Chemical: Prodrug

Available Guidelines

  1. PRO Guideline for irinotecan and UGT1A1
  2. DPWG Guideline for irinotecan and UGT1A1

last updated 06/03/2015

1. PRO Guideline for irinotecan and UGT1A1


A French joint working group comprising the National Pharmacogenetics Network (RNPGx) and the Group of Clinical Onco-pharmacology (GPCO-Unicancer) has published guidelines for the use of UGT1A1*28 genotype when prescribing irinotecan. They recommend that the dose of irinotecan be reduced in patients with the UGT1A1*28/*28 genotype, and that high-dose irinotecan (>=240 mg/m2) only be prescribed to patients with the UGT1A1*1/*1 genotype.


The French joint working group comprising the National Pharmacogenetics Network (RNPGx) and the Group of Clinical Onco-pharmacology (GPCO-Unicancer) has published UGT1A1-based drug dosing guidelines for irinotecan in Fundamental & Clinical Pharmacology. Excerpts from "UGT1A1 genotype and irinotecan therapy: general review and implementation in routine practice" [Article:25817555] follow:

...we recommend pretreatment UGT1A1 genotyping of the TATA box (*28, *36, *37) for all patients scheduled to receive an irinotecan dose >=180 mg/m2. The rare allele *36 (proficient) can be interpreted as an *1 allele and allele *37 (deficient) as an allele *28.

For low irinotecan doses (<180 mg/m2/week) UGT1A1 genotyping is not indicated as hematological and gastrointestinal toxicities are quite similar regardless of the genotype.

For initially scheduled doses between 180 and 230 mg/m2 every 2-3 weeks, *28/*28 patients are at increased risk of developing hematological and/or digestive toxicity as compared to other genotypes...a 25-30% dose reduction at the first cycle is recommended, particularly in cases of associated risk factors (performance status >3).

For initially scheduled doses >=240 mg/m2 every 2-3 weeks, *28/*28 patients are at a much higher risk of hematological toxicity (neutropenia) as compared to other genotypes. We thus recommend contraindicating such an intensified dose in *28/*28 patients. The administration of an intensified dose (240 mg/m2) is only possible in *1/*1 patients, as well as in *1/*28 patients, in the absence of additional risk factors and under strict medical surveillance.

This...analysis is limited by the fact that other UGT1A1 deficient variants are relevant in non-Caucasian populations, particularly the *6 and *27 alleles in Asian populations.

The joint working group also provided a decision tree to guide irinotecan dosing based on UGT1A1 genotype:

Decision tree for irinotecan dosing

Reprinted with permission from Etienne-Grimaldi et al. UGT1A1 genotype and irinotecan therapy: general review and implementation in routine practice. Fundamental & Clinical Pharmacology (2015)

last updated 08/25/2016

2. DPWG Guideline for irinotecan and UGT1A1


Reduce the starting dose of irinotecan for UGT1A1*28 homozygous patients receiving more than 250 mg/m2.


The Royal Dutch Pharmacists Association - Pharmacogenetics Working Group has evaluated therapeutic dose recommendations for irinotecan based on UGT1A1 genotype [Article:21412232]. They recommend reducing the dose for *28 homozygous patients receiving more than 250 mg/m2.

Phenotype (Genotype)Therapeutic Dose RecommendationLevel of EvidenceClinical Relevance
*1/*28None.Published controlled studies of moderate quality* relating to phenotyped and/or genotyped patients or healthy volunteers, and having relevant pharmacokinetic or clinical endpoints..Clinical effect (S): death; arrhythmia; unanticipated myelosuppression.
*28/*28Dose >250mg/m2: reduce initial dose by 30%. Increase dose in response to neutrophil count. Dose <=250mg/m2: no dose adjustment.Published controlled studies of moderate quality* relating to phenotyped and/or genotyped patients or healthy volunteers, and having relevant pharmacokinetic or clinical endpoints.Clinical effect (S): Failure of lifesaving therapy e.g. anticipated myelosuppression; prevention of breast cancer relapse; arrhythmia; neutropenia < 0.5x109/l; leucopenia < 1.0x109/l; thrombocytopenia < 25x109/l; life-threatening complications from diarrhea.

Annotated Labels

  1. FDA Label for irinotecan and UGT1A1
  2. PMDA Label for irinotecan and UGT1A1
  3. HCSC Label for irinotecan and UGT1A1

PharmGKB contains no Clinical Variants that meet the highest level of criteria.

To see more Clinical Variants with lower levels of criteria, click the button at the bottom of the page.

Disclaimer: The PharmGKB's clinical annotations reflect expert consensus based on clinical evidence and peer-reviewed literature available at the time they are written and are intended only to assist clinicians in decision-making and to identify questions for further research. New evidence may have emerged since the time an annotation was submitted to the PharmGKB. The annotations are limited in scope and are not applicable to interventions or diseases that are not specifically identified.

The annotations do not account for individual variations among patients, and cannot be considered inclusive of all proper methods of care or exclusive of other treatments. It remains the responsibility of the health-care provider to determine the best course of treatment for a patient. Adherence to any guideline is voluntary, with the ultimate determination regarding its application to be made solely by the clinician and the patient. PharmGKB assumes no responsibility for any injury or damage to persons or property arising out of or related to any use of the PharmGKB clinical annotations, or for any errors or omissions.

? = Mouse-over for quick help

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Links in the "Gene" column lead to PharmGKB Gene Pages.

List of all variant annotations for irinotecan

Gene ? Variant?
Alternate Names ? Chemicals ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
VIP No VIP available No VIP available ABCB1 *13 (PMID: 12893986) N/A N/A N/A
VIP No VIP available No VIP available ABCB1 *2 (PMID: 11503014) N/A N/A N/A
No VIP available No VIP available VA CYP2A6 *4A N/A N/A N/A
No VIP available No VIP available VA CYP2A6 *7 N/A N/A N/A
No VIP available No VIP available VA CYP2A6 *9 N/A N/A N/A
No VIP available No VIP available VA DPYD *1 N/A N/A N/A
No VIP available No VIP available VA DPYD *2A N/A N/A N/A
No VIP available No VIP available VA SLCO1B1 *1 N/A N/A N/A
No VIP available No VIP available VA SLCO1B1 *15 N/A N/A N/A
No VIP available No VIP available VA UGT1A1 *1 N/A N/A N/A
No VIP available No VIP available VA UGT1A1 *6 N/A N/A N/A
No VIP available No VIP available VA UGT1A1 *28 N/A N/A N/A
No VIP available CA VA UGT1A1 *60 N/A N/A N/A
No VIP available CA VA UGT1A6 *2a N/A N/A N/A
No VIP available CA VA UGT1A7 *3 N/A N/A N/A
No VIP available No Clinical Annotations available VA
rs10380 NC_000005.10:g.7897078C>T, NC_000005.9:g.7897191C>T, NG_008856.1:g.32975C>T, NM_002454.2:c.1783C>T, NM_024010.2:c.1864C>T, NP_002445.2:p.His595Tyr, NP_076915.2:p.His622Tyr, NR_134480.1:n.1906C>T, NR_134481.1:n.1831C>T, NR_134482.1:n.1766C>T, XM_005248304.1:c.1828C>T, XM_005248305.1:c.1783C>T, XM_011514043.1:c.1864C>T, XM_011514044.1:c.1783C>T, XP_005248361.1:p.His610Tyr, XP_005248362.1:p.His595Tyr, XP_011512345.1:p.His622Tyr, XP_011512346.1:p.His595Tyr, XR_241702.1:n.1905C>T, XR_241703.1:n.1790C>T, XR_925614.1:n.1909C>T, rs1134946, rs17354145, rs2287782, rs3197331, rs52810705, rs60582795, rs9282886
C > -
C > T
rs1045642 NC_000007.13:g.87138645A>G, NC_000007.14:g.87509329A>G, NG_011513.1:g.208920T>C, NM_000927.4:c.3435T>C, NP_000918.2:p.Ile1145=, rs10239679, rs11568726, rs117328163, rs17210003, rs2229108, rs386513066, rs60023214, rs9690664
A > G
No VIP available CA VA
rs1051266 NC_000021.8:g.46957794T>C, NC_000021.9:g.45537880T>C, NG_028278.1:g.9592A>G, NM_001205206.1:c.80A>G, NM_194255.2:c.80A>G, NP_001192135.1:p.His27Arg, NP_919231.1:p.His27Arg, XM_005261163.1:c.80A>G, XM_005261164.1:c.-279A>G, XM_005261164.2:c.-279A>G, XM_011529696.1:c.371A>G, XM_011529697.1:c.371A>G, XM_011529698.1:c.146A>G, XM_011529699.1:c.-1639A>G, XM_011529700.1:c.80A>G, XM_011529701.1:c.80A>G, XM_011529702.1:c.80A>G, XM_011529703.1:c.80A>G, XM_011529704.1:c.80A>G, XM_011529705.1:c.371A>G, XM_011529707.1:c.371A>G, XM_011529708.1:c.80A>G, XM_011529709.1:c.-279A>G, XM_011529710.1:c.-165-5732A>G, XP_005261220.1:p.His27Arg, XP_011527998.1:p.His124Arg, XP_011527999.1:p.His124Arg, XP_011528000.1:p.His49Arg, XP_011528002.1:p.His27Arg, XP_011528003.1:p.His27Arg, XP_011528004.1:p.His27Arg, XP_011528005.1:p.His27Arg, XP_011528006.1:p.His27Arg, XP_011528007.1:p.His124Arg, XP_011528009.1:p.His124Arg, XP_011528010.1:p.His27Arg, rs17844977, rs17857726, rs3171496, rs386514057, rs61510559
T > C
No VIP available CA VA
rs1056515 NC_000001.10:g.163113260G>T, NC_000001.11:g.163143470G>T, NG_027731.2:g.183322C>A, NM_001195303.2:c.*3872C>A, NM_001254748.1:c.*3872C>A, NM_001254749.1:c.*3872C>A, NM_003617.3:c.*3872C>A, rs111183181, rs386514407, rs58775087, rs59069797
G > T
No VIP available No Clinical Annotations available VA
rs10815019 NC_000009.11:g.4547288A>G, NC_000009.12:g.4547288A>G, NG_017044.1:g.61862A>G, NM_004170.5:c.232+2581A>G, XM_011518007.1:c.301+2581A>G, XM_011518008.1:c.241+2581A>G, XM_011518009.1:c.172+2581A>G, XM_011518010.1:c.92-14161A>G, rs56618216, rs59895460
A > G
A > T
No VIP available No Clinical Annotations available VA
rs10841661 NC_000012.11:g.20984832C>T, NC_000012.12:g.20831898C>T, NG_032071.1:g.26195C>T, NM_019844.3:c.84+16076C>T, XM_005253347.1:c.84+16076C>T, rs60957758
C > T
No VIP available CA VA
rs10929302 NC_000002.11:g.234665782G>A, NC_000002.12:g.233757136G>A, NG_002601.2:g.172393G>A, NG_033238.1:g.1864G>A, NM_001072.3:c.862-9898G>A, NM_007120.2:c.868-9898G>A, NM_019075.2:c.856-9898G>A, NM_019076.4:c.856-9898G>A, NM_019077.2:c.856-9898G>A, NM_019078.1:c.868-9898G>A, NM_019093.2:c.868-9898G>A, NM_021027.2:c.856-9898G>A, NM_205862.1:c.61-9898G>A, NR_037694.1:n.-1791C>T, NR_037695.1:n.-1791C>T, NR_037696.1:n.-1791C>T, XR_241238.1:n.924-9898G>A, XR_241240.1:n.1023-9898G>A, XR_241241.1:n.942-9898G>A
G > A
No VIP available CA VA
G > A
No VIP available CA VA
rs10937158 NC_000003.11:g.183708439T>C, NC_000003.12:g.183990651T>C, NM_001023587.2:c.130-1268A>G, NM_001320032.1:c.-1402-1268A>G, NM_005688.3:c.130-1268A>G, NR_135125.1:n.316-1268A>G, XM_005247058.1:c.130-1268A>G, XM_005247058.3:c.130-1268A>G, XM_005247059.1:c.130-1268A>G, XM_005247059.3:c.130-1268A>G, XM_005247060.1:c.130-1268A>G, XM_005247061.1:c.130-1268A>G, XM_005247062.1:c.-1402-1268A>G, XM_011512314.1:c.130-1268A>G, XM_011512315.1:c.130-1268A>G, XM_011512316.1:c.-1402-1268A>G
T > C
No VIP available No Clinical Annotations available VA
rs11022922 NC_000011.10:g.2457965C>T, NC_000011.9:g.2479195C>T, NG_008935.1:g.17975C>T, NM_000218.2:c.386+12481C>T, rs60426613
C > T
No VIP available No Clinical Annotations available VA
rs1105879 NC_000002.11:g.234602202A>C, NC_000002.12:g.233693556A>C, NG_002601.2:g.108813A>C, NM_001072.3:c.552A>C, NM_019075.2:c.855+56179A>C, NM_019076.4:c.856-73478A>C, NM_019077.2:c.855+10764A>C, NM_021027.2:c.855+20767A>C, NM_205862.1:c.-7-243A>C, NP_001063.2:p.Arg184Ser, XR_241240.1:n.713A>C, XR_241241.1:n.941+20767A>C, rs17684024, rs386516515, rs4365457, rs61226878
A > C
No VIP available No Clinical Annotations available VA
rs11128347 NC_000003.11:g.73619561G>C, NC_000003.12:g.73570410G>C, NM_001303139.1:c.-1248C>G, NM_015009.2:c.918+31944C>G, XM_005264719.1:c.-1248C>G, rs59928417
G > C
No VIP available No Clinical Annotations available VA
rs112445441 NC_000012.11:g.25398281C>A, NC_000012.11:g.25398281C>G, NC_000012.11:g.25398281C>T, NC_000012.12:g.25245347C>A, NC_000012.12:g.25245347C>G, NC_000012.12:g.25245347C>T, NG_007524.1:g.10574G>A, NG_007524.1:g.10574G>C, NG_007524.1:g.10574G>T, NM_004985.4:c.38G>A, NM_004985.4:c.38G>C, NM_004985.4:c.38G>T, NM_033360.3:c.38G>A, NM_033360.3:c.38G>C, NM_033360.3:c.38G>T, NP_004976.2:p.Gly13Ala, NP_004976.2:p.Gly13Asp, NP_004976.2:p.Gly13Val, NP_203524.1:p.Gly13Ala, NP_203524.1:p.Gly13Asp, NP_203524.1:p.Gly13Val, XM_005253365.1:c.38G>A, XM_005253365.1:c.38G>C, XM_005253365.1:c.38G>T, XM_006719069.2:c.38G>A, XM_006719069.2:c.38G>C, XM_006719069.2:c.38G>T, XM_011520653.1:c.38G>A, XM_011520653.1:c.38G>C, XM_011520653.1:c.38G>T, XP_005253422.1:p.Gly13Ala, XP_005253422.1:p.Gly13Asp, XP_005253422.1:p.Gly13Val, XP_006719132.1:p.Gly13Ala, XP_006719132.1:p.Gly13Asp, XP_006719132.1:p.Gly13Val, XP_011518955.1:p.Gly13Ala, XP_011518955.1:p.Gly13Asp, XP_011518955.1:p.Gly13Val
C > A
C > G
C > T
No VIP available No Clinical Annotations available VA
rs1127648 NC_000015.10:g.75674754A>G, NC_000015.9:g.75967095A>G, NM_001897.4:c.*796T>C, rs17591523, rs3183827, rs59364090
A > G
rs1128503 NC_000007.13:g.87179601A>G, NC_000007.14:g.87550285A>G, NG_011513.1:g.167964T>C, NM_000927.4:c.1236T>C, NP_000918.2:p.Gly412=, rs116989428, rs17276907, rs2032587, rs2229105, rs28365046, rs386518005, rs58257317
A > G
No VIP available CA VA
rs11563250 NC_000002.11:g.234683350A>G, NC_000002.12:g.233774704A>G, NG_002601.2:g.189961A>G, NG_033238.1:g.19432A>G, NM_001287395.1:c.-1068A>G, XM_011511080.1:c.-1068A>G, XM_291007.11:c.-1068A>G, rs35837558
A > G
No VIP available No Clinical Annotations available VA
(CA)16 > (CA)14
(CA)16 > (CA)15
(CA)16 > (CA)17
(CA)16 > (CA)18
(CA)16 > (CA)19
(CA)16 > (CA)20
(CA)16 > (CA)21
(CA)16 > (CA)22
(CA)16 > (CA)23
(CA)16 > (CA)9
No VIP available CA VA
rs11692021 NC_000002.11:g.234591205T>C, NC_000002.12:g.233682559T>C, NG_002601.2:g.97816T>C, NM_019075.2:c.855+45182T>C, NM_019076.4:c.855+63997T>C, NM_019077.2:c.622T>C, NM_021027.2:c.855+9770T>C, NP_061950.2:p.Trp208Arg, XM_005246081.1:c.622T>C, XP_005246138.1:p.Trp208Arg, XR_241241.1:n.941+9770T>C, rs17863779, rs57605148
T > C
No VIP available No Clinical Annotations available VA
rs11722476 NC_000004.11:g.95170839G>A, NC_000004.12:g.94249688G>A, NG_031945.1:g.47081G>A, NM_001128429.2:c.740G>A, NM_001128430.1:c.740G>A, NM_020159.4:c.740G>A, NP_001121901.1:p.Ser247Asn, NP_001121902.1:p.Ser247Asn, NP_064544.2:p.Ser247Asn, NR_045644.1:n.1066G>A, XR_938765.1:n.995G>A, XR_938766.1:n.995G>A, rs17854343, rs52806084, rs60379623
G > -
G > A
No VIP available CA No Variant Annotations available
rs11942466 NC_000004.11:g.75422078C>A, NC_000004.12:g.74556361C>A, NW_003571035.1:g.39869C>A
C > A
No VIP available No Clinical Annotations available VA
rs11979430 NC_000007.13:g.80509256C>T, NC_000007.14:g.80879940C>T, NM_006379.3:c.103+36739G>A, XM_005250112.1:c.157+36739G>A, XM_005250113.1:c.-72+25889G>A, rs56476176, rs57935337
C > T
No VIP available CA No Variant Annotations available
rs13104811 NC_000004.11:g.75395312G>A, NC_000004.12:g.74529595G>A, NW_003571035.1:g.13103G>A
G > A
No VIP available CA No Variant Annotations available
rs1353295 NC_000004.11:g.75329122G>A, NC_000004.12:g.74463405G>A, rs1797595, rs59361263
G > A
No VIP available CA VA
rs1517114 NC_000008.10:g.69389217C>G, NC_000008.11:g.68476982C>G, NM_001195639.1:c.736+8162C>G, NM_052958.2:c.736+8162C>G, XM_005251149.1:c.736+8162C>G, XM_011517445.1:c.736+8162C>G, XM_011517446.1:c.736+8162C>G, XM_011517447.1:c.736+8162C>G, XM_011517448.1:c.608-11041C>G, XM_011517449.1:c.736+8162C>G, XM_011517450.1:c.736+8162C>G, XM_011517452.1:c.736+8162C>G, XR_928756.1:n.794+8162C>G, rs4292667, rs61127031
C > G
No VIP available No Clinical Annotations available VA
rs1532268 NC_000005.10:g.7878066C>T, NC_000005.9:g.7878179C>T, NG_008856.1:g.13963C>T, NM_002454.2:c.524C>T, NM_024010.2:c.605C>T, NP_002445.2:p.Ser175Leu, NP_076915.2:p.Ser202Leu, NR_134480.1:n.647C>T, NR_134481.1:n.661C>T, NR_134482.1:n.507C>T, XM_005248304.1:c.569C>T, XM_005248305.1:c.524C>T, XM_006714474.2:c.605C>T, XM_011514043.1:c.605C>T, XM_011514044.1:c.524C>T, XM_011514045.1:c.605C>T, XP_005248361.1:p.Ser190Leu, XP_005248362.1:p.Ser175Leu, XP_006714537.1:p.Ser202Leu, XP_011512345.1:p.Ser202Leu, XP_011512346.1:p.Ser175Leu, XP_011512347.1:p.Ser202Leu, XR_241701.1:n.627C>T, XR_241702.1:n.627C>T, XR_241703.1:n.620C>T, XR_925614.1:n.627C>T, XR_925615.1:n.627C>T, rs58799540
C > -
C > T
No VIP available No Clinical Annotations available VA
rs1570360 NC_000006.11:g.43737830A>G, NC_000006.12:g.43770093A>G, NG_008732.1:g.4878A>G, NM_001025366.2:c.-614A>G, NM_001025367.2:c.-614A>G, NM_001025368.2:c.-614A>G, NM_001025369.2:c.-614A>G, NM_001025370.2:c.-614A>G, NM_001033756.2:c.-614A>G, NM_001171622.1:c.-614A>G, NM_001171623.1:c.-1154A>G, NM_001171624.1:c.-1154A>G, NM_001171625.1:c.-1154A>G, NM_001171626.1:c.-1154A>G, NM_001171627.1:c.-1154A>G, NM_001171628.1:c.-1154A>G, NM_001171629.1:c.-1154A>G, NM_001171630.1:c.-1154A>G, NM_001204384.1:c.-1154A>G, NM_001204385.1:c.-614A>G, NM_001287044.1:c.-2027A>G, NM_001317010.1:c.-1154A>G, NM_003376.5:c.-614A>G, XM_005249363.1:c.-2027A>G, rs36208386, rs58036053
A > G
No VIP available No Clinical Annotations available VA
rs162036 NC_000005.10:g.7885846A>G, NC_000005.9:g.7885959A>G, NG_008856.1:g.21743A>G, NM_002454.2:c.1049A>G, NM_024010.2:c.1130A>G, NP_002445.2:p.Lys350Arg, NP_076915.2:p.Lys377Arg, NR_134480.1:n.1172A>G, NR_134481.1:n.1186A>G, NR_134482.1:n.1032A>G, XM_005248304.1:c.1094A>G, XM_005248305.1:c.1049A>G, XM_006714474.2:c.1130A>G, XM_011514043.1:c.1130A>G, XM_011514044.1:c.1049A>G, XM_011514045.1:c.*103A>G, XP_005248361.1:p.Lys365Arg, XP_005248362.1:p.Lys350Arg, XP_006714537.1:p.Lys377Arg, XP_011512345.1:p.Lys377Arg, XP_011512346.1:p.Lys350Arg, XR_241701.1:n.1152A>G, XR_241702.1:n.1152A>G, XR_241703.1:n.1145A>G, XR_925614.1:n.1152A>G, XR_925615.1:n.1152A>G, rs1189017, rs16879313, rs327619, rs329836, rs52821116, rs61092918, rs696311
A > -
A > G
No VIP available No Clinical Annotations available VA
rs1661167 NC_000019.10:g.44548749A>G, NC_000019.9:g.45052068G>A, NR_027754.2:n.498+149C>T, NR_027754.2:n.498+149T>C, rs111180091, rs386540506, rs57455473, rs60630023
G > A
No VIP available CA VA
rs16950650 NC_000013.10:g.95775432C>T, NC_000013.11:g.95123178C>T, NM_001105515.2:c.2456-7177G>A, NM_001301829.1:c.2315-7177G>A, NM_001301830.1:c.2231-7177G>A, NM_005845.4:c.2456-7177G>A, XM_005254025.1:c.2327-7177G>A, XM_005254025.2:c.2327-7177G>A, XM_005254026.1:c.2315-7177G>A, XM_005254027.1:c.2231-7177G>A, XM_005254028.1:c.2231-7177G>A, XM_006719914.1:c.2366-7177G>A, XM_011521047.1:c.1907-7177G>A, rs56643033, rs58582224
C > T
No VIP available No Clinical Annotations available VA
rs17287570 NC_000016.10:g.16061246A=, NC_000016.10:g.16061246A>C, NC_000016.9:g.16155103A>C, NG_028268.1:g.116670A=, NG_028268.1:g.116670A>C, NM_004996.3:c.1677+4951A>C, NM_004996.3:c.1677+4951C>A, NT_187607.1:g.1719137C=, NT_187607.1:g.1719137C>A, XM_005255326.1:c.1677+4951A>C, XM_005255327.1:c.1551+4951A>C, XM_005255328.1:c.1539+4951A>C, XM_005255329.1:c.1677+4951A>C, XM_011522497.1:c.1653+4951A>C, XM_011522497.1:c.1653+4951C>A, XM_011522498.1:c.1731+4951A>C, XM_011522498.1:c.1731+4951C>A, rs57882411
A > C
No VIP available No Clinical Annotations available VA
rs17376848 NC_000001.10:g.97915624A>G, NC_000001.11:g.97450068A>G, NG_008807.2:g.475992T>C, NM_000110.3:c.1896T>C, NP_000101.2:p.Phe632=, XM_005270561.1:c.1785T>C, XM_005270562.1:c.1680T>C, XM_005270562.3:c.1680T>C, XM_005270563.1:c.1896T>C, XM_006710397.2:c.1896T>C, XP_005270618.1:p.Phe595=, XP_005270619.1:p.Phe560=, XP_005270619.2:p.Phe560=, XP_005270620.1:p.Phe632=, XP_006710460.1:p.Phe632=, rs117467766, rs52815410, rs58485702
A > G
No VIP available CA VA
rs17574269 NC_000006.11:g.117816128A>G, NC_000006.12:g.117494965A>G, NM_173674.2:c.113-8802A>G, XM_005266941.1:c.254-8802A>G, XM_005266942.1:c.254-8802A>G, XM_006715463.1:c.254-8802A>G, XM_011535770.1:c.119-8802A>G, XM_011535771.1:c.-44-8802A>G, XM_011535772.1:c.-44-8802A>G, XM_011535773.1:c.254-8802A>G, XM_011535774.1:c.254-8802A>G, rs58365592
A > G
No VIP available No Clinical Annotations available VA
rs17868323 NC_000002.11:g.234590970T>G, NC_000002.12:g.233682324T>G, NG_002601.2:g.97581T>G, NM_019075.2:c.855+44947T>G, NM_019076.4:c.855+63762T>G, NM_019077.2:c.387T>G, NM_021027.2:c.855+9535T>G, NP_061950.2:p.Asn129Lys, XM_005246081.1:c.387T>G, XP_005246138.1:p.Asn129Lys, XR_241241.1:n.941+9535T>G
T > G
No VIP available No Clinical Annotations available VA
rs1801394 NC_000005.10:g.7870860A>G, NC_000005.9:g.7870973A>G, NG_008856.1:g.6757A>G, NG_033101.1:g.3178T>C, NM_002454.2:c.66A>G, NM_024010.2:c.147A>G, NM_024091.3:c.-1995T>C, NP_002445.2:p.Ile22Met, NP_076915.2:p.Ile49Met, NR_036553.1:n.-1823T>C, NR_073608.1:n.-1823T>C, NR_134480.1:n.203A>G, NR_134481.1:n.203A>G, NR_134482.1:n.203A>G, XM_005248304.1:c.111A>G, XM_005248305.1:c.66A>G, XM_006714474.2:c.147A>G, XM_006714498.1:c.-1906T>C, XM_011514043.1:c.147A>G, XM_011514044.1:c.66A>G, XM_011514045.1:c.147A>G, XP_005248361.1:p.Ile37Met, XP_005248362.1:p.Ile22Met, XP_006714537.1:p.Ile49Met, XP_011512345.1:p.Ile49Met, XP_011512346.1:p.Ile22Met, XP_011512347.1:p.Ile49Met, XR_241701.1:n.169A>G, XR_241702.1:n.169A>G, XR_241703.1:n.162A>G, XR_427664.1:n.-1823T>C, XR_925614.1:n.169A>G, XR_925615.1:n.169A>G, rs52813630
A > G
No VIP available CA VA
rs1979277 NC_000017.10:g.18232096G>A, NC_000017.11:g.18328782G>A, NG_017111.1:g.39761C>T, NM_001281786.1:c.1006C>T, NM_004169.4:c.1420C>T, NM_148918.2:c.1303C>T, NP_001268715.1:p.Leu336Phe, NP_004160.3:p.Leu474Phe, NP_683718.1:p.Leu435Phe, XM_005256767.1:c.1420C>T, XM_005256767.2:c.1420C>T, XM_005256768.1:c.1006C>T, XM_011523992.1:c.1180C>T, XP_005256824.1:p.Leu474Phe, XP_005256825.1:p.Leu336Phe, XP_011522294.1:p.Leu394Phe, rs17850285, rs2230025, rs3183766, rs57933897
G > A
No VIP available No Clinical Annotations available VA
rs2010963 NC_000006.11:g.43738350C>G, NC_000006.12:g.43770613C>G, NG_008732.1:g.5398C>G, NM_001025366.2:c.-94C>G, NM_001025367.2:c.-94C>G, NM_001025368.2:c.-94C>G, NM_001025369.2:c.-94C>G, NM_001025370.2:c.-94C>G, NM_001033756.2:c.-94C>G, NM_001171622.1:c.-94C>G, NM_001171623.1:c.-634C>G, NM_001171624.1:c.-634C>G, NM_001171625.1:c.-634C>G, NM_001171626.1:c.-634C>G, NM_001171627.1:c.-634C>G, NM_001171628.1:c.-634C>G, NM_001171629.1:c.-634C>G, NM_001171630.1:c.-634C>G, NM_001204384.1:c.-634C>G, NM_001204385.1:c.-94C>G, NM_001287044.1:c.-1507C>G, NM_001317010.1:c.-634C>G, NM_003376.5:c.-94C>G, XM_005249363.1:c.-1507C>G
C > G
No VIP available No Clinical Annotations available VA
rs2018683 NC_000007.13:g.29014195G>T, NC_000007.14:g.28974579G>T, rs56487635, rs59311291
G > T
No VIP available No Clinical Annotations available VA
rs2032582 NC_000007.13:g.87160618A>C, NC_000007.13:g.87160618A>T, NC_000007.14:g.87531302A>C, NC_000007.14:g.87531302A>T, NG_011513.1:g.186947T>A, NG_011513.1:g.186947T>G, NM_000927.4:c.2677T>A, NM_000927.4:c.2677T>G, NP_000918.2:p.Ser893Ala, NP_000918.2:p.Ser893Thr, rs10228331, rs2229106, rs386553610, rs57135550, rs9641018
A > C
No VIP available CA VA
rs2070959 NC_000002.11:g.234602191A>G, NC_000002.12:g.233693545A>G, NG_002601.2:g.108802A>G, NM_001072.3:c.541A>G, NM_019075.2:c.855+56168A>G, NM_019076.4:c.856-73489A>G, NM_019077.2:c.855+10753A>G, NM_021027.2:c.855+20756A>G, NM_205862.1:c.-7-254A>G, NP_001063.2:p.Thr181Ala, XR_241240.1:n.702A>G, XR_241241.1:n.941+20756A>G, rs17683988, rs386556316, rs3903007, rs61246460
A > G
No VIP available No Clinical Annotations available VA
rs2166219 NC_000002.11:g.19617302T>C, NC_000002.12:g.19417541T>C, XR_939779.1:n.496-18349A>G, rs13008844, rs16986416, rs58751495
T > C
No VIP available CA VA
rs2231137 NC_000004.11:g.89061114C>T, NC_000004.12:g.88139962C>T, NG_032067.2:g.96361G>A, NM_001257386.1:c.34G>A, NM_004827.2:c.34G>A, NP_001244315.1:p.Val12Met, NP_004818.2:p.Val12Met, XM_005263354.1:c.34G>A, XM_005263354.2:c.34G>A, XM_005263355.1:c.34G>A, XM_005263355.2:c.34G>A, XM_005263356.1:c.34G>A, XM_005263356.2:c.34G>A, XM_011532420.1:c.34G>A, XP_005263411.1:p.Val12Met, XP_005263412.1:p.Val12Met, XP_005263413.1:p.Val12Met, XP_011530722.1:p.Val12Met
C > T
No VIP available No Clinical Annotations available VA
rs2231142 NC_000004.11:g.89052323G>T, NC_000004.12:g.88131171G>T, NG_032067.2:g.105152C>A, NM_001257386.1:c.421C>A, NM_004827.2:c.421C>A, NP_001244315.1:p.Gln141Lys, NP_004818.2:p.Gln141Lys, XM_005263354.1:c.421C>A, XM_005263354.2:c.421C>A, XM_005263355.1:c.421C>A, XM_005263355.2:c.421C>A, XM_005263356.1:c.421C>A, XM_005263356.2:c.421C>A, XM_011532420.1:c.421C>A, XP_005263411.1:p.Gln141Lys, XP_005263412.1:p.Gln141Lys, XP_005263413.1:p.Gln141Lys, XP_011530722.1:p.Gln141Lys, rs12721641, rs28365035, rs3736117, rs52809243, rs58973676
G > T
No VIP available CA VA
rs225440 NC_000021.8:g.43653053C>T, NC_000021.9:g.42232943C>T, NM_004915.3:c.286+7029C>T, NM_016818.2:c.286+7029C>T, NM_207174.1:c.319+7029C>T, NM_207627.1:c.292+7029C>T, NM_207628.1:c.220+7029C>T, NM_207629.1:c.277+7029C>T, XM_005261209.1:c.319+7029C>T, XM_011529806.1:c.319+7029C>T, XM_011529807.1:c.319+7029C>T, rs3827226, rs386562698, rs474673, rs56980987, rs872748
C > T
No VIP available CA VA
rs2273697 NC_000010.10:g.101563815G>A, NC_000010.11:g.99804058G>A, NG_011798.1:g.26353G>A, NM_000392.4:c.1249G>A, NP_000383.1:p.Val417Ile, XM_005269536.1:c.1249G>A, XM_006717630.2:c.553G>A, XM_006717631.2:c.1249G>A, XM_011539291.1:c.1249G>A, XP_005269593.1:p.Val417Ile, XP_006717693.1:p.Val185Ile, XP_006717694.1:p.Val417Ile, XP_011537593.1:p.Val417Ile, XR_945604.1:n.1438G>A, XR_945605.1:n.1440G>A, rs17216184, rs60620335
G > A
No VIP available CA VA
rs2292997 NC_000003.11:g.183724072G>A, NC_000003.12:g.184006284G>A, NM_001023587.2:c.129+7980C>T, NM_001320032.1:c.-1403+7980C>T, NM_005688.3:c.129+7980C>T, NR_046570.1:n.-54G>A, NR_135125.1:n.315+7980C>T, XM_005247058.1:c.129+7980C>T, XM_005247058.3:c.129+7980C>T, XM_005247059.1:c.129+7980C>T, XM_005247059.3:c.129+7980C>T, XM_005247060.1:c.129+7980C>T, XM_005247061.1:c.129+7980C>T, XM_005247062.1:c.-1403+7980C>T, XM_011512314.1:c.129+7980C>T, XM_011512315.1:c.129+7980C>T, XM_011512316.1:c.-1403+7980C>T, rs17750557, rs56715946
G > A
No VIP available No Clinical Annotations available VA
rs2302273 NC_000005.10:g.150155692G>A, NC_000005.9:g.149535255G>A, NG_023367.1:g.5168C>T, NM_002609.3:c.-302C>T, XM_005268464.1:c.-448C>T, XM_005268464.2:c.-448C>T, XM_011537659.1:c.-769C>T, rs56934659
G > A
rs2306283 NC_000012.11:g.21329738A>G, NC_000012.12:g.21176804A>G, NG_011745.1:g.50611A>G, NM_006446.4:c.388A>G, NP_006437.3:p.Asn130Asp, rs17389242, rs52832430, rs60767041
A > G
No VIP available No Clinical Annotations available VA
rs2401863 NC_000014.8:g.90456188G>T, NC_000014.9:g.89989844G>T, NG_009164.1:g.38943G>T, NM_001008744.1:c.1366+79G>T, NM_018319.3:c.1366+79G>T, XM_005267847.1:c.1366+79G>T, XM_005267847.2:c.1366+79G>T, XM_005267848.1:c.1366+79G>T, XM_005267849.1:c.1366+79G>T, XM_006720197.2:c.1366+79G>T, XM_006720198.2:c.1366+79G>T, XM_006720199.1:c.571+79G>T, XM_006720200.2:c.571+79G>T, XM_011536941.1:c.1366+79G>T, XM_011536942.1:c.1366+79G>T, XM_011536943.1:c.1366+79G>T, XM_011536944.1:c.1366+79G>T, rs34560941, rs58608928
G > T
No VIP available No Clinical Annotations available VA
rs2622604 NC_000004.11:g.89078924T>C, NC_000004.12:g.88157772T>C, NG_032067.2:g.78551A>G, NM_001257386.1:c.-19-17758A>G, NM_004827.2:c.-20+614A>G, XM_005263354.1:c.-20+805A>G, XM_005263354.2:c.-20+805A>G, XM_005263355.1:c.-19-17758A>G, XM_005263355.2:c.-19-17758A>G, XM_005263356.1:c.-20+614A>G, XM_005263356.2:c.-20+614A>G, XM_011532420.1:c.-19-17758A>G, rs61481684
T > A
T > C
No VIP available No Clinical Annotations available VA
rs2661280 NC_000001.10:g.163113375G>C, NC_000001.11:g.163143585G>C, NG_027731.2:g.183207C>G, NM_001195303.2:c.*3757C>G, NM_001254748.1:c.*3757C>G, NM_001254749.1:c.*3757C>G, NM_003617.3:c.*3757C>G, rs17361582, rs56558782, rs57479307, rs60251204
G > C
No VIP available No Clinical Annotations available VA
rs2745761 NC_000020.10:g.8277943G>C, NC_000020.11:g.8297296G>C, NG_028168.1:g.169648G>C, NM_015192.3:c.178-74086G>C, NM_182734.2:c.178-74086G>C, XM_005260681.1:c.178-74086G>C, XM_011529199.1:c.178-74086G>C, XM_011529202.1:c.178-74086G>C, rs61713950
G > A
G > C
No VIP available CA VA
rs3025039 NC_000006.11:g.43752536C>T, NC_000006.12:g.43784799C>T, NG_008732.1:g.19584C>T, NM_001025366.2:c.*237C>T, NM_001025367.2:c.*237C>T, NM_001025368.2:c.*237C>T, NM_001025369.2:c.*253C>T, NM_001025370.2:c.*237C>T, NM_001033756.2:c.*171C>T, NM_001171622.1:c.*237C>T, NM_001171623.1:c.*237C>T, NM_001171624.1:c.*237C>T, NM_001171625.1:c.*237C>T, NM_001171626.1:c.*237C>T, NM_001171627.1:c.*253C>T, NM_001171628.1:c.*237C>T, NM_001171629.1:c.*171C>T, NM_001171630.1:c.*237C>T, NM_001204384.1:c.*237C>T, NM_001204385.1:c.*237C>T, NM_001287044.1:c.*237C>T, NM_001317010.1:c.*171C>T, NM_003376.5:c.*237C>T, XM_005249363.1:c.*237C>T, rs11575898
C > T
No VIP available No Clinical Annotations available VA
rs329007 NC_000018.10:g.9522608G>A, NC_000018.9:g.9522606G>A, NM_006788.3:c.1053+99G>A, XM_005258080.1:c.1053+99G>A, rs59437962
G > A
No VIP available No Clinical Annotations available VA
No VIP available CA VA
rs3740066 NC_000010.10:g.101604207C>T, NC_000010.11:g.99844450C>T, NG_011798.1:g.66745C>T, NM_000392.4:c.3972C>T, NP_000383.1:p.Ile1324=, XM_005269536.1:c.3693C>T, XM_006717630.2:c.3276C>T, XP_005269593.1:p.Ile1231=, XP_006717693.1:p.Ile1092=, XR_945604.1:n.4161C>T, XR_945605.1:n.4036C>T, rs12780340, rs17216303, rs59292214
C > T
No VIP available CA VA
rs3749438 NC_000003.11:g.183705184G>A, NC_000003.12:g.183987396G>A, NM_001023587.2:c.591+374C>T, NM_001320032.1:c.-941+374C>T, NM_005688.3:c.591+374C>T, NR_135125.1:n.777+374C>T, XM_005247058.1:c.591+374C>T, XM_005247058.3:c.591+374C>T, XM_005247059.1:c.591+374C>T, XM_005247059.3:c.591+374C>T, XM_005247060.1:c.591+374C>T, XM_005247061.1:c.591+374C>T, XM_005247062.1:c.-941+374C>T, XM_011512314.1:c.591+374C>T, XM_011512315.1:c.591+374C>T, XM_011512316.1:c.-941+374C>T, rs117658700, rs17218232, rs60372003
G > A
No VIP available No Clinical Annotations available VA
rs3813627 NC_000001.10:g.161195148G>T, NC_000001.11:g.161225358G>T, NG_012043.1:g.3271C>A, NM_001286373.1:c.-914G>T, NM_001286374.1:c.-914G>T, NM_001643.1:c.-1788C>A, NM_032174.5:c.-914G>T, NR_049819.1:n.-1828G>T, XM_005245536.1:c.-814G>T, XM_005245537.1:c.-914G>T, XM_005245538.1:c.-1005G>T, XM_006711572.1:c.-793G>T, XM_011510057.1:c.-793G>T
G > T
No VIP available No Clinical Annotations available VA
rs3813628 NC_000001.10:g.161196166A>C, NC_000001.11:g.161226376A>C, NG_012043.1:g.2253T>G, NM_001286373.1:c.-114A>C, NM_001286374.1:c.-114A>C, NM_032174.5:c.-114A>C, NR_049819.1:n.-810A>C, XM_005245536.1:c.-35-79A>C, XM_005245537.1:c.-114A>C, XM_005245538.1:c.-205A>C, XM_006711572.1:c.-14-100A>C, XM_011510057.1:c.-14-100A>C, rs57851595
A > C
No VIP available CA VA
rs3832043 NC_000002.11:g.234580454delT, NC_000002.12:g.233671808delT, NG_002601.2:g.87065delT, NM_019075.2:c.855+34431del, NM_019075.2:c.855+34431delT, NM_019076.4:c.855+53246del, NM_019076.4:c.855+53246delT, NM_021027.2:c.-127del, NM_021027.2:c.-127delT, XR_241241.1:n.-41delT, rs150487502, rs35426722, rs371526135, rs57111427, rs67695772, rs67695773
T > -
No VIP available No Clinical Annotations available VA
rs3918305 NC_000012.11:g.109331162C>T, NC_000012.12:g.108937386C>T, NM_018711.4:c.898-49G>A, rs59527033
C > T
No VIP available CA VA
rs4124874 NC_000002.11:g.234665659T>G, NC_000002.12:g.233757013T>G, NG_002601.2:g.172270T>G, NG_033238.1:g.1741T>G, NM_001072.3:c.862-10021T>G, NM_007120.2:c.868-10021T>G, NM_019075.2:c.856-10021T>G, NM_019076.4:c.856-10021T>G, NM_019077.2:c.856-10021T>G, NM_019078.1:c.868-10021T>G, NM_019093.2:c.868-10021T>G, NM_021027.2:c.856-10021T>G, NM_205862.1:c.61-10021T>G, NR_037694.1:n.-1668A>C, NR_037695.1:n.-1668A>C, NR_037696.1:n.-1668A>C, XR_241238.1:n.924-10021T>G, XR_241240.1:n.1023-10021T>G, XR_241241.1:n.942-10021T>G, rs57409706
T > G
rs4148323 NC_000002.11:g.234669144G>A, NC_000002.12:g.233760498G>A, NG_002601.2:g.175755G>A, NG_033238.1:g.5226G>A, NM_000463.2:c.211G>A, NM_001072.3:c.862-6536G>A, NM_007120.2:c.868-6536G>A, NM_019075.2:c.856-6536G>A, NM_019076.4:c.856-6536G>A, NM_019077.2:c.856-6536G>A, NM_019078.1:c.868-6536G>A, NM_019093.2:c.868-6536G>A, NM_021027.2:c.856-6536G>A, NM_205862.1:c.61-6536G>A, NP_000454.1:p.Gly71Arg, XR_241238.1:n.924-6536G>A, XR_241239.1:n.233G>A, XR_241240.1:n.1023-6536G>A, XR_241241.1:n.942-6536G>A, rs113525835, rs34360183, rs58105808, rs58585123
G > A
rs4149015 NC_000012.11:g.21283322G>A, NC_000012.12:g.21130388G>A, NG_011745.1:g.4195G>A, NM_006446.4:c.-910G>A
G > A
rs4149056 NC_000012.11:g.21331549T>C, NC_000012.12:g.21178615T>C, NG_011745.1:g.52422T>C, NM_006446.4:c.521T>C, NP_006437.3:p.Val174Ala, rs52816141, rs60037639
T > C
No VIP available No Clinical Annotations available VA
rs425215 NC_000021.8:g.43707101C>G, NC_000021.9:g.42286991C>G, NM_004915.3:c.974-898C>G, NM_016818.2:c.974-898C>G, NM_207174.1:c.1007-898C>G, NM_207627.1:c.980-898C>G, NM_207628.1:c.908-898C>G, NM_207629.1:c.965-898C>G, XM_005261209.1:c.1007-898C>G, XM_011529806.1:c.1007-898C>G, XM_011529807.1:c.1007-898C>G, rs17767113, rs59807195, rs690665
C > G
No VIP available CA VA
rs45445694 NC_000018.10:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NC_000018.9:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NG_028255.1:g.5043_5070CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NM_001012716.2:c.*34+169_*34+196CGGGACGGAGGCAGGCCAAGTGGCGCGG[2][3][4][7][8][9], NM_001071.2:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258137.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258138.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9]
No VIP available No Clinical Annotations available VA
rs4655567 NC_000001.10:g.68101640G>C, NC_000001.11:g.67635957G>C, rs57378090, rs57576059
G > C
No VIP available No Clinical Annotations available VA
rs4702484 NC_000005.10:g.7649747C>T, NC_000005.9:g.7649860C>T, NM_020546.2:c.720+23431C>T, XM_011513942.1:c.720+23431C>T, XR_427657.2:n.734+23431C>T, rs57296477
C > T
No VIP available No Clinical Annotations available VA
rs562 NC_000003.11:g.183637845T>C, NC_000003.12:g.183920057T>C, NM_001320032.1:c.*1243A>G, NM_005688.3:c.*1243A>G, XM_005247058.1:c.*1243A>G, XM_005247058.3:c.*1243A>G, XM_005247059.1:c.*1243A>G, XM_005247059.3:c.*1243A>G, XM_005247060.1:c.*1243A>G, XM_005247062.1:c.*1243A>G, XM_011512314.1:c.*1243A>G, XM_011512316.1:c.*1243A>G, rs17675, rs3193906, rs3805113, rs59910781
T > C
No VIP available No Clinical Annotations available VA
rs576523 NC_000001.10:g.160746076G>A, NC_000001.11:g.160776286G>A, XR_922204.1:n.447C>T, XR_922205.1:n.414+33C>T, XR_922206.1:n.447C>T, rs56592820, rs57939783, rs58334060
G > A
No VIP available CA VA
rs6072262 NC_000020.10:g.39704995G>A, NC_000020.11:g.41076355G>A, NG_012262.1:g.52534G>A, NM_003286.2:c.279+61G>A, XM_005260541.1:c.183+61G>A
G > A
No VIP available No Clinical Annotations available VA
rs61764370 NC_000012.11:g.25360224A>C, NC_000012.12:g.25207290A>C, NG_007524.1:g.48631T>G, NM_004985.4:c.*2505T>G, NM_033360.3:c.*2626T>G, XM_011520653.1:c.*2505T>G, rs200812391
A > C
No VIP available No Clinical Annotations available VA
rs6759892 NC_000002.11:g.234601669T>G, NC_000002.12:g.233693023T>G, NG_002601.2:g.108280T>G, NM_001072.3:c.19T>G, NM_019075.2:c.855+55646T>G, NM_019076.4:c.856-74011T>G, NM_019077.2:c.855+10231T>G, NM_021027.2:c.855+20234T>G, NM_205862.1:c.-7-776T>G, NP_001063.2:p.Ser7Ala, XR_241240.1:n.180T>G, XR_241241.1:n.941+20234T>G, rs17670302, rs60624335
T > G
No VIP available CA VA
rs699947 NC_000006.11:g.43736389A>C, NC_000006.12:g.43768652A>C, NG_008732.1:g.3437A>C, NM_001025366.2:c.-2055A>C, NM_001025367.2:c.-2055A>C, NM_001025368.2:c.-2055A>C, NM_001025369.2:c.-2055A>C, NM_001025370.2:c.-2055A>C, NM_001033756.2:c.-2055A>C, NM_001171622.1:c.-2055A>C, NM_001171623.1:c.-2595A>C, NM_001171624.1:c.-2595A>C, NM_001171625.1:c.-2595A>C, NM_001171626.1:c.-2595A>C, NM_001171627.1:c.-2595A>C, NM_001171628.1:c.-2595A>C, NM_001171629.1:c.-2595A>C, NM_001171630.1:c.-2595A>C, NM_001204384.1:c.-2595A>C, NM_001204385.1:c.-2055A>C, NM_001317010.1:c.-2595A>C, NM_003376.5:c.-2055A>C, rs1310065, rs36208051, rs61399354
A > C
No VIP available CA No Variant Annotations available
rs712829 NC_000007.13:g.55086755G>T, NC_000007.14:g.55019062G>T, NG_007726.3:g.5031G>T, NM_005228.3:c.-216G>T, NM_201282.1:c.-216G>T, NM_201283.1:c.-216G>T, NM_201284.1:c.-216G>T, XM_005271746.1:c.-216G>T, XM_005271748.1:c.-216G>T, rs17288931
G > T
No VIP available CA VA
rs712830 NC_000007.13:g.55086780A>C, NC_000007.14:g.55019087A>C, NG_007726.3:g.5056A>C, NM_005228.3:c.-191A>C, NM_201282.1:c.-191A>C, NM_201283.1:c.-191A>C, NM_201284.1:c.-191A>C, XM_005271746.1:c.-191A>C, XM_005271748.1:c.-191A>C, rs17288938
A > C
No VIP available No Clinical Annotations available VA
rs717620 NC_000010.10:g.101542578C>T, NC_000010.11:g.99782821C>T, NG_011798.1:g.5116C>T, NM_000392.4:c.-24C>T, XM_005269536.1:c.-24C>T, XM_006717631.2:c.-24C>T, XM_011539291.1:c.-24C>T, XR_945604.1:n.166C>T, XR_945605.1:n.168C>T, rs17216163, rs386485129, rs58371376
C > T
No VIP available CA VA
rs7186128 NC_000016.10:g.16864058G=, NC_000016.10:g.16864058G>A, NC_000016.9:g.16957915G>A, NT_187607.1:g.2524971A=, NT_187607.1:g.2524971A>G, rs56576370, rs57245322, rs58011988
G > A
No VIP available No Clinical Annotations available VA
rs75017182 NC_000001.10:g.98045449G>C, NC_000001.11:g.97579893G>C, NG_008807.2:g.346167C>G, NM_000110.3:c.1129-5923C>G, XM_005270561.1:c.1018-5923C>G, XM_005270562.1:c.1129-5923C>G, XM_005270562.3:c.1129-5923C>G, XM_005270563.1:c.1129-5923C>G, XM_005270564.1:c.1129-5923C>G, XM_006710397.2:c.1129-5923C>G
G > C
No VIP available No Clinical Annotations available VA
rs7586110 NC_000002.11:g.234590527T>G, NC_000002.12:g.233681881T>G, NG_002601.2:g.97138T>G, NM_019075.2:c.855+44504T>G, NM_019076.4:c.855+63319T>G, NM_019077.2:c.-57T>G, NM_021027.2:c.855+9092T>G, XM_005246081.1:c.-57T>G, XR_241241.1:n.941+9092T>G, rs60348498
T > G
No VIP available No Clinical Annotations available VA
rs768172 NC_000007.13:g.95805703A>T, NC_000007.14:g.96176391A>T, NG_012247.1:g.150757T>A, NM_001160210.1:c.1181-4867T>A, NM_014251.2:c.1178-4867T>A, NR_027662.1:n.1253-4867T>A, XM_006715831.2:c.1211-4867T>A, XM_011515727.1:c.1211-4867T>A, XM_011515728.1:c.326-4867T>A, rs118193516, rs59685268
A > T
No VIP available CA VA
rs7699188 NC_000004.11:g.89096061G>A, NC_000004.12:g.88174909G>A, NG_032067.2:g.61414C>T, NM_001257386.1:c.-19-34895C>T, XM_005263355.1:c.-19-34895C>T, XM_005263355.2:c.-19-34895C>T, XM_011532420.1:c.-19-34895C>T, rs57955088
G > A
G > C
rs776746 NC_000007.13:g.99270539C>T, NC_000007.14:g.99672916T>C, NG_007938.1:g.12083G=, NG_007938.1:g.12083G>A, NM_000777.4:c.219-237A>G, NM_000777.4:c.219-237G>A, NM_001190484.2:c.219-237A>G, NM_001190484.2:c.219-237G>A, NM_001291829.1:c.-253-1A>G, NM_001291829.1:c.-253-1G>A, NM_001291830.1:c.189-237A>G, NM_001291830.1:c.189-237G>A, NR_033807.2:n.717-1A>G, NR_033807.2:n.717-1G>A, NR_033808.1:n.689-1G>A, NR_033809.1:n.581-237G>A, NR_033810.1:n.689-1G>A, NR_033811.1:n.321-1G>A, NR_033812.1:n.321-1G>A, XM_005250169.1:c.189-237G>A, XM_005250170.1:c.-357-1G>A, XM_005250171.1:c.-253-1G>A, XM_005250172.1:c.-254G>A, XM_005250173.1:c.-331-237G>A, XM_005250198.1:c.806-4288C>T, XM_006715859.2:c.219-237A>G, XM_011515843.1:c.-254A>G, XM_011515844.1:c.-229-237A>G, XM_011515845.1:c.-463-1A>G, XM_011515846.1:c.-331-237A>G, XM_011515847.1:c.-571-1A>G, XR_927383.1:n.344-237A>G, XR_927402.1:n.1466+48736T>C, rs10361242, rs11266830, rs386613022, rs58244770
C > T
No VIP available CA VA
rs7779029 NC_000007.13:g.80532112T>C, NC_000007.14:g.80902796T>C, NM_006379.3:c.103+13883A>G, XM_005250112.1:c.157+13883A>G, XM_005250113.1:c.-72+3033A>G, rs61425409
T > C
No VIP available No Clinical Annotations available VA
rs7977213 NC_000012.11:g.20980800G>C, NC_000012.12:g.20827866G>C, NG_032071.1:g.22163G>C, NM_019844.3:c.84+12044G>C, XM_005253347.1:c.84+12044G>C, rs11502664, rs58558915
G > C
No VIP available No Clinical Annotations available VA
rs8020368 NC_000014.8:g.95943548T>C, NC_000014.9:g.95477211T>C, NM_152592.3:c.-1390A>G, XM_005267376.1:c.-14-1376A>G, XM_005267376.3:c.176-1376A>G, XM_005267377.1:c.-14-1376A>G, XM_005267377.2:c.-14-1376A>G, XM_005267378.1:c.-14-1376A>G, XM_005267379.1:c.-14-1376A>G, XM_005267380.1:c.-14-1376A>G, XM_006720063.2:c.-14-1376A>G, XM_011536513.1:c.176-1376A>G, XM_011536514.1:c.176-1376A>G, XM_011536515.1:c.11-1376A>G, XM_011536516.1:c.176-1376A>G, rs56427699, rs58836477, rs59378010
T > C
No VIP available No Clinical Annotations available VA
rs8101143 NC_000019.10:g.21773334G>A, NC_000019.9:g.21956136G>A, NW_003315964.2:g.134524G>A, rs17686410, rs58479809
G > A
(TA)6 > (TA)5
(TA)6 > (TA)7
(TA)6 > (TA)8
No VIP available No Clinical Annotations available VA
rs833061 NC_000006.11:g.43737486C>T, NC_000006.12:g.43769749C>T, NG_008732.1:g.4534C>T, NM_001025366.2:c.-958C>T, NM_001025367.2:c.-958C>T, NM_001025368.2:c.-958C>T, NM_001025369.2:c.-958C>T, NM_001025370.2:c.-958C>T, NM_001033756.2:c.-958C>T, NM_001171622.1:c.-958C>T, NM_001171623.1:c.-1498C>T, NM_001171624.1:c.-1498C>T, NM_001171625.1:c.-1498C>T, NM_001171626.1:c.-1498C>T, NM_001171627.1:c.-1498C>T, NM_001171628.1:c.-1498C>T, NM_001171629.1:c.-1498C>T, NM_001171630.1:c.-1498C>T, NM_001204384.1:c.-1498C>T, NM_001204385.1:c.-958C>T, NM_001317010.1:c.-1498C>T, NM_003376.5:c.-958C>T, rs36208046, rs60746584
C > T
No VIP available CA VA
rs861539 NC_000014.8:g.104165753G>A, NC_000014.9:g.103699416G>A, NG_011516.1:g.21071C>T, NG_012307.1:g.75229G>A, NM_001100118.1:c.722C>T, NM_001100119.1:c.722C>T, NM_001130107.1:c.1782-1239G>A, NM_005432.3:c.722C>T, NM_182923.3:c.1651-1239G>A, NP_001093588.1:p.Thr241Met, NP_001093589.1:p.Thr241Met, NP_005423.1:p.Thr241Met, XM_005267599.1:c.1924-1239G>A, XM_005267600.1:c.*17-1239G>A, XM_005267602.1:c.1897-1239G>A, XM_005267603.1:c.*17-1239G>A, XM_005267604.1:c.1857-1239G>A, XM_005267605.1:c.1849-1239G>A, XM_005267606.1:c.*17-1239G>A, XM_005267607.1:c.1830-1239G>A, XM_005267608.1:c.1825-1239G>A, XM_005267609.1:c.1822-1239G>A, XM_005267610.1:c.*46-1239G>A, XM_005267612.1:c.*17-1239G>A, XM_005267613.1:c.1758-1239G>A, XM_005267614.1:c.1755-1239G>A, XM_005267615.1:c.1726-1239G>A, XM_005267616.1:c.*17-1239G>A, XM_005267617.1:c.1699-1239G>A, XM_005267618.1:c.*17-1239G>A, XM_005267624.1:c.1624-1239G>A, XM_005268045.1:c.722C>T, XM_005268046.1:c.722C>T, XM_005268047.1:c.722C>T, XM_011537138.1:c.722C>T, XP_005268102.1:p.Thr241Met, XP_005268103.1:p.Thr241Met, XP_005268104.1:p.Thr241Met, XP_011535440.1:p.Thr241Met, rs1734804, rs17435402, rs17850783, rs3212111, rs56934996
G > A
No VIP available CA VA
rs9351963 NC_000006.11:g.73749861A>C, NC_000006.12:g.73040138A>C, NM_001160130.1:c.490-1798A>C, NM_001160132.1:c.490-1798A>C, NM_001160133.1:c.490-1798A>C, NM_001160134.1:c.490-1798A>C, NM_019842.3:c.490-1798A>C, XM_005248734.1:c.-9-1798A>C, XM_011535944.1:c.490-1798A>C
A > C
No VIP available CA VA
rs9597 NC_000016.10:g.1324950C>G, NC_000016.9:g.1374951C>G, NM_003345.4:c.*157C>G, NM_194259.2:c.*157C>G, NM_194260.2:c.*157C>G, NM_194261.2:c.*157C>G, XM_005255544.1:c.*157C>G, rs74248366
C > G
No VIP available CA No Variant Annotations available
rs9996584 NC_000004.11:g.75421961A>G, NC_000004.12:g.74556244A>G, NW_003571035.1:g.39752A>G
A > G
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 147


Generic Names
  • Irinotecan Hcl
  • Irinotecan Hydrochloride
  • Irinotecan Hydrochloride Trihydrate
  • Irinotecanum [INN-Latin]
  • irinotecan
Trade Names
  • CP0
  • Camptosar
Brand Mixture Names

PharmGKB Accession Id






Irinotecan is an antineoplastic enzyme inhibitor primarily used in the treatment of colorectal cancer. It is a derivative of camptothecin that inhibits the action of topoisomerase I. Irinotecan prevents religation of the DNA strand by binding to topoisomerase I-DNA complex, and causes double-strand DNA breakage and cell death.

Source: Drug Bank


For the treatment of metastatic colorectal cancer (first-line therapy when administered with 5-fluorouracil and leucovorin). Also used in combination with cisplatin for the treatment of extensive small cell lung cancer. Irinotecan is currently under investigation for the treatment of metastatic or recurrent cervical cancer.

Source: Drug Bank

Other Vocabularies

Information pulled from DrugBank has not been reviewed by PharmGKB.

Pharmacology, Interactions, and Contraindications

Mechanism of Action

Irinotecan inhibits the action of topoisomerase I. Irinotecan prevents religation of the DNA strand by binding to topoisomerase I-DNA complex. The formation of this ternary complex interferes with the moving replication fork, which induces replication arrest and lethal double-stranded breaks in DNA. As a result, DNA damage is not efficiently repaired and apoptosis (programmed cell death) occurs.

Source: Drug Bank


Irinotecan is an antineoplastic enzyme inhibitor primarily used in the treatment of colorectal cancer. Irinotecan is a semisynthetic derivative of camptothecin. Camptothecins interact specifically with topoisomerase I, an enzyme in the cell nucleus that regulates DNA topology and facilitates nuclear processes such as DNA replication, recombination, and repair. During these processes, topoisomerase I relieves torsional strain in DNA by inducing reversible single-strand breaks, allowing single DNA strands to pass through the break. The 3'-DNA terminus of the broken DNA strands bind covalently with the topoisomerase enzyme to form a catalytic intermediate called a cleavable complex. After the DNA is sufficiently relaxed and the strand passage reaction is complete, DNA topoisomerase reattaches the broken DNA strands to form the chemically unaltered topoisomers that allow transcription to proceed. Irinotecan and its active metabolite SN-38 bind to the topoisomerase I-DNA complex and prevent religation of these single-strand breaks. Current research suggests that the cytotoxicity of irinotecan is due to double-strand DNA damage produced during DNA synthesis when replication enzymes interact with the ternary complex formed by topoisomerase I, DNA, and either Irinotecan or SN-38. Mammalian cells cannot efficiently repair these double-strand breaks. The precise contribution of SN-38 to the activity of irinotecan in humans is not known. Irinotecan is cell cycle phase-specific (S-phase).

Source: Drug Bank

Absorption, Distribution, Metabolism, Elimination & Toxicity



Source: Drug Bank

Protein Binding


Source: Drug Bank



Source: Drug Bank


6-12 hours

Source: Drug Bank


Gastrointestinal complications, such as nausea, vomiting, abdominal cramping, diarrhea, and infection.

Source: Drug Bank

Route of Elimination

The cumulative biliary and urinary excretion of irinotecan and its metabolites (SN-38 and SN-38 glucuronide) over a period of 48 hours following administration of irinotecan in two patients ranged from approximately 25% (100 mg/m2) to 50% (300 mg/m2).

Source: Drug Bank

Chemical Properties

Chemical Formula


Source: Drug Bank

Canonical SMILES


Source: Drug Bank

Average Molecular Weight


Source: Drug Bank

Monoisotopic Molecular Weight


Source: Drug Bank



Source: Drug Bank

InChI String


Source: Drug Bank

PharmGKB Curated Pathways

Pathways created internally by PharmGKB based primarily on literature evidence.

  1. Irinotecan Pathway, Pharmacodynamics
    Model non-tissue specific cancer cell displaying genes which may be involved in the irinotecan pathway.
  1. Irinotecan Pathway, Pharmacokinetics
    Model human liver cell showing blood, bile and intestinal compartments, indicating tissue specific involvement of genes in the irinotecan pathway.

Genes that are associated with this drug in PharmGKB's database based on (1) variant annotations, (2) literature review, (3) pathways or (4) information automatically retrieved from DrugBank, depending on the "evidence" and "source" listed below.

Curated Information ?

Drug Targets

Gene Description
TOP1 (source: Drug Bank )
TOP1MT (source: Drug Bank )

Curated Information ?

No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available

Drug Interactions

Interaction Description
aprepitant - irinotecan Aprepitant may change levels of the chemotherapy agent, irinotecan. (source: Drug Bank )
atazanavir - irinotecan Increases levels/effect of irinotecan (source: Drug Bank )
atazanavir - irinotecan Increases levels/effect of irinotecan (source: Drug Bank )
fosphenytoin - irinotecan The hydantoin decreases the effect of irinotecan (source: Drug Bank )
ketoconazole - irinotecan Ketoconazole increases the effect and toxicity of irinotecan (source: Drug Bank )
ketoconazole - irinotecan Ketoconazole increases the effect and toxicity of irinotecan (source: Drug Bank )
phenytoin - irinotecan The hydantoin decreases the effect of irinotecan (source: Drug Bank )
phenytoin - irinotecan The hydantoin decreases the effect of irinotecan (source: Drug Bank )
telithromycin - irinotecan Telithromycin may reduce clearance of Irinotecan. Consider alternate therapy or monitor for changes in the therapeutic/adverse effects of Irinotecan if Telithromycin is initiated, discontinued or dose changed. (source: Drug Bank )
thiotepa - irinotecan Thiotepa, a strong CYP2B6 inhibitor, may decrease the metabolism and clearance of Irinotecan, a CYP2B6 substrate. Consider alternate therapy or monitor for changes in the therapeutic and adverse effects of Irinotecan if Thiotepa is initiated, discontinued or dose changed. (source: Drug Bank )
trastuzumab - irinotecan Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
voriconazole - irinotecan Voriconazole, a strong CYP3A4 inhibitor, may increase the serum concentration of irinotecan by decreasing its metabolism. Monitor for changes in the therapeutic and adverse effects of irinotecan if voriconazole is initiated, discontinued or dose changed. (source: Drug Bank )

Curated Information ?

No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Arrhythmias, Cardiac
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Arthritis, Rheumatoid
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Atrial Fibrillation
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Attention Deficit Disorder with Hyperactivity
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
biliary tract neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Bipolar Disorder
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Brain Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Breast Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
cancer or viral infections
No Dosing Guideline available DL CA VA No VIP available No VIP available
Carcinoma, Non-Small-Cell Lung
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Carcinoma, Renal Cell
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Carcinoma, Small Cell
No Dosing Guideline available DL CA VA No VIP available No VIP available
Colonic Neoplasms
No Dosing Guideline available DL CA VA No VIP available No VIP available
Colorectal Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Crigler-Najjar Syndrome
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Crohn Disease
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cystic Fibrosis
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Disease Progression
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Drug Resistance
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
Drug Toxicity
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Esophageal Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Esophogeal Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gallbladder Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gastrointestinal Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gastrointestinal Stromal Tumors
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genital Neoplasms, Female
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gilbert's syndrome
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Head and Neck Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Heart Failure
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HIV Infections
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Hyperbilirubinemia, Hereditary
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Hypereosinophilic Syndrome
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Hyperlipoproteinemia Type II
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Inflammatory Bowel Diseases
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Kidney Transplantation
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukemia, Lymphocytic, Chronic, B-Cell
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukemia, Myelogenous, Chronic, BCR-ABL Positive
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukemia, Myeloid, Acute
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukemia, Nonlymphocytic, Acute
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukemia, Promyelocytic, Acute
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Lung Neoplasms
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Lymphoma, Large B-Cell, Diffuse
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Lymphoma, Non-Hodgkin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Myelodysplastic Syndromes
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Nasopharyngeal Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Neoplasm Metastasis
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Neurotoxicity Syndromes
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Ocular Hypertension
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Ovarian Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
overall survival
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pancreatic Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Peripheral Vascular Diseases
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Precursor Cell Lymphoblastic Leukemia-Lymphoma
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
progression-free survival
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Prostatic Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pulmonary Disease, Chronic Obstructive
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pulmonary Fibrosis
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Rectal Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Sarcoma, Kaposi
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Sjogren's Syndrome
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Stevens-Johnson Syndrome
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Stomach Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Tuberculosis, Pulmonary
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Tumor Lysis Syndrome
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Urinary Incontinence
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available

Relationships from National Drug File - Reference Terminology (NDF-RT)

May Treat
Contraindicated With

Publications related to irinotecan: 190

No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pregnane X receptor, constitutive androstane receptor and hepatocyte nuclear factors as emerging players in cancer precision medicine. Pharmacogenomics. 2016. De Mattia Elena, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Effect of Single Nucleotide Polymorphisms in the Xenobiotic-sensing Receptors NR1I2 and NR1I3 on the Pharmacokinetics and Toxicity of Irinotecan in Colorectal Cancer Patients. Clinical pharmacokinetics. 2016. Mbatchi Litaty Céphanoée, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Impact of UGT1A1 genotype upon toxicities of combination with low-dose irinotecan plus platinum. Asia-Pacific journal of clinical oncology. 2016. Takano Masashi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
High Resectability Rate of Initially Unresectable Colorectal Liver Metastases After UGT1A1-Adapted High-Dose Irinotecan Combined with LV5FU2 and Cetuximab: A Multicenter Phase II Study (ERBIFORT). Annals of surgical oncology. 2016. Phelip Jean Marc, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Correlation of UGT1A1(*)28 and (*)6 polymorphisms with irinotecan-induced neutropenia in Thai colorectal cancer patients. Drug metabolism and pharmacokinetics. 2015. Atasilp Chalirmporn, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BRAF in metastatic colorectal cancer: the future starts now. Pharmacogenomics. 2015. Orlandi Armando. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Uncovering drug-responsive regulatory elements. Pharmacogenomics. 2015. Luizon Marcelo R, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ABCC5 and ABCG1 polymorphisms predict irinotecan-induced severe toxicity in metastatic colorectal cancer patients. Pharmacogenetics and genomics. 2015. Chen Sylvia, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
DPD and UGT1A1 deficiency in colorectal cancer patients receiving triplet chemotherapy with fluoropyrimidines, oxaliplatin and irinotecan. British journal of clinical pharmacology. 2015. Falvella Felicia Stefania, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Fluorouracil, leucovorin, and irinotecan plus cetuximab treatment and RAS mutations in colorectal cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2015. Van Cutsem Eric, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Clinical validation study of genetic markers for capecitabine efficacy in metastatic colorectal cancer patients. Pharmacogenetics and genomics. 2015. van Huis-Tanja Lieke H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Report of New Haplotype for ABCC2 Gene: rs17222723 and rs8187718 in cis. The Journal of molecular diagnostics : JMD. 2015. Pratt Victoria M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A novel UGT1 marker associated with better tolerance against irinotecan-induced severe neutropenia in metastatic colorectal cancer patients. The pharmacogenomics journal. 2015. Chen S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pre-treatment serum total bilirubin level as an indicator of optimal CPT-11 dosage. Cancer chemotherapy and pharmacology. 2015. Makihara Katsuya, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genes involved in pericyte-driven tumor maturation predict treatment benefit of first-line FOLFIRI plus bevacizumab in patients with metastatic colorectal cancer. The pharmacogenomics journal. 2015. Volz N B, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Relationship between UGT1A1*6/*28 polymorphisms and severe toxicities in Chinese patients with pancreatic or biliary tract cancer treated with irinotecan-containing regimens. Drug design, development and therapy. 2015. Yang Chen, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Correlation of UGT1A1 and ERCC1 gene polymorphisms with the outcome of combined irinotecan plus cisplatin treatment in recurrent ovarian cancer. Genetics and molecular research : GMR. 2015. Xu Q, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Molecular biomarkers in colorectal carcinoma. Pharmacogenomics. 2015. Puerta-García Elena, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association between Polymorphisms in Vascular Endothelial Growth Factor Gene and Response to Chemotherapies in Colorectal Cancer: A Meta-Analysis. PloS one. 2015. Wang Lei, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Prospective study of EGFR intron 1 (CA)n repeats variants as predictors of benefit from cetuximab and irinotecan in chemo-refractory metastatic colorectal cancer (mCRC) patients. The pharmacogenomics journal. 2014. Loupakis F, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UGT1A1 *6 polymorphism predicts outcome in elderly patients with relapsed or refractory diffuse large B-cell lymphoma treated with carboplatin, dexamethasone, etoposide and irinotecan. Annals of hematology. 2014. Yamasaki Satoshi, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Dose-Finding and Pharmacokinetic Study to Optimize the Dosing of Irinotecan According to the UGT1A1 Genotype of Patients With Cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2014. Innocenti Federico, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of solute carrier transporters in pancreatic cancer: a review. Pharmacogenomics. 2014. Lemstrová Radmila, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Associations between UGT1A1*6 or UGT1A1*6/*28 polymorphisms and irinotecan-induced neutropenia in Asian cancer patients. Cancer chemotherapy and pharmacology. 2014. Han Fei-fei, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The effect of the UGT1A1*28 allele on survival after irinotecan-based chemotherapy: a collaborative meta-analysis. The pharmacogenomics journal. 2014. Dias M M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UGT1A1*6 polymorphisms are correlated with irinotecan-induced toxicity: a system review and meta-analysis in Asians. Cancer chemotherapy and pharmacology. 2014. Cheng Lei, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
PharmGKB summary: very important pharmacogene information for UGT1A1. Pharmacogenetics and genomics. 2014. Barbarino Julia M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The association of UGT1A1*6 and UGT1A1*28 with irinotecan-induced neutropenia in Asians: a meta-analysis. Biomarkers : biochemical indicators of exposure, response, and susceptibility to chemicals. 2014. Chen Yi-Jing, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacokinetics, safety, and efficacy of FOLFIRI plus bevacizumab in Japanese colorectal cancer patients with UGT1A1 gene polymorphisms. Journal of clinical pharmacology. 2014. Suenaga Mitsukuni, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Prognostic advantage of irinotecan dose escalation according to uridine diphosphate glucuronosyltransferase 1A1 (UGT1A1) genotyping in patients with metastatic colorectal cancer treated with bevacizumab combined with 5-fluorouracil/leucovorin with irinotecan in a first-line setting. Translational research : the journal of laboratory and clinical medicine. 2014. Lu Chien-Yu, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Clinical Observations on Associations Between the UGT1A1 Genotype and Severe Toxicity of Irinotecan. Asian Pacific journal of cancer prevention : APJCP. 2014. Lu Yan-Yan, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
UGT1A1 genotype-guided phase I study of irinotecan, oxaliplatin, and capecitabine. Investigational new drugs. 2013. Goetz Matthew P, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Clinical significance of UGT1A1 gene polymorphisms on irinotecan-based regimens as the treatment in metastatic colorectal cancer. OncoTargets and therapy. 2014. Li Minmin, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Application of a combination of a knowledge-based algorithm and 2-stage screening to hypothesis-free genomic data on irinotecan-treated patients for identification of a candidate single nucleotide polymorphism related to an adverse effect. PloS one. 2014. Takahashi Hiro, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic diversity of the KIR/HLA system and outcome of patients with metastatic colorectal cancer treated with chemotherapy. PloS one. 2014. De Re Valli, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetics of ABC and SLC transporters in metastatic colorectal cancer patients receiving first-line FOLFIRI treatment. Pharmacogenetics and genomics. 2013. De Mattia Elena, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
S-1 plus irinotecan and oxaliplatin for the first-line treatment of patients with metastatic colorectal cancer: a prospective phase II study and pharmacogenetic analysis. British journal of cancer. 2013. Kim S Y, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Intergenic polymorphisms in the amphiregulin gene region as biomarkers in metastatic colorectal cancer patients treated with anti-EGFR plus irinotecan. The pharmacogenomics journal. 2013. Sebio A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Implications of Genome-Wide Association Studies in Cancer Therapeutics. British journal of clinical pharmacology. 2013. Patel Jai N, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Challenges in pharmacogenetics. European journal of clinical pharmacology. 2013. Cascorbi Ingolf, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DNA repair and cytotoxic drugs: the potential role of RAD51 in clinical outcome of non-small-cell lung cancer patients. Pharmacogenomics. 2013. Nogueira Augusto, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Refining the UGT1A haplotype associated with irinotecan-induced hematological toxicity in metastatic colorectal cancer patients treated with 5-fluorouracil/irinotecan-based regimens. The Journal of pharmacology and experimental therapeutics. 2013. Lévesque Eric, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The LCS6 polymorphism in the binding site of let-7 microRNA to the KRAS 3'-untranslated region: its role in the efficacy of anti-EGFR-based therapy in metastatic colorectal cancer patients. Pharmacogenetics and genomics. 2013. Sebio Ana, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A genome-wide association study of survival in small-cell lung cancer patients treated with irinotecan plus cisplatin chemotherapy. The pharmacogenomics journal. 2013. Han J-Y, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of UGT1A1*28 polymorphisms with irinotecan-induced toxicities in colorectal cancer: a meta-analysis in Caucasians. The pharmacogenomics journal. 2013. Liu X, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Clinical outcome of Japanese metastatic colorectal cancer patients harbouring the KRAS p.G13D mutation treated with cetuximab + irinotecan. Japanese journal of clinical oncology. 2012. Bando Hideaki, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SLCO1B1 and SLC19A1 Gene Variants and Irinotecan-Induced Rapid Response and Survival: A Prospective Multicenter Pharmacogenetics Study of Metastatic Colorectal Cancer. PloS one. 2013. Huang Liu, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
XRCC3 Thr241Met polymorphism and clinical outcomes of NSCLC patients receiving platinum-based chemotherapy: a systematic review and meta-analysis. PloS one. 2013. Shen Xiao-yong, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Association of KRAS G13D tumor mutations with outcome in patients with metastatic colorectal cancer treated with first-line chemotherapy with or without cetuximab. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2012. Tejpar Sabine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
PharmGKB summary: very important pharmacogene information for CYP3A5. Pharmacogenetics and genomics. 2012. Lamba Jatinder, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Impact of the UGT1A1*28 allele on response to irinotecan: a systematic review and meta-analysis. Pharmacogenomics. 2012. Dias Mafalda M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A genome-wide association study for irinotecan-related severe toxicities in patients with advanced non-small-cell lung cancer. The pharmacogenomics journal. 2012. Han J-Y, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Multifactorial pharmacogenetic analysis in colorectal cancer patients receiving 5-fluorouracil-based therapy together with cetuximab-irinotecan. British journal of clinical pharmacology. 2012. Etienne-Grimaldi Marie-Christine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Absence of transcriptomic signature of response to chemotherapy in metastatic colorectal carcinoma patients. Pharmacogenomics. 2012. Laroche-Clary Audrey, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A Systems Biology Approach Identifies SART1 as a Novel Determinant of Both 5-Fluorouracil and SN38 Drug Resistance in Colorectal Cancer. Molecular cancer therapeutics. 2012. Allen Wendy L, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Impact of SHMT1 polymorphism on the clinical outcome of patients with metastatic colorectal cancer treated with first-line FOLFIRI+bevacizumab. Pharmacogenetics and genomics. 2012. Budai Barna, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Methylenetetrahydrofolate reductase genetic polymorphisms and toxicity to 5-FU-based chemoradiation in rectal cancer. British journal of cancer. 2011. Thomas F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Single nucleotide polymorphisms of ABCC5 and ABCG1 transporter genes correlate to irinotecan-associated gastrointestinal toxicity in colorectal cancer patients: A DMET microarray profiling study. Cancer biology & therapy. 2011. Di Martino Maria Teresa, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Vascular endothelial growth factor polymorphisms and clinical outcome in colorectal cancer patients treated with irinotecan-based chemotherapy and bevacizumab. The pharmacogenomics journal. 2011. Koutras A K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
A genotype-directed phase I-IV dose-finding study of irinotecan in combination with fluorouracil/leucovorin as first-line treatment in advanced colorectal cancer. British journal of cancer. 2011. Marcuello E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Perspectives on Epigenetics and Its Relevance to Adverse Drug Reactions. Clinical pharmacology and therapeutics. 2011. Kacevska M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics: From Bench to Byte- An Update of Guidelines. Clinical pharmacology and therapeutics. 2011. Swen J J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Very important pharmacogene summary: ABCB1 (MDR1, P-glycoprotein). Pharmacogenetics and genomics. 2011. Hodges Laura M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genomics and drug response. The New England journal of medicine. 2011. Wang Liewei, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Databases in the area of pharmacogenetics. Human mutation. 2011. Sim Sarah C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Prediction of irinotecan and 5-fluorouracil toxicity and response in patients with advanced colorectal cancer. The pharmacogenomics journal. 2011. Glimelius B, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The predictive value of genetic variations in the vascular endothelial growth factor A gene in metastatic colorectal cancer. The pharmacogenomics journal. 2011. Hansen T F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacogenetic Tailoring of Irinotecan-based First-line Chemotherapy in Metastatic Colorectal Cancer: Results of a Pilot Study. Anticancer research. 2011. Freyer Gilles, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Thymidylate Synthase Genotype-Directed Neoadjuvant Chemoradiation for Patients With Rectal Adenocarcinoma. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2011. Tan Benjamin R, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic tests in cancer chemotherapy: what physicians should know for clinical application. The Journal of pathology. 2011. Lee Soo-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomic contribution to drug response. Cancer journal (Sudbury, Mass.). 2011. Watson Roshawn G, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MDR1 polymorphism role in patients treated with cetuximab and irinotecan in irinotecan refractory colorectal cancer. Medical oncology (Northwood, London, England). 2010. Paule Bernard, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABCB1 gene polymorphisms are associated with adverse reactions in fluoropyrimidine-treated colorectal cancer patients. Pharmacogenomics. 2010. Gonzalez-Haba Eva, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Identification and Replication of Loci Involved in Camptothecin-Induced Cytotoxicity Using CEPH Pedigrees. PloS one. 2011. Watson Venita Gresham, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Systematic review of pharmacoeconomic studies of pharmacogenomic tests. Pharmacogenomics. 2010. Beaulieu Mathieu, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic modulation of the Let-7 microRNA binding to KRAS 3'-untranslated region and survival of metastatic colorectal cancer patients treated with salvage cetuximab-irinotecan. The pharmacogenomics journal. 2010. Graziano F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Association of carboxylesterase 1A genotypes with irinotecan pharmacokinetics in Japanese cancer patients. British journal of clinical pharmacology. 2010. Sai Kimie, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Dose-dependent association between UGT1A1*28 genotype and irinotecan-induced neutropenia: low doses also increase risk. Clinical cancer research : an official journal of the American Association for Cancer Research. 2010. Hu Zhe-Yi, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Dose-dependent association between UGT1A1*28 polymorphism and irinotecan-induced diarrhoea: a meta-analysis. European journal of cancer (Oxford, England : 1990). 2010. Hu Zhe-Yi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic predictors of adverse events and response to chemotherapy in metastatic colorectal cancer: results from North American Gastrointestinal Intergroup Trial N9741. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2010. McLeod Howard L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of primary miRNA polymorphic variants in metastatic colon cancer patients treated with 5-fluorouracil and irinotecan. The pharmacogenomics journal. 2010. Boni V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic assessment of toxicity and outcome in patients with metastatic colorectal cancer treated with LV5FU2, FOLFOX, and FOLFIRI: FFCD 2000-05. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2010. Boige Valérie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics of membrane transporters: past, present and future. Pharmacogenomics. 2010. Yee Sook Wah, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of SUMO1 and UBC9 genotypes with tumor response in non-small-cell lung cancer treated with irinotecan-based chemotherapy. The pharmacogenomics journal. 2010. Han Ji-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Oxaliplatin, irinotecan and capecitabine as first-line therapy in metastatic colorectal cancer (mCRC): a dose-finding study and pharmacogenomic analysis. British journal of cancer. 2010. Zarate R, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
PharmGKB very important pharmacogene: SLCO1B1. Pharmacogenetics and genomics. 2010. Oshiro Connie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
An overview of the recent progress in irinotecan pharmacogenetics. Pharmacogenomics. 2010. Fujiwara Yutaka, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gilbert-Meulengracht's syndrome and pharmacogenetics: is jaundice just the tip of the iceberg?. Drug metabolism reviews. 2010. Strassburg Christian P. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genotype-driven phase I study of irinotecan administered in combination with fluorouracil/leucovorin in patients with metastatic colorectal cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2010. Toffoli Giuseppe, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Individualizing dosing of irinotecan. Clinical cancer research : an official journal of the American Association for Cancer Research. 2010. Ratain Mark J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The dual EGFR/HER-2 tyrosine kinase inhibitor lapatinib sensitizes colon and gastric cancer cells to the irinotecan active metabolite SN-38. International journal of cancer. Journal international du cancer. 2009. LaBonte Melissa J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leveraging learning from a phase III colorectal cancer clinical trial: outcomes, methodology, meta-analysis and pharmacogenetics. Transactions of the American Clinical and Climatological Association. 2010. Goldberg Richard M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Single nucleotide polymorphism in ABCG2 is associated with irinotecan-induced severe myelosuppression. Journal of human genetics. 2009. Cha Pei-Chieng, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Chemotherapy: Optimizing irinotecan regimens for colorectal cancer. Nature reviews. Clinical oncology. 2009. Yim Kein-Leong, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cost effectiveness of pharmacogenetic testing for uridine diphosphate glucuronosyltransferase 1A1 before irinotecan administration for metastatic colorectal cancer. Cancer. 2009. Gold Heather Taffet, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The increasing role of pharmacogenetics in the treatment of gastrointestinal cancers. Gastrointestinal cancer research : GCR. 2009. Yalçin Suayib. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinically available pharmacogenomics tests. Clinical pharmacology and therapeutics. 2009. Flockhart D A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacodynamic genes do not influence risk of neutropenia in cancer patients treated with moderately high-dose irinotecan. Pharmacogenomics. 2009. Hoskins Janelle M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics and biomarkers in colorectal cancer. The pharmacogenomics journal. 2009. Strimpakos A S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ADME pharmacogenetics: current practices and future outlook. Expert opinion on drug metabolism & toxicology. 2009. Grossman Iris. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Predictive role of the UGT1A1, UGT1A7, and UGT1A9 genetic variants and their haplotypes on the outcome of metastatic colorectal cancer patients treated with fluorouracil, leucovorin, and irinotecan. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2009. Cecchin Erika, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UGT1A1*28 genotype predicts gastrointestinal toxicity in patients treated with intermediate-dose irinotecan. Pharmacogenomics. 2009. Ferraldeschi Roberta, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UGT1A1*6 polymorphism is most predictive of severe neutropenia induced by irinotecan in Japanese cancer patients. International journal of clinical oncology / Japan Society of Clinical Oncology. 2009. Onoue Masahide, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Phase I trial of oral irinotecan and temozolomide for children with relapsed high-risk neuroblastoma: a new approach to neuroblastoma therapy consortium study. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2009. Wagner Lars M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Phase I/II pharmacokinetic and pharmacogenomic study of UGT1A1 polymorphism in elderly patients with advanced non-small cell lung cancer treated with irinotecan. Clinical pharmacology and therapeutics. 2009. Yamamoto N, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Integrated pharmacogenetic prediction of irinotecan pharmacokinetics and toxicity in patients with advanced non-small cell lung cancer. Lung cancer (Amsterdam, Netherlands). 2009. Han Ji-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics and pharmacogenomics of anticancer agents. CA: a cancer journal for clinicians. 2009. Huang R Stephanie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
UGT1A1, UGT1A6 and UGT1A7 genetic analysis: repercussion for irinotecan pharmacogenetics in the São Miguel Island Population (Azores, Portugal). Molecular diagnosis & therapy. 2009. Pacheco Paula R, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Clinical significance of UDP-glucuronosyltransferase 1A1*6 for toxicities of combination chemotherapy with irinotecan and cisplatin in gynecologic cancers: a prospective multi-institutional study. Oncology. 2009. Takano Masashi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Predictive Factors for Response and Toxicity in Chemotherapy: Pharmacogenomics. Seminars in colon & rectal surgery. 2008. Sanoff Hanna K, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of ATP-binding cassette, sub-family C, number 2 (ABCC2) genotype with pharmacokinetics of irinotecan in Japanese patients with metastatic colorectal cancer treated with irinotecan plus infusional 5-fluorouracil/leucovorin (FOLFIRI). Biological & pharmaceutical bulletin. 2008. Fujita Ken-ichi, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Cisplatin plus weekly CPT-11/docetaxel in advanced esophagogastric cancer: a phase I study with pharmacogenetic assessment of XPD, XRCC3 and UGT1A1 polymorphisms. Cancer chemotherapy and pharmacology. 2008. Font Albert, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacokinetic and pharmacogenetic determinants of the activity and toxicity of irinotecan in metastatic colorectal cancer patients. British journal of cancer. 2008. Rouits E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Irinotecan and uridine diphosphate glucuronosyltransferase 1A1 pharmacogenetics: to test or not to test, that is the question. Cancer. 2008. Deeken John F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic pathway analysis of irinotecan. Clinical pharmacology and therapeutics. 2008. Rosner G L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics in colorectal cancer: a systematic review. Pharmacogenomics. 2008. Funke Silvia, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic profiling in patients with advanced colorectal cancer treated with first-line FOLFIRI chemotherapy. The pharmacogenomics journal. 2008. Ruzzo A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Family 1 uridine-5'-diphosphate glucuronosyltransferases (UGT1A): from Gilbert's syndrome to genetic organization and variability. Archives of toxicology. 2008. Strassburg Christian P, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UGT1A1*28 genotype and irinotecan dosage in patients with metastatic colorectal cancer: a Dutch Colorectal Cancer Group study. British journal of cancer. 2008. Kweekel D M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Structure, function and regulation of P-glycoprotein and its clinical relevance in drug disposition. Xenobiotica; the fate of foreign compounds in biological systems. 2008. Zhou S-F. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CYP450 pharmacogenetics for personalizing cancer therapy. Drug resistance updates : reviews and commentaries in antimicrobial and anticancer chemotherapy. 2008. van Schaik Ron H N. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of Gilbert's syndrome. Pharmacogenomics. 2008. Strassburg Christian P. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Influence of UGT1A9 intronic I399C>T polymorphism on SN-38 glucuronidation in Asian cancer patients. The pharmacogenomics journal. 2008. Sandanaraj E, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UGT1A1*28 polymorphism predicts irinotecan-induced severe toxicities without affecting treatment outcome and survival in patients with metastatic colorectal carcinoma. Cancer. 2008. Liu Chun-Yu, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cost-effectiveness of UGT1A1 genotyping in second-line, high-dose, once every 3 weeks irinotecan monotherapy treatment of colorectal cancer. Pharmacogenomics. 2008. Obradovic Marko, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Lopinavir-ritonavir dramatically affects the pharmacokinetics of irinotecan in HIV patients with Kaposi's sarcoma. Clinical pharmacology and therapeutics. 2008. Corona G, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Gilbert's Syndrome and irinotecan toxicity: combination with UDP-glucuronosyltransferase 1A7 variants increases risk. Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology. 2008. Lankisch Tim O, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Irinotecan pharmacogenetics: influence of pharmacodynamic genes. Clinical cancer research : an official journal of the American Association for Cancer Research. 2008. Hoskins Janelle M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic profiling for cetuximab plus irinotecan therapy in patients with refractory advanced colorectal cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2008. Graziano Francesco, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A genomic "roadmap" to "better" drugs. Drug metabolism reviews. 2008. Liao Guochun, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics of drug-metabolizing enzymes and drug transporters in chemotherapy. Methods in molecular biology (Clifton, N.J.). 2008. Bosch Tessa M. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
In silico and in vitro pharmacogenetic analysis in mice. Proceedings of the National Academy of Sciences of the United States of America. 2007. Guo Yingying, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Haplotypes and a novel defective allele of CES2 found in a Japanese population. Drug metabolism and disposition: the biological fate of chemicals. 2007. Kim Su-Ryang, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Intra-ethnic differences in genetic variants of the UGT-glucuronosyltransferase 1A1 gene in Chinese populations. The pharmacogenomics journal. 2007. Zhang A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of UGT1A1*6, UGT1A1*28 and ABCG2 c.421C>A polymorphisms in irinotecan-induced neutropenia in Asian cancer patients. Cancer science. 2007. Jada Srinivasa Rao, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UGT1A1*28 genotype and irinotecan-induced neutropenia: dose matters. Journal of the National Cancer Institute. 2007. Hoskins Janelle M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UGT1A1 polymorphism can predict hematologic toxicity in patients treated with irinotecan. Clinical cancer research : an official journal of the American Association for Cancer Research. 2007. Côté Jean-François, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UGT1A1 promoter genotype correlates with SN-38 pharmacokinetics, but not severe toxicity in patients receiving low-dose irinotecan. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2007. Stewart Clinton F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Circulating VEGF reduction, response and outcome in advanced colorectal cancer patients treated with cetuximab plus irinotecan. Pharmacogenomics. 2007. Vincenzi Bruno, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Effects of green tea compounds on irinotecan metabolism. Drug metabolism and disposition: the biological fate of chemicals. 2007. Mirkov Snezana, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Irinotecan-induced diarrhea: functional significance of the polymorphic ABCC2 transporter protein. Clinical pharmacology and therapeutics. 2007. de Jong F A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Results from an in vitro and a clinical/pharmacological phase I study with the combination irinotecan and sorafenib. European journal of cancer (Oxford, England : 1990). 2007. Mross K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The role of SN-38 exposure, UGT1A1*28 polymorphism, and baseline bilirubin level in predicting severe irinotecan toxicity. Journal of clinical pharmacology. 2007. Ramchandani Roshni P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Adding pharmacogenetics information to drug labels: lessons learned. Pharmacogenetics and genomics. 2006. Haga Susanne B, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of irinotecan: clinical perspectives on the utility of genotyping. Pharmacogenomics. 2006. Innocenti Federico, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A phase II study of irinotecan and carboplatin in advanced non-small cell lung cancer with pharmacogenomic analysis: final report. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2006. Pillot Giancarlo A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinical relevance of different dihydropyrimidine dehydrogenase gene single nucleotide polymorphisms on 5-fluorouracil tolerance. Molecular cancer therapeutics. 2006. Morel Alain, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinical pharmacokinetics of irinotecan-based chemotherapy in colorectal cancer patients. Current clinical pharmacology. 2006. Di Paolo Antonello, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of SLCO1B1 gene and the impact of *1b and *15 haplotypes on irinotecan disposition in Asian cancer patients. Pharmacogenetics and genomics. 2006. Xiang Xiaoqiang, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Prophylaxis of irinotecan-induced diarrhea with neomycin and potential role for UGT1A1*28 genotype screening: a double-blind, randomized, placebo-controlled study. The oncologist. 2006. de Jong Floris A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic variability, haplotypes, and htSNPs for exons 1 at the human UGT1A locus. Human mutation. 2006. Thomas Sushma S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The role of UGT1A1*28 polymorphism in the pharmacodynamics and pharmacokinetics of irinotecan in patients with metastatic colorectal cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2006. Toffoli Giuseppe, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cancer and leukemia group B gastrointestinal cancer committee. Clinical cancer research : an official journal of the American Association for Cancer Research. 2006. Goldberg Richard M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Expression of drug pathway proteins is independent of tumour type. The Journal of pathology. 2006. Zhang W, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Comprehensive analysis of UGT1A polymorphisms predictive for pharmacokinetics and treatment outcome in patients with non-small-cell lung cancer treated with irinotecan and cisplatin. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2006. Han Ji-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Uridine diphosphate glucuronosyl transferase 1A1 promoter polymorphism predicts the risk of gastrointestinal toxicity and fatigue induced by irinotecan-based chemotherapy. Cancer. 2006. Massacesi Cristian, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
5-Fluorouracil/irinotecan induced lethal toxicity as a result of a combined pharmacogenetic syndrome: report of a case. Journal of clinical pathology. 2005. Steiner M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Haplotypes of variants in the UDP-glucuronosyltransferase1A9 and 1A1 genes. Pharmacogenetics and genomics. 2005. Innocenti Federico, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of organic anion transporter OATP1B1 (OATP-C) in hepatic uptake of irinotecan and its active metabolite, 7-ethyl-10-hydroxycamptothecin: in vitro evidence and effect of single nucleotide polymorphisms. Drug metabolism and disposition: the biological fate of chemicals. 2005. Nozawa Takashi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of human carboxylesterase 2, an enzyme involved in the activation of irinotecan into SN-38. Clinical pharmacology and therapeutics. 2004. Charasson Virginie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Determination and analysis of single nucleotide polymorphisms and haplotype structure of the human carboxylesterase 2 gene. Pharmacogenetics. 2004. Wu Michael H, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UGT1A1 gene variations and irinotecan treatment in patients with metastatic colorectal cancer. British journal of cancer. 2004. Marcuello E, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Relevance of different UGT1A1 polymorphisms in irinotecan-induced toxicity: a molecular and clinical study of 75 patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2004. Rouits Elisabeth, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variants in the UDP-glucuronosyltransferase 1A1 gene predict the risk of severe neutropenia of irinotecan. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2004. Innocenti Federico, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Irinotecan pharmacogenetics: is it time to intervene?. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2004. McLeod Howard L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Phase I trial of UFT/leucovorin and irinotecan in patients with advanced cancer. European journal of cancer (Oxford, England : 1990). 2004. Veronese M L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cancer pharmacogenetics: polymorphisms, pathways and beyond. Nature reviews. Cancer. 2003. Ulrich Cornelia M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Haplotype analysis of ABCB1/MDR1 blocks in a Japanese population reveals genotype-dependent renal clearance of irinotecan. Pharmacogenetics. 2003. Sai Kimie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Irinotecan pathway genotype analysis to predict pharmacokinetics. Clinical cancer research : an official journal of the American Association for Cancer Research. 2003. Mathijssen Ron H J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Functional characterization of human UDP-glucuronosyltransferase 1A9 variant, D256N, found in Japanese cancer patients. The Journal of pharmacology and experimental therapeutics. 2003. Jinno Hideto, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Differential effects of the breast cancer resistance protein on the cellular accumulation and cytotoxicity of 9-aminocamptothecin and 9-nitrocamptothecin. Cancer research. 2003. Rajendra Rajeev, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Effect of P-glycoprotein modulator, cyclosporin A, on the gastrointestinal excretion of irinotecan and its metabolite SN-38 in rats. Pharmaceutical research. 2003. Arimori Kazuhiko, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Haplotype structure of the UDP-glucuronosyltransferase 1A1 promoter in different ethnic groups. Pharmacogenetics. 2002. Innocenti Federico, et al. PubMed
Common human UGT1A polymorphisms and the altered metabolism of irinotecan active metabolite 7-ethyl-10-hydroxycamptothecin (SN-38). Molecular pharmacology. 2002. Gagné Jean-François, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Human carboxylesterase 2 is commonly expressed in tumor tissue and is correlated with activation of irinotecan. Clinical cancer research : an official journal of the American Association for Cancer Research. 2002. Xu Guang, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Irinotecan activation by human carboxylesterases in colorectal adenocarcinoma cells. Clinical cancer research : an official journal of the American Association for Cancer Research. 2002. Wu Michael H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Effects of St. John's wort on irinotecan metabolism. Journal of the National Cancer Institute. 2002. Mathijssen Ron H J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Med-psych drug-drug interactions update. Psychosomatics. 2002. Armstrong Scott C, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UGT1A1*28 polymorphism as a determinant of irinotecan disposition and toxicity. The pharmacogenomics journal. 2002. Iyer L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A new metabolite of irinotecan in which formation is mediated by human hepatic cytochrome P-450 3A4. Drug metabolism and disposition: the biological fate of chemicals. 2001. Sai K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Human liver UDP-glucuronosyltransferase isoforms involved in the glucuronidation of 7-ethyl-10-hydroxycamptothecin. Xenobiotica; the fate of foreign compounds in biological systems. 2001. Hanioka N, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of anticancer agents: lessons from amonafide and irinotecan. Drug metabolism and disposition: the biological fate of chemicals. 2001. Innocenti F, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Polymorphisms of UDP-glucuronosyltransferase gene and irinotecan toxicity: a pharmacogenetic analysis. Cancer research. 2000. Ando Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Metabolism of irinotecan (CPT-11) by CYP3A4 and CYP3A5 in humans. Clinical cancer research : an official journal of the American Association for Cancer Research. 2000. Santos A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ATP-Dependent efflux of CPT-11 and SN-38 by the multidrug resistance protein (MRP) and its inhibition by PAK-104P. Molecular pharmacology. 1999. Chen Z S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The anticancer prodrug CPT-11 is a potent inhibitor of acetylcholinesterase but is rapidly catalyzed to SN-38 by butyrylcholinesterase. Cancer research. 1999. Morton C L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Active efflux of CPT-11 and its metabolites in human KB-derived cell lines. The Journal of pharmacology and experimental therapeutics. 1999. Chu X Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
UGT1A1 genotypes and glucuronidation of SN-38, the active metabolite of irinotecan. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO. 1998. Ando Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic predisposition to the metabolism of irinotecan (CPT-11). Role of uridine diphosphate glucuronosyltransferase isoform 1A1 in the glucuronidation of its active metabolite (SN-38) in human liver microsomes. The Journal of clinical investigation. 1998. Iyer L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Preclinical evaluation of CPT-11 and its active metabolite SN-38. Seminars in oncology. 1996. Lavelle F, et al. PubMed


Web Resource:
National Drug Code Directory:
KEGG Drug:
PubChem Compound:
PubChem Substance:
Drugs Product Database (DPD):
Therapeutic Targets Database:
FDA Drug Label at DailyMed:

Clinical Trials

These are trials that mention irinotecan and are related to either pharmacogenetics or pharmacogenomics.

No trials loaded.

NURSA Datasets

provided by

No NURSA datasets available.

Common Searches

Search PubMed
Search Medline Plus
Search PubChem
Search CTD

Sources for PharmGKB drug information: DrugBank, PubChem.