Chemical: Drug / Metabolite

Available Prescribing Info

Dosing Guidelines
  1. CPIC Guideline for mercaptopurine and TPMT
  2. DPWG Guideline for mercaptopurine and TPMT
last updated 05/10/2016

1. CPIC Guideline for mercaptopurine and TPMT


Start with reduced doses of mercaptopurine for patients with one nonfunctional TPMT allele, or drastically reduced doses for patients with malignancy and two nonfunctional alleles; adjust dose based on degree of myelosuppression and disease-specific guidelines. Consider alternative nonthiopurine immunosuppressant therapy for patients with nonmalignant conditions and two nonfunctional alleles.


May 2016 Update on PharmGKB

Several studies have reported that individuals who carry low-function alleles for NUDT15 are unable to tolerate usual doses of thiopurines. [Articles:25108385, 25624441, 26033531, 26076924, 26405151, 26503813, 26590936, 26735160, 26878724] These alleles are more common among those of Asian ancestry and Hispanic ethnicity than others. [Articles:25624441, 26878724] The dose tolerated by those with two low-function alleles is only ~ 10% that tolerated by those with no low-function NUDT15 or TPMT alleles. [Articles:25624441, 26878724] CPIC is planning a guideline to address NUDT15 variants and possible dosing recommendations for thiopurines.

April 2013 Update

Advance online publication January 2013

March 2011

Advance online publication January 2011.

  • Guidelines regarding the use of pharmacogenomic tests in dosing for azathioprine, thioguanine and mercaptopurine were published in Clinical Pharmacology and Therapeutics by the Clinical Pharmacogenetics Implementation Consortium (CPIC).
  • Excerpt from the 2011 thiopurine dosing guidelines:
    • "Thiopurines are most commonly used to treat nonmalignant conditions but are also critical anticancer agents. The approach to dosing adjustments based on TPMT status may differ depending on the clinical indication and the propensity to initiate therapy at higher vs. lower starting doses. We and others advocate testing for TPMT status prior to initiating thiopurine therapy, so that starting dosages can be adjusted accordingly."
  • Download and read:

Adapted from Tables 1 and 2 of the 2011 guideline manuscript.

Phenotype (Genotype)Examples of diplotypesImplications for mercaptopurine and azathioprine pharmacologic measuresDosing recommendations for mercaptopurineClassification of recommendations
Homozygous wild-type or normal, high activity (two functional *1 alleles)*1/*1Lower concentrations of TGN metabolites, higher methylTIMP, this is the "normal" patternStart with normal starting dose (e.g., 75 mg/m2/d or 1.5 mg/kg/d) and adjust doses of mercaptopurine (and of any other myelosuppressive therapy) without any special emphasis on mercaptopurine compared to other agents. Allow 2 weeks to reach steady state after each dose adjustment.Strong
Heterozygote or intermediate activity (one functional allele - *1, plus one nonfunctional allele - *2, *3A, *3B, *3C, or *4)*1/*2, *1/*3A, *1/*3B, *1/*3C, *1/*4Moderate to high concentrations of TGN metabolites; low concentrations of methylTIMPStart with reduced doses (start at 30-70% of full dose: e.g., at 50 mg/m2/d or 0.75 mg/kg/d) and adjust doses of MP based on degree of myelosuppression and disease-specific guidelines. Allow 2-4 weeks to reach steady state after each dose adjustment. In those who require a dosage reduction based on myelosuppression, the median dose may be ~40% lower (44 mg/m2) than that tolerated in wild-type patients (75 mg/m2). In setting of myelosuppression, and depending on other therapy, emphasis should be on reducing mercaptopurine over other agents.Strong
Homozygous variant, mutant, low, or deficient activity (two nonfunctional alleles - *2, *3A, *3B, *3C, or *4)*3A/*3A, *2/*3A, *3C/*3A, *3C/*4, *3C/*2, *3A/*4Extremely high concentrations of TGN metabolites; fatal toxicity possible without dose decrease; no methylTIMP metabolitesFor malignancy, start with drastically reduced doses (reduce daily dose by 10-fold and reduce frequency to thrice weekly instead of daily, e.g., 10 mg/m2/d given just 3 days/week) and adjust doses of MP based on degree of myelosuppression and disease-specific guidelines. Allow 4-6 weeks to reach steady state after each dose adjustment. In setting of myelosuppression, emphasis should be on reducing mercaptopurine over other agents. For nonmalignant conditions, consider alternative nonthiopurine immunosuppressant therapy.Strong

last updated 08/10/2011

2. DPWG Guideline for mercaptopurine and TPMT


Select an alternative drug or reduce the initial dose for intermediate or poor metabolizers.


The Royal Dutch Pharmacists Association - Pharmacogenetics Working Group has evaluated therapeutic dose recommendations for mercaptopurine based on TPMT genotype [Article:21412232]. They recommend selecting an alternative drug or reducing the initial dose for patients carrying inactive alleles.

Phenotype (Genotype)Therapeutic Dose RecommendationLevel of EvidenceClinical Relevance
IM (one inactive allele: *2, *3, *4-*18)Select alternative drug or reduce dose by 50%. Increase dose in response of hematologic monitoring and efficacy.Published controlled studies of good quality* relating to phenotyped and/or genotyped patients or healthy volunteers, and having relevant pharmacokinetic or clinical endpoints.Clinical effect (S): Failure of lifesaving therapy e.g. anticipated myelosuppression; prevention of breast cancer relapse; arrhythmia; neutropenia < 0.5x109/l; leucopenia < 1.0x109/l; thrombocytopenia < 25x109/l; life-threatening complications from diarrhea.
PM (two inactive alleles: *2, *3, *4-*18)Select alternative drug or reduce dose by 90%. Increase dose in response of hematologic monitoring and efficacy.Published controlled studies of good quality* relating to phenotyped and/or genotyped patients or healthy volunteers, and having relevant pharmacokinetic or clinical endpoints.Clinical effect (S): death; arrhythmia; unanticipated myelosuppression.
  • *See Methods or [Article:18253145] for definition of "good quality."
  • S: statistically significant difference.

Annotated Labels

  1. FDA Label for mercaptopurine and TPMT
  2. EMA Label for mercaptopurine and TPMT
  3. HCSC Label for mercaptopurine and TPMT

last updated 10/25/2013

1. FDA Label for mercaptopurine and TPMT

Genetic testing recommended


TPMT genotyping or phenotyping can identify patients who are homozygous deficient, which predisposes them to mercaptopurine toxicity, and generally require substantial dose reduction. It also can identify those who have low/intermediate TPMT activity, which makes them more likely to experience mercaptopurine toxicity than people with normal TPMT activity, and may require a dose reduction.

There's more of this label. Read more.

last updated 10/27/2013

2. EMA Label for mercaptopurine and TPMT

Actionable PGx


The EMA European Public Assessment Report (EPAR) for mercaptopurine (Xaluprine) contains information regarding its metabolism by TPMT, and that patients with reduced activity are at increased risk of severe toxicity and likely require a reduced dose. TPMT genotyping or phenotyping can be used to identify these patients, although this should not replace close monitoring of blood counts.

There's more of this label. Read more.

3. HCSC Label for mercaptopurine and TPMT

Actionable PGx


The product monograph for mercaptopurine (PURINETHOL) states that individuals who are TPMT deficient are at risk of developing life-threatening bone marrow suppression when receiving the drug, and that substantial dose reductions are usually required for these individuals.

There's more of this label. Read more.

Clinical Variants that meet the highest level of criteria, manually curated by PharmGKB, are shown below.

To see more Clinical Variants with lower levels of criteria, click the button at the bottom of the page.

Clinical Annotation for TPMT*1, TPMT*10, TPMT*13, TPMT*15, TPMT*19, TPMT*1A, TPMT*24, TPMT*25, TPMT*26, TPMT*27, TPMT*28, TPMT*30, TPMT*31, TPMT*32, TPMT*33, TPMT*34, TPMT*37, TPMT*3D, TPMT*5, mercaptopurine and thioguanine (level 4 Dosage, Toxicity/ADR)

Level of Evidence
Level 4
Dosage, Toxicity/ADR
*1, *10, *13, *15, *19, *1A, *24, *25, *26, *27, *28, *30, *31, *32, *33, *34, *37, *3D, *5
OMB Race
Mixed Population
Race Notes
Various races as well as in vitro studies

To see the rest of this clinical annotation please register or sign in.

Disclaimer: The PharmGKB's clinical annotations reflect expert consensus based on clinical evidence and peer-reviewed literature available at the time they are written and are intended only to assist clinicians in decision-making and to identify questions for further research. New evidence may have emerged since the time an annotation was submitted to the PharmGKB. The annotations are limited in scope and are not applicable to interventions or diseases that are not specifically identified.

The annotations do not account for individual variations among patients, and cannot be considered inclusive of all proper methods of care or exclusive of other treatments. It remains the responsibility of the health-care provider to determine the best course of treatment for a patient. Adherence to any guideline is voluntary, with the ultimate determination regarding its application to be made solely by the clinician and the patient. PharmGKB assumes no responsibility for any injury or damage to persons or property arising out of or related to any use of the PharmGKB clinical annotations, or for any errors or omissions.

? = Mouse-over for quick help

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Links in the "Gene" column lead to PharmGKB Gene Pages.

List of all variant annotations for mercaptopurine

Gene ? Variant?
Alternate Names ? Chemicals ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
No VIP available CA VA HLA-DQA1 *02:01 N/A N/A N/A
No VIP available CA VA HLA-DRB1 *07:01:01:01 N/A N/A N/A
No VIP available No VIP available VA NUDT15 *1 N/A N/A N/A
No VIP available No VIP available VA NUDT15 *2 N/A N/A N/A
No VIP available No VIP available VA NUDT15 *3 N/A N/A N/A
No VIP available No VIP available VA NUDT15 *4 N/A N/A N/A
No VIP available No VIP available VA NUDT15 *5 N/A N/A N/A
No VIP available No VIP available VA NUDT15 *6 N/A N/A N/A
No VIP available CA VA TPMT *1 N/A N/A N/A
No VIP available CA VA TPMT *1A N/A N/A N/A
No VIP available CA VA TPMT *1S N/A N/A N/A
No VIP available CA VA TPMT *2 N/A N/A N/A
No VIP available CA VA TPMT *3A N/A N/A N/A
No VIP available CA VA TPMT *3B N/A N/A N/A
No VIP available CA VA TPMT *3C N/A N/A N/A
No VIP available CA VA TPMT *3D N/A N/A N/A
No VIP available CA VA TPMT *4 N/A N/A N/A
No VIP available CA VA TPMT *5 N/A N/A N/A
No VIP available CA VA TPMT *6 N/A N/A N/A
No VIP available CA VA TPMT *7 N/A N/A N/A
No VIP available CA VA TPMT *8 N/A N/A N/A
No VIP available CA VA TPMT *9 N/A N/A N/A
No VIP available CA VA TPMT *10 N/A N/A N/A
No VIP available CA VA TPMT *11 N/A N/A N/A
No VIP available CA VA TPMT *12 N/A N/A N/A
No VIP available CA VA TPMT *13 N/A N/A N/A
No VIP available CA VA TPMT *14 N/A N/A N/A
No VIP available CA VA TPMT *15 N/A N/A N/A
No VIP available CA No VIP available TPMT *16 N/A N/A N/A
No VIP available CA No VIP available TPMT *17 N/A N/A N/A
No VIP available CA VA TPMT *18 N/A N/A N/A
No VIP available CA No VIP available TPMT *19 N/A N/A N/A
No VIP available CA No VIP available TPMT *20 N/A N/A N/A
No VIP available CA VA TPMT *21 N/A N/A N/A
No VIP available CA VA TPMT *22 N/A N/A N/A
No VIP available CA VA TPMT *23 N/A N/A N/A
No VIP available CA VA TPMT *24 N/A N/A N/A
No VIP available CA VA TPMT *25 N/A N/A N/A
No VIP available CA VA TPMT *26 N/A N/A N/A
No VIP available CA No VIP available TPMT *27 N/A N/A N/A
No VIP available CA No VIP available TPMT *28 N/A N/A N/A
No VIP available CA No VIP available TPMT *30 N/A N/A N/A
No VIP available CA VA TPMT *31 N/A N/A N/A
No VIP available CA VA TPMT *32 N/A N/A N/A
No VIP available CA VA TPMT *33 N/A N/A N/A
No VIP available CA VA TPMT *34 N/A N/A N/A
No VIP available CA VA TPMT *37 N/A N/A N/A
No VIP available No Clinical Annotations available VA
rs10035440 NC_000005.10:g.31539356T>C, NC_000005.9:g.31539463T>C, NM_018356.2:c.807+667T>C, NR_134298.1:n.710+667T>C, XM_005248319.1:c.12+667T>C, XM_005248319.2:c.12+667T>C, XM_006714479.1:c.555+667T>C, XM_006714480.2:c.12+667T>C, XM_011514062.1:c.900+667T>C, XR_241704.1:n.934+667T>C, rs13155198, rs56434987, rs58924525, rs59453111
T > C
No VIP available No Clinical Annotations available VA
rs10061133 NC_000005.10:g.55170716A>G, NC_000005.9:g.54466544A>G, NM_001145734.2:c.126+1872T>C, NM_001170402.1:c.126+1872T>C, NM_152623.2:c.126+1872T>C, NR_029960.1:n.-94T>C, NR_030387.1:n.27T>C, XM_005248450.1:c.126+1872T>C, XM_011543218.1:c.126+1872T>C
A > C
A > T
No VIP available No Clinical Annotations available VA
rs10505168 NC_000008.10:g.113655752T>C, NC_000008.11:g.112643523T>C, NM_052900.2:c.2998+1586A>G, NM_198123.1:c.3310+1586A>G, NM_198124.1:c.3190+1586A>G, NR_031745.1:n.31T>C, XM_005250771.1:c.3190+1586A>G, XM_011516808.1:c.3112+1586A>G, XM_011516809.1:c.2872+1586A>G, XM_011516810.1:c.2800+1586A>G, XM_011516811.1:c.1414+1586A>G, XM_011516812.1:c.3190+1586A>G, XM_011516813.1:c.586+1586A>G, XM_011516814.1:c.3190+1586A>G, XM_011516816.1:c.2998+1586A>G, rs60368931
T > A
T > G
No VIP available No Clinical Annotations available VA
rs1051266 NC_000021.8:g.46957794T>C, NC_000021.9:g.45537880T>C, NG_028278.1:g.9592A>G, NM_001205206.1:c.80A>G, NM_194255.2:c.80A>G, NP_001192135.1:p.His27Arg, NP_919231.1:p.His27Arg, XM_005261163.1:c.80A>G, XM_005261164.1:c.-279A>G, XM_005261164.2:c.-279A>G, XM_011529696.1:c.371A>G, XM_011529697.1:c.371A>G, XM_011529698.1:c.146A>G, XM_011529699.1:c.-1639A>G, XM_011529700.1:c.80A>G, XM_011529701.1:c.80A>G, XM_011529702.1:c.80A>G, XM_011529703.1:c.80A>G, XM_011529704.1:c.80A>G, XM_011529705.1:c.371A>G, XM_011529707.1:c.371A>G, XM_011529708.1:c.80A>G, XM_011529709.1:c.-279A>G, XM_011529710.1:c.-165-5732A>G, XP_005261220.1:p.His27Arg, XP_011527998.1:p.His124Arg, XP_011527999.1:p.His124Arg, XP_011528000.1:p.His49Arg, XP_011528002.1:p.His27Arg, XP_011528003.1:p.His27Arg, XP_011528004.1:p.His27Arg, XP_011528005.1:p.His27Arg, XP_011528006.1:p.His27Arg, XP_011528007.1:p.His124Arg, XP_011528009.1:p.His124Arg, XP_011528010.1:p.His27Arg, rs17844977, rs17857726, rs3171496, rs386514057, rs61510559
T > C
No VIP available No Clinical Annotations available VA
rs10868138 NC_000009.11:g.86917301T>C, NC_000009.12:g.84302386T>C, NM_001199633.1:c.338A>G, NM_022127.2:c.338A>G, NP_001186562.1:p.Tyr113Cys, NP_071410.1:p.Tyr113Cys, NR_037638.2:n.660A>G, XM_011518905.1:c.422A>G, XM_011518906.1:c.422A>G, XM_011518907.1:c.89A>G, XM_011518909.1:c.422A>G, XM_011518910.1:c.422A>G, XP_011517207.1:p.Tyr141Cys, XP_011517208.1:p.Tyr141Cys, XP_011517209.1:p.Tyr30Cys, XP_011517211.1:p.Tyr141Cys, XP_011517212.1:p.Tyr141Cys, XR_929832.1:n.549A>G, rs52792697, rs56686947
T > -
T > C
No VIP available CA VA
C > T
No VIP available No Clinical Annotations available VA
rs11045879 NC_000012.11:g.21382619T>C, NC_000012.12:g.21229685T>C, NG_011745.1:g.103492T>C, NM_006446.4:c.1865+4846T>C, rs60471795
T > C
No VIP available CA VA
rs1127354 NC_000020.10:g.3193842C>A, NC_000020.11:g.3213196C>A, NG_012093.1:g.8787C>A, NM_001267623.1:c.67-789C>A, NM_033453.3:c.94C>A, NM_181493.2:c.43C>A, NP_258412.1:p.Pro32Thr, NP_852470.1:p.Pro15Thr, NR_052000.1:n.194C>A, NR_052001.1:n.49-62C>A, NR_052002.1:n.286C>A, XM_006723564.2:c.94C>A, XM_006723565.2:c.67-789C>A, XM_011529234.1:c.94C>A, XM_011529235.1:c.94C>A, XP_006723627.1:p.Pro32Thr, XP_011527536.1:p.Pro32Thr, XP_011527537.1:p.Pro32Thr, rs111069069, rs11565932, rs117814751, rs16988347, rs3177087, rs3183216, rs41320251, rs52834049
C > A
rs1142345 NC_000006.11:g.18130918T>C, NC_000006.12:g.18130687T>C, NG_012137.2:g.29457A>G, NM_000367.3:c.719A>G, NP_000358.1:p.Tyr240Cys, XM_011514839.1:c.674A>G, XM_011514840.1:c.650A>G, XP_011513141.1:p.Tyr225Cys, XP_011513142.1:p.Tyr217Cys, rs16880254, rs1801205, rs29001646, rs52798150, rs61510596
T > C
No VIP available CA VA
rs116855232 NC_000013.10:g.48619855C>T, NC_000013.11:g.48045719C>T, NM_018283.2:c.415C>T, NP_060753.1:p.Arg139Cys
C > T
No VIP available No Clinical Annotations available VA
rs11866002 NC_000016.10:g.58553833C>T, NC_000016.9:g.58587737C>T, NM_001265612.1:c.2904G>A, NM_016284.4:c.2919G>A, NM_206999.2:c.2919G>A, NP_001252541.1:p.Gln968=, NP_057368.3:p.Gln973=, NP_996882.1:p.Gln973=, NR_049763.1:n.3237G>A, XM_005255845.1:c.2919G>A, XM_005255846.1:c.2919G>A, XM_005255847.1:c.2916G>A, XM_005255848.1:c.2904G>A, XM_005255849.1:c.2916G>A, XM_005255850.1:c.2919G>A, XM_005255851.1:c.2919G>A, XP_005255902.1:p.Gln973=, XP_005255903.1:p.Gln973=, XP_005255904.1:p.Gln972=, XP_005255905.1:p.Gln968=, XP_005255906.1:p.Gln972=, XP_005255907.1:p.Gln973=, XP_005255908.1:p.Gln973=, XR_243400.1:n.3197G>A, rs59053850
C > -
C > T
No VIP available CA VA
rs12201199 NC_000006.11:g.18139802A>T, NC_000006.12:g.18139571A>T, NG_012137.2:g.20573T>A, NM_000367.3:c.419+94T>A, XM_011514839.1:c.419+94T>A, XM_011514840.1:c.350+94T>A, rs58109747
A > T
No VIP available No Clinical Annotations available VA
rs12529220 NC_000006.11:g.18148247T>A, NC_000006.12:g.18148016T>A, NG_012137.2:g.12128A>T, NM_000367.3:c.141-101A>T, XM_011514839.1:c.141-101A>T, XM_011514840.1:c.72-101A>T
T > A
No VIP available No Clinical Annotations available VA
rs12894467 NC_000014.8:g.101507727C>T, NC_000014.9:g.101041390C>T, NR_030582.1:n.28C>T, NR_031575.1:n.-1587C>T, rs60410947
C > T
No VIP available No Clinical Annotations available VA
rs1695 NC_000011.10:g.67585218A>G, NC_000011.9:g.67352689A>G, NG_012075.1:g.6624A>G, NM_000852.3:c.313A>G, NP_000843.1:p.Ile105Val, XM_005273958.1:c.313A>G, XP_005274015.1:p.Ile105Val, rs1138257, rs11553891, rs17353321, rs17856342, rs2230827, rs4609, rs56971933, rs947894
A > G
No VIP available No Clinical Annotations available VA
T > C
No VIP available No Clinical Annotations available VA
rs17087144 NC_000009.11:g.86964718T>A, NC_000009.12:g.84349803T>A, NM_022127.2:c.-45-9125A>T, XM_011518906.1:c.-45-9125A>T, XM_011518907.1:c.-98+18649A>T, rs57817760, rs60939937
T > A
No VIP available No Clinical Annotations available VA
rs17268122 NC_000013.10:g.95844494G>T, NC_000013.11:g.95192240G>T, NM_001105515.2:c.1263+2596C>A, NM_001301829.1:c.1263+2596C>A, NM_001301830.1:c.1038+2596C>A, NM_005845.4:c.1263+2596C>A, XM_005254025.1:c.1134+2596C>A, XM_005254025.2:c.1134+2596C>A, XM_005254026.1:c.1263+2596C>A, XM_005254027.1:c.1038+2596C>A, XM_005254028.1:c.1038+2596C>A, XM_006719914.1:c.1263+2596C>A, XM_011521047.1:c.714+2596C>A
G > T
No VIP available No Clinical Annotations available VA
rs17428030 NC_000009.11:g.86953621A>G, NC_000009.12:g.84338706A>G, NM_001199633.1:c.60+1868T>C, NM_022127.2:c.60+1868T>C, NR_037638.2:n.206+1868T>C, XM_011518905.1:c.60+1868T>C, XM_011518906.1:c.60+1868T>C, XM_011518907.1:c.-97-25252T>C, XM_011518909.1:c.60+1868T>C, XM_011518910.1:c.60+1868T>C, XR_929832.1:n.187+1868T>C, rs61131364
A > G
No VIP available CA VA
rs17839843 NC_000006.11:g.18143854G>A, NC_000006.12:g.18143623G>A, NG_012137.2:g.16521C>T, NM_000367.3:c.339C>T, NP_000358.1:p.Thr113=, XM_011514839.1:c.339C>T, XM_011514840.1:c.270C>T, XP_011513141.1:p.Thr113=, XP_011513142.1:p.Thr90=, rs61457799
G > A
rs1800460 NC_000006.11:g.18139228C>T, NC_000006.12:g.18138997C>T, NG_012137.2:g.21147G>A, NM_000367.3:c.460G>A, NP_000358.1:p.Ala154Thr, XM_011514839.1:c.460G>A, XM_011514840.1:c.391G>A, XP_011513141.1:p.Ala154Thr, XP_011513142.1:p.Ala131Thr, rs11568060, rs16880273, rs386545583, rs57650974
C > T
VIP No Clinical Annotations available No Variant Annotations available
rs1800462 NC_000006.11:g.18143955C>G, NC_000006.12:g.18143724C>G, NG_012137.2:g.16420G>C, NM_000367.3:c.238G>C, NP_000358.1:p.Ala80Pro, XM_011514839.1:c.238G>C, XM_011514840.1:c.169G>C, XP_011513141.1:p.Ala80Pro, XP_011513142.1:p.Ala57Pro
C > G
VIP No Clinical Annotations available No Variant Annotations available
rs1800584 NC_000006.11:g.18131012C>T, NC_000006.12:g.18130781C>T, NG_012137.2:g.29363G>A, NM_000367.3:c.626-1G>A, XM_011514839.1:c.581-1G>A, XM_011514840.1:c.557-1G>A, rs386545588
C > T
No VIP available No Clinical Annotations available VA
rs1801131 NC_000001.10:g.11854476T>G, NC_000001.11:g.11794419T>G, NG_013351.1:g.16685A>C, NM_005957.4:c.1286A>C, NP_005948.3:p.Glu429Ala, XM_005263458.1:c.1409A>C, XM_005263458.2:c.1409A>C, XM_005263459.1:c.1355A>C, XM_005263460.1:c.1286A>C, XM_005263460.3:c.1286A>C, XM_005263461.1:c.1286A>C, XM_005263461.3:c.1286A>C, XM_005263462.1:c.1286A>C, XM_005263462.3:c.1286A>C, XM_005263463.1:c.1040A>C, XM_005263463.2:c.1040A>C, XM_011541495.1:c.1406A>C, XM_011541496.1:c.1409A>C, XP_005263515.1:p.Glu470Ala, XP_005263516.1:p.Glu452Ala, XP_005263517.1:p.Glu429Ala, XP_005263518.1:p.Glu429Ala, XP_005263519.1:p.Glu429Ala, XP_005263520.1:p.Glu347Ala, XP_011539797.1:p.Glu469Ala, XP_011539798.1:p.Glu470Ala, rs17367365, rs17857426, rs4134712
T > G
No VIP available CA VA
rs1801133 NC_000001.10:g.11856378G>A, NC_000001.11:g.11796321G>A, NG_013351.1:g.14783C>T, NM_005957.4:c.665C>T, NP_005948.3:p.Ala222Val, XM_005263458.1:c.788C>T, XM_005263458.2:c.788C>T, XM_005263459.1:c.734C>T, XM_005263460.1:c.665C>T, XM_005263460.3:c.665C>T, XM_005263461.1:c.665C>T, XM_005263461.3:c.665C>T, XM_005263462.1:c.665C>T, XM_005263462.3:c.665C>T, XM_005263463.1:c.419C>T, XM_005263463.2:c.419C>T, XM_011541495.1:c.785C>T, XM_011541496.1:c.788C>T, XP_005263515.1:p.Ala263Val, XP_005263516.1:p.Ala245Val, XP_005263517.1:p.Ala222Val, XP_005263518.1:p.Ala222Val, XP_005263519.1:p.Ala222Val, XP_005263520.1:p.Ala140Val, XP_011539797.1:p.Ala262Val, XP_011539798.1:p.Ala263Val, rs386545618, rs4134713, rs59514310
G > A
No VIP available No Clinical Annotations available VA
rs1805087 NC_000001.10:g.237048500A>G, NC_000001.11:g.236885200A>G, NG_008959.1:g.94920A>G, NM_000254.2:c.2756A>G, NM_001291939.1:c.2603A>G, NM_001291940.1:c.1535A>G, NP_000245.2:p.Asp919Gly, NP_001278868.1:p.Asp868Gly, NP_001278869.1:p.Asp512Gly, XM_005273140.1:c.2924A>G, XM_005273141.1:c.2753A>G, XM_005273141.3:c.2753A>G, XM_005273142.1:c.2666A>G, XM_005273143.1:c.2603A>G, XM_005273144.1:c.2318A>G, XM_005273145.1:c.1118A>G, XM_006711769.2:c.2756A>G, XM_006711770.1:c.1820A>G, XM_011544193.1:c.2567A>G, XM_011544194.1:c.2924A>G, XP_005273197.1:p.Asp975Gly, XP_005273198.1:p.Asp918Gly, XP_005273199.1:p.Asp889Gly, XP_005273200.1:p.Asp868Gly, XP_005273201.1:p.Asp773Gly, XP_005273202.1:p.Asp373Gly, XP_006711832.1:p.Asp919Gly, XP_006711833.1:p.Asp607Gly, XP_011542495.1:p.Asp856Gly, XP_011542496.1:p.Asp975Gly, rs17658739, rs56618494, rs61036243
A > G
No VIP available No Clinical Annotations available VA
rs197388 NC_000001.10:g.112297482A>T, NC_000001.11:g.111754860A>T, NM_007204.4:c.-1065A>T, NM_198926.2:c.12+841T>A, NR_125963.1:n.222+428T>A, XR_246395.1:n.249+428T>A, XR_246396.1:n.-1300T>A, rs59798432
A > T
No VIP available No Clinical Annotations available VA
rs1979277 NC_000017.10:g.18232096G>A, NC_000017.11:g.18328782G>A, NG_017111.1:g.39761C>T, NM_001281786.1:c.1006C>T, NM_004169.4:c.1420C>T, NM_148918.2:c.1303C>T, NP_001268715.1:p.Leu336Phe, NP_004160.3:p.Leu474Phe, NP_683718.1:p.Leu435Phe, XM_005256767.1:c.1420C>T, XM_005256767.2:c.1420C>T, XM_005256768.1:c.1006C>T, XM_011523992.1:c.1180C>T, XP_005256824.1:p.Leu474Phe, XP_005256825.1:p.Leu336Phe, XP_011522294.1:p.Leu394Phe, rs17850285, rs2230025, rs3183766, rs57933897
G > A
No VIP available No Clinical Annotations available VA
rs2114358 NC_000008.10:g.129021179G>A, NC_000008.11:g.128008933G>A, NR_003367.3:n.1212+19642G>A, NR_031611.1:n.36G>A, rs13269734, rs61088727
G > C
G > T
No VIP available No Clinical Annotations available VA
rs2274407 NC_000013.10:g.95859035C>A, NC_000013.11:g.95206781C>A, NM_001105515.2:c.912G>T, NM_001301829.1:c.912G>T, NM_001301830.1:c.687G>T, NM_005845.4:c.912G>T, NP_001098985.1:p.Lys304Asn, NP_001288758.1:p.Lys304Asn, NP_001288759.1:p.Lys229Asn, NP_005836.2:p.Lys304Asn, XM_005254025.1:c.783G>T, XM_005254025.2:c.783G>T, XM_005254026.1:c.912G>T, XM_005254027.1:c.687G>T, XM_005254028.1:c.687G>T, XM_006719914.1:c.912G>T, XM_011521047.1:c.363G>T, XP_005254082.1:p.Lys261Asn, XP_005254083.1:p.Lys304Asn, XP_005254084.1:p.Lys229Asn, XP_005254085.1:p.Lys229Asn, XP_006719977.1:p.Lys304Asn, XP_011519349.1:p.Lys121Asn, rs117944872, rs52813831, rs58221897
C > A
No VIP available No Clinical Annotations available VA
rs2278293 NC_000007.13:g.128040752C>T, NC_000007.14:g.128400698C>T, NG_009194.1:g.14285G>A, NM_000883.3:c.579+119G>A, NM_001102605.1:c.549+119G>A, NM_001142573.1:c.324+119G>A, NM_001142574.1:c.309+134G>A, NM_001142575.1:c.250-159G>A, NM_001142576.1:c.480+119G>A, NM_001304521.1:c.372+119G>A, NM_183243.2:c.471+119G>A, XM_005250313.1:c.372+119G>A, XM_005250314.1:c.348+119G>A, XM_005250315.1:c.324+119G>A, XM_005250316.1:c.-62+119G>A, XM_006715967.1:c.579+119G>A, XM_006715968.1:c.549+119G>A, XM_006715969.1:c.471+119G>A, XM_006715970.2:c.372+119G>A, XM_006715971.1:c.348+119G>A, XM_011516156.1:c.-220G>A, XM_011516157.1:c.-220G>A, rs10348032, rs60861084
C > T
No VIP available No Clinical Annotations available VA
rs2287584 NC_000005.10:g.31422900T>C, NC_000005.9:g.31423007T>C, NM_001100412.1:c.3195A>G, NM_013235.4:c.3306A>G, NP_001093882.1:p.Pro1065=, NP_037367.3:p.Pro1102=, XM_005248291.1:c.3306A>G, XM_005248291.2:c.3306A>G, XM_005248292.1:c.3282A>G, XM_005248292.2:c.3282A>G, XM_005248293.1:c.3213A>G, XM_005248293.2:c.3213A>G, XM_005248294.1:c.3102A>G, XM_005248294.2:c.3102A>G, XM_011514033.1:c.3306A>G, XP_005248348.1:p.Pro1102=, XP_005248349.1:p.Pro1094=, XP_005248350.1:p.Pro1071=, XP_005248351.1:p.Pro1034=, XP_011512335.1:p.Pro1102=, rs57044049
T > C
No VIP available No Clinical Annotations available VA
rs2289030 NC_000012.11:g.95228286G>C, NC_000012.12:g.94834510G>C, NR_030171.1:n.113G>C, NR_036685.1:n.57G>C, rs59816854
G > C
No VIP available No Clinical Annotations available VA
rs2368393 NC_000010.10:g.29833998A>G, NC_000010.11:g.29545069A>G, NG_033998.1:g.195733T>C, NM_003174.3:c.827+5528T>C, NM_021738.2:c.827+5528T>C, NR_030335.1:n.29T>C, XM_005252564.1:c.1061+5528T>C, XM_005252565.1:c.1061+5528T>C, XM_005252566.1:c.1061+5528T>C, XM_005252567.1:c.1061+5528T>C, XM_005252568.1:c.1061+5528T>C, XM_005252569.1:c.1061+5528T>C, XM_005252570.1:c.827+5528T>C, XM_005252570.2:c.827+5528T>C, XM_005252571.1:c.827+5528T>C, XM_005252571.2:c.827+5528T>C, XM_005252572.1:c.827+5528T>C, XM_005252573.1:c.827+5528T>C, XM_005252573.2:c.827+5528T>C, XM_011519630.1:c.827+5528T>C, XM_011519631.1:c.827+5528T>C, XM_011519632.1:c.827+5528T>C, XM_011519633.1:c.827+5528T>C, XM_011519634.1:c.827+5528T>C, XM_011519635.1:c.827+5528T>C, XM_011519636.1:c.827+5528T>C, XM_011519637.1:c.827+5528T>C, XM_011519638.1:c.827+5528T>C, XM_011519639.1:c.827+5528T>C, XM_011519640.1:c.827+5528T>C
A > G
No VIP available CA VA
rs2413739 NC_000022.10:g.43397036C>T, NC_000022.11:g.43001030C>T, NM_001184970.1:c.-78+13991G>A, XM_005261319.1:c.-78+13991G>A, XM_005261319.3:c.-78+13991G>A, XM_011529846.1:c.-78+13991G>A, XM_011529852.1:c.-64+13991G>A, XM_011529853.1:c.-78+13991G>A
C > T
No VIP available No Clinical Annotations available VA
rs2413775 NC_000015.10:g.45252090T>A, NC_000015.9:g.45544288T>A, NM_004212.3:c.-205T>A, NR_120335.1:n.181-18A>T, XM_011522198.1:c.-230T>A, XM_011522199.1:c.-205T>A, XM_011522200.1:c.-205T>A, XM_011522201.1:c.-205T>A, XR_243147.1:n.271-18A>T, rs3759897, rs59171024
T > A
No VIP available No Clinical Annotations available VA
rs2518463 NC_000006.11:g.18143769A>G, NC_000006.12:g.18143538A>G, NG_012137.2:g.16606T>C, NM_000367.3:c.366+58T>C, XM_011514839.1:c.366+58T>C, XM_011514840.1:c.297+58T>C, rs386568705, rs56804132
A > G
No VIP available CA VA
rs2647087 NC_000006.11:g.32681049A=, NC_000006.11:g.32681049A>C, NC_000006.12:g.32713272A=, NC_000006.12:g.32713272A>C, NT_113891.2:g.4126664A=, NT_113891.2:g.4126664A>C, NT_113891.3:g.4126558A=, NT_113891.3:g.4126558A>C, NT_167245.1:g.3962959C=, NT_167245.1:g.3962959C>A, NT_167245.2:g.3957374C=, NT_167245.2:g.3957374C>A, NT_167246.1:g.4138195C=, NT_167246.1:g.4138195C>A, NT_167246.2:g.4132575C=, NT_167246.2:g.4132575C>A, NT_167247.1:g.4017591A=, NT_167247.1:g.4017591A>C, NT_167247.2:g.4012006A=, NT_167247.2:g.4012006A>C, NT_167248.1:g.3913118A=, NT_167248.1:g.3913118A>C, NT_167248.2:g.3907522A=, NT_167248.2:g.3907522A>C, NT_167249.1:g.4112694A=, NT_167249.1:g.4112694A>C, NT_167249.2:g.4113396A=, NT_167249.2:g.4113396A>C, rs112058546, rs116333078, rs118168432, rs17219323, rs7745306
A > C
No VIP available No Clinical Annotations available VA
rs2682818 NC_000012.11:g.81329536A>C, NC_000012.12:g.80935757A>C, NM_004664.2:c.82+1884T>G, NR_030349.1:n.77T>G, XM_005269212.1:c.82+1884T>G, XM_011538928.1:c.82+1884T>G, XM_011539062.1:c.-779A>C
A > G
A > T
No VIP available No Clinical Annotations available VA
C > T
No VIP available No Clinical Annotations available VA
rs2842934 NC_000006.11:g.18139214G>A, NC_000006.12:g.18138983G>A, NG_012137.2:g.21161T=, NG_012137.2:g.21161T>C, NM_000367.3:c.474T=, NM_000367.3:c.474T>C, NP_000358.1:p.Ile158=, XM_011514839.1:c.474C>T, XM_011514840.1:c.405C>T, XP_011513141.1:p.Ile158=, XP_011513142.1:p.Ile135=, rs17850525, rs41332952, rs56622291, rs57191363, rs59455534, rs74291799
G > A
No VIP available No Clinical Annotations available VA
rs2842949 NC_000006.11:g.18134021C>A, NC_000006.12:g.18133790C>A, NG_012137.2:g.26354G>T, NM_000367.3:c.580+14G>T, XM_011514839.1:c.580+14G>T, XM_011514840.1:c.511+14G>T, rs45475992
C > A
No VIP available No Clinical Annotations available VA
rs2910164 NC_000005.10:g.160485411C>G, NC_000005.9:g.159912418C>G, NR_029701.1:n.60C>G, NR_132748.1:n.303C>G, rs56537094, rs57852408, rs61270459
C > G
No VIP available No Clinical Annotations available VA
rs34115976 NC_000004.11:g.115577997C>G, NC_000004.12:g.114656841C>G, NM_001128174.1:c.823-7154C>G, NM_003360.3:c.823-7154C>G, NR_030303.1:n.83C>G, XM_006714302.2:c.823-7154C>G, XM_006714303.2:c.823-7154C>G, XM_011532232.1:c.823-7154C>G, XR_244645.1:n.1052-7154C>G
C > G
No VIP available No Clinical Annotations available VA
rs34324334 NC_000006.11:g.43535018C>T, NC_000006.12:g.43567281C>T, NM_020750.2:c.722G>A, NP_065801.1:p.Ser241Asn
C > T
No VIP available No Clinical Annotations available VA
rs3744741 NC_000017.10:g.649232C>T, NC_000017.11:g.745992C>T, NM_015721.2:c.2051G>A, NP_056536.2:p.Arg684Gln, XM_005256667.1:c.2063G>A, XM_005256667.3:c.2063G>A, XM_005256668.1:c.2063G>A, XM_005256668.3:c.2063G>A, XM_005256669.1:c.2018G>A, XM_005256670.1:c.2018G>A, XM_005256670.3:c.2018G>A, XM_011523910.1:c.2063G>A, XM_011523911.1:c.2063G>A, XM_011523912.1:c.2018G>A, XM_011523913.1:c.2018G>A, XP_005256724.1:p.Arg688Gln, XP_005256725.1:p.Arg688Gln, XP_005256726.1:p.Arg673Gln, XP_005256727.1:p.Arg673Gln, XP_011522212.1:p.Arg688Gln, XP_011522213.1:p.Arg688Gln, XP_011522214.1:p.Arg673Gln, XP_011522215.1:p.Arg673Gln, rs56482056, rs59343482
C > T
No VIP available CA VA
rs3765534 NC_000013.10:g.95815415C>T, NC_000013.11:g.95163161C>T, NM_001105515.2:c.2269G>A, NM_001301829.1:c.2128G>A, NM_001301830.1:c.2044G>A, NM_005845.4:c.2269G>A, NP_001098985.1:p.Glu757Lys, NP_001288758.1:p.Glu710Lys, NP_001288759.1:p.Glu682Lys, NP_005836.2:p.Glu757Lys, XM_005254025.1:c.2140G>A, XM_005254025.2:c.2140G>A, XM_005254026.1:c.2128G>A, XM_005254027.1:c.2044G>A, XM_005254028.1:c.2044G>A, XM_006719914.1:c.2179G>A, XM_011521047.1:c.1720G>A, XP_005254082.1:p.Glu714Lys, XP_005254083.1:p.Glu710Lys, XP_005254084.1:p.Glu682Lys, XP_005254085.1:p.Glu682Lys, XP_006719977.1:p.Glu727Lys, XP_011519349.1:p.Glu574Lys, rs17235040, rs52814620, rs57150501
C > T
No VIP available No Clinical Annotations available VA
rs3805500 NC_000005.10:g.31462870G>A, NC_000005.9:g.31462977G>A, NM_001100412.1:c.2463+1366C>T, NM_013235.4:c.2574+1366C>T, XM_005248291.1:c.2574+1366C>T, XM_005248291.2:c.2574+1366C>T, XM_005248292.1:c.2550+1366C>T, XM_005248292.2:c.2550+1366C>T, XM_005248293.1:c.2481+1366C>T, XM_005248293.2:c.2481+1366C>T, XM_005248294.1:c.2370+1366C>T, XM_005248294.2:c.2370+1366C>T, XM_011514033.1:c.2574+1366C>T, rs386586733
G > A
No VIP available CA VA
rs3824662 NC_000010.10:g.8104208C>A, NC_000010.11:g.8062245C>A, NG_015859.1:g.12542C>A, NM_001002295.1:c.779-1748C>A, NM_002051.2:c.779-1751C>A, XM_005252442.1:c.779-1748C>A, XM_005252442.2:c.779-1748C>A, XM_005252443.1:c.779-1748C>A, XM_005252443.3:c.779-1748C>A, rs11567915
C > A
No VIP available CA VA
rs3931660 NC_000006.11:g.18149105A>T, NC_000006.12:g.18148874A>T, NG_012137.2:g.11270T>A, NM_000367.3:c.140+114T>A, XM_011514839.1:c.140+114T>A, XM_011514840.1:c.71+100T>A
A > G
A > T
No VIP available No Clinical Annotations available VA
rs4305983 NC_000009.11:g.86944451A>G, NC_000009.12:g.84329536A>G, NM_001199633.1:c.60+11038T>C, NM_022127.2:c.60+11038T>C, NR_037638.2:n.206+11038T>C, XM_011518905.1:c.60+11038T>C, XM_011518906.1:c.60+11038T>C, XM_011518907.1:c.-97-16082T>C, XM_011518909.1:c.60+11038T>C, XM_011518910.1:c.60+11038T>C, XR_929832.1:n.187+11038T>C, rs74305426
A > G
No VIP available No Clinical Annotations available VA
rs4449636 NC_000006.11:g.18148019G>A, NC_000006.12:g.18147788G>A, NG_012137.2:g.12356C>T, NM_000367.3:c.233+35C>T, XM_011514839.1:c.233+35C>T, XM_011514840.1:c.164+35C>T
G > A
No VIP available No Clinical Annotations available VA
rs45445694 NC_000018.10:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NC_000018.9:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NG_028255.1:g.5043_5070CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NM_001012716.2:c.*34+169_*34+196CGGGACGGAGGCAGGCCAAGTGGCGCGG[2][3][4][7][8][9], NM_001071.2:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258137.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258138.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], rs34743033 (retired)
No VIP available No Clinical Annotations available VA
rs4588940 NC_000009.11:g.86941620A>G, NC_000009.12:g.84326705A>G, NM_001199633.1:c.61-13251T>C, NM_022127.2:c.61-13251T>C, NR_037638.2:n.207-13251T>C, XM_011518905.1:c.61-13251T>C, XM_011518906.1:c.61-13251T>C, XM_011518907.1:c.-97-13251T>C, XM_011518909.1:c.61-13251T>C, XM_011518910.1:c.61-13251T>C, XR_929832.1:n.188-13251T>C, rs17552068
A > G
No VIP available No Clinical Annotations available VA
rs4731448 NC_000007.13:g.128041339A>G, NC_000007.14:g.128401285A>G, NG_009194.1:g.13698T>C, NM_000883.3:c.403-169T>C, NM_001102605.1:c.373-169T>C, NM_001142573.1:c.148-169T>C, NM_001142574.1:c.148-169T>C, NM_001142575.1:c.148-169T>C, NM_001142576.1:c.304-169T>C, NM_001304521.1:c.196-169T>C, NM_183243.2:c.295-169T>C, XM_005250313.1:c.196-169T>C, XM_005250314.1:c.172-169T>C, XM_005250315.1:c.148-169T>C, XM_005250316.1:c.-238-169T>C, XM_006715967.1:c.403-169T>C, XM_006715968.1:c.373-169T>C, XM_006715969.1:c.295-169T>C, XM_006715970.2:c.196-169T>C, XM_006715971.1:c.172-169T>C, XM_011516156.1:c.-807T>C, XM_011516157.1:c.-807T>C, rs59964737, rs60262971
A > G
No VIP available No Clinical Annotations available VA
rs4867329 NC_000005.10:g.31435520A>C, NC_000005.9:g.31435627A>C, NM_001100412.1:c.2931+245T>G, NM_013235.4:c.3042+245T>G, XM_005248291.1:c.3042+245T>G, XM_005248291.2:c.3042+245T>G, XM_005248292.1:c.3018+245T>G, XM_005248292.2:c.3018+245T>G, XM_005248293.1:c.2949+245T>G, XM_005248293.2:c.2949+245T>G, XM_005248294.1:c.2838+245T>G, XM_005248294.2:c.2838+245T>G, XM_011514033.1:c.3042+245T>G, rs17485775
A > C
No VIP available No Clinical Annotations available VA
rs494852 NC_000002.11:g.31624836C>T, NC_000002.12:g.31401970C>T, NG_008871.1:g.17776G>A, NM_000379.3:c.198-642G>A, XM_011533095.1:c.198-642G>A, XM_011533096.1:c.198-642G>A, rs1429373, rs386596654, rs59544081
C > T
No VIP available No Clinical Annotations available VA
rs56103835 NC_000014.8:g.101522556T>C, NC_000014.9:g.101056219T>C, NR_036133.1:n.1T>C
T > A
T > C
No VIP available No Clinical Annotations available VA
rs595961 NC_000001.10:g.36367780A>G, NC_000001.11:g.35902179A>G, NM_001317122.1:c.1264-25A>G, NM_001317123.1:c.1039-25A>G, NM_012199.4:c.1264-25A>G, XM_005270746.1:c.1246-25A>G, XM_005270747.1:c.1039-25A>G, XM_011541236.1:c.1273-25A>G, XM_011541237.1:c.1048-25A>G, XM_011541238.1:c.1039-25A>G, XM_011541239.1:c.820-25A>G, rs59876085
A > G
No VIP available CA VA
rs61886492 NC_000011.10:g.49164722G>A, NC_000011.9:g.49186274G>A, NG_029170.1:g.48949C>T, NM_001014986.1:c.1423C>T, NM_001193471.1:c.1378C>T, NM_001193472.1:c.1378C>T, NM_001193473.1:c.499C>T, NM_004476.1:c.1423C>T, NP_001014986.1:p.His475Tyr, NP_001180400.1:p.His460Tyr, NP_001180401.1:p.His460Tyr, NP_001180402.1:p.His167Tyr, NP_004467.1:p.His475Tyr, XM_005252839.1:c.919C>T, XM_011519958.1:c.1378C>T, XP_005252896.1:p.His307Tyr, XP_011518260.1:p.His460Tyr
G > A
No VIP available CA VA
rs639174 NC_000005.10:g.31433540C>T, NC_000005.9:g.31433647C>T, NM_001100412.1:c.2932-1862G>A, NM_013235.4:c.3043-1862G>A, XM_005248291.1:c.3043-1862G>A, XM_005248291.2:c.3043-1862G>A, XM_005248292.1:c.3019-1862G>A, XM_005248292.2:c.3019-1862G>A, XM_005248293.1:c.2950-1862G>A, XM_005248293.2:c.2950-1862G>A, XM_005248294.1:c.2839-1862G>A, XM_005248294.2:c.2839-1862G>A, XM_011514033.1:c.3043-1862G>A, rs57933113
C > T
No VIP available No Clinical Annotations available VA
rs6497759 NC_000016.10:g.24790416G>A, NC_000016.9:g.24801737G>A, NM_014494.2:c.1774G>A, NP_055309.2:p.Ala592Thr, XM_005255253.1:c.1678G>A, XM_005255254.1:c.1774G>A, XM_005255254.2:c.1774G>A, XM_005255255.1:c.1678G>A, XM_005255256.1:c.1678G>A, XM_005255257.1:c.1015G>A, XM_005255257.3:c.1015G>A, XM_006721039.2:c.1348G>A, XM_011545791.1:c.1774G>A, XM_011545792.1:c.1774G>A, XM_011545793.1:c.1774G>A, XM_011545794.1:c.1774G>A, XM_011545795.1:c.1774G>A, XM_011545796.1:c.1774G>A, XP_005255310.1:p.Ala560Thr, XP_005255311.1:p.Ala592Thr, XP_005255312.1:p.Ala560Thr, XP_005255313.1:p.Ala560Thr, XP_005255314.1:p.Ala339Thr, XP_006721102.1:p.Ala450Thr, XP_011544093.1:p.Ala592Thr, XP_011544094.1:p.Ala592Thr, XP_011544095.1:p.Ala592Thr, XP_011544096.1:p.Ala592Thr, XP_011544097.1:p.Ala592Thr, XP_011544098.1:p.Ala592Thr, rs52832662, rs59562937
G > A
No VIP available No Clinical Annotations available VA
rs6505162 NC_000017.10:g.28444183A>C, NC_000017.11:g.30117165A>C, NM_001261467.1:c.-49+302A>C, NM_032141.3:c.20+302A>C, NR_029945.1:n.87A>C, NR_036149.1:n.-5T>G, XM_005258042.1:c.20+302A>C, XM_011525345.1:c.21-137A>C, XR_934651.1:n.682+227T>G, rs56453081, rs61093106
A > C
A > T
No VIP available No Clinical Annotations available VA
rs7035753 NC_000009.11:g.86955682C>T, NC_000009.12:g.84340767C>T, NM_001199633.1:c.-134G>A, NM_022127.2:c.-45-89G>A, NR_037638.2:n.13G>A, XM_011518905.1:c.-134G>A, XM_011518906.1:c.-45-89G>A, XM_011518907.1:c.-97-27313G>A, XM_011518909.1:c.-134G>A, XM_011518910.1:c.-134G>A, XR_929832.1:n.-7G>A, rs17343394, rs386606815, rs52791876
C > -
C > T
No VIP available No Clinical Annotations available VA
rs7043257 NC_000009.11:g.86953674T>C, NC_000009.12:g.84338759T>C, NM_001199633.1:c.60+1815A>G, NM_022127.2:c.60+1815A>G, NR_037638.2:n.206+1815A>G, XM_011518905.1:c.60+1815A>G, XM_011518906.1:c.60+1815A>G, XM_011518907.1:c.-97-25305A>G, XM_011518909.1:c.60+1815A>G, XM_011518910.1:c.60+1815A>G, XR_929832.1:n.187+1815A>G, rs17428058, rs59384460
T > C
No VIP available No Clinical Annotations available VA
rs7270101 NC_000020.10:g.3193893A>C, NC_000020.11:g.3213247A>C, NG_012093.1:g.8838A>C, NM_001267623.1:c.67-738A>C, NM_033453.3:c.124+21A>C, NM_181493.2:c.73+21A>C, NR_052000.1:n.224+21A>C, NR_052001.1:n.49-11A>C, NR_052002.1:n.316+21A>C, XM_006723564.2:c.124+21A>C, XM_006723565.2:c.67-738A>C, XM_011529234.1:c.124+21A>C, XM_011529235.1:c.124+21A>C
A > C
No VIP available No Clinical Annotations available VA
rs747199 NC_000006.11:g.44194345G>C, NC_000006.12:g.44226608G>C, NG_042893.1:g.12104G>C, NM_001078174.1:c.-54-652G>C, NM_001078175.2:c.-52+441G>C, NM_001078176.2:c.-51-655G>C, NM_001078177.1:c.-55+441G>C, NM_001304462.1:c.187-655G>C, NM_001304463.1:c.76-655G>C, NM_001304465.1:c.25-652G>C, NM_001304466.1:c.25-655G>C, NM_004955.2:c.-51-655G>C, XM_005248875.1:c.187-655G>C, XM_005248876.1:c.76-652G>C, XM_005248876.3:c.76-652G>C, XM_005248877.1:c.76-655G>C, XM_005248878.1:c.-52+441G>C, XM_005248878.3:c.-52+441G>C, XM_005248879.1:c.-52+441G>C, XM_005248879.3:c.-52+441G>C, XM_005248880.1:c.-55+441G>C, XM_005248880.3:c.-55+441G>C, XM_005248881.1:c.-483G>C, XM_005248881.3:c.-483G>C, XM_005248882.1:c.-486G>C, XM_005248882.3:c.-486G>C, XM_011514341.1:c.187-652G>C, rs3799961
G > C
No VIP available No Clinical Annotations available VA
rs7911488 NC_000010.10:g.105154089A>G, NC_000010.11:g.103394332A>G, NM_001206426.1:c.-9-1866T>C, NM_001206427.1:c.-10+1414T>C, NM_032747.3:c.-143T>C, NR_031707.1:n.70T>C
A > -
A > G
No VIP available CA VA
G > A
No VIP available No Clinical Annotations available VA
rs9611280 NC_000022.10:g.40552119G>A, NC_000022.11:g.40156115G>A, NM_001024843.1:c.46G>A, NP_001020014.1:p.Val16Met, XM_005261393.1:c.46G>A, XM_005261394.1:c.46G>A, XP_005261450.1:p.Val16Met, XP_005261451.1:p.Val16Met, rs52808489, rs61442552
G > A
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 147


Generic Names
  • 6 MP
  • 6-Mercaptopurine
  • MP
  • Mercaptopurine Monohydrate
  • Mercapurin
Trade Names
  • Ismipur
  • Leukerin
  • Leupurin
  • Mercaleukim
  • Mercaleukin
  • Mern
  • Puri-Nethol
  • Purimethol
  • Purinethol
  • Xaluprine
Brand Mixture Names

PharmGKB Accession Id



Drug, Metabolite

Metabolite of azathioprine.


An antimetabolite antineoplastic agent with immunosuppressant properties. It interferes with nucleic acid synthesis by inhibiting purine metabolism and is used, usually in combination with other drugs, in the treatment of or in remission maintenance programs for leukemia.

Source: Drug Bank


For remission induction and maintenance therapy of acute lymphatic leukemia.

Source: Drug Bank

Other Vocabularies

Information pulled from DrugBank has not been reviewed by PharmGKB.

Pharmacology, Interactions, and Contraindications

Mechanism of Action

Mercaptopurine competes with hypoxanthine and guanine for the enzyme hypoxanthine-guanine phosphoribosyltransferase (HGPRTase) and is itself converted to thioinosinic acid (TIMP). This intracellular nucleotide inhibits several reactions involving inosinic acid (IMP), including the conversion of IMP to xanthylic acid (XMP) and the conversion of IMP to adenylic acid (AMP) via adenylosuccinate (SAMP). In addition, 6-methylthioinosinate (MTIMP) is formed by the methylation of TIMP. Both TIMP and MTIMP have been reported to inhibit glutamine-5-phosphoribosylpyrophosphate amidotransferase, the first enzyme unique to the de novo pathway for purine ribonucleotide synthesis. Experiments indicate that radiolabeled mercaptopurine may be recovered from the DNA in the form of deoxythioguanosine. Some mercaptopurine is converted to nucleotide derivatives of 6-thioguanine (6-TG) by the sequential actions of inosinate (IMP) dehydrogenase and xanthylate (XMP) aminase, converting TIMP to thioguanylic acid (TGMP).

Source: Drug Bank


Mercaptopurine is one of a large series of purine analogues which interfere with nucleic acid biosynthesis and has been found active against human leukemias. It is an analogue of the purine bases adenine and hypoxanthine. It is not known exactly which of any one or more of the biochemical effects of mercaptopurine and its metabolites are directly or predominantly responsible for cell death.

Source: Drug Bank

Food Interaction

Preferably on an empty stomach, drink plenty of liquids, avoid alcohol.

Source: Drug Bank

Absorption, Distribution, Metabolism, Elimination & Toxicity


Hepatic. Degradation primarily by xanthine oxidase. The catabolism of mercaptopurine and its metabolites is complex. In humans, after oral administration of ^35^S-6-mercaptopurine, urine contains intact mercaptopurine, thiouric acid (formed by direct oxidation by xanthine oxidase, probably via 6-mercapto-8-hydroxypurine), and a number of 6-methylated thiopurines. The methylthiopurines yield appreciable amounts of inorganic sulfate.

Source: Drug Bank

Protein Binding

Plasma protein binding averages 19% over the concentration range 10 to 50 microg/mL (a concentration only achieved by intravenous administration of mercaptopurine at doses exceeding 5 to 10 mg/kg).

Source: Drug Bank


Clinical studies have shown that the absorption of an oral dose of mercaptopurine in humans is incomplete and variable, averaging approximately 50% of the administered dose. The factors influencing absorption are unknown.

Source: Drug Bank


Triphasic: 45 minutes, 2.5 hours, and 10 hours.

Source: Drug Bank


Signs and symptoms of overdosage may be immediate such as anorexia, nausea, vomiting, and diarrhea; or delayed such as myelosuppression, liver dysfunction, and gastroenteritis. The oral LD ~50~ of mercaptopurine was determined to be 480 mg/kg in the mouse and 425 mg/kg in the rat.

Source: Drug Bank

Chemical Properties

Chemical Formula


Source: Drug Bank

Average Molecular Weight


Source: Drug Bank

Monoisotopic Molecular Weight


Source: Drug Bank



Source: Drug Bank

InChI String


Source: Drug Bank

PharmGKB Curated Pathways

Pathways created internally by PharmGKB based primarily on literature evidence.

  1. Thiopurine Pathway, Pharmacokinetics/Pharmacodynamics
    Diagrammatic representation of a non-tissue specific cancer cell displaying candidate genes involved in the metabolism and action of thiopurines.

Genes that are associated with this drug in PharmGKB's database based on (1) variant annotations, (2) literature review, (3) pathways or (4) information automatically retrieved from DrugBank, depending on the "evidence" and "source" listed below.

Curated Information ?

No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available

Drug Targets

Gene Description
ADSL (source: Drug Bank )
AMPD1 (source: Drug Bank )
AMPD2 (source: Drug Bank )
AMPD3 (source: Drug Bank )
GMPR (source: Drug Bank )
GMPR2 (source: Drug Bank )
GMPS (source: Drug Bank )
HPRT1 (source: Drug Bank )
IMPDH1 (source: Drug Bank )
IMPDH2 (source: Drug Bank )
PPAT (source: Drug Bank )

Curated Information ?

No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available

Drug Interactions

Interaction Description
allopurinol - mercaptopurine Allopurinol increases the effect of thiopurine (source: Drug Bank )
allopurinol - mercaptopurine Allopurinol increases the effect of thiopurine (source: Drug Bank )
aminosalicylic acid - mercaptopurine The 5-ASA derivative increases the toxicity of thiopurine (source: Drug Bank )
aminosalicylic acid - mercaptopurine The 5-ASA derivative increases the toxicity of thiopurine (source: Drug Bank )
mesalazine - mercaptopurine The 5-ASA derivative increases the toxicity of thiopurine (source: Drug Bank )
mesalazine - mercaptopurine The 5-ASA derivative increases the toxicity of thiopurine (source: Drug Bank )
thioguanine - mercaptopurine Complete cross resistance may occur. (source: Drug Bank )
trastuzumab - mercaptopurine Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )

Curated Information ?

No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Arrhythmias, Cardiac
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Arthritis, Juvenile Rheumatoid
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Arthritis, Rheumatoid
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Atrial Fibrillation
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Attention Deficit Disorder with Hyperactivity
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Autoimmune Diseases
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Bipolar Disorder
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Breast Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Carcinoma, Non-Small-Cell Lung
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Carcinoma, Renal Cell
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cardiovascular Abnormalities
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cardiovascular Diseases
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Colitis, Ulcerative
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Colonic Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Colorectal Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Crohn Disease
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
dose reduction
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Drug Hypersensitivity
No Dosing Guideline available DL CA VA No VIP available No VIP available
Drug Toxicity
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Epidermal Necrolysis, Toxic
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Epilepsy, Absence
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Epilepsy, Generalized
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
event-free survival
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gastrointestinal Stromal Tumors
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gilbert's syndrome
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Graft vs Host Disease
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Heart Failure
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Hematologic Diseases
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Hematologic Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HIV Infections
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Hypereosinophilic Syndrome
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Hyperlipoproteinemia Type II
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available DL CA VA No VIP available No VIP available
Inflammatory Bowel Diseases
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Irritable Bowel Syndrome
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukemia, Lymphocytic, Chronic, B-Cell
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukemia, Lymphoid
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukemia, Myelogenous, Chronic, BCR-ABL Positive
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukemia, Myeloid
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukemia, Myeloid, Acute
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukemia, Nonlymphocytic, Acute
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukemia, Promyelocytic, Acute
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Lung Neoplasms
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Lupus Erythematosus, Systemic
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Lymphoma, Non-Hodgkin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Migraine without Aura
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Muscular Diseases
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Myelodysplastic Syndromes
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Myocardial Infarction
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Myoclonic Epilepsy, Juvenile
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Neoplasm Metastasis
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Neoplasms, Radiation-Induced
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Neoplasms, Second Primary
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Ocular Hypertension
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Peripheral Nervous System Diseases
No Dosing Guideline available DL CA VA No VIP available No VIP available
Precursor Cell Lymphoblastic Leukemia-Lymphoma
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Precursor T-Cell Lymphoblastic Leukemia-Lymphoma
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pulmonary Disease, Chronic Obstructive
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pulmonary Fibrosis
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Sjogren's Syndrome
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Sleep Disorders
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Stevens-Johnson Syndrome
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Toxic liver disease
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
treatment interruptions
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
treatment modification
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Tuberculosis, Pulmonary
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Tumor Lysis Syndrome
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Urinary Incontinence
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available

Publications related to mercaptopurine: 275

No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
NUDT15 polymorphisms are better than thiopurine S-methyltransferase as predictor of risk for thiopurine-induced leukopenia in Chinese patients with Crohn's disease. Alimentary pharmacology & therapeutics. 2016. Zhu X, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The pharmacogenomics of drug resistance to protein kinase inhibitors. Drug resistance updates : reviews and commentaries in antimicrobial and anticancer chemotherapy. 2016. Gillis Nancy K, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A Genome-wide Approach Validates that Thiopurine Methyltransferase Activity is a Monogenic Pharmacogenomic Trait. Clinical pharmacology and therapeutics. 2016. Liu Chengcheng, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A coding variant in FTO confers susceptibility to thiopurine-induced leukopenia in East Asian patients with IBD. Gut. 2016. Kim Han Sang, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
NUDT15 and TPMT genetic polymorphisms are related to 6-mercaptopurine intolerance in children treated for acute lymphoblastic leukemia at the Children's Cancer Center of Lebanon. Pediatric blood & cancer. 2016. Zgheib Nathalie K, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Further evidence that a variant of the gene NUDT15 may be an important predictor of azathioprine-induced toxicity in Chinese subjects: a case report. Journal of clinical pharmacy and therapeutics. 2016. Ailing Z, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Nudt15 C415t Variant as a Predictor For Thiopurine Induced Toxicity in Indian Patients. Journal of gastroenterology and hepatology. 2016. Shah Swarup A V, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genotyping NUDT15 can predict the dose reduction of 6-MP for children with acute lymphoblastic leukemia especially at a preschool age. Journal of human genetics. 2016. Suzuki Hisato, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
NUDT15 variant and thiopurine-induced leukopenia in Hong Kong. Hong Kong medical journal = Xianggang yi xue za zhi / Hong Kong Academy of Medicine. 2016. Wong F Ck, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Prospective Evaluation of Pharmacogenomics and Metabolite Measurements upon Azathioprine Therapy in Inflammatory Bowel Disease: An Observational Study. Medicine. 2016. Fangbin Zhang, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
NUDT15 polymorphisms alter thiopurine metabolism and hematopoietic toxicity. Nature genetics. 2016. Moriyama Takaya, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
NUDT15 variant is the most common variant associated with thiopurine-induced early leukopenia and alopecia in Korean pediatric patients with Crohn's disease. European journal of gastroenterology & hepatology. 2016. Lee Yeoun Joo, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
NUDT15 c.415C>T increases risk of 6-mercaptopurine induced myelosuppression during maintenance therapy in children with acute lymphoblastic leukemia. Haematologica. 2016. Chiengthong Kanhatai, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
NUDT15 R139C-related thiopurine leukocytopenia is mediated by 6-thioguanine nucleotide-independent mechanism in Japanese patients with inflammatory bowel disease. Journal of gastroenterology. 2016. Asada Ayumi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomically actionable medications in a safety net health care system. SAGE open medicine. 2016. Carpenter Janet S, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
PACSIN2 polymorphism is associated with thiopurine-induced hematological toxicity in children with acute lymphoblastic leukaemia undergoing maintenance therapy. Scientific reports. 2016. Smid Alenka, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Integrated Patient and Tumor Genetic Testing for Individualized Cancer Therapy. Clinical pharmacology and therapeutics. 2015. Hertz Daniel L, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Susceptibility to 6-MP toxicity conferred by a NUDT15 variant in Japanese children with acute lymphoblastic leukaemia. British journal of haematology. 2015. Tanaka Yoichi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Identification of Patients With Variants in TPMT and Dose Reduction Reduces Hematologic Events During Thiopurine Treatment of Inflammatory Bowel Disease. Gastroenterology. 2015. Coenen Marieke J H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TPMT gene expression is increased during maintenance therapy in childhood acute lymphoblastic leukemia patients in a TPMT gene promoter variable number of tandem repeat-dependent manner. Pharmacogenomics. 2015. Kotur Nikola, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
NUDT15 gene polymorphism related to mercaptopurine intolerance in Taiwan Chinese children with acute lymphoblastic leukemia. The pharmacogenomics journal. 2015. Liang D-C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Childhood Acute Lymphoblastic Leukemia: Progress Through Collaboration. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2015. Pui Ching-Hon, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Inherited genetic variation in childhood acute lymphoblastic leukemia. Blood. 2015. Moriyama Takaya, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Systemic Exposure to Thiopurines and Risk of Relapse in Children With Acute Lymphoblastic Leukemia: A Children's Oncology Group Study. JAMA oncology. 2015. Bhatia Smita, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
NUDT15 R139C causes thiopurine-induced early severe hair loss and leukopenia in Japanese patients with IBD. The pharmacogenomics journal. 2015. Kakuta Y, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Inherited NUDT15 Variant Is a Genetic Determinant of Mercaptopurine Intolerance in Children With Acute Lymphoblastic Leukemia. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2015. Yang Jun J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Physiologically based pharmacokinetic model for 6-mercpatopurine: exploring the role of genetic polymorphism in TPMT enzyme activity. British journal of clinical pharmacology. 2015. Ogungbenro Kayode, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Myelotoxicity after high-dose methotrexate in childhood acute leukemia is influenced by 6-mercaptopurine dosing but not by intermediate thiopurine methyltransferase activity. Cancer chemotherapy and pharmacology. 2015. Levinsen Mette, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Crystal structure, biochemical and cellular activities demonstrate separate functions of MTH1 and MTH2. Nature communications. 2015. Carter Megan, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variants in 6-mercaptopurine pathway as potential factors of hematological toxicity in acute lymphoblastic leukemia patients. Pharmacogenomics. 2015. Hareedy Mohammad Salem, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Progress in understanding the genomic basis for adverse drug reactions: a comprehensive review and focus on the role of ethnicity. Pharmacogenomics. 2015. Chan Sze Ling, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Association between Thiopurine S-methyltransferase Polymorphisms and Thiopurine-Induced Adverse Drug Reactions in Patients with Inflammatory Bowel Disease: A Meta-Analysis. PloS one. 2015. Liu Yue-Ping, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Model-Based Individualized Treatment of Chemotherapeutics: Bayesian Population Modeling and Dose Optimization. PloS one. 2015. Jayachandran Devaraj, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine dose intensity and treatment outcome in childhood lymphoblastic leukaemia: the influence of thiopurine methyltransferase pharmacogenetics. British journal of haematology. 2014. Lennard Lynne, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Surgeons and their tools: a history of surgical instruments and their innovators--part I: place the scissors on the Mayo stand. The American surgeon. 2014. El-Sedfy Abraham, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
HLA-DQA1-HLA-DRB1 variants confer susceptibility to pancreatitis induced by thiopurine immunosuppressants. Nature genetics. 2014. Heap Graham A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine monitoring in children with inflammatory bowel disease: a systematic review. British journal of clinical pharmacology. 2014. Konidari Anastasia, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A common missense variant in NUDT15 confers susceptibility to thiopurine-induced leukopenia. Nature genetics. 2014. Yang Suk-Kyun, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
From pharmacogenetics to pharmacometabolomics: SAM modulates TPMT activity. Pharmacogenomics. 2014. Karas-Kuželički Nataša, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of childhood acute lymphoblastic leukemia. Pharmacogenomics. 2014. Lopez-Lopez Elixabet, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Adherence to oral 6-mercaptopurine in African American and Asian children with acute lymphoblastic leukemia: a Children's Oncology Group study. Blood. 2014. Bhatia Smita, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Host thiopurine methyltransferase status affects mercaptopurine antileukemic effectiveness in a murine model. Pharmacogenetics and genomics. 2014. Ramsey Laura B, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Implementation of TPMT testing. British journal of clinical pharmacology. 2014. Lennard Lynne. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Identification of a novel thiopurine S-methyltransferase allele (TPMT*37). Pharmacogenetics and genomics. 2014. Roberts Rebecca L, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine pharmacogenomics: association of SNPs with clinical response and functional validation of candidate genes. Pharmacogenomics. 2014. Matimba Alice, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetics of microRNAs and microRNAs biogenesis machinery in pediatric acute lymphoblastic leukemia. PloS one. 2014. López-López Elixabet, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Inherited GATA3 variants are associated with Ph-like childhood acute lymphoblastic leukemia and risk of relapse. Nature genetics. 2013. Perez-Andreu Virginia, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine methyltransferase genotype-phenotype discordance and thiopurine active metabolite formation in childhood acute lymphoblastic leukaemia. British journal of clinical pharmacology. 2013. Lennard Lynne, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Activating mutations in the NT5C2 nucleotidase gene drive chemotherapy resistance in relapsed ALL. Nature medicine. 2013. Tzoneva Gannie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Nomenclature for alleles of the thiopurine methyltransferase gene. Pharmacogenetics and genomics. 2013. Appell Malin L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics and pharmacogenomics: a bridge to individualized cancer therapy. Pharmacogenomics. 2013. Weng Liming, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinical Pharmacogenetics Implementation Consortium Guidelines for Thiopurine Methyltransferase Genotype and Thiopurine Dosing: 2013 Update. Clinical pharmacology and therapeutics. 2013. Relling M V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Optimising outcome on thiopurines in inflammatory bowel disease by co-prescription of allopurinol. Journal of Crohn's & colitis. 2012. Smith Melissa A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A Clinician-Driven Automated System for Integration of Pharmacogenetic Interpretations Into an Electronic Medical Record. Clinical pharmacology and therapeutics. 2012. Hicks J K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic determinants of mercaptopurine disposition in children with acute lymphoblastic leukemia. European journal of clinical pharmacology. 2012. Adam de Beaumais Tiphaine, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
PACSIN2 polymorphism influences TPMT activity and mercaptopurine-related gastrointestinal toxicity. Human molecular genetics. 2012. Stocco Gabriele, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PharmGKB summary: very important pharmacogene information for GSTT1. Pharmacogenetics and genomics. 2012. Thorn Caroline F, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variants of thiopurine and folate metabolic pathways determine 6-MP-mediated hematological toxicity in childhood ALL. Pharmacogenomics. 2012. Dorababu Patchva, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Nonadherence to Oral Mercaptopurine and Risk of Relapse in Hispanic and Non-Hispanic White Children With Acute Lymphoblastic Leukemia: A Report From the Children's Oncology Group. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2012. Bhatia Smita, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CDA deficiency as a possible culprit for life-threatening toxicities after cytarabine plus 6-mercaptopurine therapy: pharmacogenetic investigations. Pharmacogenomics. 2012. Ciccolini Joseph, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
6-mercaptopurine influences TPMT gene transcription in a TPMT gene promoter variable number of tandem repeats-dependent manner. Pharmacogenomics. 2012. Kotur Nikola, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pan-pathway based interaction profiling of FDA-approved nucleoside and nucleobase analogs with enzymes of the human nucleotide metabolism. PloS one. 2012. Egeblad Louise, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic analysis of pediatric patients with acute lymphoblastic leukemia: a possible association between survival rate and ITPA polymorphism. PloS one. 2012. Kim Hyery, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase (TPMT) polymorphisms in children with acute lymphoblastic leukemia, and the need for reduction or cessation of 6-mercaptopurine doses during maintenance therapy: the Polish multicenter analysis. Pediatric blood & cancer. 2011. Peregud-Pogorzelski Jarosław, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine methyl-transferase activity and azathioprine metabolite concentrations do not predict clinical outcome in thiopurine-treated inflammatory bowel disease patients. Alimentary pharmacology & therapeutics. 2011. González-Lama Y, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase polymorphism in Iranian kidney transplant recipients. Experimental and clinical transplantation : official journal of the Middle East Society for Organ Transplantation. 2011. Aghdaie Mahdokht Hossein, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Azathioprine-related myelosuppression in a patient homozygous for TPMT*3A. Nature reviews. Nephrology. 2011. Budhiraja Pooja, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The pattern of gene expression and gene dose profiles of 6-Mercaptopurine- and 6-Thioguanine-resistant human leukemia cells. Biochemical and biophysical research communications. 2011. Karim Hazhar, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cancer Pharmacogenomics. Clinical pharmacology and therapeutics. 2011. Paugh S W, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Prospective-retrospective biomarker analysis for regulatory consideration: white paper from the industry pharmacogenomics working group. Pharmacogenomics. 2011. Patterson Scott D, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Novel thiopurine methyltransferase variant TPMT*28 results in a misdiagnosis of TPMT deficiency. Inflammatory bowel diseases. 2011. Landy J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics and individualized therapy in children: immunosuppressants, antidepressants, anticancer and anti-inflammatory drugs. Pharmacogenomics. 2011. Elie Valery, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pediatric pharmacogenetic and pharmacogenomic studies: the current state and future perspectives. European journal of clinical pharmacology. 2011. Russo Roberta, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Determinants of mercaptopurine toxicity in paediatric acute lymphoblastic leukemia maintenance therapy. British journal of clinical pharmacology. 2011. Adam de Beaumais Tiphaine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinical pharmacogenetics implementation consortium guidelines for thiopurine methyltransferase genotype and thiopurine dosing. Clinical pharmacology and therapeutics. 2011. Relling M V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics: From Bench to Byte- An Update of Guidelines. Clinical pharmacology and therapeutics. 2011. Swen J J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Practical recommendations for pharmacogenomics-based prescription: 2010 ESF-UB Conference on Pharmacogenetics and Pharmacogenomics. Pharmacogenomics. 2011. Becquemont Laurent, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomic contribution to drug response. Cancer journal (Sudbury, Mass.). 2011. Watson Roshawn G, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Promoter Polymorphisms in the beta-2 Adrenergic Receptor Are Associated With Drug-Induced Gene Expression Changes and Response in Acute Lymphoblastic Leukemia. Clinical pharmacology and therapeutics. 2010. Pottier N, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Ecto-5'-nucleotidase and thiopurine cellular circulation: association with cytotoxicity. Drug metabolism and disposition: the biological fate of chemicals. 2010. Li Fang, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine methyltransferase predicts the extent of cytotoxicty and DNA damage in astroglial cells after thioguanine exposure. PloS one. 2011. Hosni-Ahmed Amira, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Characterization of a novel sequence variant, TPMT*28, in the human thiopurine methyltransferase gene. Pharmacogenetics and genomics. 2010. Appell Malin Lindqvist, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Identifying genomic and developmental causes of adverse drug reactions in children. Pharmacogenomics. 2010. Becker Mara L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Systematic review of pharmacoeconomic studies of pharmacogenomic tests. Pharmacogenomics. 2010. Beaulieu Mathieu, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Multivariate models to detect genomic signatures for a class of drugs: application to thiopurines pharmacogenomics. The pharmacogenomics journal. 2010. Fridley B L, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The multidrug-resistance protein 4 polymorphism is a new factor accounting for thiopurine sensitivity in Japanese patients with inflammatory bowel disease. Journal of gastroenterology. 2010. Ban Hiromistu, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine pathway. Pharmacogenetics and genomics. 2010. Zaza Gianluigi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DNA incorporation of 6-thioguanine nucleotides during maintenance therapy of childhood acute lymphoblastic leukaemia and non-Hodgkin lymphoma. Cancer chemotherapy and pharmacology. 2010. Hedeland Rikke L, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase gene polymorphism and 6-mercaptopurine dose intensity in Indian children with acute lymphoblastic leukemia. Leukemia research. 2010. Kapoor Gauri, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Influence of 5-aminosalicylic acid on 6-thioguanosine phosphate metabolite levels: a prospective study in patients under steady thiopurine therapy. British journal of pharmacology. 2010. de Graaf P, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase polymorphisms and thiopurine toxicity in treatment of inflammatory bowel disease. World journal of gastroenterology : WJG. 2010. Dong Xian-Wen, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The association of reduced folate carrier 80G>A polymorphism to outcome in childhood acute lymphoblastic leukemia interacts with chromosome 21 copy number. Blood. 2010. Gregers Jannie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Very important pharmacogene summary: thiopurine S-methyltransferase. Pharmacogenetics and genomics. 2010. Wang Liewei, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Drug transporter pharmacogenetics in nucleoside-based therapies. Pharmacogenomics. 2010. Errasti-Murugarren Ekaitz, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase pharmacogenetics: functional characterization of a novel rapidly degraded variant allozyme. Biochemical pharmacology. 2010. Feng Qiping, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Low-dose azathioprine or mercaptopurine in combination with allopurinol can bypass many adverse drug reactions in patients with inflammatory bowel disease. Alimentary pharmacology & therapeutics. 2010. Ansari A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Human lymphoblastoid cell line panels: novel tools for assessing shared drug pathways. Pharmacogenomics. 2010. Morag Ayelet, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics in the treatment of inflammatory bowel disease. Pharmacogenomics. 2010. Smith Melissa A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase genotype and the use of thiopurines in paediatric inflammatory bowel disease Greek patients. Journal of clinical pharmacy and therapeutics. 2010. Gazouli M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Long-term results of NOPHO ALL-92 and ALL-2000 studies of childhood acute lymphoblastic leukemia. Leukemia. 2010. Schmiegelow K, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Are patients with intermediate TPMT activity at increased risk of myelosuppression when taking thiopurine medications?. Pharmacogenomics. 2010. Higgs Jenny E, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Influences of thiopurine methyltransferase genotype and activity on thiopurine-induced leukopenia in Korean patients with inflammatory bowel disease: a retrospective cohort study. Journal of clinical gastroenterology. 2010. Kim Jae Hak, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase pharmacogenetics in a large-scale healthy Italian-Caucasian population: differences in enzyme activity. Pharmacogenomics. 2009. Serpe Loredana, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Polymorphisms in multidrug resistance-associated protein gene 4 is associated with outcome in childhood acute lymphoblastic leukemia. Blood. 2009. Ansari Marc, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine methyltransferase genetics is not a major risk factor for secondary malignant neoplasms after treatment of childhood acute lymphoblastic leukemia on Berlin-Frankfurt-Münster protocols. Blood. 2009. Stanulla Martin, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
TPMT*26 (208F-->L), a novel mutation detected in a Chinese. British journal of clinical pharmacology. 2009. Kham Shirley Kow Yin, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinically available pharmacogenomics tests. Clinical pharmacology and therapeutics. 2009. Flockhart D A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Impact of the heterozygous TPMT*1/*3C genotype on azathioprine-induced myelosuppression in kidney transplant recipients in Thailand. Clinical therapeutics. 2009. Vannaprasaht Suda, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Adverse reactions to azathioprine cannot be predicted by thiopurine S-methyltransferase genotype in Japanese patients with inflammatory bowel disease. Journal of gastroenterology and hepatology. 2009. Takatsu Noritaka, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Methotrexate/6-mercaptopurine maintenance therapy influences the risk of a second malignant neoplasm after childhood acute lymphoblastic leukemia: results from the NOPHO ALL-92 study. Blood. 2009. Schmiegelow Kjeld, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ADME pharmacogenetics: current practices and future outlook. Expert opinion on drug metabolism & toxicology. 2009. Grossman Iris. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Heterozygosity at the TPMT gene locus, augmented by mutated MTHFR gene, predisposes to 6-MP related toxicities in childhood ALL patients. Leukemia. 2009. Karas-Kuzelicki N, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Application of SNaPshot for analysis of thiopurine methyltransferase gene polymorphism. The Indian journal of medical research. 2009. Kapoor Gauri, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Relationships between thiopurine S-methyltransferase polymorphism and azathioprine-related adverse drug reactions in Chinese renal transplant recipients. European journal of clinical pharmacology. 2009. Xin Hua-Wen, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine methyltransferase activity is related to the risk of relapse of childhood acute lymphoblastic leukemia: results from the NOPHO ALL-92 study. Leukemia : official journal of the Leukemia Society of America, Leukemia Research Fund, U.K. 2009. Schmiegelow K, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic polymorphism of inosine triphosphate pyrophosphatase is a determinant of mercaptopurine metabolism and toxicity during treatment for acute lymphoblastic leukemia. Clinical pharmacology and therapeutics. 2009. Stocco G, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
TPMT genetic variations in populations of the Russian Federation. Pediatric blood & cancer. 2009. Samochatova Elena V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics and pharmacogenomics of anticancer agents. CA: a cancer journal for clinicians. 2009. Huang R Stephanie, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase (TPMT) gene polymorphism in Brazilian children with acute lymphoblastic leukemia: association with clinical and laboratory data. Therapeutic drug monitoring. 2008. Silva Marcilene Rezende, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genome-wide copy number profiling reveals molecular evolution from diagnosis to relapse in childhood acute lymphoblastic leukemia. Blood. 2008. Yang Jun J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Prospective evaluation of the pharmacogenetics of azathioprine in the treatment of inflammatory bowel disease. Alimentary pharmacology & therapeutics. 2008. Ansari A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacogenomic studies of the anticancer and immunosuppressive thiopurines mercaptopurine and azathioprine. British journal of clinical pharmacology. 2008. Hawwa Ahmed F, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Functional characterization of 23 allelic variants of thiopurine S-methyltransferase gene (TPMT*2 - *24). Pharmacogenetics and genomics. 2008. Ujiie Shuta, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Long-term outcome of using allopurinol co-therapy as a strategy for overcoming thiopurine hepatotoxicity in treating inflammatory bowel disease. Alimentary pharmacology & therapeutics. 2008. Ansari A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Characterisation of novel defective thiopurine S-methyltransferase allelic variants. Biochemical pharmacology. 2008. Garat A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Transporter-mediated protection against thiopurine-induced hematopoietic toxicity. Cancer research. 2008. Krishnamurthy Partha, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Creating and evaluating genetic tests predictive of drug response. Nature reviews. Drug discovery. 2008. Weiss Scott T, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Structural basis of substrate recognition in thiopurine s-methyltransferase. Biochemistry. 2008. Peng Yi, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine dose in intermediate and normal metabolizers of thiopurine methyltransferase may differ three-fold. Clinical gastroenterology and hepatology : the official clinical practice journal of the American Gastroenterological Association. 2008. Gardiner Sharon J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
6-mercaptopurine and 9-(2-phosphonyl-methoxyethyl) adenine (PMEA) transport altered by two missense mutations in the drug transporter gene ABCC4. Human mutation. 2008. Janke Daniel, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Influence of MTHFR and RFC1 polymorphisms on toxicities during maintenance chemotherapy for childhood acute lymphoblastic leukemia or lymphoma. Journal of pediatric hematology/oncology : official journal of the American Society of Pediatric Hematology/Oncology. 2008. Shimasaki Noriko, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Up-regulation of MRP4 and down-regulation of influx transporters in human leukemic cells with acquired resistance to 6-mercaptopurine. Leukemia research. 2008. Peng Xing-Xiang, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Trinucleotide repeat variants in the promoter of the thiopurine S-methyltransferase gene of patients exhibiting ultra-high enzyme activity. Pharmacogenetics and genomics. 2008. Roberts Rebecca L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Functional characterization of human xanthine oxidase allelic variants. Pharmacogenetics and genomics. 2008. Kudo Mutsumi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Azathioprine-associated acute myeloid leukemia in a patient with Crohn's disease and thiopurine S-methyltransferase deficiency. American journal of hematology. 2008. Yenson Paul R, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase (TPMT) pharmacogenetics: three new mutations and haplotype analysis in the Estonian population. Clinical chemistry and laboratory medicine : CCLM / FESCC. 2008. Tamm Riin, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Analysis of thiopurine S-methyltransferase genotypes in Japanese patients with inflammatory bowel disease. Internal medicine (Tokyo, Japan). 2008. Ban Hiromitsu, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase gene (TMPT) polymorphisms in a Mexican population of healthy individuals and leukemic patients. Medical oncology (Northwood, London, England). 2008. Taja-Chayeb Lucia, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics of drug-metabolizing enzymes and drug transporters in chemotherapy. Methods in molecular biology (Clifton, N.J.). 2008. Bosch Tessa M. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The low frequency of defective TPMT alleles in Turkish population: a study on pediatric patients with acute lymphoblastic leukemia. American journal of hematology. 2007. Tumer Tugba Boyunegmez, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Explaining TPMT genotype/phenotype discrepancy by haplotyping of TPMT*3A and identification of a novel sequence variant, TPMT*23. Pharmacogenetics and genomics. 2007. Lindqvist Malin, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic significance of inosine triphosphatase. Pharmacogenomics. 2007. Bierau Jörgen, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic polymorphisms of folate metabolic enzymes and toxicities of high dose methotrexate in children with acute lymphoblastic leukemia. Annals of hematology. 2007. Pakakasama Samart, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Assessment of thiopurine methyltransferase enzyme activity is superior to genotype in predicting myelosuppression following azathioprine therapy in patients with inflammatory bowel disease. Alimentary pharmacology & therapeutics. 2007. Winter J W, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Ancestry and pharmacogenetics of antileukemic drug toxicity. Blood. 2007. Kishi Shinji, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Differential effects of targeted disruption of thiopurine methyltransferase on mercaptopurine and thioguanine pharmacodynamics. Cancer research. 2007. Hartford Christine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Using HapMap tools in pharmacogenomic discovery: the thiopurine methyltransferase polymorphism. Clinical pharmacology and therapeutics. 2007. Jones T S, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Efficient screening method of the thiopurine methyltransferase polymorphisms for patients considering taking thiopurine drugs in a Chinese Han population in Henan Province (central China). Clinica chimica acta; international journal of clinical chemistry. 2007. Zhang Li-Rong, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase gene polymorphism in Japanese patients with autoimmune liver diseases. Liver international : official journal of the International Association for the Study of the Liver. 2007. Tamori Akihiro, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Monitoring of thiopurine methyltransferase activity in postsurgical patients with Crohn's disease during 1 year of treatment with azathioprine or mesalazine. Therapeutic drug monitoring. 2007. Dilger Karin, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
TPMT genotype and its clinical implication in renal transplant recipients with azathioprine treatment. Journal of clinical pharmacy and therapeutics. 2006. Song D-K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Adding pharmacogenetics information to drug labels: lessons learned. Pharmacogenetics and genomics. 2006. Haga Susanne B, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Analysis of thiopurine S-methyltransferase polymorphism in the population of Serbia and Montenegro and mercaptopurine therapy tolerance in childhood acute lymphoblastic leukemia. Therapeutic drug monitoring. 2006. Dokmanovic Lidija, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The thiopurine methyltransferase genetic polymorphism is associated with thioguanine-related veno-occlusive disease of the liver in children with acute lymphoblastic leukemia. Clinical pharmacology and therapeutics. 2006. Lennard Lynne, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetics during standardised initiation of thiopurine treatment in inflammatory bowel disease. Gut. 2006. Hindorf U, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Toxicity and efficacy of 6-thioguanine versus 6-mercaptopurine in childhood lymphoblastic leukaemia: a randomised trial. Lancet. 2006. Vora Ajay, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Three novel thiopurine S-methyltransferase allelic variants (TPMT*20, *21, *22) - association with decreased enzyme function. Human mutation. 2006. Schaeffeler Elke, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Divergent activities of human glutathione transferases in the bioactivation of azathioprine. Molecular pharmacology. 2006. Eklund Birgitta I, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Adverse events leading to modification of therapy in a large cohort of patients with inflammatory bowel disease. Alimentary pharmacology & therapeutics. 2006. Hindorf U, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The frequency and significance of thiopurine S-methyltransferase gene polymorphisms in azathioprine-treated renal transplant recipients. The British journal of dermatology. 2006. Moloney F J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of thiopurine therapy in paediatric IBD patients. Alimentary pharmacology & therapeutics. 2006. De Ridder L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Involvement of the concentrative nucleoside transporter 3 and equilibrative nucleoside transporter 2 in the resistance of T-lymphoblastic cell lines to thiopurines. Biochemical and biophysical research communications. 2006. Fotoohi Alan Kambiz, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Determination of intra-ethnic differences in the polymorphisms of thiopurine S-methyltransferase in Chinese. Clinica chimica acta; international journal of clinical chemistry. 2006. Zhang Jian-Ping, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase pharmacogenetics: insights, challenges and future directions. Oncogene. 2006. Wang L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Predictors of immunomodulator use as early therapy in pediatric Crohn's disease. Journal of clinical gastroenterology. 2006. Jacobstein Douglas A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine methyltransferase in acute lymphoblastic leukemia. Blood. 2006. Relling Mary V, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Inosine triphosphate pyrophosphatase and thiopurine s-methyltransferase genotypes relationship to azathioprine-induced myelosuppression. Clinical gastroenterology and hepatology : the official clinical practice journal of the American Gastroenterological Association. 2006. Zelinkova Zuzana, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Azathioprine suppresses ezrin-radixin-moesin-dependent T cell-APC conjugation through inhibition of Vav guanosine exchange activity on Rac proteins. Journal of immunology (Baltimore, Md. : 1950). 2006. Poppe Daniela, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics and individualized drug therapy. Annual review of medicine. 2006. Eichelbaum Michel, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics: catechol O-methyltransferase to thiopurine S-methyltransferase. Cellular and molecular neurobiology. 2006. Weinshilboum Richard M. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
TPMT genotype and the use of thiopurines in paediatric inflammatory bowel disease. Digestive and liver disease : official journal of the Italian Society of Gastroenterology and the Italian Association for the Study of the Liver. 2005. Stocco G, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase phenotype-genotype correlation in hemodialyzed patients. Pharmacological reports : PR. 2006. Chrzanowska Maria, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase pharmacogenetics: genotype to phenotype correlation in the Slovenian population. Pharmacology. 2006. Milek M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine methyltransferase genotype and phenotype status in Japanese patients with systemic lupus erythematosus. Biological & pharmaceutical bulletin. 2005. Okada Yuko, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of 5'-nucleotidase in thiopurine metabolism: enzyme kinetic profile and association with thio-GMP levels in patients with acute lymphoblastic leukemia during 6-mercaptopurine treatment. Clinica chimica acta; international journal of clinical chemistry. 2005. Brouwer Connie, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase pharmacogenetics: variant allele functional and comparative genomics. Pharmacogenetics and genomics. 2005. Salavaggione Oreste E, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine methyltransferase and 6-thioguanine nucleotide measurement: early experience of use in clinical practice. Internal medicine journal. 2005. Gearry R B, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A cost-effectiveness analysis of alternative disease management strategies in patients with Crohn's disease treated with azathioprine or 6-mercaptopurine. The American journal of gastroenterology. 2005. Dubinsky Marla C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gene expression and thioguanine nucleotide disposition in acute lymphoblastic leukemia after in vivo mercaptopurine treatment. Blood. 2005. Zaza Gianluigi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Karyotypic abnormalities create discordance of germline genotype and cancer cell phenotypes. Nature genetics. 2005. Cheng Qing, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The impact of thiopurine s-methyltransferase polymorphism on azathioprine-induced myelotoxicity in renal transplant recipients. Therapeutic drug monitoring. 2005. Kurzawski Mateusz, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic association with adverse drug reactions to azathioprine immunosuppressive therapy following liver transplantation. Liver transplantation : official publication of the American Association for the Study of Liver Diseases and the International Liver Transplantation Society. 2005. Breen David P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacogenetics of outcome in children with acute lymphoblastic leukemia. Blood. 2005. Rocha Jose Claudio C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Azathioprine induced nodular regenerative hyperplasia in IBD patients. Gastroentérologie clinique et biologique. 2005. Daniel Fady, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine methyltransferase (TPMT) heterozygosity and enzyme activity as predictive tests for the development of azathioprine-related adverse events. Journal of the neurological sciences. 2005. Heckmann Jeannine M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine methyltransferase (TPMT) genotype and early treatment response to mercaptopurine in childhood acute lymphoblastic leukemia. JAMA : the journal of the American Medical Association. 2005. Stanulla Martin, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Identification and functional analysis of two rare allelic variants of the thiopurine S-methyltransferase gene, TPMT*16 and TPMT*19. Biochemical pharmacology. 2005. Hamdan-Khalil Rima, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase polymorphisms and the relationship between the mutant alleles and the adverse effects in systemic lupus erythematosus patients taking azathioprine. Clinical and experimental rheumatology. 2005. Jun J B, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Assessment of thiopurine methyltransferase and metabolite formation during thiopurine therapy: results from a large Swedish patient population. Therapeutic drug monitoring. 2004. Hindorf Ulf, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase genotype predicts azathioprine-induced myelotoxicity in kidney transplant recipients. American journal of transplantation : official journal of the American Society of Transplantation and the American Society of Transplant Surgeons. 2004. Formea Christine M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Monitoring of long-term thiopurine therapy among adults with inflammatory bowel disease. Scandinavian journal of gastroenterology. 2004. Hindorf U, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Allele frequency of inosine triphosphate pyrophosphatase gene polymorphisms in a Japanese population. Nucleosides, nucleotides & nucleic acids. 2004. Marinaki A M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The impact of thiopurine S-methyltransferase polymorphisms on azathioprine dose 1 year after renal transplantation. Transplant international : official journal of the European Society for Organ Transplantation. 2004. Fabre Margarete A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Comprehensive analysis of thiopurine S-methyltransferase phenotype-genotype correlation in a large population of German-Caucasians and identification of novel TPMT variants. Pharmacogenetics. 2004. Schaeffeler Elke, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Methylated metabolites of 6-mercaptopurine are associated with hepatotoxicity. Clinical pharmacology and therapeutics. 2004. Nygaard Ulrikka, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Phenotype and genotype for thiopurine methyltransferase activity in the French Caucasian population: impact of age. European journal of clinical pharmacology. 2004. Ganiere-Monteil Catherine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Analysis of variation in mouse TPMT genotype, expression and activity. Pharmacogenetics. 2004. Watters James W, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Identification of two novel sequence variants affecting thiopurine methyltransferase enzyme activity. Pharmacogenetics. 2004. Lindqvist Malin, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of thiopurine S-methyltransferase and thiopurine therapy. Therapeutic drug monitoring. 2004. Evans William E. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pyrosequencing of TPMT alleles in a general Swedish population and in patients with inflammatory bowel disease. Clinical chemistry. 2004. Haglund Sofie, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Mistaken identity: misclassification of TPMT phenotype following blood transfusion. European journal of gastroenterology & hepatology. 2003. Cheung Seau-Tak, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
In vitro characterization of four novel non-functional variants of the thiopurine S-methyltransferase. Biochemical and biophysical research communications. 2003. Hamdan-Khalil Rima, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Drug methylation in cancer therapy: lessons from the TPMT polymorphism. Oncogene. 2003. Krynetski Eugene, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Phenotypic and genotypic analysis of thiopurine s-methyltransferase polymorphism in the bulgarian population. Therapeutic drug monitoring. 2003. Indjova Dessislava, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase pharmacogenetics: chaperone protein association and allozyme degradation. Pharmacogenetics. 2003. Wang Liewei, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic polymorphism of thiopurine S-methyltransferase in Argentina. Annals of clinical biochemistry. 2003. Laróvere L E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Dose reduction of coadministered 6-mercaptopurine decreases myelotoxicity following high-dose methotrexate in childhood leukemia. Leukemia. 2003. Nygaard U, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A novel TPMT missense mutation associated with TPMT deficiency in a 5-year-old boy with ALL. Leukemia : official journal of the Leukemia Society of America, Leukemia Research Fund, U.K. 2003. Schaeffeler E, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine methyltransferase phenotypes and genotypes in Brazilians. Pharmacogenetics. 2003. Reis Marcelo, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Treatment-specific changes in gene expression discriminate in vivo drug response in human leukemia cells. Nature genetics. 2003. Cheok Meyling H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CD28-dependent Rac1 activation is the molecular target of azathioprine in primary human CD4+ T lymphocytes. The Journal of clinical investigation. 2003. Tiede Imke, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Safe treatment of thiopurine S-methyltransferase deficient Crohn's disease patients with azathioprine. Gut. 2003. Kaskas B A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Is thiopurine methyltransferase genetic polymorphism a major factor for withdrawal of azathioprine in rheumatoid arthritis patients?. Rheumatology (Oxford, England). 2003. Corominas H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine metabolism and identification of the thiopurine metabolites transported by MRP4 and MRP5 overexpressed in human embryonic kidney cells. Molecular pharmacology. 2002. Wielinga P R, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine methyltransferase activity and the use of azathioprine in inflammatory bowel disease. Alimentary pharmacology & therapeutics. 2002. Ansari A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Azathioprine therapy and adverse drug reactions in patients with inflammatory bowel disease: impact of thiopurine S-methyltransferase polymorphism. Pharmacogenetics. 2002. Schwab Matthias, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine methyltransferase polymorphisms in a multiracial asian population and children with acute lymphoblastic leukemia. Journal of pediatric hematology/oncology. 2002. Kham S K Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Differing contribution of thiopurine methyltransferase to mercaptopurine versus thioguanine effects in human leukemic cells. Cancer research. 2001. Dervieux T, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Influence of the variable number of tandem repeats located in the promoter region of the thiopurine methyltransferase gene on enzymatic activity. Clinical pharmacology and therapeutics. 2001. Alves S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Rational dosing of azathioprine and 6-mercaptopurine. Gut. 2001. Sandborn W J. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine pharmacogenetics: clinical and molecular studies of thiopurine methyltransferase. Drug metabolism and disposition: the biological fate of chemicals. 2001. Weinshilboum R. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genotype-phenotype correlation for thiopurine S-methyltransferase in healthy Italian subjects. European journal of clinical pharmacology. 2001. Rossi A M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Preponderance of thiopurine S-methyltransferase deficiency and heterozygosity among patients intolerant to mercaptopurine or azathioprine. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2001. Evans W E, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic polymorphisms of thiopurine S-methyltransferase and 6-mercaptopurine toxicity in Japanese children with acute lymphoblastic leukaemia. Pharmacogenetics. 2001. Ando M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
6-mercaptopurine dosage and pharmacokinetics influence the degree of bone marrow toxicity following high-dose methotrexate in children with acute lymphoblastic leukemia. Leukemia. 2001. Schmiegelow K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Therapeutic drug monitoring of cytotoxic drugs. British journal of clinical pharmacology. 2001. Lennard L. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A multicenter trial of 6-mercaptopurine and prednisone in children with newly diagnosed Crohn's disease. Gastroenterology. 2000. Markowitz J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genotypic analysis of thiopurine S-methyltransferase in patients with Crohn's disease and severe myelosuppression during azathioprine therapy. Gastroenterology. 2000. Colombel J F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Multidrug-resistance protein 5 is a multispecific organic anion transporter able to transport nucleotide analogs. Proceedings of the National Academy of Sciences of the United States of America. 2000. Wijnholds J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenomics and metabolite measurement for 6-mercaptopurine therapy in inflammatory bowel disease. Gastroenterology. 2000. Dubinsky M C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic polymorphism of thiopurine methyltransferase and its clinical relevance for childhood acute lymphoblastic leukemia. Leukemia : official journal of the Leukemia Society of America, Leukemia Research Fund, U.K. 2000. McLeod H L, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase gene polymorphism is predictive of azathioprine-induced myelosuppression in heart transplant recipients. Transplantation. 2000. Sebbag L, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Severe 6-thioguanine-induced marrow aplasia in a child with acute lymphoblastic leukemia and inherited thiopurine methyltransferase deficiency. Journal of pediatric hematology/oncology. 2000. McBride K L, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Mercaptopurine therapy intolerance and heterozygosity at the thiopurine S-methyltransferase gene locus. Journal of the National Cancer Institute. 1999. Relling M V, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Enhanced proteasomal degradation of mutant human thiopurine S-methyltransferase (TPMT) in mammalian cells: mechanism for TPMT protein deficiency inherited by TPMT*2, TPMT*3A, TPMT*3B or TPMT*3C. Pharmacogenetics. 1999. Tai H L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Possible carcinogenic effect of 6-mercaptopurine on bone marrow stem cells: relation to thiopurine metabolism. Cancer. 1999. Bo J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
High incidence of secondary brain tumours after radiotherapy and antimetabolites. Lancet. 1999. Relling M V, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Analysis of thiopurine methyltransferase variant alleles in childhood acute lymphoblastic leukaemia. British journal of haematology. 1999. McLeod H L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Prognostic importance of 6-mercaptopurine dose intensity in acute lymphoblastic leukemia. Blood. 1999. Relling M V, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine methyltransferase pharmacogenetics: alternative molecular diagnosis and preliminary data from Northern Portugal. Pharmacogenetics. 1999. Alves S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Therapeutic drug monitoring of antimetabolic cytotoxic drugs. British journal of clinical pharmacology. 1999. Lennard L. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Polymorphism of the thiopurine S-methyltransferase gene in African-Americans. Human molecular genetics. 1999. Hon Y Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The frequency and distribution of thiopurine methyltransferase alleles in Caucasian and Asian populations. Pharmacogenetics. 1999. Collie-Duguid E S, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine methyltransferase genotype predicts therapy-limiting severe toxicity from azathioprine. Annals of internal medicine. 1998. Black A J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinical implications of thiopurine methyltransferase--optimization of drug dosage and potential drug interactions. Therapeutic drug monitoring. 1998. Lennard L. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available