, XM_011541224.1:c.1414T>C, XM_011541225.1:c.1786T=, XM_011541225.1:c.1786T>C, XP_005270795.1:p.Trp596=, XP_005270795.1:p.Trp596Arg, XP_011539523.1:p.Trp594=, XP_011539523.1:p.Trp594Arg, XP_011539524.1:p.Trp620=, XP_011539524.1:p.Trp620Arg, XP_011539525.1:p.Trp620=, XP_011539525.1:p.Trp620Arg, XP_011539526.1:p.Trp472=, XP_011539526.1:p.Trp472Arg, XP_011539527.1:p.Trp596=, XP_011539527.1:p.Trp596Arg, rs117063937, rs52834763, rs60104027
A > A
No VIP available CA VA
rs2650972 NC_000020.10:g.6783274T>C, NC_000020.11:g.6802627T>C, rs111195393, rs59264576
T > C
No VIP available No Clinical Annotations available VA
rs2682818 NC_000012.11:g.81329536A>C, NC_000012.12:g.80935757A>C, NM_004664.2:c.82+1884T>G, NR_030349.1:n.77T>G, XM_005269212.1:c.82+1884T>G, XM_011538928.1:c.82+1884T>G, XM_011539062.1:c.-779A>C
A > G
A > T
No VIP available No Clinical Annotations available VA
rs2740574 NC_000007.13:g.99382096C>T, NC_000007.14:g.99784473C>T, NG_008421.1:g.4713G>A, NM_001202855.2:c.-392G>A, NM_017460.5:c.-392G>A, XM_011515841.1:c.-392G>A, XM_011515842.1:c.-392G>A, rs3176920, rs36231114, rs59393892
C > T
No VIP available CA VA
rs28364006 NC_000016.10:g.16134392A>G, NC_000016.9:g.16228249A>G, NG_028268.1:g.189816A>G, NM_004996.3:c.4009A>G, NP_004987.2:p.Thr1337Ala, NT_187607.1:g.1792283A>G, XM_005255326.1:c.4039A>G, XM_005255327.1:c.3883A>G, XM_005255328.1:c.3871A>G, XM_005255329.1:c.3832A>G, XM_011522497.1:c.3985A>G, XM_011522498.1:c.3916A>G, XP_005255383.1:p.Thr1347Ala, XP_005255384.1:p.Thr1295Ala, XP_005255385.1:p.Thr1291Ala, XP_005255386.1:p.Thr1278Ala, XP_011520799.1:p.Thr1329Ala, XP_011520800.1:p.Thr1306Ala, rs45544333
A > G
No VIP available No Clinical Annotations available VA
rs2838956 NC_000021.8:g.46945024A>G, NC_000021.9:g.45525110A>G, NG_028278.1:g.22362T>C, NM_001205206.1:c.1293+707T>C, NM_001205207.1:c.1173+707T>C, NM_194255.2:c.1293+707T>C, XM_005261163.1:c.1293+707T>C, XM_005261164.1:c.939+707T>C, XM_005261164.2:c.939+707T>C, XM_011529696.1:c.1584+707T>C, XM_011529697.1:c.1584+707T>C, XM_011529698.1:c.1359+707T>C, XM_011529699.1:c.1320+707T>C, XM_011529700.1:c.1293+707T>C, XM_011529701.1:c.1293+707T>C, XM_011529702.1:c.1293+707T>C, XM_011529703.1:c.1293+707T>C, XM_011529704.1:c.1293+707T>C, XM_011529705.1:c.1584+707T>C, XM_011529706.1:c.1155+707T>C, XM_011529707.1:c.1584+707T>C, XM_011529708.1:c.1293+707T>C, XM_011529709.1:c.939+707T>C, XM_011529710.1:c.939+707T>C, rs60159565
A > G
No VIP available CA VA
rs2853539 NC_000018.10:g.659829A>G, NC_000018.9:g.659829A>G, NG_028255.1:g.7226A>G, NM_001012716.2:c.-1582T>C, NM_001071.2:c.279+115A>G, XM_005258137.1:c.279+115A>G, XM_005258138.1:c.205+1882A>G
A > G
No VIP available No Clinical Annotations available VA
rs2910164 NC_000005.10:g.160485411C>G, NC_000005.9:g.159912418C>G, NR_029701.1:n.60C>G, NR_132748.1:n.303C>G, rs56537094, rs57852408, rs61270459
C > G
No VIP available No Clinical Annotations available VA
rs34115976 NC_000004.11:g.115577997C>G, NC_000004.12:g.114656841C>G, NM_001128174.1:c.823-7154C>G, NM_003360.3:c.823-7154C>G, NR_030303.1:n.83C>G, XM_006714302.2:c.823-7154C>G, XM_006714303.2:c.823-7154C>G, XM_011532232.1:c.823-7154C>G, XR_244645.1:n.1052-7154C>G
C > G
No VIP available No Clinical Annotations available VA
rs34324334 NC_000006.11:g.43535018C>T, NC_000006.12:g.43567281C>T, NM_020750.2:c.722G>A, NP_065801.1:p.Ser241Asn
C > T
T > -
No VIP available No Clinical Annotations available VA
rs34965641 NC_000005.10:g.80646557G>A, NC_000005.9:g.79942376G>A, NG_023304.1:g.13425C>T, NM_000791.3:c.242+2832C>T, NM_001290354.1:c.86+2832C>T, NM_001290357.1:c.242+2832C>T, NR_110936.1:n.684+2832C>T, XM_005248455.1:c.131+2832C>T, XM_005248456.1:c.86+2832C>T, rs386583121
G > A
No VIP available CA VA
rs351855 NC_000005.10:g.177093242G>A, NC_000005.9:g.176520243G>A, NG_012067.1:g.11323G>A, NM_001291980.1:c.1097+65G>A, NM_002011.4:c.1162G>A, NM_022963.3:c.1058-90G>A, NM_213647.2:c.1162G>A, NP_002002.3:p.Gly388Arg, NP_998812.1:p.Gly388Arg, XM_005265837.1:c.1258G>A, XM_005265838.1:c.1162G>A, XM_005265838.2:c.1162G>A, XM_005265839.1:c.1097+65G>A, XM_011534464.1:c.1255G>A, XM_011534465.1:c.844G>A, XP_005265894.1:p.Gly420Arg, XP_005265895.1:p.Gly388Arg, XP_011532766.1:p.Gly419Arg, XP_011532767.1:p.Gly282Arg, XR_941090.1:n.1207G>A, rs117475361, rs56695235
G > A
No VIP available CA VA
rs35592 NC_000016.10:g.16047966T>C, NC_000016.9:g.16141823T>C, NG_028268.1:g.103390T>C, NM_004996.3:c.1219-176T>C, NT_187607.1:g.1705863T>C, XM_005255326.1:c.1219-176T>C, XM_005255327.1:c.1093-176T>C, XM_005255328.1:c.1081-176T>C, XM_005255329.1:c.1219-176T>C, XM_011522497.1:c.1195-176T>C, XM_011522498.1:c.1273-176T>C, rs1173294, rs666803
T > C
No VIP available No Clinical Annotations available VA
rs3737967 NC_000001.10:g.11847449G>A, NC_000001.11:g.11787392G>A, NG_013351.1:g.23712C>T, NM_001010881.1:c.3572G>A, NM_005957.4:c.*3288C>T, NP_001010881.1:p.Arg1191His, XM_003118845.3:c.3572G>A, XM_005263458.1:c.*3288C>T, XM_005263459.1:c.*3148C>T, XM_005263460.1:c.*3288C>T, XM_005263461.1:c.*3288C>T, XM_005263462.1:c.*3288C>T, XM_005263463.1:c.*3288C>T, XM_006711078.2:c.3572G>A, XM_011541267.1:c.3707G>A, XM_011541268.1:c.3707G>A, XM_011541269.1:c.3707G>A, XM_011541270.1:c.3707G>A, XM_011541271.1:c.3653G>A, XM_011541272.1:c.3707G>A, XM_011541273.1:c.3572G>A, XM_011541274.1:c.3572G>A, XM_011541275.1:c.3572G>A, XM_011541276.1:c.3707G>A, XM_011541277.1:c.3707G>A, XM_011541278.1:c.3707G>A, XM_011541279.1:c.3299G>A, XM_011541280.1:c.1988G>A, XM_011541281.1:c.1988G>A, XP_003118893.3:p.Arg1191His, XP_006711141.1:p.Arg1191His, XP_011539569.1:p.Arg1236His, XP_011539570.1:p.Arg1236His, XP_011539571.1:p.Arg1236His, XP_011539572.1:p.Arg1236His, XP_011539573.1:p.Arg1218His, XP_011539574.1:p.Arg1236His, XP_011539575.1:p.Arg1191His, XP_011539576.1:p.Arg1191His, XP_011539577.1:p.Arg1191His, XP_011539578.1:p.Arg1236His, XP_011539579.1:p.Arg1236His, XP_011539580.1:p.Arg1236His, XP_011539581.1:p.Arg1100His, XP_011539582.1:p.Arg663His, XP_011539583.1:p.Arg663His, rs386585099
G > A
G > T
No VIP available CA VA
rs3740065 NC_000010.10:g.101605693A>G, NC_000010.11:g.99845936A>G, NG_011798.1:g.68231A>G, NM_000392.4:c.4146+154A>G, XM_005269536.1:c.3867+154A>G, XM_006717630.2:c.3450+154A>G, XR_945604.1:n.4276+154A>G, XR_945605.1:n.4210+154A>G, rs386585170, rs61012324
A > G
No VIP available No Clinical Annotations available VA
rs3740066 NC_000010.10:g.101604207C>T, NC_000010.11:g.99844450C>T, NG_011798.1:g.66745C>T, NM_000392.4:c.3972C>T, NP_000383.1:p.Ile1324=, XM_005269536.1:c.3693C>T, XM_006717630.2:c.3276C>T, XP_005269593.1:p.Ile1231=, XP_006717693.1:p.Ile1092=, XR_945604.1:n.4161C>T, XR_945605.1:n.4036C>T, rs12780340, rs17216303, rs59292214
C > T
No VIP available No Clinical Annotations available VA
rs3744741 NC_000017.10:g.649232C>T, NC_000017.11:g.745992C>T, NM_015721.2:c.2051G>A, NP_056536.2:p.Arg684Gln, XM_005256667.1:c.2063G>A, XM_005256667.3:c.2063G>A, XM_005256668.1:c.2063G>A, XM_005256668.3:c.2063G>A, XM_005256669.1:c.2018G>A, XM_005256670.1:c.2018G>A, XM_005256670.3:c.2018G>A, XM_011523910.1:c.2063G>A, XM_011523911.1:c.2063G>A, XM_011523912.1:c.2018G>A, XM_011523913.1:c.2018G>A, XP_005256724.1:p.Arg688Gln, XP_005256725.1:p.Arg688Gln, XP_005256726.1:p.Arg673Gln, XP_005256727.1:p.Arg673Gln, XP_011522212.1:p.Arg688Gln, XP_011522213.1:p.Arg688Gln, XP_011522214.1:p.Arg673Gln, XP_011522215.1:p.Arg673Gln, rs56482056, rs59343482
C > T
No VIP available CA VA
rs3758149 NC_000008.10:g.63951728G>A, NC_000008.11:g.63039169G>A, NG_028126.1:g.4883C>T, NM_003878.2:c.-401C>T, XM_011517623.1:c.-401C>T
G > A
No VIP available CA VA
rs3761422 NC_000022.10:g.24826672T>C, NC_000022.11:g.24430704T>C, NM_000675.5:c.-274-2427T>C, NM_001278497.1:c.-2045T>C, NM_001278498.1:c.-1939T>C, NM_001278499.1:c.-274-2427T>C, NM_001278500.1:c.-274-2427T>C, NR_028484.2:n.1672+193A>G, NR_103543.1:n.185+2958T>C, NR_103544.1:n.165+2978T>C, NR_103546.1:n.3906-2427T>C, rs58256941
T > C
No VIP available CA VA
rs3763980 NC_000012.11:g.60173356A>T, NC_000012.12:g.59779575A>T, NM_001270622.1:c.1333A>T, NM_001270623.1:c.1333A>T, NM_004731.4:c.1333A>T, NP_001257551.1:p.Thr445Ser, NP_001257552.1:p.Thr445Ser, NP_004722.2:p.Thr445Ser, NR_073055.1:n.1773A>T, NR_073056.1:n.1634A>T, XM_005269231.1:c.1333A>T, XM_005269231.3:c.1333A>T, XM_005269232.1:c.1036A>T, XM_005269233.1:c.1036A>T, XM_011538989.1:c.1411A>T, XM_011538990.1:c.1411A>T, XM_011538991.1:c.1411A>T, XM_011538992.1:c.1411A>T, XM_011538993.1:c.1036A>T, XM_011538994.1:c.1036A>T, XM_011538995.1:c.1036A>T, XM_011538996.1:c.1036A>T, XM_011538997.1:c.1036A>T, XP_005269288.1:p.Thr445Ser, XP_005269289.1:p.Thr346Ser, XP_005269290.1:p.Thr346Ser, XP_011537291.1:p.Thr471Ser, XP_011537292.1:p.Thr471Ser, XP_011537293.1:p.Thr471Ser, XP_011537294.1:p.Thr471Ser, XP_011537295.1:p.Thr346Ser, XP_011537296.1:p.Thr346Ser, XP_011537297.1:p.Thr346Ser, XP_011537298.1:p.Thr346Ser, XP_011537299.1:p.Thr346Ser, rs17571543, rs56973174, rs57488699
A > -
A > T
No VIP available CA VA
rs3768142 NC_000001.10:g.237028564G>T, NC_000001.11:g.236865264G>T, NG_008959.1:g.74984G>T, NM_000254.2:c.2405+1710G>T, NM_001291939.1:c.2252+1710G>T, NM_001291940.1:c.1184+1710G>T, XM_005273140.1:c.2573+1710G>T, XM_005273141.1:c.2402+1710G>T, XM_005273141.3:c.2402+1710G>T, XM_005273142.1:c.2315+1710G>T, XM_005273143.1:c.2252+1710G>T, XM_005273144.1:c.1967+1710G>T, XM_005273145.1:c.767+1710G>T, XM_006711769.2:c.2405+1710G>T, XM_006711770.1:c.1469+1710G>T, XM_011544193.1:c.2405+1710G>T, XM_011544194.1:c.2573+1710G>T, rs59283581
G > T
No VIP available No Clinical Annotations available VA
rs3784862 NC_000016.10:g.16017034G=, NC_000016.10:g.16017034G>A, NC_000016.9:g.16110891G>A, NG_028268.1:g.72458G=, NG_028268.1:g.72458G>A, NM_004996.3:c.615+413A>G, NM_004996.3:c.615+413G>A, NT_187607.1:g.1674909A=, NT_187607.1:g.1674909A>G, XM_005255326.1:c.615+413G>A, XM_005255327.1:c.489+2406G>A, XM_005255328.1:c.477+413G>A, XM_005255329.1:c.615+413G>A, XM_011522497.1:c.591+413A>G, XM_011522497.1:c.591+413G>A, XM_011522498.1:c.669+413A>G, XM_011522498.1:c.669+413G>A, rs59892787
G > A
No VIP available CA VA
rs3784864 NC_000016.10:g.16031468G=, NC_000016.10:g.16031468G>A, NC_000016.9:g.16125325G>A, NG_028268.1:g.86892G=, NG_028268.1:g.86892G>A, NM_004996.3:c.616-1641A>G, NM_004996.3:c.616-1641G>A, NT_187607.1:g.1689346A=, NT_187607.1:g.1689346A>G, XM_005255326.1:c.616-1641G>A, XM_005255327.1:c.490-1641G>A, XM_005255328.1:c.478-1641G>A, XM_005255329.1:c.616-1641G>A, XM_011522497.1:c.592-1641A>G, XM_011522497.1:c.592-1641G>A, XM_011522498.1:c.670-1641A>G, XM_011522498.1:c.670-1641G>A, rs17264945, rs56505200, rs58170425
G > A
No VIP available No Clinical Annotations available VA
rs3787186 NC_000020.10:g.50153344T>C, NC_000020.11:g.51536805T>C, NM_001136021.2:c.71-12695A>G, NM_001258292.1:c.71-12695A>G, NM_001258294.1:c.-13-13209A>G, NM_001258295.1:c.-13-13209A>G, NM_001258296.1:c.-14+5565A>G, NM_001258297.1:c.-14+5565A>G, NM_012340.4:c.130+5565A>G, NM_173091.3:c.130+5565A>G, XM_005260413.1:c.130+5565A>G, XM_011528824.1:c.130+5565A>G, XM_011528825.1:c.71-12695A>G, XM_011528826.1:c.-13-13209A>G, rs56471074, rs56739286, rs61514015
T > C
No VIP available No Clinical Annotations available VA
rs3805500 NC_000005.10:g.31462870G>A, NC_000005.9:g.31462977G>A, NM_001100412.1:c.2463+1366C>T, NM_013235.4:c.2574+1366C>T, XM_005248291.1:c.2574+1366C>T, XM_005248291.2:c.2574+1366C>T, XM_005248292.1:c.2550+1366C>T, XM_005248292.2:c.2550+1366C>T, XM_005248293.1:c.2481+1366C>T, XM_005248293.2:c.2481+1366C>T, XM_005248294.1:c.2370+1366C>T, XM_005248294.2:c.2370+1366C>T, XM_011514033.1:c.2574+1366C>T, rs386586733
G > A
No VIP available No Clinical Annotations available VA
rs3821353 NC_000002.11:g.216197779G>T, NC_000002.12:g.215333056G>T, NG_013002.1:g.26101G>T, NM_004044.6:c.815-294G>T
G > T
No VIP available CA VA
rs3824662 NC_000010.10:g.8104208C>A, NC_000010.11:g.8062245C>A, NG_015859.1:g.12542C>A, NM_001002295.1:c.779-1748C>A, NM_002051.2:c.779-1751C>A, XM_005252442.1:c.779-1748C>A, XM_005252442.2:c.779-1748C>A, XM_005252443.1:c.779-1748C>A, XM_005252443.3:c.779-1748C>A, rs11567915
C > A
No VIP available CA VA
rs408626 NC_000005.10:g.80655314T>C, NC_000005.9:g.79951133T>C, NG_016607.1:g.5840T>C, NG_023304.1:g.4668A>G, NM_000791.3:c.-825A>G, NM_001290354.1:c.-931A>G, NM_001290357.1:c.-825A>G, NM_002439.4:c.237+350T>C, NR_110936.1:n.-333A>G, XM_005248455.1:c.-1282A>G, XM_005248456.1:c.-931A>G, rs36231776, rs3776963
T > C
No VIP available No Clinical Annotations available VA
rs4148396 NC_000010.10:g.101591944T>C, NC_000010.11:g.99832187T>C, NG_011798.1:g.54482T>C, NM_000392.4:c.3258+56T>C, XM_005269536.1:c.2979+56T>C, XM_006717630.2:c.2562+56T>C, XM_011539291.1:c.*573T>C, XR_945604.1:n.3447+56T>C, XR_945605.1:n.3449+56T>C, rs17495225
T > C
No VIP available CA VA
rs4148416 NC_000017.10:g.48753423C>T, NC_000017.11:g.50676062C>T, NM_003786.3:c.3039C>T, NP_003777.2:p.Gly1013=, XM_005257763.1:c.2847C>T, XM_005257763.2:c.2847C>T, XM_011525422.1:c.2952C>T, XM_011525423.1:c.3144C>T, XM_011525424.1:c.2364C>T, XM_011525425.1:c.2313C>T, XP_005257820.1:p.Gly949=, XP_011523724.1:p.Gly984=, XP_011523725.1:p.Gly1048=, XP_011523726.1:p.Gly788=, XP_011523727.1:p.Gly771=, XR_934586.1:n.3237C>T
C > T
No VIP available CA VA
rs4148737 NC_000007.13:g.87171152T>C, NC_000007.14:g.87541836T>C, NG_011513.1:g.176413A>G, NM_000927.4:c.2212-372A>G, rs386591482, rs60838665
T > C
VIP No Clinical Annotations available No Variant Annotations available
rs4149015 NC_000012.11:g.21283322G>A, NC_000012.12:g.21130388G>A, NG_011745.1:g.4195G>A, NM_006446.4:c.-910G>A
G > A
rs4149056 NC_000012.11:g.21331549T>C, NC_000012.12:g.21178615T>C, NG_011745.1:g.52422T>C, NM_006446.4:c.521T>C, NP_006437.3:p.Val174Ala, rs52816141, rs60037639
T > C
No VIP available CA VA
rs4149081 NC_000012.11:g.21378021G>A, NC_000012.12:g.21225087G>A, NG_011745.1:g.98894G>A, NM_006446.4:c.1865+248G>A, rs60942524
G > A
No VIP available CA VA
rs442767 NC_000005.10:g.80655677G>T, NC_000005.9:g.79951496G>T, NG_016607.1:g.6203G>T, NG_023304.1:g.4305C>A, NM_000791.3:c.-1188C>A, NM_001290354.1:c.-1294C>A, NM_001290357.1:c.-1188C>A, NM_002439.4:c.237+713G>T, NR_110936.1:n.-696C>A, XM_005248455.1:c.-1645C>A, XM_005248456.1:c.-1294C>A, rs36231429
G > T
No VIP available No Clinical Annotations available VA
rs4451422 NC_000009.11:g.130576597A>C, NC_000009.12:g.127814318A>C, NG_009551.1:g.45451T>G, NG_023245.1:g.16444A>C, NM_001018078.2:c.*714A>C, NM_001288803.1:c.*714A>C, NM_004957.5:c.*714A>C, NR_110170.1:n.2526A>C, XM_005251863.1:c.*714A>C, XM_005251864.1:c.*91A>C, XM_005251864.2:c.*91A>C, XM_005251865.1:c.*714A>C, XM_011518437.1:c.*714A>C, XM_011518438.1:c.*714A>C, XM_011518439.1:c.*714A>C, XM_011519273.1:c.-2261A>C, XR_242581.1:n.2356A>C, XR_242581.2:n.2375A>C, XR_242582.1:n.1472A>C, XR_242582.2:n.1491A>C, rs57484472
A > C
rs45445694 NC_000018.10:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NC_000018.9:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NG_028255.1:g.5043_5070CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NM_001012716.2:c.*34+169_*34+196CGGGACGGAGGCAGGCCAAGTGGCGCGG[2][3][4][7][8][9], NM_001071.2:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258137.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258138.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9]
No VIP available No Clinical Annotations available VA
rs45589337 NC_000001.10:g.98144726T>C, NC_000001.11:g.97679170T>C, NG_008807.2:g.246890A>G, NM_000110.3:c.775A>G, NP_000101.2:p.Lys259Glu, XM_005270561.1:c.664A>G, XM_005270562.1:c.775A>G, XM_005270562.3:c.775A>G, XM_005270563.1:c.775A>G, XM_005270564.1:c.775A>G, XM_006710397.2:c.775A>G, XP_005270618.1:p.Lys222Glu, XP_005270619.1:p.Lys259Glu, XP_005270619.2:p.Lys259Glu, XP_005270620.1:p.Lys259Glu, XP_005270621.1:p.Lys259Glu, XP_006710460.1:p.Lys259Glu, rs59034382
T > C
No VIP available CA VA
rs4673993 NC_000002.11:g.216212339T>C, NC_000002.12:g.215347616T>C, NG_013002.1:g.40661T>C, NM_004044.6:c.1503+675T>C, rs17448559, rs58608144
T > C
No VIP available No Clinical Annotations available VA
rs4781712 NC_000016.10:g.16009375A=, NC_000016.10:g.16009375A>G, NC_000016.9:g.16103232A>G, NG_028268.1:g.64799A=, NG_028268.1:g.64799A>G, NM_004996.3:c.226-401A>G, NM_004996.3:c.226-401G>A, NT_187607.1:g.1667251G=, NT_187607.1:g.1667251G>A, XM_005255326.1:c.226-401A>G, XM_005255327.1:c.226-401A>G, XM_005255328.1:c.226-401A>G, XM_005255329.1:c.226-401A>G, XM_011522497.1:c.202-401A>G, XM_011522497.1:c.202-401G>A, XM_011522498.1:c.280-401A>G, XM_011522498.1:c.280-401G>A, rs17264542, rs58943181
A > G
No VIP available No Clinical Annotations available VA
rs4818789 NC_000021.8:g.46948827G>T, NC_000021.9:g.45528913G>T, NG_028278.1:g.18559C>A, NM_001205206.1:c.1151+1857C>A, NM_001205207.1:c.1031+1857C>A, NM_194255.2:c.1151+1857C>A, XM_005261163.1:c.1151+1857C>A, XM_005261164.1:c.797+1857C>A, XM_005261164.2:c.797+1857C>A, XM_011529696.1:c.1442+1857C>A, XM_011529697.1:c.1442+1857C>A, XM_011529698.1:c.1217+1857C>A, XM_011529699.1:c.1178+1857C>A, XM_011529700.1:c.1151+1857C>A, XM_011529701.1:c.1151+1857C>A, XM_011529702.1:c.1151+1857C>A, XM_011529703.1:c.1151+1857C>A, XM_011529704.1:c.1151+1857C>A, XM_011529705.1:c.1442+1857C>A, XM_011529706.1:c.1013+1857C>A, XM_011529707.1:c.1442+1857C>A, XM_011529708.1:c.1151+1857C>A, XM_011529709.1:c.797+1857C>A, XM_011529710.1:c.797+1857C>A, rs58521338
G > T
No VIP available No Clinical Annotations available VA
rs4819128 NC_000021.8:g.46949649C>T, NC_000021.9:g.45529735C>T, NG_028278.1:g.17737G>A, NM_001205206.1:c.1151+1035G>A, NM_001205207.1:c.1031+1035G>A, NM_194255.2:c.1151+1035G>A, XM_005261163.1:c.1151+1035G>A, XM_005261164.1:c.797+1035G>A, XM_005261164.2:c.797+1035G>A, XM_011529696.1:c.1442+1035G>A, XM_011529697.1:c.1442+1035G>A, XM_011529698.1:c.1217+1035G>A, XM_011529699.1:c.1178+1035G>A, XM_011529700.1:c.1151+1035G>A, XM_011529701.1:c.1151+1035G>A, XM_011529702.1:c.1151+1035G>A, XM_011529703.1:c.1151+1035G>A, XM_011529704.1:c.1151+1035G>A, XM_011529705.1:c.1442+1035G>A, XM_011529706.1:c.1013+1035G>A, XM_011529707.1:c.1442+1035G>A, XM_011529708.1:c.1151+1035G>A, XM_011529709.1:c.797+1035G>A, XM_011529710.1:c.797+1035G>A, rs111154961, rs111213124, rs36138260, rs58322235
C > T
No VIP available CA VA
rs4846051 NC_000001.10:g.11854457G>A, NC_000001.11:g.11794400G>A, NG_013351.1:g.16704C>T, NM_005957.4:c.1305C>T, NP_005948.3:p.Phe435=, XM_005263458.1:c.1428C>T, XM_005263458.2:c.1428C>T, XM_005263459.1:c.1374C>T, XM_005263460.1:c.1305C>T, XM_005263460.3:c.1305C>T, XM_005263461.1:c.1305C>T, XM_005263461.3:c.1305C>T, XM_005263462.1:c.1305C>T, XM_005263462.3:c.1305C>T, XM_005263463.1:c.1059C>T, XM_005263463.2:c.1059C>T, XM_011541495.1:c.1425C>T, XM_011541496.1:c.1428C>T, XP_005263515.1:p.Phe476=, XP_005263516.1:p.Phe458=, XP_005263517.1:p.Phe435=, XP_005263518.1:p.Phe435=, XP_005263519.1:p.Phe435=, XP_005263520.1:p.Phe353=, XP_011539797.1:p.Phe475=, XP_011539798.1:p.Phe476=, rs17854810, rs57431061
G > A
No VIP available No Clinical Annotations available VA
rs4867329 NC_000005.10:g.31435520A>C, NC_000005.9:g.31435627A>C, NM_001100412.1:c.2931+245T>G, NM_013235.4:c.3042+245T>G, XM_005248291.1:c.3042+245T>G, XM_005248291.2:c.3042+245T>G, XM_005248292.1:c.3018+245T>G, XM_005248292.2:c.3018+245T>G, XM_005248293.1:c.2949+245T>G, XM_005248293.2:c.2949+245T>G, XM_005248294.1:c.2838+245T>G, XM_005248294.2:c.2838+245T>G, XM_011514033.1:c.3042+245T>G, rs17485775
A > C
No VIP available CA VA
rs4880 NC_000006.11:g.160113872A>G, NC_000006.12:g.159692840A>G, NG_008729.1:g.5482T>C, NM_000636.2:c.47T>C, NM_001024465.1:c.47T>C, NM_001024466.1:c.47T>C, NP_000627.2:p.Val16Ala, NP_001019636.1:p.Val16Ala, NP_001019637.1:p.Val16Ala, rs1141717, rs11551083, rs116851270, rs17362379, rs17405198, rs17856520, rs1799725, rs3205539, rs386596107
A > G
No VIP available CA VA
rs4888024 NC_000016.10:g.79405477A>G, NC_000016.9:g.79439374A>G, XM_011523084.1:c.*28+180403T>C, rs17655371, rs59573204
A > G
No VIP available CA VA
rs4948496 NC_000010.10:g.63805617T>C, NC_000010.11:g.62045858T>C, NG_030027.1:g.149605T>C, NM_032199.2:c.734-5030T>C, XM_005270215.1:c.479-5030T>C, XM_011540262.1:c.503-5030T>C, rs17288843, rs58586872
T > C
No VIP available CA VA
rs4982133 NC_000014.8:g.34526819A>C, NC_000014.9:g.34057613A>C, XR_429348.2:n.460+34708T>G, XR_943736.1:n.253-1519A>C, rs59135361
A > C
No VIP available CA VA
rs4986790 NC_000009.11:g.120475302A>G, NC_000009.12:g.117713024A>G, NG_011475.1:g.13843A>G, NM_003266.3:c.776A>G, NM_138554.3:c.896A>G, NM_138554.4:c.896A>G, NM_138557.2:c.296A>G, NP_003257.1:p.Asp259Gly, NP_612564.1:p.Asp299Gly, NP_612567.1:p.Asp99Gly, XM_005252182.1:c.890A>G, XP_005252239.1:p.Asp297Gly, rs52820966, rs59093760
A > G
No VIP available No Clinical Annotations available VA
rs56103835 NC_000014.8:g.101522556T>C, NC_000014.9:g.101056219T>C, NR_036133.1:n.1T>C
T > A
T > C
No VIP available No Clinical Annotations available VA
rs5751876 NC_000022.10:g.24837301T>C, NC_000022.11:g.24441333T>C, NM_000675.5:c.1083T>C, NM_001278497.1:c.1083T>C, NM_001278498.1:c.1083T>C, NM_001278499.1:c.1083T>C, NM_001278500.1:c.1083T>C, NP_000666.2:p.Tyr361=, NP_001265426.1:p.Tyr361=, NP_001265427.1:p.Tyr361=, NP_001265428.1:p.Tyr361=, NP_001265429.1:p.Tyr361=, NR_028483.2:n.1270+659A>G, NR_028484.2:n.833+659A>G, NR_103543.1:n.936T>C, NR_103544.1:n.916T>C, NR_103546.1:n.5262T>C, rs17851062
T > -
T > C
No VIP available CA VA
rs5760410 NC_000022.10:g.24815406G>A, NC_000022.11:g.24419438G>A, NG_031915.2:g.153617G>A, NR_103546.1:n.3905+4694G>A, rs7284907
G > A
No VIP available No Clinical Annotations available VA
rs595961 NC_000001.10:g.36367780A>G, NC_000001.11:g.35902179A>G, NM_001317122.1:c.1264-25A>G, NM_001317123.1:c.1039-25A>G, NM_012199.4:c.1264-25A>G, XM_005270746.1:c.1246-25A>G, XM_005270747.1:c.1039-25A>G, XM_011541236.1:c.1273-25A>G, XM_011541237.1:c.1048-25A>G, XM_011541238.1:c.1039-25A>G, XM_011541239.1:c.820-25A>G, rs59876085
A > G
No VIP available CA VA
rs6064463 NC_000020.10:g.55480277T>C, NC_000020.11:g.56905221T>C, rs59614919
T > C
No VIP available No Clinical Annotations available VA
rs6123048 NC_000020.10:g.50147400A>G, NC_000020.11:g.51530861A>G, NM_001136021.2:c.71-6751T>C, NM_001258292.1:c.71-6751T>C, NM_001258294.1:c.-13-7265T>C, NM_001258295.1:c.-13-7265T>C, NM_001258296.1:c.-13-7265T>C, NM_001258297.1:c.-13-7265T>C, NM_012340.4:c.131-6751T>C, NM_173091.3:c.131-6751T>C, XM_005260413.1:c.131-6754T>C, XM_011528824.1:c.131-6751T>C, XM_011528825.1:c.71-6751T>C, XM_011528826.1:c.-13-7265T>C, rs59847809
A > G
No VIP available CA VA
rs61886492 NC_000011.10:g.49164722G>A, NC_000011.9:g.49186274G>A, NG_029170.1:g.48949C>T, NM_001014986.1:c.1423C>T, NM_001193471.1:c.1378C>T, NM_001193472.1:c.1378C>T, NM_001193473.1:c.499C>T, NM_004476.1:c.1423C>T, NP_001014986.1:p.His475Tyr, NP_001180400.1:p.His460Tyr, NP_001180401.1:p.His460Tyr, NP_001180402.1:p.His167Tyr, NP_004467.1:p.His475Tyr, XM_005252839.1:c.919C>T, XM_011519958.1:c.1378C>T, XP_005252896.1:p.His307Tyr, XP_011518260.1:p.His460Tyr
G > A
No VIP available CA VA
rs639174 NC_000005.10:g.31433540C>T, NC_000005.9:g.31433647C>T, NM_001100412.1:c.2932-1862G>A, NM_013235.4:c.3043-1862G>A, XM_005248291.1:c.3043-1862G>A, XM_005248291.2:c.3043-1862G>A, XM_005248292.1:c.3019-1862G>A, XM_005248292.2:c.3019-1862G>A, XM_005248293.1:c.2950-1862G>A, XM_005248293.2:c.2950-1862G>A, XM_005248294.1:c.2839-1862G>A, XM_005248294.2:c.2839-1862G>A, XM_011514033.1:c.3043-1862G>A, rs57933113
C > T
No VIP available No Clinical Annotations available VA
rs6497759 NC_000016.10:g.24790416G>A, NC_000016.9:g.24801737G>A, NM_014494.2:c.1774G>A, NP_055309.2:p.Ala592Thr, XM_005255253.1:c.1678G>A, XM_005255254.1:c.1774G>A, XM_005255254.2:c.1774G>A, XM_005255255.1:c.1678G>A, XM_005255256.1:c.1678G>A, XM_005255257.1:c.1015G>A, XM_005255257.3:c.1015G>A, XM_006721039.2:c.1348G>A, XM_011545791.1:c.1774G>A, XM_011545792.1:c.1774G>A, XM_011545793.1:c.1774G>A, XM_011545794.1:c.1774G>A, XM_011545795.1:c.1774G>A, XM_011545796.1:c.1774G>A, XP_005255310.1:p.Ala560Thr, XP_005255311.1:p.Ala592Thr, XP_005255312.1:p.Ala560Thr, XP_005255313.1:p.Ala560Thr, XP_005255314.1:p.Ala339Thr, XP_006721102.1:p.Ala450Thr, XP_011544093.1:p.Ala592Thr, XP_011544094.1:p.Ala592Thr, XP_011544095.1:p.Ala592Thr, XP_011544096.1:p.Ala592Thr, XP_011544097.1:p.Ala592Thr, XP_011544098.1:p.Ala592Thr, rs52832662, rs59562937
G > A
No VIP available No Clinical Annotations available VA
rs6505162 NC_000017.10:g.28444183A>C, NC_000017.11:g.30117165A>C, NM_001261467.1:c.-49+302A>C, NM_032141.3:c.20+302A>C, NR_029945.1:n.87A>C, NR_036149.1:n.-5T>G, XM_005258042.1:c.20+302A>C, XM_011525345.1:c.21-137A>C, XR_934651.1:n.682+227T>G, rs56453081, rs61093106
A > C
A > T
No VIP available CA VA
rs6506569 NC_000018.10:g.8275859T>C, NC_000018.9:g.8275857T>C, NM_001105244.1:c.2755-20509T>C, NM_002845.3:c.2716-20509T>C, XM_005258128.1:c.2077-20509T>C, XM_006722335.2:c.2791-20509T>C, XM_006722337.2:c.2716-20509T>C, XM_011525708.1:c.2830-20509T>C, XM_011525709.1:c.2818-20509T>C, XM_011525710.1:c.2830-20509T>C, XM_011525711.1:c.2818-20509T>C, XM_011525712.1:c.2755-20509T>C, XM_011525713.1:c.2644-20509T>C, XM_011525714.1:c.2626-20509T>C, XM_011525715.1:c.2191-20509T>C, XM_011525716.1:c.2077-20509T>C, XM_011525717.1:c.1693-20509T>C, XM_011525722.1:c.2116-20509T>C, XR_430046.2:n.3101-20509T>C, rs59608859
T > C
No VIP available CA VA
rs66554220 unknown
No VIP available CA VA
rs6920220 NC_000006.11:g.138006504G>A, NC_000006.12:g.137685367G>A, rs17264367, rs56495515, rs57269942, rs58273351
G > A
No VIP available CA VA
rs70991108 NC_000005.10:g.80654344_80654345insTGGCGCGTCCCGCCCAGGT, NC_000005.9:g.79950163_79950164insTGGCGCGTCCCGCCCAGGT, NG_016607.1:g.4870_4871insTGGCGCGTCCCGCCCAGGT, NG_023304.1:g.5637_5638insACCTGGGCGGGACGCGCCA, NM_000791.3:c.86+59_86+60insACCTGGGCGGGACGCGCCA, NM_001290354.1:c.-21+59_-21+60insACCTGGGCGGGACGCGCCA, NM_001290357.1:c.86+59_86+60insACCTGGGCGGGACGCGCCA, NM_002439.4:c.-384_-383insTGGCGCGTCCCGCCCAGGT, NR_110936.1:n.578+59_578+60insACCTGGGCGGGACGCGCCA, XM_005248455.1:c.-313_-312insACCTGGGCGGGACGCGCCA, XM_005248456.1:c.-21+59_-21+60insACCTGGGCGGGACGCGCCA, rs147334155
No VIP available CA VA
rs7142143 NC_000014.8:g.51403531T>C, NC_000014.9:g.50936813T>C, NG_012796.1:g.12718A>G, NM_001163940.1:c.244-1628A>G, NM_002863.3:c.345+923A>G, NM_002863.4:c.345+923A>G, rs111177964, rs57811686
T > C
No VIP available CA VA
rs717620 NC_000010.10:g.101542578C>T, NC_000010.11:g.99782821C>T, NG_011798.1:g.5116C>T, NM_000392.4:c.-24C>T, XM_005269536.1:c.-24C>T, XM_006717631.2:c.-24C>T, XM_011539291.1:c.-24C>T, XR_945604.1:n.166C>T, XR_945605.1:n.168C>T, rs17216163, rs386485129, rs58371376
C > T
No VIP available CA VA
rs719235 NC_000008.10:g.63951681C>A, NC_000008.11:g.63039122C>A, NG_028126.1:g.4930G>T, NM_003878.2:c.-354G>T, XM_011517623.1:c.-354G>T, rs3758150, rs58005468
C > A
No VIP available No Clinical Annotations available VA
rs7270101 NC_000020.10:g.3193893A>C, NC_000020.11:g.3213247A>C, NG_012093.1:g.8838A>C, NM_001267623.1:c.67-738A>C, NM_033453.3:c.124+21A>C, NM_181493.2:c.73+21A>C, NR_052000.1:n.224+21A>C, NR_052001.1:n.49-11A>C, NR_052002.1:n.316+21A>C, XM_006723564.2:c.124+21A>C, XM_006723565.2:c.67-738A>C, XM_011529234.1:c.124+21A>C, XM_011529235.1:c.124+21A>C
A > C
No VIP available No Clinical Annotations available VA
rs7279445 NC_000021.8:g.46919918C>T, NC_000021.9:g.45500004C>T, NG_011903.1:g.99822C>T, NM_030582.3:c.3223+2343C>T, NM_130444.2:c.3928+2343C>T, NM_130445.2:c.2683+2343C>T, NM_130445.3:c.2683+2343C>T, XM_005261178.1:c.3223+2343C>T, XM_005261179.1:c.3187+2343C>T, XM_005261180.1:c.3124+2343C>T, XM_005261181.1:c.2683+2343C>T, XM_005261182.1:c.2659+2343C>T, rs56456884, rs60261684, rs60932654
C > T
No VIP available CA VA
rs7317112 NC_000013.10:g.95923523A>G, NC_000013.11:g.95271269A>G, NM_001105515.2:c.75-23516T>C, NM_001301829.1:c.75-23516T>C, NM_001301830.1:c.75-23516T>C, NM_005845.4:c.75-23516T>C, XM_005254025.2:c.-2168T>C, XM_005254026.1:c.75-23516T>C, XM_005254027.1:c.75-23516T>C, XM_005254028.1:c.75-23516T>C, XM_006719914.1:c.75-23516T>C, rs56448869, rs57356558, rs60109691
A > G
No VIP available No Clinical Annotations available VA
rs7387 NC_000005.10:g.80628972T>A, NC_000005.9:g.79924791T>A, NG_023304.1:g.31010A>T, NM_000791.3:c.*115A>T, NM_001290354.1:c.*115A>T, NM_001290357.1:c.*173A>T, NR_110936.1:n.994A>T, XM_005248455.1:c.*115A>T, XM_005248456.1:c.*115A>T, rs1643633, rs3202536
T > -
T > A
No VIP available No Clinical Annotations available VA
rs747199 NC_000006.11:g.44194345G>C, NC_000006.12:g.44226608G>C, NG_042893.1:g.12104G>C, NM_001078174.1:c.-54-652G>C, NM_001078175.2:c.-52+441G>C, NM_001078176.2:c.-51-655G>C, NM_001078177.1:c.-55+441G>C, NM_001304462.1:c.187-655G>C, NM_001304463.1:c.76-655G>C, NM_001304465.1:c.25-652G>C, NM_001304466.1:c.25-655G>C, NM_004955.2:c.-51-655G>C, XM_005248875.1:c.187-655G>C, XM_005248876.1:c.76-652G>C, XM_005248876.3:c.76-652G>C, XM_005248877.1:c.76-655G>C, XM_005248878.1:c.-52+441G>C, XM_005248878.3:c.-52+441G>C, XM_005248879.1:c.-52+441G>C, XM_005248879.3:c.-52+441G>C, XM_005248880.1:c.-55+441G>C, XM_005248880.3:c.-55+441G>C, XM_005248881.1:c.-483G>C, XM_005248881.3:c.-483G>C, XM_005248882.1:c.-486G>C, XM_005248882.3:c.-486G>C, XM_011514341.1:c.187-652G>C, rs3799961
G > C
No VIP available No Clinical Annotations available VA
rs7499 NC_000021.8:g.46932328G>A, NC_000021.9:g.45512414G>A, NG_011903.1:g.112223G>A, NM_030582.3:c.*16G>A, NM_130444.2:c.*16G>A, NM_130445.2:c.*16G>A, NM_130445.3:c.*16G>A, XM_005261178.1:c.*16G>A, XM_005261179.1:c.*16G>A, XM_005261180.1:c.*16G>A, XM_005261181.1:c.*16G>A, XM_005261182.1:c.*16G>A, XM_011529707.1:c.1585-9445C>T, rs3190718, rs61437544
G > A
No VIP available No Clinical Annotations available VA
rs7563206 NC_000002.11:g.216190654C>T, NC_000002.12:g.215325931C>T, NG_013002.1:g.18976C>T, NM_004044.6:c.380-56C>T, rs17447642, rs60588287
C > T
No VIP available CA VA
rs7624766 NC_000003.11:g.160429869A>G, NC_000003.12:g.160712081A>G, rs10288868, rs57928390
A > G
No VIP available CA VA
rs79085477 NC_000020.10:g.55701215C>T, NC_000020.11:g.57126159C>T, XR_936901.1:n.278+5836G>A, XR_936902.1:n.89+350G>A, XR_936903.1:n.48+399G>A, XR_936904.1:n.278+5836G>A
C > T
No VIP available No Clinical Annotations available VA
rs7911488 NC_000010.10:g.105154089A>G, NC_000010.11:g.103394332A>G, NM_001206426.1:c.-9-1866T>C, NM_001206427.1:c.-10+1414T>C, NM_032747.3:c.-143T>C, NR_031707.1:n.70T>C
A > -
A > G
No VIP available CA VA
rs7992226 NC_000013.10:g.101797840A>G, NC_000013.11:g.101145489A>G, NM_052867.2:c.1840-593T>C, XM_005254037.1:c.1840-593T>C, XM_011521067.1:c.1897-593T>C, XM_011521068.1:c.1840-593T>C, XM_011521069.1:c.1810-593T>C, XM_011521070.1:c.1897-20808T>C, rs17582066, rs57809036
A > G
No VIP available CA VA
rs80223967 NC_000001.10:g.213943679A>G, NC_000001.11:g.213770336A>G, XR_922586.1:n.137-24048A>G, XR_922587.1:n.136+38778A>G
A > G
No VIP available No Clinical Annotations available VA
rs8058040 NC_000016.10:g.16013855A>G, NC_000016.9:g.16107712A>G, NG_028268.1:g.69279A>G, NM_004996.3:c.352-636A>G, NT_187607.1:g.1671731A>G, XM_005255326.1:c.352-636A>G, XM_005255327.1:c.352-636A>G, XM_005255328.1:c.352-2641A>G, XM_005255329.1:c.352-636A>G, XM_011522497.1:c.328-636A>G, XM_011522498.1:c.406-636A>G, rs56942501
A > G
No VIP available No Clinical Annotations available VA
rs8090560 NC_000018.10:g.79453155G>A, NC_000018.9:g.77213155G>A, NG_029226.1:g.62384G>A, NM_001278669.1:c.1903+1339G>A, NM_001278670.1:c.1903+1339G>A, NM_001278672.1:c.1864+1339G>A, NM_001278673.1:c.487+1339G>A, NM_001278675.1:c.1864+1339G>A, NM_006162.4:c.1903+1339G>A, NM_172387.2:c.1864+1339G>A, NM_172388.2:c.487+1339G>A, NM_172389.2:c.1864+1339G>A, NM_172390.2:c.1903+1339G>A, XM_005266701.1:c.1870+1339G>A, XM_005266702.1:c.1903+1339G>A, rs60596973
G > A
No VIP available No Clinical Annotations available VA
rs8187710 NC_000010.10:g.101611294G>A, NC_000010.11:g.99851537G>A, NG_011798.1:g.73832G>A, NM_000392.4:c.4544G>A, NP_000383.1:p.Cys1515Tyr, XM_005269536.1:c.4265G>A, XM_006717630.2:c.3848G>A, XP_005269593.1:p.Cys1422Tyr, XP_006717693.1:p.Cys1283Tyr, XR_945605.1:n.4608G>A, rs17222568, rs52804507, rs58135906
G > A
No VIP available No Clinical Annotations available VA
rs868755 NC_000007.13:g.87189930T>G, NC_000007.14:g.87560614T>G, NG_011513.1:g.157635A>C, NM_000927.4:c.827+649A>C, rs10358632, rs386618038
T > G
No VIP available No Clinical Annotations available VA
rs868853 NC_000013.10:g.95955076C>T, NC_000013.11:g.95302822C>T, NM_001105515.2:c.-1508G>A, NM_001301829.1:c.-1508G>A, NM_001301830.1:c.-1508G>A, NM_005845.4:c.-1508G>A, XM_005254026.1:c.-1508G>A, XM_005254027.1:c.-1508G>A, XM_005254028.1:c.-1508G>A, XM_006719914.1:c.-1508G>A, XR_429273.2:n.1009+496C>T, XR_931650.1:n.752+757C>T, rs386618045, rs57110980
C > T
No VIP available CA VA
rs9344 NC_000011.10:g.69648142G>A, NC_000011.9:g.69462910G>A, NG_007375.1:g.12038G>A, NM_053056.2:c.723G>A, NP_444284.1:p.Pro241=, XM_006718653.2:c.747G>A, XP_006718716.1:p.Pro249=, rs1131451, rs11557586, rs17295377, rs17349816, rs17359282, rs17852153, rs2227951, rs3191361, rs59807553, rs603965
G > A
No VIP available CA VA
rs9345389 NC_000006.11:g.94440604A>G, NC_000006.12:g.93730886A>G, NR_015362.1:n.1869-5735A>G, XR_241850.1:n.1869-5735A>G, XR_241851.1:n.2011-1109A>G, XR_241852.1:n.2084-5735A>G, rs58119272
A > G
No VIP available CA VA
rs9516519 NC_000013.10:g.95672457T>G, NC_000013.11:g.95020203T>G, NM_001301829.1:c.*1372A>C, NM_005845.4:c.*1372A>C, XM_005254025.1:c.*1372A>C, XM_005254025.2:c.*1372A>C, XM_005254026.1:c.*1372A>C, XM_005254027.1:c.*1372A>C, XM_006719914.1:c.*1372A>C, XM_011521047.1:c.*1372A>C, rs17189278
T > G
No VIP available No Clinical Annotations available VA
rs9611280 NC_000022.10:g.40552119G>A, NC_000022.11:g.40156115G>A, NM_001024843.1:c.46G>A, NP_001020014.1:p.Val16Met, XM_005261393.1:c.46G>A, XM_005261394.1:c.46G>A, XP_005261450.1:p.Val16Met, XP_005261451.1:p.Val16Met, rs52808489, rs61442552
G > A
No VIP available CA VA
rs9895420 NC_000017.10:g.48712038T>A, NC_000017.11:g.50634677T>A, NM_001144070.1:c.-260T>A, NM_003786.3:c.-260T>A, XM_005257763.1:c.-260T>A, XM_005257763.2:c.-260T>A, XM_011525422.1:c.-260T>A, XM_011525423.1:c.-260T>A, XR_934586.1:n.-167T>A, rs59559322
T > A
No VIP available CA VA
rs9977268 NC_000021.8:g.46907287C>T, NC_000021.9:g.45487373C>T, NG_011903.1:g.87191C>T, NM_030582.3:c.2374-74C>T, NM_130444.2:c.3079-74C>T, NM_130445.2:c.1834-74C>T, NM_130445.3:c.1834-74C>T, XM_005261178.1:c.2374-74C>T, XM_005261179.1:c.2374-74C>T, XM_005261180.1:c.2275-74C>T, XM_005261181.1:c.1834-74C>T, XM_005261182.1:c.1810-74C>T
C > T
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 147


Generic Names
  • Amethopterin
  • Amethopterine
  • L-Amethopterin
  • MTX
  • Methopterin
  • Methotextrate
  • Methotrexat
  • Methotrexate Sodium
  • Methylaminopterin
  • Methylaminopterinum
  • N-Bismethylpteroylglutamic Acid
Trade Names
  • Abitrexate
  • Antifolan
  • Arbitrexate
  • Emtexate
  • Folex
  • Ledertrexate
  • Metatrexan
  • Methotrate
  • Mexate
  • Rheumatrex
  • Trexall
Brand Mixture Names

PharmGKB Accession Id





An antineoplastic antimetabolite with immunosuppressant properties. It is an inhibitor of tetrahydrofolate dehydrogenase and prevents the formation of tetrahydrofolate, necessary for synthesis of thymidylate, an essential component of DNA.

Source: Drug Bank


For the treatment of gestational choriocarcinoma, chorioadenoma destruens and hydatidiform mole. Also for the treatment of severe psoriasis and severe, active, classical or definite rheumatoid arthritis.

Source: Drug Bank

Other Vocabularies

Information pulled from DrugBank has not been reviewed by PharmGKB.

Pharmacology, Interactions, and Contraindications

Mechanism of Action

Methotrexate anti-tumor activity is a result of the inhibition of folic acid reductase, leading to inhibition of DNA synthesis and inhibition of cellular replication. The mechanism involved in its activity against rheumatoid arthritis is not known.

Source: Drug Bank


Methotrexate is an antineoplastic anti-metabolite. Anti-metabolites masquerade as purine or pyrimidine - which become the building blocks of DNA. They prevent these substances becoming incorporated in to DNA during the "S" phase (of the cell cycle), stopping normal development and division. Methotrexate inhibits folic acid reductase which is responsible for the conversion of folic acid to tetrahydrofolic acid. At two stages in the biosynthesis of purines and at one stage in the synthesis of pyrimidines, one-carbon transfer reactions occur which require specific coenzymes synthesized in the cell from tetrahydrofolic acid. Tetrahydrofolic acid itself is synthesized in the cell from folic acid with the help of an enzyme, folic acid reductase. Methotrexate looks a lot like folic acid to the enzyme, so it binds to it quite strongly and inhibits the enzyme. Thus, DNA synthesis cannot proceed because the coenzymes needed for one-carbon transfer reactions are not produced from tetrahydrofolic acid because there is no tetrahydrofolic acid. Methotrexate selectively affects the most rapidly dividing cells (neoplastic and psoriatic cells). Methotrexate is also indicated in the management of severe, active, classical, or definite rheumatoid arthritis.

Source: Drug Bank

Food Interaction

Take without regard to meals. Limit caffeine intake.|Milk appears to reduce its absorption.

Source: Drug Bank

Absorption, Distribution, Metabolism, Elimination & Toxicity



Source: Drug Bank

Protein Binding

50%, primarily to albumin

Source: Drug Bank


Generally well absorbed with a mean bioavailability of about 60%.

Source: Drug Bank


Low doses: 3 to 10 hours; High doses: 8 to 15 hours.

Source: Drug Bank


Symptoms of overdose include bone marrow suppression and gastrointestinal toxicity. LD 50=43mg/kg(orally in rat).

Source: Drug Bank

Route of Elimination

With IV administration, 80% to 90% of the administered dose is excreted unchanged in the urine within 24 hours. There is limited biliary excretion amounting to 10% or less of the administered dose.

Source: Drug Bank

Volume of Distribution

  • 0.4 to 0.8 L/kg

Source: Drug Bank

Chemical Properties

Chemical Formula


Source: Drug Bank

Isomeric SMILES


Source: OpenEye

Canonical SMILES


Source: Drug Bank

Average Molecular Weight


Source: Drug Bank

Monoisotopic Molecular Weight


Source: Drug Bank



Source: Drug Bank

InChI String


Source: Drug Bank

PharmGKB Curated Pathways

Pathways created internally by PharmGKB based primarily on literature evidence.

  1. Antimetabolite Pathway - Folate Cycle, Pharmacodynamics
    Model non-tissue specific cancer cell displaying candidate genes which may be involved in the pharmacodynamics of antimetabolite drugs acting on the folate cycle.
  1. Ibuprofen Pathway, Pharmacokinetics
    Stylized diagram of metabolism and transport of ibuprofen in the liver and kidney.
  1. Methotrexate Pathway (Brain Cell), Pharmacokinetics
    Representation of transport and exchange of methotrexate in the brain.
  1. Methotrexate Pathway (Cancer Cell), Pharmacodynamics
    Methotrexate cellular disposition and effects.
  1. Methotrexate Pathway, Pharmacokinetics
    Diagramatic representation of uptake, transport and elimination of methotrexate.

External Pathways

Links to non-PharmGKB pathways.

PharmGKB contains no links to external pathways for this drug. To report a pathway, click here.

Genes that are associated with this drug in PharmGKB's database based on (1) variant annotations, (2) literature review, (3) pathways or (4) information automatically retrieved from DrugBank, depending on the "evidence" and "source" listed below.

Curated Information ?

No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available PW
No Dosing Guideline available No Drug Label available CA VA No VIP available PW
No Dosing Guideline available No Drug Label available CA VA No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available PW
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available