Chemical: Drug

PharmGKB contains no dosing guidelines for this . To report known genotype-based dosing guidelines, or if you are interested in developing guidelines, click here.

PharmGKB annotates drug labels containing pharmacogenetic information approved by the US Food and Drug Administration (FDA), European Medicines Agency (EMA), the Pharmaceuticals and Medical Devices Agency, Japan (PMDA), and Health Canada (Santé Canada) (HCSC). PharmGKB annotations provide a brief summary of the PGx in the label, an excerpt from the label and a downloadable highlighted label PDF file. A list of genes and phenotypes found within the label is mapped to label section headers and listed at the end of each annotation. PharmGKB also attempts to interpret the level of action implied in each label with the "PGx Level" tag.

See the legend for more information about drug label sources and PGx Levels.

We welcome any information regarding drug labels containing PGx information approved by the FDA, EMA, PMDA, HCSC or other Medicine Agencies around the world - please contact feedback.

1. FDA Label for methotrexate

Full label available at DailyMed

Genes and/or phenotypes found in this label

PharmGKB contains no Clinical Variants that meet the highest level of criteria.

To see more Clinical Variants with lower levels of criteria, click the button at the bottom of the page.

Clinical Annotation for rs1801133 (MTHFR), methotrexate, Arthritis, Juvenile Rheumatoid, Arthritis, Psoriatic, Arthritis, Rheumatoid and Drug Toxicity (level 3 Toxicity/ADR)

Level of Evidence
Level 3
Arthritis, Juvenile Rheumatoid, Arthritis, Psoriatic, Arthritis, Rheumatoid, Drug Toxicity
OMB Race
Mixed Population
Race Notes
White pediatric group, Asian group, and an unknown group, several mixed populations, Black or African American, White.

To see the rest of this clinical annotation please register or sign in.

Disclaimer: The PharmGKB's clinical annotations reflect expert consensus based on clinical evidence and peer-reviewed literature available at the time they are written and are intended only to assist clinicians in decision-making and to identify questions for further research. New evidence may have emerged since the time an annotation was submitted to the PharmGKB. The annotations are limited in scope and are not applicable to interventions or diseases that are not specifically identified.

The annotations do not account for individual variations among patients, and cannot be considered inclusive of all proper methods of care or exclusive of other treatments. It remains the responsibility of the health-care provider to determine the best course of treatment for a patient. Adherence to any guideline is voluntary, with the ultimate determination regarding its application to be made solely by the clinician and the patient. PharmGKB assumes no responsibility for any injury or damage to persons or property arising out of or related to any use of the PharmGKB clinical annotations, or for any errors or omissions.

? = Mouse-over for quick help

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Links in the "Gene" column lead to PharmGKB Gene Pages.

List of all variant annotations for methotrexate

Gene ? Variant?
Alternate Names ? Chemicals ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
No VIP available No VIP available VA SLCO1B1 *1A N/A N/A N/A
No VIP available No VIP available VA SLCO1B1 *1B N/A N/A N/A
No VIP available No VIP available VA SLCO1B1 *5 N/A N/A N/A
No VIP available No VIP available VA SLCO1B1 *14 N/A N/A N/A
No VIP available No VIP available VA SLCO1B1 *15 N/A N/A N/A
No VIP available No VIP available VA SLCO1B1 *23 N/A N/A N/A
No VIP available No VIP available VA SLCO1B1 *31 N/A N/A N/A
No VIP available No VIP available VA SLCO1B1 *35 N/A N/A N/A
No VIP available No VIP available VA TPMT *1 N/A N/A N/A
No VIP available No VIP available VA TPMT *2 N/A N/A N/A
No VIP available No VIP available VA TPMT *3A N/A N/A N/A
No VIP available No VIP available VA TPMT *3B N/A N/A N/A
No VIP available No VIP available VA TPMT *3C N/A N/A N/A
No VIP available No VIP available VA TPMT *12 N/A N/A N/A
No VIP available No Clinical Annotations available TPMT intermediate metabolizer phenotype
TPMT intermediate metabolizer phenotype N/A N/A N/A
No VIP available No Clinical Annotations available VA
rs10035440 31529463T>C, 31539463T>C, 807+667T>C
T > C
No VIP available No Clinical Annotations available VA
rs10061133 -94T>C, 126+1872T>C, 27T>C, 5060903A>G, 54466544A>G
A > G
Not Available
No VIP available No Clinical Annotations available VA
rs10072026 10661A>G, 242+68A>G, 30539499T>C, 79945140T>C
T > C
No VIP available No Clinical Annotations available VA
rs10106 *192T>C, 130576075T>C, 15922T>C, 45973A>G, 59740607T>C
T > C
3' UTR
No VIP available No Clinical Annotations available VA
rs1017860 -191+15855T>C, 1187+705T>C, 1226+705T>C, 21435T>C, 24963070T>C, 77172206T>C
T > C
No VIP available CA VA
rs10197559 14147C>T, 216185825C>T, 290+1371C>T, 66395243C>T
C > T
No VIP available CA VA
rs10276036 1000-44G>A, 167367G>A, 25213041C>T, 87180198C>T, ABCB1: IVS9 ¿44a>G
C > T
No VIP available No Clinical Annotations available VA
rs10280623 145021A>G, 25235387T>C, 287-3005A>G, 87202544T>C
T > C
rs1045642 208920T>A, 208920T>C, 25171488A>G, 25171488A>T, 3435T>A, 3435T>C, 87138645A>G, 87138645A>T, ABCB1*6, ABCB1: 3435C>T, ABCB1: C3435T, ABCB1: c.3435C>T, ABCB1:3435C>T, Ile1145=, Ile1145Ile, MDR1 3435C>T, MDR1 C3435T, PGP C3435T, c.3435C>T, mRNA 3853C>T
A > T
A > G
No VIP available No Clinical Annotations available VA
rs10505168 113655752T>C, 26929301T>C, 2998+1586A>G, 3190+1586A>G, 31T>C, 3310+1586A>G
T > C
rs1051266 3952235T>C, 46957794T>C, 80A>G, 9592A>G, : 80A>G, His27Arg, RFC-1, SCL19A1:80G>A, SLC19A1:Arg27His, SLC19A1:G80A, mRNA 199A>G
T > C
No VIP available CA VA
rs1053129 *2186G>T, *2244G>T, 3065G>T, 33081G>T, 79922720C>A, 80626901C>A
C > -
C > A
3' UTR
No VIP available No Clinical Annotations available VA
rs1054774 130554998T>A, 59719530T>A
T > A
Not Available
No VIP available No Clinical Annotations available VA
rs1059150 27801531T>G, 523A>C, 57605439T>G, 6984A>C, 782A>C, 78A>C, Ala26=
A > T
A > G
No VIP available No Clinical Annotations available VA
rs10760502 -429A>G, 130565267A>G, 5114A>G, 59729799A>G, 64A>G, Ile22Val
A > G
5' Flanking
No VIP available CA VA
rs10821936 14528041C>T, 502+23410C>T, 63723577C>T, 67565C>T
C > T
No VIP available No Clinical Annotations available VA
rs10868138 16081833T>C, 338A>G, 660A>G, 86917301T>C, Tyr113Cys
T > C
Not Available
No VIP available No Clinical Annotations available VA
rs10994982 14514568A>G, 502+9937A>G, 54092A>G, 63710104A>G
A > G
No VIP available CA VA
rs11045821 14092547G>A, 21332423G>A, 53296G>A, 727+469G>A
G > A
No VIP available CA VA
rs11045872 14132468A>G, 1682+2107A>G, 21372344A>G, 93217A>G
A > G
No VIP available CA VA
rs11045879 103492T>C, 14142743T>C, 1865+4846T>C, 21382619T>C, OATP1B1: intronic C/T
T > C
No VIP available CA VA
rs1105525 -200G>A, -39C>T, 30544867C>T, 5215C>T, 5293G>A, 79950508C>T
C > T
5' UTR
No VIP available CA VA
rs11231809 64302950T>A, 9608745T>A
T > A
Not Available
No VIP available CA VA
rs1127354 194C>A, 194C>G, 194C>T, 286C>A, 286C>G, 286C>T, 3133842C>A, 3133842C>G, 3133842C>T, 3193842C>A, 3193842C>G, 3193842C>T, 43C>A, 43C>G, 43C>T, 49-62C>A, 49-62C>G, 49-62C>T, 67-789C>A, 67-789C>G, 67-789C>T, 8787C>A, 8787C>G, 8787C>T, 94C>A, 94C>G, 94C>T, ITPA, ITPA: 94C>A, P32T, Pro15Ala, Pro15Ser, Pro15Thr, Pro32Ala, Pro32Ser, Pro32Thr
C > G
C > T
C > A
Not Available
No VIP available CA VA
rs1128503 1236T>C, 167964T>C, 87179601A>G, 87550285A>G, ABCB1 1236C>T, ABCB1*8, ABCB1: c.1236T>C, ABCB1:1236C>T, ABCB1:1236T>C, Gly412=, Gly412Gly, mRNA 1654T>C, p.Gly412Gly
A > G
No VIP available No Clinical Annotations available VA
rs1131596 -43C>A, -43C>G, -43C>T, 3952357G>A, 3952357G>C, 3952357G>T, 46957916G>A, 46957916G>C, 46957916G>T, 9470C>A, 9470C>G, 9470C>T
G > A
G > T
G > C
5' UTR
No VIP available No Clinical Annotations available VA
rs1142345 18070918T>C, 18130918T>C, 29457A>G, 719A>G, TPMT*3C, Tyr240Cys
T > C
No VIP available CA VA
rs11545078 15803165G>A, 17847C>T, 452C>T, 63938764G>A, GGH: 452C>T, GGH: c.452C>T, Thr151Ile, p.Thr127Ile, p.Thr151Ile
G > A
No VIP available No Clinical Annotations available VA
rs11702425 1920T>C, 2460T>C, 3902796T>C, 46908355T>C, 88259T>C, Leu640=, Leu820=
T > C
No VIP available No Clinical Annotations available VA
rs117532069 23497160G>A, 53301068G>A
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs11866002 12201936C>T, 2904G>A, 2919G>A, 3237G>A, 58587737C>T, Gln968=, Gln973=
G > T
G > C
No VIP available No Clinical Annotations available VA
rs1232027 30509379G>A, 79915020G>A
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs12517451 30514432C>T, 35728G>A, 79920073C>T
C > T
Not Available
No VIP available No Clinical Annotations available VA
rs1264457 1750979A>A, 1751704A>A, 1790354A>A, 1806142G>A, 1839928G>A, 1970128A>A, 30398064G>A, 30458064G>A, 382G>A, Gly128Arg
G > A
No VIP available No Clinical Annotations available VA
rs12681874 14269G>A, 15806743C>T, 275+384G>A, 63942342C>T
C > T
No VIP available No Clinical Annotations available VA
rs12894467 -1587C>T, 101507727C>T, 28C>T, 82507727C>T
C > T
5' Flanking
No VIP available No Clinical Annotations available VA
rs12995526 216197971T>C, 26293T>C, 66407389T>C, 815-102T>C
T > C
No VIP available CA VA
rs13120400 1194+928A>G, 13581248T>C, 51485A>G, 89033527T>C
T > C
No VIP available No Clinical Annotations available VA
rs13181 *304T>G, 18123137T>G, 2251A>C, 23927A>C, 45854919T>G, ERCC2 Lys751Gln, ERCC2:2251A>C, ERCC2:Lys751Gln, Lys751Gln, rs13181:T>G
T > G
No VIP available No Clinical Annotations available VA
rs141059755 17972006A>C, 66107605A>C
A > C
A > G
Not Available
No VIP available CA VA
rs1476413 11852300C>T, 1632+35G>A, 18861G>A, 7857032C>T
C > T
No VIP available CA VA
rs1544105 130562725C>T, 2572C>T, 59727257C>T
C > T
Not Available
No VIP available CA VA
rs1643650 15658A>G, 242+5065A>G, 30534502T>C, 79940143T>C
T > C
No VIP available No Clinical Annotations available VA
rs1643657 19384A>G, 243-2589A>G, 30530776T>C, 79936417T>C
T > C
No VIP available CA VA
rs1650723 *2876G>A, 30516389C>T, 33771G>A, 79922030C>T
C > T
3' Flanking
No VIP available CA VA
rs16853826 1227+1537G>A, 216205167G>A, 33489G>A, 66414585G>A
G > A
No VIP available No Clinical Annotations available VA
rs16853834 1320+642C>T, 216210236C>T, 38558C>T, 66419654C>T
C > T
No VIP available CA VA
rs1695 12658484A>G, 313A>G, 6624A>G, 67352689A>G, GSTP1*2, GSTP1*B, GSTP1: I105V, GSTP1:A313G, GSTP1:I105V, GSTP1:Ile105Val, Ile105Val, Part of haplotypes GSTP1*B and GSTP1*C, rs1695:A>G
A > G
No VIP available No Clinical Annotations available VA
rs17021408 213943238T>C, 7461017T>C
T > C
Not Available
No VIP available CA VA
rs1703794 14578700T>C, 85897A>G, 99613173T>C
T > C
Not Available
No VIP available No Clinical Annotations available VA
rs17222723 101595996T>A, 2867T>A, 3284T>A, 3563T>A, 3752T>A, 3754T>A, 58534T>A, 99836239T>A, ABCC2 rs8187694, MRP2 Val1188Glu, Val1095Glu, Val1188Glu, Val956Glu
T > A
Not Available
No VIP available No Clinical Annotations available VA
rs17264736 16056556G>T, 16116556G>T, 615+6078G>T, 78123G>T
G > T
No VIP available CA VA
rs17421511 11857788G>A, 13373C>T, 587-1332C>T, 7862520G>A
G > A
No VIP available No Clinical Annotations available VA
rs17514110 1227+1854C>T, 216205484C>T, 33806C>T, 66414902C>T
C > T
No VIP available CA VA
rs17602729 115236057G>A, 121+2014C>T, 133C>T, 7120C>T, 85207975G>A, Gln45Ter
G > A
Stop Codon
No VIP available CA VA
rs17731538 13603100G>A, 204-1592C>T, 29633C>T, 89055379G>A
G > A
No VIP available No Clinical Annotations available VA
rs1799793 11587G>A, 18135477C>T, 45867259C>T, 862G>A, 934G>A, Asp288Asn, Asp312Asn, XPD Asp312Asn, XPD:Asp312Asn
C > T
No VIP available CA VA
rs1799983 11291734T>G, 12965T>G, 150696111T>G, 894T>G, Asp298Glu, NOS3:894G>T
T > G
No VIP available No Clinical Annotations available VA
rs1800460 18079228C>T, 18139228C>T, 21147G>A, 460G>A, Ala154Thr, TPMT*3B
C > T
No VIP available No Clinical Annotations available VA
rs1800566 20389C>T, 23359344G>A, 445C>T, 457C>T, 559C>T, 69745145G>A, NQO1*2, NQO1:C609T, NQO1:P187S, NQO1:c.558C>T, Pro149Ser, Pro153Ser, Pro187Ser, rs1800566 C>T
G > A
No VIP available CA VA
rs1800909 15815713A>G, 16T>C, 5299T>C, 63951312A>G, Cys6Arg, GGH: 16T>C, GGH: c.16T>C, p.Cys6Arg
A > G
rs1801131 1040A>C, 11208431T>G, 11794419T>G, 1286A>C, 1409A>C, 16685A>C, A1298C, Glu347Ala, Glu429Ala, Glu470Ala, MTHFR:1298A>C
T > G
Not Available
rs1801133 11210333G>A, 11796321G>A, 14783C>T, 419C>T, 665C>T, 677C>T, 788C>T, A222V, Ala140Val, Ala222Val, Ala263Val, C677T, MTHFR: c.677C>T, MTHFR:667C>T, p.A222V
G > A
Not Available
No VIP available CA VA
rs1801394 -172-1823T>C, 1-1823T>C, 147A>G, 66A>G, 6757A>G, 7860973A>G, 7870973A>G, Ile22Met, Ile49Met, MTRR 66A>G, MTRR:66A>G
A > G
No VIP available CA VA
rs1805087 237048500A>G, 2756A>G, 30566279A>G, 94920A>G, Asp919Gly, MS 2756A>G, MS D919G, MTR:2756A>G, MTR:Asp919Gly
A > G
No VIP available No Clinical Annotations available VA
rs1891059 213946009G>A, 7463788G>A
G > A
Not Available
No VIP available CA VA
rs1901633 4750561A>G, 4810561A>G
A > G
Not Available
No VIP available No Clinical Annotations available VA
rs197388 -1065A>T, 112297482A>T, 12+841T>A, 82269400A>T
A > T
5' Flanking
No VIP available CA VA
rs1979277 1303C>T, 1420C>T, 17835470G>A, 18232096G>A, 39761C>T, Leu435Phe, Leu474Phe, SHMT1 L435F
G > A
No VIP available No Clinical Annotations available VA
rs2032582 186947T>A, 186947T>G, 2677A, 2677G, 2677T, 2677T>A, 2677T>G, 3095G>T/A, 87160618A>C, 87160618A>T, 87531302A>C, 87531302A>T, 893 Ala, 893 Ser, 893 Thr, ABCB1*7, ABCB1: 2677G>T/A, ABCB1: 2677T/A>G, ABCB1: A893S, ABCB1: G2677T/A, ABCB1: c.2677G>T/A, ABCB1:2677G>A/T, ABCB1:2677G>T/A, ABCB1:A893T, Ala893Ser/Thr, MDR1, MDR1 G2677T/A, Ser893Ala, Ser893Thr, mRNA 3095G>T/A, p.Ala893Ser/Thr
A > T
A > C
No VIP available CA No Variant Annotations available
rs2070744 -51-762C>T, -786, -813C>T, 11285702C>T, 150690079C>T, 6933C>T, NOS3 -786T>C, NOS3:, T>C, eNOS -786T>C
C > T
5' Flanking
No VIP available No Clinical Annotations available VA
rs2114358 129021179G>A, 36G>A, 42294728G>A, 971+19642G>A
G > A
No VIP available No Clinical Annotations available VA
rs2177735 1228-1627G>A, 216207875G>A, 36197G>A, 66417293G>A
G > A
No VIP available CA VA
rs2229109 1199G>A, 1199G>T, 167756G>A, 167756G>T, 25212652C>A, 25212652C>T, 87179809C>A, 87179809C>T, ABCB1: c.1199G>A, Ser400Asn, Ser400Ile, mRNA 1617G>A, p.Ser400Asn
C > T
C > A
No VIP available CA VA
rs2231135 -19-18828T>C, -476T>C, 13627715A>G, 5018T>C, 89079994A>G
A > G
No VIP available No Clinical Annotations available VA
rs2231137 13608835C>T, 23898G>A, 34G>A, 89061114C>T, ABCG2:V12M, Val12Met
C > T
No VIP available No Clinical Annotations available VA
rs2231142 13600044G>T, 32689C>A, 421C>A, 89052323G>T, ABCG2: Q141K, ABCG2:421C>A, ABCG2:Q141K, ABCG2:c.421C>A, Gln141Lys, rs2231142
G > T
No VIP available CA VA
rs2236225 1958G>A, 45908845G>A, 59087G>A, 64908845G>A, Arg653Gln, MTHFD1:1958G>A, MTHFD1:Arg653Gln, R653Q
G > A
No VIP available CA VA
rs2236624 1012-489A>G, 24836024T>C, 333-527T>C, 4226593T>C, 574+1936A>G, ADORA2A: g.4226593T>C
T > C
No VIP available CA VA
rs2238476 16153872G>A, 16213872G>A, 175439G>A, 3391-1960G>A
G > A
No VIP available CA VA
rs2267076 24830595T>C, 332+891T>C, 4221164T>C, 575-2193A>G, ADORA2A: g.4221164T>C
T > C
No VIP available No Clinical Annotations available VA
rs2273697 101563815G>A, 1249G>A, 1438G>A, 1440G>A, 26353G>A, 553G>A, 99804058G>A, ABCC2: c.1249G>A, ABCC2:1249G>A, ABCC2:V417I, ABCC2:c.1249G>A, Val185Ile, Val417Ile, p.V417I
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs2274407 8948711C>A, 8948711C>G, 8948711C>T, 912G>A, 912G>C, 912G>T, 95859035C>A, 95859035C>G, 95859035C>T, Lys304=, Lys304Asn
C > G
C > T
C > A
No VIP available No Clinical Annotations available VA
rs2274808 1702-148C>T, 2242-148C>T, 3901068C>T, 46906627C>T, 86531C>T
C > T
No VIP available No Clinical Annotations available VA
rs2274976 11850927C>T, 1781G>A, 20234G>A, 7855659C>T, Arg594Gln, G1793A, MTHFR:1793G>A, MTHFR:Arg594Gln
C > T
No VIP available No Clinical Annotations available VA
rs2278293 128040752C>T, 14285G>A, 250-159G>A, 309+134G>A, 324+119G>A, 471+119G>A, 480+119G>A, 549+119G>A, 579+119G>A, 66073595C>T, IMPDH1:IVS7+125G4A
C > T
No VIP available No Clinical Annotations available VA
rs2287584 31413007T>C, 31423007T>C, 3195A>G, 3306A>G, Pro1065=, Pro1102=
T > C
No VIP available No Clinical Annotations available VA
rs2289030 113G>C, 57371592G>C, 57G>C, 95228286G>C
G > C
Not Available
No VIP available CA VA
rs2298383 -275+1797C>T, 2235A>A, 24825511C>T, 4216080C>T, ADORA2A: g.4216080C>T
C > T
rs2306283 14089862A>G, 21329738A>G, 388A>G, 50611A>G, Asn130Asp, SLCO1B1*1B
A > G
No VIP available No Clinical Annotations available VA
rs2368393 29773998A>G, 29833998A>G, 29T>C, 827+5528T>C
A > G
No VIP available CA VA
rs2372536 18342C>G, 216190020C>G, 347C>G, 66399438C>G, ATIC: 347C>G, ATIC:347C>G, Thr116Ser, mRNA 521C>G
C > G
No VIP available No Clinical Annotations available VA
rs2413739 -78+13991G>A, 22787605C>T, 43397036C>T
C > T
No VIP available No Clinical Annotations available VA
rs2413775 -205T>A, 16334845T>A, 45544288T>A, SLC28A2: ¿146T>a
T > A
5' Flanking
No VIP available No Clinical Annotations available VA
rs244076 13449007T>C, 32462A>G, 43252915T>C, 534A>G, Val178=
T > C
No VIP available CA VA
rs246240 16059024A>G, 16119024A>G, 616-7942A>G, 80591A>G
A > G
No VIP available No Clinical Annotations available VA
rs2476601 114377568A>A, 114377568A>G, 1693C>C, 1693C>T, 1858C>C, 1858C>T, 41808C>C, 41808C>T, 84349486A>A, 84349486A>G, Arg565=, Arg620=
A > G
No VIP available CA VA
rs2650972 6723274T>C, 6783274T>C
T > C
Not Available
No VIP available No Clinical Annotations available VA
rs2682818 43472842A>C, 77T>G, 81329536A>C, 82+1884T>G
A > C
No VIP available No Clinical Annotations available VA
rs2740574 -392G>A, 4713G>A, 5'-flanking region -392A>G, 99382096C>T, 99784473C>T, CYP3A4*1B, CYP3A4-V, CYP3A4:-392A>G
C > T
5' Flanking
No VIP available CA VA
rs28364006 16168249A>G, 16228249A>G, 189816A>G, 4009A>G, Thr1337Ala
A > G
No VIP available No Clinical Annotations available VA
rs2838956 1173+707T>C, 1293+707T>C, 22362T>C, 3939465A>G, 46945024A>G
A > G
No VIP available CA VA
rs2853539 -1582T>C, 279+115A>G, 649829A>G, 659829A>G, 7226A>G
A > G
No VIP available No Clinical Annotations available VA
rs2910164 159912418C>G, 4723691C>G, 60C>G
C > G
Not Available
No VIP available No Clinical Annotations available VA
rs34115976 115577997C>G, 40125718C>G, 823-7154C>G, 83C>G
C > G
No VIP available No Clinical Annotations available VA
rs34324334 43475018C>T, 43535018C>T, 722G>A, Ser241Asn
C > T
rs34489327 *145-370delT, *145-370delTinsCTTTAA, *449delA, *449delAinsTTAAAG, *859delT, *859delTinsCTTTAA, 20843delA, 20843delAinsTTAAAG, 6-basepair 3'UTR repeat, 663446delA, 663446delAinsTTAAAG, 673446delA, 673446delAinsTTAAAG, TYMS:-TTAAAG, TYMS:1494del, TYMS:1494del TTAAAG, ttaaag
T > -
3' UTR
rs34743033 28-bp tandem repeats, CCGCGCCACTTGGCCTGCCTCCGTCCCG, TSER*2, TSER*3, TYMS: 28 bp tandem repeat, TYMS: 2R, TYMS: TSER *2/*3, TYMS:TSER 28-basepair 5'UTR enhancer region repeat
Not Available
No VIP available No Clinical Annotations available VA
rs34965641 13425C>T, 242+2832C>T, 30536735G>A, 79942376G>A
G > A
No VIP available CA VA
rs351855 1058-90G>A, 11323G>A, 1162G>A, 176520243G>A, 21331516G>A, FGFR4:Arg388, FGFR4:GLY388ARG, Gly388Arg
G > A
No VIP available CA VA
rs35592 103390T>C, 1219-176T>C, 16081823T>C, 16141823T>C
T > C
No VIP available No Clinical Annotations available VA
rs3737967 *3288C>T, 11847449G>A, 1475G>A, 23712C>T, 7852181G>A, Arg492His
G > A
No VIP available CA VA
rs3740065 101605693A>G, 4146+154A>G, 52410157A>G, 68231A>G
A > G
No VIP available No Clinical Annotations available VA
rs3740066 101604207C>T, 3972C>T, 52408671C>T, 66745C>T, ABCC2:3972C>T, I1324I, Ile1324=
C > T
No VIP available No Clinical Annotations available VA
rs3744741 2051G>A, 252606C>T, 649232C>T, Arg684Gln
G > T
G > C
No VIP available CA VA
rs3758149 -401C>T, 15816129G>A, 4883C>T, 63951728G>A, GGH: promoter -401C>T
G > A
5' Flanking
No VIP available CA VA
rs3761422 -274-2427T>C, 1398+208A>G, 24826672T>C, 4217241T>C, ADORA2A: g.4217241T>C
T > C
No VIP available CA VA
rs3763980 1333A>T, 1634A>T, 1773A>T, 22316662A>T, 60173356A>T, Thr445Ser
A > T
No VIP available CA VA
rs3768142 237028564G>T, 2405+1710G>T, 30546343G>T, 74984G>T
G > T
No VIP available No Clinical Annotations available VA
rs3784862 16050891G>A, 16110891G>A, 615+413G>A, 72458G>A
G > A
No VIP available CA VA
rs3784864 16065325G>A, 16125325G>A, 616-1641G>A, 86892G>A
G > A
No VIP available No Clinical Annotations available VA
rs3787186 -13-13209A>G, -14+5565A>G, 130+5565A>G, 20349436T>C, 50153344T>C, 71-12695A>G
T > C
No VIP available No Clinical Annotations available VA
rs3805500 2463+1366C>T, 2574+1366C>T, 31452977G>A, 31462977G>A
G > A
No VIP available No Clinical Annotations available VA
rs3821353 216197779G>T, 26101G>T, 66407197G>T, 815-294G>T
G > T
No VIP available CA VA
rs3824662 12542C>A, 779-1748C>A, 779-1751C>A, 8044208C>A, 8104208C>A
C > A
No VIP available CA VA
rs408626 -825A>G, 237+350T>C, 30545492T>C, 4668A>G, 5840T>C, 79951133T>C
T > C
5' Flanking
No VIP available No Clinical Annotations available VA
rs4148396 101591944T>C, 3258+56T>C, 52396408T>C, 54482T>C
T > C
No VIP available CA VA
rs4148416 14027575C>T, 3039C>T, 48753423C>T, Gly1013=
C > T
No VIP available CA VA
rs4148737 176413A>G, 2212-372A>G, 25203995T>C, 87171152T>C
T > C
VIP No Clinical Annotations available No Variant Annotations available
rs4149015 -910G>A, 14043446G>A, 21283322G>A, 4195G>A, SLCO1B1:11187G>A, SLCO1B1:G-11187A
G > A
5' Flanking
rs4149056 14091673T>C, 21331549T>C, 521T>C, 52422T>C, SLCO1B1*5, Val174Ala
T > C
No VIP available CA VA
rs4149081 14138145G>A, 1865+248G>A, 21378021G>A, 98894G>A, OATP1B1: intronic A/G
G > A
No VIP available CA VA
rs442767 -1188C>A, 237+713G>T, 30545855G>T, 4305C>A, 6203G>T, 79951496G>T
G > T
5' Flanking
No VIP available No Clinical Annotations available VA
rs4451422 *714A>C, 130576597A>C, 16444A>C, 45451T>G, 59741129A>C
A > C
3' Flanking
No VIP available CA VA
rs45445694 *34+169_*34+196CGGGACGGAGGCAGGCCAAGTGGCGCGG[2][3][4][7][8][9], -97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], 2, 28-bp tandem repeats located in the TS enhancer region of 5'UTR, 5043_5070CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], 657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], TYMS:*2
5' UTR
No VIP available No Clinical Annotations available VA
rs45589337 246890A>G, 68116644T>C, 775A>G, 98144726T>C, Lys259Glu
T > C
No VIP available CA VA
rs4673993 1503+675T>C, 216212339T>C, 40661T>C, 66421757T>C
T > C
No VIP available No Clinical Annotations available VA
rs4781712 16043232A>G, 16103232A>G, 226-401A>G, 64799A>G
A > G
No VIP available No Clinical Annotations available VA
rs4818789 1031+1857C>A, 1151+1857C>A, 18559C>A, 3943268G>T, 46948827G>T
G > T
No VIP available No Clinical Annotations available VA
rs4819128 1031+1035G>A, 1151+1035G>A, 17737G>A, 3944090C>T, 46949649C>T
C > T
No VIP available CA VA
rs4846051 11854457G>A, 1305C>T, 16704C>T, 7859189G>A, MTHFR:1317T>C, MTHFR:Phe435PHE, Phe435=
G > A
No VIP available No Clinical Annotations available VA
rs4867329 2931+245T>G, 3042+245T>G, 31425627A>C, 31435627A>C
A > C
No VIP available No Clinical Annotations available VA
rs4880 160113872A>G, 47C-T, 47T>C, 5482T>C, 64283329A>G, Ala16Val, SOD1:Val16Ala, SOD2: Val16Ala, T47C, V16A
A > G
No VIP available CA VA
rs4888024 33053573A>G, 79439374A>G
A > G
Not Available
No VIP available CA VA
rs4948496 14610081T>C, 149605T>C, 63805617T>C, 734-5030T>C
T > C
No VIP available CA VA
rs4982133 15526819A>C, 34526819A>C
A > C
Not Available
No VIP available CA VA
rs4986790 1020A>G, 120475302A>G, 1307A>G, 13843A>G, 296A>G, 49639834A>G, 776A>G, 896A>G, Asp259Gly, Asp299Gly, Asp99Gly, TLR4: D299G
A > G
No VIP available No Clinical Annotations available VA
rs56103835 101522556T>C, 1T>C, 82522556T>C
T > C
Not Available
No VIP available No Clinical Annotations available VA
rs5751876 1011+659A>G, 1083T>C, 24837301T>C, 4227870T>C, 574+659A>G, ADORA2A:1083T>C, ADORA2A:1976T>C, Tyr361=
T > C
No VIP available CA VA
rs5760410 153617G>A, 24815406G>A, 4205975G>A, ADORA2A: g.4205975G>A
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs595961 1264-25A>G, 36367780A>G, 6339698A>G
A > G
No VIP available CA VA
rs6064463 25676369T>C, 55480277T>C
T > C
Not Available
No VIP available No Clinical Annotations available VA
rs6123048 -13-7265T>C, 131-6751T>C, 20343492A>G, 50147400A>G, 71-6751T>C
A > G
No VIP available CA VA
rs61886492 1378C>T, 1423C>T, 48949C>T, 49126274G>A, 49186274G>A, 499C>T, His167Tyr, His460Tyr, His475Tyr
G > A
No VIP available CA VA
rs639174 2932-1862G>A, 3043-1862G>A, 31423647C>T, 31433647C>T
C > T
No VIP available No Clinical Annotations available VA
rs6497759 1774G>A, 24741737G>A, 24801737G>A, Ala592Thr
G > A
No VIP available No Clinical Annotations available VA
rs6505162 -49+302A>C, -5T>G, 20+302A>C, 28444183A>C, 3181177A>C, 87A>C
A > C
5' Flanking
No VIP available CA VA
rs6506569 2716-20509T>C, 2755-20509T>C, 8265857T>C, 8275857T>C
T > C
No VIP available CA VA
T > -
Not Available
No VIP available CA VA
rs6920220 138006504G>A, 42175961G>A
G > A
Not Available
No VIP available CA VA
rs70991108 -384_-383insTGGCGCGTCCCGCCCAGGT, 30544522_30544523insTGGCGCGTCCCGCCCAGGT, 4870_4871insTGGCGCGTCCCGCCCAGGT, 5637_5638insACCTGGGCGGGACGCGCCA, 79950163_79950164insTGGCGCGTCCCGCCCAGGT, 86+59_86+60insACCTGGGCGGGACGCGCCA, DHFR 19 bp deletion, DHFR 19-bp deletion, DHFR c.86 + 60_78, DHFR:19bp deletion, DHFR:19bp deletion in intron 1
No VIP available CA VA
rs7142143 12718A>G, 244-1628A>G, 32403531T>C, 345+923A>G, 51403531T>C
T > C
No VIP available CA VA
rs717620 -24C>T, 101542578C>T, 5116C>T, 52347042C>T, ABCC2: 5'UTR, ABCC2:(-24)C>T, mRNA 118C>T
C > T
5' UTR
No VIP available CA VA
rs719235 -354G>T, 15816082C>A, 4930G>T, 63951681C>A
C > A
5' Flanking
No VIP available No Clinical Annotations available VA
rs7270101 124+21A>C, 224+21A>C, 3133893A>C, 316+21A>C, 3193893A>C, 49-11A>C, 67-738A>C, 73+21A>C, 8838A>C
A > C
No VIP available No Clinical Annotations available VA
rs7279445 2683+2343C>T, 3223+2343C>T, 3914359C>T, 46919918C>T, 99822C>T
C > T
No VIP available CA VA
rs7317112 75-23516T>C, 9013199A>G, 95923523A>G
A > G
No VIP available No Clinical Annotations available VA
rs7387 *115A>T, 30519150T>A, 31010A>T, 79924791T>A
T > A
3' UTR
No VIP available No Clinical Annotations available VA
rs747199 -51-655G>C, -52+441G>C, -54-652G>C, -55+441G>C, 44134345G>C, 44194345G>C
G > C
No VIP available No Clinical Annotations available VA
rs7499 *16G>A, 112223G>A, 3926769G>A, 46932328G>A
G > A
3' UTR
No VIP available No Clinical Annotations available VA
rs7563206 18976C>T, 216190654C>T, 380-56C>T, 66400072C>T
C > T
No VIP available CA VA
rs7624766 160429869A>G, 66925015A>G
A > G
Not Available
No VIP available No Clinical Annotations available VA
rs79085477 25897307C>T, 55701215C>T
C > T
Not Available
No VIP available No Clinical Annotations available VA
rs7911488 -10+1414T>C, -143T>C, -9-1866T>C, 105154089A>G, 55958553A>G, 70T>C
A > G
No VIP available CA VA
rs7992226 101797840A>G, 14887516A>G, 1840-593T>C
A > G
No VIP available No Clinical Annotations available VA
rs80223967 213943679A>G, 7461458A>G
A > G
Not Available
No VIP available No Clinical Annotations available VA
rs8058040 16047712A>G, 16107712A>G, 352-636A>G, 69279A>G
A > G
No VIP available No Clinical Annotations available VA
rs8090560 1864+1339G>A, 1903+1339G>A, 25004019G>A, 487+1339G>A, 62384G>A, 77213155G>A
G > A
No VIP available No Clinical Annotations available VA
rs8187710 101611294G>A, 4544G>A, 52415758G>A, 73832G>A, ABCC2 rs8187710, Cys1515Tyr, MRP2 Cys1515Tyr
G > A
No VIP available No Clinical Annotations available VA
rs868755 157635A>C, 25222773T>G, 827+649A>C, 87189930T>G
T > G
No VIP available No Clinical Annotations available VA
rs868853 -1508G>A, 9044752C>T, 95955076C>T
C > T
5' Flanking
No VIP available CA VA
rs9344 *1365+4648C>T, 12038G>A, 14768705G>A, 69462910G>A, 723G>A, CCND1 (A870G), CCND1:870G>A, Pro241=, rs603965
G > A
No VIP available CA VA
rs9345389 1869-5735A>G, 32560438A>G, 94440604A>G
A > G
No VIP available CA VA
rs9516519 *1372A>C, 8762133T>G, 95672457T>G
T > G
3' UTR
No VIP available No Clinical Annotations available VA
rs9611280 19942688G>A, 40552119G>A, 46G>A, Val16Met
G > A
No VIP available CA VA
rs9895420 -260T>A, 13986190T>A, 48712038T>A
T > A
5' Flanking
No VIP available CA VA
rs9977268 1834-74C>T, 2374-74C>T, 3901728C>T, 46907287C>T, 87191C>T
C > T
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 147


Generic Names
  • Amethopterin
  • Amethopterine
  • L-Amethopterin
  • MTX
  • Methopterin
  • Methotextrate
  • Methotrexat
  • Methotrexate Sodium
  • Methylaminopterin
  • Methylaminopterinum
  • N-Bismethylpteroylglutamic Acid
Trade Names
  • Abitrexate
  • Antifolan
  • Arbitrexate
  • Emtexate
  • Folex
  • Ledertrexate
  • Metatrexan
  • Methotrate
  • Mexate
  • Rheumatrex
  • Trexall
Brand Mixture Names

PharmGKB Accession Id





An antineoplastic antimetabolite with immunosuppressant properties. It is an inhibitor of tetrahydrofolate dehydrogenase and prevents the formation of tetrahydrofolate, necessary for synthesis of thymidylate, an essential component of DNA.

Source: Drug Bank


For the treatment of gestational choriocarcinoma, chorioadenoma destruens and hydatidiform mole. Also for the treatment of severe psoriasis and severe, active, classical or definite rheumatoid arthritis.

Source: Drug Bank

Other Vocabularies

Information pulled from DrugBank has not been reviewed by PharmGKB.

Pharmacology, Interactions, and Contraindications

Mechanism of Action

Methotrexate anti-tumor activity is a result of the inhibition of folic acid reductase, leading to inhibition of DNA synthesis and inhibition of cellular replication. The mechanism involved in its activity against rheumatoid arthritis is not known.

Source: Drug Bank


Methotrexate is an antineoplastic anti-metabolite. Anti-metabolites masquerade as purine or pyrimidine - which become the building blocks of DNA. They prevent these substances becoming incorporated in to DNA during the "S" phase (of the cell cycle), stopping normal development and division. Methotrexate inhibits folic acid reductase which is responsible for the conversion of folic acid to tetrahydrofolic acid. At two stages in the biosynthesis of purines and at one stage in the synthesis of pyrimidines, one-carbon transfer reactions occur which require specific coenzymes synthesized in the cell from tetrahydrofolic acid. Tetrahydrofolic acid itself is synthesized in the cell from folic acid with the help of an enzyme, folic acid reductase. Methotrexate looks a lot like folic acid to the enzyme, so it binds to it quite strongly and inhibits the enzyme. Thus, DNA synthesis cannot proceed because the coenzymes needed for one-carbon transfer reactions are not produced from tetrahydrofolic acid because there is no tetrahydrofolic acid. Methotrexate selectively affects the most rapidly dividing cells (neoplastic and psoriatic cells). Methotrexate is also indicated in the management of severe, active, classical, or definite rheumatoid arthritis.

Source: Drug Bank

Food Interaction

Take without regard to meals. Limit caffeine intake.|Milk appears to reduce its absorption.

Source: Drug Bank

Absorption, Distribution, Metabolism, Elimination & Toxicity



Source: Drug Bank

Protein Binding

50%, primarily to albumin

Source: Drug Bank


Generally well absorbed with a mean bioavailability of about 60%.

Source: Drug Bank


Low doses: 3 to 10 hours; High doses: 8 to 15 hours.

Source: Drug Bank


Symptoms of overdose include bone marrow suppression and gastrointestinal toxicity. LD 50=43mg/kg(orally in rat).

Source: Drug Bank

Route of Elimination

With IV administration, 80% to 90% of the administered dose is excreted unchanged in the urine within 24 hours. There is limited biliary excretion amounting to 10% or less of the administered dose.

Source: Drug Bank

Volume of Distribution

  • 0.4 to 0.8 L/kg

Source: Drug Bank

Chemical Properties

Chemical Formula


Source: Drug Bank

Isomeric SMILES


Source: OpenEye

Canonical SMILES


Source: Drug Bank

Average Molecular Weight


Source: Drug Bank

Monoisotopic Molecular Weight


Source: Drug Bank



Source: Drug Bank

InChI String


Source: Drug Bank

PharmGKB Curated Pathways

Pathways created internally by PharmGKB based primarily on literature evidence.

  1. Antimetabolite Pathway - Folate Cycle, Pharmacodynamics
    Model non-tissue specific cancer cell displaying candidate genes which may be involved in the pharmacodynamics of antimetabolite drugs acting on the folate cycle.
  1. Ibuprofen Pathway, Pharmacokinetics
    Stylized diagram of metabolism and transport of ibuprofen in the liver and kidney.
  1. Methotrexate Pathway (Brain Cell), Pharmacokinetics
    Representation of transport and exchange of methotrexate in the brain.
  1. Methotrexate Pathway (Cancer Cell), Pharmacodynamics
    Methotrexate cellular disposition and effects.
  1. Methotrexate Pathway, Pharmacokinetics
    Diagramatic representation of uptake, transport and elimination of methotrexate.

External Pathways

Links to non-PharmGKB pathways.

PharmGKB contains no links to external pathways for this drug. To report a pathway, click here.

Genes that are associated with this drug in PharmGKB's database based on (1) variant annotations, (2) literature review, (3) pathways or (4) information automatically retrieved from DrugBank, depending on the "evidence" and "source" listed below.

Curated Information ?

No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available PW
No Dosing Guideline available No Drug Label available CA VA No VIP available PW
No Dosing Guideline available No Drug Label available CA VA No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available PW
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available