Chemical: Drug

PharmGKB contains no dosing guidelines for this . To report known genotype-based dosing guidelines, or if you are interested in developing guidelines, click here.

PharmGKB annotates drug labels containing pharmacogenetic information approved by the US Food and Drug Administration (FDA), European Medicines Agency (EMA), the Pharmaceuticals and Medical Devices Agency, Japan (PMDA), and Health Canada (Santé Canada) (HCSC). PharmGKB annotations provide a brief summary of the PGx in the label, an excerpt from the label and a downloadable highlighted label PDF file. A list of genes and phenotypes found within the label is mapped to label section headers and listed at the end of each annotation. PharmGKB also attempts to interpret the level of action implied in each label with the "PGx Level" tag.

See the legend for more information about drug label sources and PGx Levels.

We welcome any information regarding drug labels containing PGx information approved by the FDA, EMA, PMDA, HCSC or other Medicine Agencies around the world - please contact feedback.

1. FDA Label for doxorubicin

Full label available at DailyMed

Genes and/or phenotypes found in this label

  • Arrhythmias, Cardiac
    • Contraindications section, Warnings section
    • source: PHONT
  • Breast Neoplasms
    • Indications & usage section, Warnings section, Adverse reactions section, Precautions section
    • source: PHONT
  • Cardiomyopathies
    • Warnings section
    • source: PHONT
  • Heart Arrest
    • Warnings section
    • source: PHONT
  • Heart Failure
    • Warnings section, Precautions section
    • source: PHONT
  • Hodgkin Disease
    • Indications & usage section
    • source: PHONT
  • Leukemia
    • Indications & usage section, Warnings section, Adverse reactions section, Precautions section
    • source: PHONT
  • Leukemia, Myeloid
    • Indications & usage section, Warnings section, Adverse reactions section, Precautions section
    • source: PHONT
  • Leukemia, Myeloid, Acute
    • Indications & usage section, Warnings section, Precautions section
    • source: PHONT
  • Lymphoma, Non-Hodgkin
    • Indications & usage section, Precautions section
    • source: PHONT
  • Sarcoma
    • Indications & usage section
    • source: PHONT
  • Seizures
    • Adverse reactions section, Precautions section
    • source: PHONT
  • Tachycardia, Ventricular
    • Warnings section
    • source: PHONT
  • Thyroid Neoplasms
    • Indications & usage section
    • source: PHONT

PharmGKB contains no Clinical Variants that meet the highest level of criteria.

To see more Clinical Variants with lower levels of criteria, click the button at the bottom of the page.

Disclaimer: The PharmGKB's clinical annotations reflect expert consensus based on clinical evidence and peer-reviewed literature available at the time they are written and are intended only to assist clinicians in decision-making and to identify questions for further research. New evidence may have emerged since the time an annotation was submitted to the PharmGKB. The annotations are limited in scope and are not applicable to interventions or diseases that are not specifically identified.

The annotations do not account for individual variations among patients, and cannot be considered inclusive of all proper methods of care or exclusive of other treatments. It remains the responsibility of the health-care provider to determine the best course of treatment for a patient. Adherence to any guideline is voluntary, with the ultimate determination regarding its application to be made solely by the clinician and the patient. PharmGKB assumes no responsibility for any injury or damage to persons or property arising out of or related to any use of the PharmGKB clinical annotations, or for any errors or omissions.

? = Mouse-over for quick help

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Links in the "Gene" column lead to PharmGKB Gene Pages.

List of all variant annotations for doxorubicin

Gene ? Variant?
Alternate Names ? Chemicals ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
No VIP available No VIP available VA CYP2C8 *1A N/A N/A N/A
No VIP available No VIP available VA CYP2C8 *3 N/A N/A N/A
No VIP available CA VA GSTM1 non-null N/A N/A N/A
No VIP available CA VA GSTM1 null N/A N/A N/A
No VIP available No VIP available VA GSTT1 non-null N/A N/A N/A
No VIP available No VIP available VA GSTT1 null N/A N/A N/A
No VIP available No Clinical Annotations available VA
rs10144771 1426878A>G, 16036T>C, 613+1720T>C, 94312316A>G, 94778653A>G
A > G
No VIP available CA VA
rs10276036 1000-44G>A, 167367G>A, 87180198C>T, 87550882C>T, ABCB1: IVS9 ¿44a>G
C > T
No VIP available No Clinical Annotations available VA
rs10426628 378+1736A>G, 42002A>G, 423+1736A>G, 48589173A>G, 49092430A>G
A > G
rs1045642 208920T>C, 3435T>C, 87138645A>G, 87509329A>G, ABCB1*6, ABCB1: 3435C>T, ABCB1: C3435T, ABCB1: c.3435C>T, ABCB1:3435C>T, Ile1145=, Ile1145Ile, MDR1 3435C>T, MDR1 C3435T, PGP C3435T, c.3435C>T, mRNA 3853C>T
A > T
A > G
No VIP available No Clinical Annotations available VA
rs10497346 101313T>C, 168914686T>C, 169771196T>C
T > C
Not Available
No VIP available No Clinical Annotations available VA
rs1056892 36146408G>A, 37518706G>A, 730G>A, 93-53C>T, CBR3 730G>A, CBR3 V244M, CBR3:Val244Met, Val244Met
G > A
No VIP available No Clinical Annotations available VA
rs10865801 24888311C>A, 24929802C>A
C > A
Not Available
No VIP available No Clinical Annotations available VA
rs11046217 21864223G>C, 22017157G>C, 2237+216C>G, 77472C>G
G > C
No VIP available CA VA
rs1128503 1236T>C, 167964T>C, 87179601A>G, 87550285A>G, ABCB1 1236C>T, ABCB1*8, ABCB1: c.1236T>C, ABCB1:1236C>T, ABCB1:1236T>C, Gly412=, Gly412Gly, mRNA 1654T>C, p.Gly412Gly
A > G
VIP No Clinical Annotations available No Variant Annotations available
rs1138272 341C>T, 67353579C>T, 67586108C>T, 7514C>T, A114V, Ala114Val, GSTP1: A114V, GSTP1: C341T
C > T
No VIP available No Clinical Annotations available VA
rs1143663 262G>A, 36070377G>A, 37442675G>A, 486C>T, CBR1:Val88Ile, V88I, Val88Ile
G > A
No VIP available CA VA
rs1143684 139C>T, 15341C>T, 3010156C>T, 3010390C>T, Leu47Phe
C > T
No VIP available No Clinical Annotations available VA
rs117532069 53301068G>A, 54684529G>A
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs11861115 16105813G=, 16105813G>A, 161237G=, 161237G>A, 16199670G>A, 1763672A=, 1763672A>G, 2736-925A>G, 2736-925G>A
G > A
No VIP available No Clinical Annotations available VA
rs12059276 109730919C>T, 110273541C>T
C > T
Not Available
No VIP available No Clinical Annotations available VA
rs1214763 43360261T>C, 43392523T>C
T > C
Not Available
No VIP available CA VA
rs12210538 110438805A>G, 110760008A>G, 1226T>C, Met409Thr
A > G
No VIP available No Clinical Annotations available VA
rs12658397 101751653T>C, 102415949T>C, 1287-2806A>G, 1473-2806A>G, 714-2806A>G
T > C
No VIP available CA VA
rs12721655 18079A>G, 41004377A>G, 41510282A>G, 415A>G, CYP2B6: 415A>G, K139E, Lys139Glu
A > G
No VIP available CA VA
rs13058338 108-3812A>T, 12536A>T, 37236730T>A, 37632770T>A, 7508T-->A of RAC2
T > A
No VIP available No Clinical Annotations available VA
rs13181 *304T>G, 2251A>C, 23927A>C, 45351661T>G, 45854919T>G, ERCC2 Lys751Gln, ERCC2:2251A>C, ERCC2:Lys751Gln, Lys751Gln, rs13181:T>G
T > G
No VIP available No Clinical Annotations available VA
rs141059755 65195370A>C, 65195370A>G, 66107605A>C, 66107605A>G
A > C
A > G
Not Available
No VIP available No Clinical Annotations available VA
rs1533682 183634879T>C, 183917091T>C
T > C
Not Available
No VIP available No Clinical Annotations available VA
rs168351 1434-1115T>C, 55659T>C, 72902395A>G, 75517311A>G
A > G
rs1695 313A>G, 6624A>G, 67352689A>G, 67585218A>G, GSTP1*2, GSTP1*B, GSTP1: I105V, GSTP1:A313G, GSTP1:I105V, GSTP1:Ile105Val, Ile105Val, Part of haplotypes GSTP1*B and GSTP1*C, rs1695:A>G
A > G
No VIP available No Clinical Annotations available VA
rs16967126 16034561T>C, 16128418T>C, 1692461T>C, 677+1391T>C, 89985T>C
T > C
No VIP available No Clinical Annotations available VA
rs17021408 213769895T>C, 213943238T>C
T > C
Not Available
No VIP available CA VA
rs17222723 101595996T>A, 3563T>A, 58534T>A, 99836239T>A, ABCC2 rs8187694, MRP2 Val1188Glu, Val1188Glu
T > A
Not Available
No VIP available No Clinical Annotations available VA
rs1799793 11587G>A, 45364001C>T, 45867259C>T, 862G>A, 934G>A, Asp288Asn, Asp312Asn, XPD Asp312Asn, XPD:Asp312Asn
C > T
No VIP available CA VA
rs1799983 12965T>G, 150696111T>G, 150999023T>G, 894T>G, Asp298Glu, NOS3:894G>T
T > G
rs1800566 20389C>T, 343C>T, 445C>T, 457C>T, 559C>T, 69711242G>A, 69745145G>A, NQO1*2, NQO1:C609T, NQO1:P187S, NQO1:c.558C>T, Pro115Ser, Pro149Ser, Pro153Ser, Pro187Ser, rs1800566 C>T
G > A
No VIP available No Clinical Annotations available VA
rs1801133 11796321G>A, 11856378G>A, 14783C>T, 665C>T, 677C>T, A222V, Ala222Val, C677T, MTHFR: c.677C>T, MTHFR:667C>T, p.A222V
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs1801274 161479745A>G, 161509955A>G, 497A>G, 500A>G, 9541A>G, FCGR2A:His131Arg, His166Arg, His167Arg
A > G
No VIP available CA VA
rs1805087 1535A>G, 236885200A>G, 237048500A>G, 2603A>G, 2756A>G, 94920A>G, Asp512Gly, Asp868Gly, Asp919Gly, MS 2756A>G, MS D919G, MTR:2756A>G, MTR:Asp919Gly
A > G
No VIP available CA VA
rs1883112 -368G>A, 36860804G>A, 37256846G>A, 4817G>A, 81598G>A, NCF4 -212A>G
G > A
5' Flanking
No VIP available No Clinical Annotations available VA
rs1891059 213772666G>A, 213946009G>A
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs1937840 448-212C>G, 5099115C>G, 5141307C>G
C > G
No VIP available CA VA
rs2032582 186947T>A, 186947T>G, 2677A, 2677G, 2677T, 2677T>A, 2677T>G, 3095G>T/A, 87160618A>C, 87160618A>T, 87531302A>C, 87531302A>T, 893 Ala, 893 Ser, 893 Thr, ABCB1*7, ABCB1: 2677G>T/A, ABCB1: 2677T/A>G, ABCB1: A893S, ABCB1: G2677T/A, ABCB1: c.2677G>T/A, ABCB1:2677G>A/T, ABCB1:2677G>T/A, ABCB1:A893T, Ala893Ser/Thr, MDR1, MDR1 G2677T/A, Ser893Ala, Ser893Thr, mRNA 3095G>T/A, p.Ala893Ser/Thr
A > T
A > C
No VIP available CA VA
rs20572 *736C>T, 36072675C>T, 37444973C>T, 378-2190G>A, 627C>T, A209A, Ala209=
C > T
No VIP available CA No Variant Annotations available
rs2070744 -51-762C=, -51-762C>T, -786, -813C=, -813C>T, 150690079C=, 150690079C>T, 150992991C=, 150992991C>T, 6933C=, 6933C>T, NOS3 -786T>C, NOS3:, T>C, eNOS -786T>C
C > T
5' Flanking
No VIP available No Clinical Annotations available VA
rs2180314 15631G>C, 335G>C, 52617731C>G, 52752933C>G, Ser112Thr
C > G
No VIP available CA VA
rs2229109 1199G>A, 167756G>A, 87179809C>T, 87550493C>T, ABCB1: c.1199G>A, Ser400Asn, mRNA 1617G>A, p.Ser400Asn
C > T
C > A
No VIP available No Clinical Annotations available VA
rs2233302 1362+45G>C, 150415098C>G, 151035537C>G, 1521+45G>C, 57124G>C
C > G
No VIP available No Clinical Annotations available VA
rs2236168 31384262T>C, 31607128T>C, 35484A>G, 794-415A>G
T > C
No VIP available No Clinical Annotations available VA
rs2294950 1132-249T>G, 59848824T>G, 60314496T>G
T > G
Not Available
No VIP available No Clinical Annotations available VA
rs2600834 101605641T>C, 102269937T>C, 802+687A>G
T > C
No VIP available No Clinical Annotations available VA
rs2720376 179-750G>A, 184633146C>T, 185554300C>T
C > T
No VIP available No Clinical Annotations available VA
rs2740574 -392G>A, 4713G>A, 5'-flanking region -392A>G, 99382096C>T, 99784473C>T, CYP3A4*1B, CYP3A4-V, CYP3A4:-392A>G
C > T
5' Flanking
No VIP available No Clinical Annotations available VA
rs2835285 193-1708C>T, 193-2395C>T, 277G>A, 36135469G>A, 37507767G>A, CBR3:Val93Ile, Val93Ile
G > A
No VIP available No Clinical Annotations available VA
rs2889517 143523T>C, 16088099T>C, 16181956T>C, 1745955T>C, 2460+1108T>C
T > C
No VIP available CA VA
rs3211371 1459C>T, 30512C>T, 41016810C>T, 41522715C>T, Arg487Cys, CYP2B6*5, CYP2B6*7, CYP2B6:1459C>T, CYP2B6:Arg487Cys, part of CYP2B6*1C
C > T
No VIP available No Clinical Annotations available VA
rs34743033 28-bp tandem repeats, CCGCGCCACTTGGCCTGCCTCCGTCCCG, TSER*2, TSER*3, TYMS: 28 bp tandem repeat, TYMS: 2R, TYMS: TSER *2/*3, TYMS:TSER 28-basepair 5'UTR enhancer region repeat
Not Available
No VIP available No Clinical Annotations available VA
rs35596 114507T=, 114507T>C, 16059083T=, 16059083T>C, 16152940T>C, 1677+2788C>T, 1677+2788T>C, 1716974C=, 1716974C>T
T > C
No VIP available CA VA
rs3745274 20638G>T, 41006936G>T, 41512841G>T, 516G>T, CYP2B6*6, CYP2B6:516G>T, CYP2B6:Gln172His, Gln172His, Q172H
G > A
G > T
No VIP available No Clinical Annotations available VA
rs3764435 1434-680T>G, 56094T>G, 72901960A>C, 75516876A>C
A > C
No VIP available CA VA
rs3824662 12542C>A, 779-1748C>A, 779-1751C>A, 8062245C>A, 8104208C>A
C > A
No VIP available No Clinical Annotations available VA
rs3887137 104936331C>T, 107698612C>T
C > T
Not Available
No VIP available CA VA
rs3957357 -135T>C, -281T>C, -69, 5' flanking, 52668687A>G, 52803889A>G, Eam1104I, GSTA1, GSTA1 -69 C>T polymorphism, GSTA1:
A > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs396991 10872T>G, 158V/F, 161514542A>C, 161544752A>C, 176F/V, 523T>G, 526T>G, 631T>G, 634T>G, A559C, FCGR3A: V158F, Phe175Val, Phe176Val, Phe211Val, Phe212Val, T559G
A > C
No VIP available No Clinical Annotations available VA
rs4148350 132044G>T, 16076620G>T, 16170477G>T, 1734472G>T, 1988+219G>T
G > T
No VIP available No Clinical Annotations available VA
rs4148354 136073G>A, 16080649G>A, 16174506G>A, 1738501G>A, 2115+1171G>A
G > A
No VIP available CA VA
rs4148416 3039C>T, 48753423C>T, 50676062C>T, Gly1013=
C > T
No VIP available CA VA
rs4148737 176413A>G, 2212-372A>G, 87171152T>C, 87541836T>C
T > C
No VIP available No Clinical Annotations available VA
rs4149178 1586+206A>G, 1592+206A>G, 43272188A>G, 43304450A>G
A > G
Not Available
No VIP available No Clinical Annotations available VA
rs41557318 36071051C>T, 37443349C>T, 378-566G>A, 391C>T, CBR1:Pro131Ser, P131S, Pro131Ser
C > T
No VIP available CA VA
rs4244285 24154G>A, 681G>A, 94781859G>A, 96541616G>A, CYP2C19*2, CYP2C19:681G>A, CYP2C19:G681A, Pro227=
G > A
G > C
No VIP available No Clinical Annotations available VA
rs42524 1645C>G, 24367C>G, 94043239C>G, 94413927C>G, Pro549Ala
C > G
No VIP available No Clinical Annotations available VA
rs4407290 31383804G>A, 31606670G>A, 35942C>T, 837C>T, Val279=
G > A
No VIP available CA VA
rs45511401 134799G>T, 16079375G>T, 16173232G>T, 1737227G>T, 2012G>T, ABCC1 rs45511401, ABCC1:2012G>T, G671V, Gly671Val, MRP1 Gly671Val, mRNA 2187G>T
G > T
No VIP available No Clinical Annotations available VA
rs4638843 2012+317G>C, 2210+317G>C, 47476888G>C, 47704027G>C, 78765G>C
G > C
No VIP available CA VA
rs4646 *161T>G, 132952T>G, 51210647A>C, 51502844A>C
A > C
3' UTR
No VIP available No Clinical Annotations available VA
rs4646437 21726C>T, 671-202C>T, 671-205C>T, 99365083G>A, 99767460G>A
G > A
No VIP available CA VA
rs4673 214T>C, 88646828A>G, 88713236A>G, 9222T>C, His72Tyr polymorphism in the p22phox subunit, Tyr72His
A > G
No VIP available No Clinical Annotations available VA
rs4982753 23345360C>T, 23814569C>T
C > T
Not Available
No VIP available No Clinical Annotations available VA
rs4987121 36146381A>T, 37518679A>T, 703A>T, 93-26T>A, CBR3:Met235Leu, Met235Leu
A > T
No VIP available No Clinical Annotations available VA
rs63319 1201-109C>A, 48186C>A, 72909868G>T, 75524784G>T
G > T
No VIP available CA VA
rs6907567 110456759A>G, 110777962A>G, 312T>C, Asn104=
A > G
No VIP available CA VA
rs714368 110456925T>C, 110778128T>C, 146A>G, His49Arg, SLC22A16:146A>G
T > C
No VIP available CA VA
rs723685 110442672A>G, 110763875A>G, 755T>C, Val252Ala
A > G
No VIP available No Clinical Annotations available VA
rs763110 -157-687C>T, -844C=, -844C>T, 172627498C=, 172627498C>T, 172658358C=, 172658358C>T, 4314C=, 4314C>T
C > T
5' Flanking
No VIP available No Clinical Annotations available VA
rs7754103 159640058C>T, 160061090C>T
C > T
Not Available
No VIP available No Clinical Annotations available VA
rs7853758 1381C>T, 1703C>T, 84286011G>A, 86900926G>A, Leu461=
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs79085477 55701215C>T, 57126159C>T
C > T
Not Available
No VIP available No Clinical Annotations available VA
rs8001466 1417-818C>G, 54329C>G, 98703347G>C, 99355601G>C
G > C
No VIP available No Clinical Annotations available VA
rs80223967 213770336A>G, 213943679A>G
A > G
Not Available
No VIP available CA VA
rs8133052 11G>A, 193-1442C>T, 193-2129C>T, 36135203G>A, 37507501G>A, CBR3 11G>A, CBR3:Cys4Tyr, Cys4Tyr
G > A
No VIP available CA VA
rs8187710 101611294G>A, 4544G>A, 73832G>A, 99851537G>A, ABCC2 rs8187710, Cys1515Tyr, MRP2 Cys1515Tyr
G > A
No VIP available No Clinical Annotations available VA
rs8187996 1434-299G>A, 56475G>A, 72901579C>T, 75516495C>T
C > T
No VIP available No Clinical Annotations available VA
rs8192709 40991369C>T, 41497274C>T, 5071C>T, 64C>T, Arg22Cys, CYP2B6*2, CYP2B6:64C>T
C > T
No VIP available CA VA
rs9024 *1076G>A, *133G>A, 36073015G>A, 37445313G>A, 377+1866C>T, CBR1:1096G>A
G > A
3' UTR
No VIP available No Clinical Annotations available VA
rs903880 16036657C>A, 16130514C>A, 1694556C>A, 809+54C>A, 92081C>A
C > A
No VIP available No Clinical Annotations available VA
rs939338 -941+1490C>T, 183704068G>A, 183986280G>A, 591+1490C>T, 592-902C>T, 778-825C>T
G > A
No VIP available CA VA
rs9561778 3225+1243C>A, 3366+1243C>A, 95061461G>T, 95713715G>T, NM_005845.3:c.3366+1243G>T
G > A
G > T
No VIP available No Clinical Annotations available VA
rs9679162 130-31641C>A, 31024648G>T, 31247514G>T, 315-58346C>A, 70-31641C>A, 903-31641C>A
G > T
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 147


Generic Names
  • Doxorubicin HCl
  • Doxorubicin Hydrochloride
  • Doxorubicina [INN-Spanish]
  • Doxorubicine [INN-French]
  • Doxorubicinum [INN-Latin]
  • doxorubicin
Trade Names
  • ADM
  • Adriablastin
  • Adriamycin
  • Adriamycin PFS
  • Adriamycin RDF
  • Adriamycin Semiquinone
  • Adriblastin
  • Adriblastina
  • Caelyx
  • DM2
  • Doxil
  • Doxo
  • Myocet
  • RDF Rubex
  • Resmycin
  • Rubex
Brand Mixture Names

PharmGKB Accession Id





Antineoplastic antibiotic obtained from Streptomyces peucetius. It is a hydroxy derivative of daunorubicin.

Source: Drug Bank


For the treatment of Koposi's sarcome connected to AIDS.

Source: Drug Bank

Other Vocabularies

Information pulled from DrugBank has not been reviewed by PharmGKB.

Pharmacology, Interactions, and Contraindications

Mechanism of Action

Doxorubicin has antimitotic and cytotoxic activity through a number of proposed mechanisms of action: Doxorubicin forms complexes with DNA by intercalation between base pairs, and it inhibits topoisomerase II activity by stabilizing the DNA-topoisomerase II complex, preventing the religation portion of the ligation-religation reaction that topoisomerase II catalyzes.

Source: Drug Bank


Doxorubicin is an antineoplastic in the anthracycline class. General properties of drugs in this class include: interaction with DNA in a variety of different ways including intercalation (squeezing between the base pairs), DNA strand breakage and inhibition with the enzyme topoisomerase II. Most of these compounds have been isolated from natural sources and antibiotics. However, they lack the specificity of the antimicrobial antibiotics and thus produce significant toxicity. The anthracyclines are among the most important antitumor drugs available. Doxorubicin is widely used for the treatment of several solid tumors while daunorubicin and idarubicin are used exclusively for the treatment of leukemia. Doxorubicin may also inhibit polymerase activity, affect regulation of gene expression, and produce free radical damage to DNA. Doxorubicin possesses an antitumor effect against a wide spectrum of tumors, either grafted or spontaneous. The anthracyclines are cell cycle-nonspecific.

Source: Drug Bank

Food Interaction

Liberal fluid intake to increase urine output and help the excretion of uric acid.

Source: Drug Bank

Absorption, Distribution, Metabolism, Elimination & Toxicity

Protein Binding


Source: Drug Bank


55 hours

Source: Drug Bank


LD 50=21800 ug/kg (rat, subcutaneous)

Source: Drug Bank

Route of Elimination

Plasma clearance is in the range 324 to 809 mL/min/m2 and is predominately by metabolism and biliary excretion.

Source: Drug Bank

Chemical Properties

Chemical Formula


Source: Drug Bank

Isomeric SMILES


Source: OpenEye

Canonical SMILES


Source: Drug Bank

Average Molecular Weight


Source: Drug Bank

Monoisotopic Molecular Weight


Source: Drug Bank



Source: Drug Bank

InChI String


Source: Drug Bank

PharmGKB Curated Pathways

Pathways created internally by PharmGKB based primarily on literature evidence.

  1. Doxorubicin Pathway (Cancer Cell), Pharmacodynamics
    Representation of the candidate genes involved in the action of doxorubicin in a stylized cancer cell.
  1. Doxorubicin Pathway (Cardiomyocyte Cell), Pharmacodynamics
    Representation of the candidate genes involved in adverse effects of doxorubicin in a stylized cardiomyocyte.
  1. Doxorubicin Pathway, Pharmacokinetics
    Diagrammatic representation of the transport and metabolism of doxorubicin.

External Pathways

Links to non-PharmGKB pathways.

PharmGKB contains no links to external pathways for this drug. To report a pathway, click here.

Genes that are associated with this drug in PharmGKB's database based on (1) variant annotations, (2) literature review, (3) pathways or (4) information automatically retrieved from DrugBank, depending on the "evidence" and "source" listed below.

Curated Information ?

Drug Targets

Gene Description
TOP2A (source: Drug Bank)

Drug Interactions

Interaction Description
digoxin - doxorubicin The antineoplasic agent decreases the effect of digoxin (source: Drug Bank)
digoxin - doxorubicin The antineoplasic agent decreases the effect of digoxin (source: Drug Bank)
doxorubicin - digoxin The antineoplasic agent decreases the effect of digoxin (source: Drug Bank)
doxorubicin - digoxin The antineoplasic agent decreases the effect of digoxin (source: Drug Bank)
telithromycin - doxorubicin Telithromycin may reduce clearance of Doxorubicin. Consider alternate therapy or monitor for changes in the therapeutic/adverse effects of Doxorubicin if Telithromycin is initiated, discontinued or dose changed. (source: Drug Bank)
trastuzumab - doxorubicin Trastuzumab may increase the cardiotoxicity of Doxorubicin. Signs and symptoms of cardiac dysfunction should be monitored for frequently. Increased risk of heart failure. Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank)
trazodone - doxorubicin The 2D6 inhibitor, Trazodone, may increase the efficacy of Doxorubicin by decreasing Doxorubicin metabolism and clearance. Monitor for changes in Doxorubicin efficacy if Trazodone is initiated, discontinued or dose changed. (source: Drug Bank)
trazodone - doxorubicin The 2D6 inhibitor, Trazodone, may increase the efficacy of Doxorubicin by decreasing Doxorubicin metabolism and clearance. Monitor for changes in Doxorubicin efficacy if Trazodone is initiated, discontinued or dose changed. (source: Drug Bank)
voriconazole - doxorubicin Voriconazole, a strong CYP3A4 inhibitor, may increase the serum concentration of doxorubicin by decreasing its metabolism. Monitor for changes in the therapeutic and adverse effects of doxorubicin if voriconazole is initiated, discontinued or dose changed. (source: Drug Bank)

Curated Information ?

Relationships from National Drug File - Reference Terminology (NDF-RT)

May Treat
Contraindicated With

Publications related to doxorubicin: 206

No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacogenetics of ABCB5, ABCC5 and RLIP76 and doxorubicin pharmacokinetics in Asian breast cancer patients. The pharmacogenomics journal. 2016. Lal S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Evidence for association of SNPs in ABCB1 and CBR3, but not RAC2, NCF4, SLC28A3 or TOP2B, with chronic cardiotoxicity in a cohort of breast cancer patients treated with anthracyclines. Pharmacogenomics. 2016. Hertz Daniel L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
GALNT14 genotype effectively predicts the therapeutic response in unresectable hepatocellular carcinoma treated with transcatheter arterial chemoembolization. Pharmacogenomics. 2016. Liang Kung-Hao, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genetic risk factors for the development of osteonecrosis in children under age 10 treated for acute lymphoblastic leukemia. Blood. 2015. Karol Seth E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Systems biology approaches to adverse drug effects: the example of cardio-oncology. Nature reviews. Clinical oncology. 2015. Brown Sherry-Ann, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Predictive value of cytokines and immune activation biomarkers in AIDS-related non-Hodgkin lymphoma treated with rituximab plus infusional EPOCH (AMC-034 trial). Clinical cancer research : an official journal of the American Association for Cancer Research. 2015. Epeldegui Marta, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
A First Step toward Personalized Medicine in Osteosarcoma: Pharmacogenetics as Predictive Marker of Outcome after Chemotherapy-Based Treatment. Clinical cancer research : an official journal of the American Association for Cancer Research. 2015. Hagleitner Melanie M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Polymorphisms in the ABCB1 gene and effect on outcome and toxicity in childhood acute lymphoblastic leukemia. The pharmacogenomics journal. 2015. Gregers J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genetic variants in SLC22A17 and SLC22A7 are associated with anthracycline-induced cardiotoxicity in children. Pharmacogenomics. 2015. Visscher Henk, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Relationship of MTHFR and NQO1 Pharmacogenetics and Chemotherapy Clinical Outcomes in Breast Cancer Patients. Biochemical genetics. 2015. Chaturvedi Pankaj, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Single nucleotide polymorphisms in ABCB1 and CBR1 can predict toxicity to R-CHOP type regimens in patients with diffuse non-Hodgkin lymphoma. Haematologica. 2015. Jordheim Lars P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Relationship between ABCB1 gene polymorphisms and severe neutropenia in patients with breast cancer treated with doxorubicin/cyclophosphamide chemotherapy. Drug metabolism and pharmacokinetics. 2015. Ikeda Midori, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Influence of ABCB1 polymorphisms upon the effectiveness of standard treatment for acute myeloid leukemia: A systematic review and meta-analysis of observational studies. The pharmacogenomics journal. 2015. Megías-Vericat J E, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association of ABCB1 polymorphisms with prognostic outcomes of anthracycline and cytarabine in Chinese patients with acute myeloid leukemia. European journal of clinical pharmacology. 2015. He Hui, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The CYP19 RS4646 Polymorphism IS Related to the Prognosis of Stage I-II and Operable Stage III Breast Cancer. PloS one. 2015. Shao Xiying, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Epigenetic perspectives on cancer chemotherapy response. Pharmacogenomics. 2014. Liu Mou-Ze, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Brostallicin versus doxorubicin as first-line chemotherapy in patients with advanced or metastatic soft tissue sarcoma: an European Organisation for Research and Treatment of Cancer Soft Tissue and Bone Sarcoma Group randomised phase II and pharmacogenetic study. European journal of cancer (Oxford, England : 1990). 2014. Gelderblom H, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Oxidative stress-related genetic polymorphisms are associated with the prognosis of metastatic gastric cancer patients treated with epirubicin, oxaliplatin and 5-Fluorouracil combination chemotherapy. PloS one. 2014. Geng Ruixuan, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Inherited GATA3 variants are associated with Ph-like childhood acute lymphoblastic leukemia and risk of relapse. Nature genetics. 2013. Perez-Andreu Virginia, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Germline genetic variants in ABCB1, ABCC1 and ALDH1A1, and risk of hematological and gastrointestinal toxicities in a SWOG Phase III trial S0221 for breast cancer. The pharmacogenomics journal. 2013. Yao S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Common variants in genes coding for chemotherapy metabolizing enzymes, transporters, and targets: a case-control study of contralateral breast cancer risk in the WECARE Study. Cancer causes & control : CCC. 2013. Brooks Jennifer D, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic analysis in the treatment of Hodgkin lymphoma. Leukemia & lymphoma. 2013. Altés Albert, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Triptolide, a Chinese herbal extract, enhances drug sensitivity of resistant myeloid leukemia cell lines through downregulation of HIF-1alpha and Nrf2. Pharmacogenomics. 2013. Chen Feili, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Correlation of aldo-ketoreductase (AKR) 1C3 genetic variant with doxorubicin pharmacodynamics in Asian breast cancer patients. British journal of clinical pharmacology. 2013. Voon Pei Jye, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Implications of Genome-Wide Association Studies in Cancer Therapeutics. British journal of clinical pharmacology. 2013. Patel Jai N, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics as a risk mitigation strategy for chemotherapeutic cardiotoxicity. Pharmacogenomics. 2013. Jensen Brian C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PharmGKB summary: very important pharmacogene information for GSTT1. Pharmacogenetics and genomics. 2012. Thorn Caroline F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Glutathione S-transferase P1 c.313A > G polymorphism could be useful in the prediction of doxorubicin response in breast cancer patients. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO. 2012. Romero A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CYP2C8*3 predicts benefit/risk profile in breast cancer patients receiving neoadjuvant paclitaxel. Breast cancer research and treatment. 2012. Hertz Daniel L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
PharmGKB summary: very important pharmacogene information for G6PD. Pharmacogenetics and genomics. 2012. McDonagh Ellen M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genomic approach towards personalized anticancer drug therapy. Pharmacogenomics. 2012. Midorikawa Yutaka, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Two minor NQO1 and NQO2 alleles predict poor response of breast cancer patients to adjuvant doxorubicin and cyclophosphamide therapy. Pharmacogenetics and genomics. 2011. Jamieson David, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The impact of Fc-gamma receptor polymorphisms in elderly patients with diffuse large B-cell lymphoma treated with CHOP with or without rituximab. Blood. 2011. Ahlgrimm Manfred, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomic Prediction of Anthracycline-Induced Cardiotoxicity in Children. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2011. Visscher Henk, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomic characterization of US FDA-approved cytotoxic drugs. Pharmacogenomics. 2011. Peters Eric J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cytochrome P450 Polymorphisms and their Relationship with Premature Ovarian Failure in Premenopausal Women with Breast Cancer Receiving Doxorubicin and Cyclophosphamide. The breast journal. 2011. Wessels Alette M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Nucleotide excision repair gene variants and association with survival in osteosarcoma patients treated with neoadjuvant chemotherapy. The pharmacogenomics journal. 2011. Biason P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
FcgammaR2A and 3A polymorphisms predict clinical outcome of trastuzumab in both neoadjuvant and metastatic settings in patients with HER2-positive breast cancer. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO. 2011. Tamura K, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Influence of polymorphisms in MTHFR 677 C¿T, TYMS 3R¿2R and MTR 2756 A¿G on NSCLC risk and response to platinum-based chemotherapy in advanced NSCLC. Pharmacogenomics. 2011. Cui Lian-Hua, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genotoxic effects of doxorubicin in cultured human lymphocytes with different glutathione S-transferase genotypes. Mutation research. 2011. Ramos D L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Perspectives on Epigenetics and Its Relevance to Adverse Drug Reactions. Clinical pharmacology and therapeutics. 2011. Kacevska M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Very important pharmacogene summary: ABCB1 (MDR1, P-glycoprotein). Pharmacogenetics and genomics. 2011. Hodges Laura M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Copy number variants in pharmacogenetic genes. Trends in molecular medicine. 2011. He Yijing, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Effect of ABCB1 and ABCC3 polymorphisms on osteosarcoma survival after chemotherapy: a pharmacogenetic study. PloS one. 2011. Caronia Daniela, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Efficacy and cardiac safety of adjuvant trastuzumab-based chemotherapy regimens for HER2-positive early breast cancer. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO. 2010. Costa R B, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Doxorubicin pathways: pharmacodynamics and adverse effects. Pharmacogenetics and genomics. 2010. Thorn Caroline F, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association of ABCB1 polymorphisms with survival and in vitro cytotoxicty in de novo acute myeloid leukemia with normal karyotype. The pharmacogenomics journal. 2010. Gréen H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Medications and glucose-6-phosphate dehydrogenase deficiency: an evidence-based review. Drug safety : an international journal of medical toxicology and drug experience. 2010. Youngster Ilan, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Glutathione S-transferase polymorphisms in osteosarcoma patients. Pharmacogenetics and genomics. 2010. Salinas-Souza Carolina, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Influence of pharmacogenetics on response and toxicity in breast cancer patients treated with doxorubicin and cyclophosphamide. British journal of cancer. 2010. Bray J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Naturally occurring variants of human CBR3 alter anthracycline in vitro metabolism. The Journal of pharmacology and experimental therapeutics. 2010. Bains Onkar S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
MDR1 (C3435T) polymorphism: relation to the risk of breast cancer and therapeutic outcome. The pharmacogenomics journal. 2010. Cizmarikova M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Effect of the anti-neoplastic drug doxorubicin on XPD-mutated DNA repair-deficient human cells. DNA repair. 2010. Saffi Jenifer, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Cyclophosphamide-metabolizing enzyme polymorphisms and survival outcomes after adjuvant chemotherapy for node-positive breast cancer: a retrospective cohort study. Breast cancer research : BCR. 2010. Gor Priya P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The role of topoisomerase IIalpha and HER-2 in predicting sensitivity to anthracyclines in breast cancer patients. Cancer treatment reviews. 2009. Oakman Catherine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Different anthracycline derivates for reducing cardiotoxicity in cancer patients. Cochrane database of systematic reviews (Online). 2010. van Dalen Elvira C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Post-treatment tumor gene expression signatures are more predictive of treatment outcomes than baseline signatures in breast cancer. Pharmacogenetics and genomics. 2009. Lee Soo-Chin, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association study of genetic polymorphism in ABCC4 with cyclophosphamide-induced adverse drug reactions in breast cancer patients. Journal of human genetics. 2009. Low Siew-Kee, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Improving the therapeutic index of anthracycline chemotherapy: focus on liposomal doxorubicin (Myocet). Breast (Edinburgh, Scotland). 2009. Leonard R C F, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Nitric oxide synthase variants and disease-free survival among treated and untreated breast cancer patients in a Southwest Oncology Group clinical trial. Clinical cancer research : an official journal of the American Association for Cancer Research. 2009. Choi Ji-Yeob, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Inhibition of serine/threonine phosphatase PP2A enhances cancer chemotherapy by blocking DNA damage induced defense mechanisms. Proceedings of the National Academy of Sciences of the United States of America. 2009. Lu Jie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Analysis of the host pharmacogenetic background for prediction of outcome and toxicity in diffuse large B-cell lymphoma treated with R-CHOP21. Leukemia : official journal of the Leukemia Society of America, Leukemia Research Fund, U.K. 2009. Rossi D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Inhibition of Hedgehog signaling enhances delivery of chemotherapy in a mouse model of pancreatic cancer. Science (New York, N.Y.). 2009. Olive Kenneth P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Host genetic variants in the interleukin-6 promoter predict poor outcome in patients with estrogen receptor-positive, node-positive breast cancer. Cancer research. 2009. DeMichele Angela, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Two nonsynonymous single nucleotide polymorphisms of human carbonyl reductase 1 demonstrate reduced in vitro metabolism of daunorubicin and doxorubicin. Drug metabolism and disposition: the biological fate of chemicals. 2009. Bains Onkar S, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Methotrexate in pediatric osteosarcoma: response and toxicity in relation to genetic polymorphisms and dihydrofolate reductase and reduced folate carrier 1 expression. The Journal of pediatrics. 2009. Patiño-García Ana, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Association of the ABCB1 gene polymorphisms 2677G>T/A and 3435C>T with clinical outcomes of paclitaxel monotherapy in metastatic breast cancer patients. Annals of oncology : official journal of the European Society for Medical Oncology / ESMO. 2009. Chang H, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetics of human carbonyl reductase 1 (CBR1) in livers from black and white donors. Drug metabolism and disposition: the biological fate of chemicals. 2009. Gonzalez-Covarrubias Vanessa, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
New developments in anthracycline-induced cardiotoxicity. Current medicinal chemistry. 2009. Mordente A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Topoisomerase II alpha as a marker predicting anthracyclines' activity in early breast cancer patients: ready for the primetime?. European journal of cancer (Oxford, England : 1990). 2008. Di Leo Angelo, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CBR1 and CBR3 pharmacogenetics and their influence on doxorubicin disposition in Asian breast cancer patients. Cancer science. 2008. Lal Suman, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Carbonyl reductase 1 is a predominant doxorubicin reductase in the human liver. Drug metabolism and disposition: the biological fate of chemicals. 2008. Kassner Nina, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Inactivation of the anticancer drugs doxorubicin and oracin by aldo-keto reductase (AKR) 1C3. Toxicology letters. 2008. Novotna Romana, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Metastatic breast cancer: the role of pegylated liposomal doxorubicin after conventional anthracyclines. Cancer treatment reviews. 2008. Verma Shailendra, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Hypoxia-induced resistance to anticancer drugs is associated with decreased senescence and requires hypoxia-inducible factor-1 activity. Molecular cancer therapeutics. 2008. Sullivan Richard, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genotype of human carbonyl reductase CBR3 correlates with doxorubicin disposition and toxicity. Pharmacogenetics and genomics. 2008. Fan Lu, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Topoisomerase levels determine chemotherapy response in vitro and in vivo. Proceedings of the National Academy of Sciences of the United States of America. 2008. Burgess Darren J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Drug target identification using side-effect similarity. Science (New York, N.Y.). 2008. Campillos Monica, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Structure, function and regulation of P-glycoprotein and its clinical relevance in drug disposition. Xenobiotica; the fate of foreign compounds in biological systems. 2008. Zhou S-F. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms in the carbonyl reductase 3 gene CBR3 and the NAD(P)H:quinone oxidoreductase 1 gene NQO1 in patients who developed anthracycline-related congestive heart failure after childhood cancer. Cancer. 2008. Blanco Javier G, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HER2/neu in systemic therapy for women with breast cancer: a systematic review. Breast cancer research and treatment. 2008. Dhesy-Thind Bindi, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
MDR1 diplotypes as prognostic markers in multiple myeloma. Pharmacogenetics and genomics. 2008. Maggini Valentina, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Influence of ABCB1 and ABCG2 polymorphisms on doxorubicin disposition in Asian breast cancer patients. Cancer science. 2008. Lal Suman, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HER2 status and efficacy of adjuvant anthracyclines in early breast cancer: a pooled analysis of randomized trials. Journal of the National Cancer Institute. 2008. Gennari Alessandra, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Glucose-6-phosphate dehydrogenase deficiency. Lancet. 2008. Cappellini M D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cardioprotective interventions for cancer patients receiving anthracyclines. Cochrane database of systematic reviews (Online). 2008. van Dalen E C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Reversal of drug resistance of hepatocellular carcinoma cells by adenoviral delivery of anti-ABCC2 antisense constructs. Cancer gene therapy. 2007. Folmer Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HER2 and response to paclitaxel in node-positive breast cancer. The New England journal of medicine. 2007. Hayes Daniel F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic analysis of paclitaxel transport and metabolism genes in breast cancer. The pharmacogenomics journal. 2007. Marsh S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
G6PD deficiency: the genotype-phenotype association. Blood reviews. 2007. Mason Philip J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Topoisomerase IIbeta mediated DNA double-strand breaks: implications in doxorubicin cardiotoxicity and prevention by dexrazoxane. Cancer research. 2007. Lyu Yi Lisa, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Novel SLC22A16 polymorphisms and influence on doxorubicin pharmacokinetics in Asian breast cancer patients. Pharmacogenomics. 2007. Lal Suman, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Expression levels and activation of a PXR variant are directly related to drug resistance in osteosarcoma cell lines. Cancer. 2007. Mensah-Osman Edith J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Re-evaluation and functional classification of non-synonymous single nucleotide polymorphisms of the human ATP-binding cassette transporter ABCG2. Cancer science. 2007. Tamura Ai, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Adriamycin-induced interference with cardiac mitochondrial calcium homeostasis. Cardiovascular toxicology. 2007. Wallace Kendall B. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Anthracycline cardiotoxicity in breast cancer patients: synergism with trastuzumab and taxanes. Cardiovascular toxicology. 2007. Gianni Luca, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of anthracyclines in the era of targeted therapy. Cardiovascular toxicology. 2007. Cortés-Funes Hernán, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genomic signatures to guide the use of chemotherapeutics. Nature medicine. 2006. Potti Anil, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Multidrug resistance-1 gene polymorphisms associated with treatment outcomes in de novo acute myeloid leukemia. International journal of cancer. Journal international du cancer. 2006. Kim Dong Hwan, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
NAD(P)H oxidase and multidrug resistance protein genetic polymorphisms are associated with doxorubicin-induced cardiotoxicity. Circulation. 2005. Wojnowski Leszek, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Characterization of the organic cation transporter SLC22A16: a doxorubicin importer. Biochemical and biophysical research communications. 2005. Okabe Mitsunori, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Polymorphisms of genes controlling homocysteine levels and IQ score following the treatment for childhood ALL. Pharmacogenomics. 2005. Krajinovic Maja, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cyclosporin A is a broad-spectrum multidrug resistance modulator. Clinical cancer research : an official journal of the American Association for Cancer Research. 2005. Qadir Misbah, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Reversal of multidrug resistance of cancer through inhibition of P-glycoprotein by 5-bromotetrandrine. Cancer chemotherapy and pharmacology. 2005. Jin Jing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cardiac safety of liposomal anthracyclines. Seminars in oncology. 2004. Ewer Michael S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Transmembrane helix 11 of multidrug resistance protein 1 (MRP1/ABCC1): identification of polar amino acids important for substrate specificity and binding of ATP at nucleotide binding domain 1. Biochemistry. 2004. Zhang Da-Wei, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Complete reversal of multidrug resistance by stable expression of small interfering RNAs targeting MDR1. Gene therapy. 2004. Yagüe E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Anthracyclines: molecular advances and pharmacologic developments in antitumor activity and cardiotoxicity. Pharmacological reviews. 2004. Minotti Giorgio, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The oral iron chelator ICL670A (deferasirox) does not protect myocytes against doxorubicin. Free radical biology & medicine. 2003. Hasinoff Brian B, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Doxorubicin cardiotoxicity and the control of iron metabolism: quinone-dependent and independent mechanisms. Methods in enzymology. 2004. Minotti Giorgio, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Oxidant-induced iron signaling in Doxorubicin-mediated apoptosis. Methods in enzymology. 2004. Kotamraju Srigiridhar, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Protection from doxorubicin-induced cardiac toxicity in mice with a null allele of carbonyl reductase 1. Cancer research. 2003. Olson Lisa E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Anthracycline secondary alcohol metabolite formation in human or rabbit heart: biochemical aspects and pharmacologic implications. Biochemical pharmacology. 2003. Mordente Alvaro, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Characterization of p53-mediated up-regulation of CD95 gene expression upon genotoxic treatment in human breast tumor cells. The Journal of biological chemistry. 2003. Ruiz-Ruiz Carmen, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Down-regulation of thiamine transporter THTR2 gene expression in breast cancer and its association with resistance to apoptosis. Molecular cancer research : MCR. 2003. Liu Shuqian, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Congestive heart failure in patients treated with doxorubicin: a retrospective analysis of three trials. Cancer. 2003. Swain Sandra M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Oxidative stress caused by inactivation of glutathione peroxidase and adaptive responses. Biological chemistry. 2003. Miyamoto Yasuhide, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Topoisomerase II-alpha (topoII) and HER2 amplification in breast cancers and response to preoperative doxorubicin chemotherapy. European journal of cancer (Oxford, England : 1990). 2003. Park K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Interactions between doxorubicin and the human iron regulatory system. Biochimica et biophysica acta. 2003. Brazzolotto Xavier, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PKC epsilon -mediated ERK1/2 activation involved in radiation-induced cell death in NIH3T3 cells. Biochimica et biophysica acta. 2003. Lee Yoon-Jin, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Potent metalloporphyrin peroxynitrite decomposition catalyst protects against the development of doxorubicin-induced cardiac dysfunction. Circulation. 2003. Pacher Pál, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Differential actions of cardioprotective agents on the mitochondrial death pathway. Circulation research. 2003. Akao Masaharu, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Mimicking phosphorylation of alphaB-crystallin on serine-59 is necessary and sufficient to provide maximal protection of cardiac myocytes from apoptosis. Circulation research. 2003. Morrison Lisa E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of RLIP76 in lung cancer doxorubicin resistance: I. The ATPase activity of RLIP76 correlates with doxorubicin and 4-hydroxynonenal resistance in lung cancer cells. International journal of oncology. 2003. Singhal Sharad S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Doxorubicin-derived metabolites induce release of cytochrome C and inhibition of respiration on cardiac isolated mitochondria. Anticancer research. 2003. Clementi Maria Elisabetta, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Differential ability of cytostatics from anthraquinone group to generate free radicals in three enzymatic systems: NADH dehydrogenase, NADPH cytochrome P450 reductase, and xanthine oxidase. Oncology research. 2003. Paw¿owska Jolanta, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Characterization of the drug resistance and transport properties of multidrug resistance protein 6 (MRP6, ABCC6). Cancer research. 2002. Belinsky Martin G, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Reversal of drug resistance using hammerhead ribozymes against multidrug resistance-associated protein and multidrug resistance 1 gene. International journal of oncology. 2002. Nagata Junko, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Determination of doxorubicin and its metabolites in rat serum and bile by LC: application to preclinical pharmacokinetic studies. Journal of pharmaceutical and biomedical analysis. 2002. Zhou Qingyu, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Activation of nuclear factor-kappaB during doxorubicin-induced apoptosis in endothelial cells and myocytes is pro-apoptotic: the role of hydrogen peroxide. The Biochemical journal. 2002. Wang Suwei, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Variant of SCN5A sodium channel implicated in risk of cardiac arrhythmia. Science (New York, N.Y.). 2002. Splawski Igor, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Early changes in myocardial antioxidant enzymes in rats treated with adriamycin. Molecular and cellular biochemistry. 2002. Li Timao, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The role of p53 and pRB in apoptosis and cancer. Current opinion in genetics & development. 2002. Hickman Emma S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Impact of BCRP/MXR, MRP1 and MDR1/P-Glycoprotein on thermoresistant variants of atypical and classical multidrug resistant cancer cells. International journal of cancer. Journal international du cancer. 2002. Stein Ulrike, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Doxorubicin irreversibly inactivates iron regulatory proteins 1 and 2 in cardiomyocytes: evidence for distinct metabolic pathways and implications for iron-mediated cardiotoxicity of antitumor therapy. Cancer research. 2001. Minotti G, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Enhancement of the activity of doxorubicin by inhibition of glutamate transporter. Toxicology letters. 2001. Sadzuka Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Resistance to topoisomerase poisons due to loss of DNA mismatch repair. International journal of cancer. Journal international du cancer. 2001. Fedier A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
RLIP76 is the major ATP-dependent transporter of glutathione-conjugates and doxorubicin in human erythrocytes. Archives of biochemistry and biophysics. 2001. Sharma R, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Multidrug resistance proteins MRP3, MRP1, and MRP2 in lung cancer: correlation of protein levels with drug response and messenger RNA levels. Clinical cancer research : an official journal of the American Association for Cancer Research. 2001. Young L C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of glutathione S-transferase P1, P-glycoprotein and multidrug resistance-associated protein 1 in acquired doxorubicin resistance. International journal of cancer. Journal international du cancer. 2001. Harbottle A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Oxidative DNA base modifications in peripheral blood mononuclear cells of patients treated with high-dose infusional doxorubicin. Blood. 2001. Doroshow J H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Mechanism of specific nuclear transport of adriamycin: the mode of nuclear translocation of adriamycin-proteasome complex. Cancer research. 2001. Kiyomiya K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gene expression and amplification in breast carcinoma cells with intrinsic and acquired doxorubicin resistance. Oncogene. 2001. Turton N J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2. The New England journal of medicine. 2001. Slamon D J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Reversal of multidrug resistance by the P-glycoprotein modulator, LY335979, from the bench to the clinic. Current medicinal chemistry. 2001. Dantzig A H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of apoptosis and apoptosis-related genes in cellular response and antitumor efficacy of anthracyclines. Current medicinal chemistry. 2001. Perego P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Human carbonyl reductase overexpression in the heart advances the development of doxorubicin-induced cardiotoxicity in transgenic mice. Cancer research. 2000. Forrest G L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Anticancer derivative of butyric acid (Pivalyloxymethyl butyrate) specifically potentiates the cytotoxicity of doxorubicin and daunorubicin through the suppression of microsomal glycosidic activity. Molecular pharmacology. 2000. Niitsu N, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cardiac peroxynitrite formation and left ventricular dysfunction following doxorubicin treatment in mice. The Journal of pharmacology and experimental therapeutics. 2000. Weinstein D M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Doxorubicin metabolism and toxicity in human myocardium: role of cytoplasmic deglycosidation and carbonyl reduction. Chemical research in toxicology. 2000. Licata S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Effect of tamoxifen pretreatment on the pharmacokinetics, metabolism and cardiotoxicity of doxorubicin in female rats. Cancer chemotherapy and pharmacology. 2000. Vaidyanathan S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The decrease of mitochondrial NADH dehydrogenease and drug induced apoptosis in doxorubicin resistant A431 cells. Life sciences. 2000. Wong T W, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Inhibition of aldo-keto reductases by phenobarbital alters metabolism, pharmacokinetics and toxicity of doxorubicin in rats. The Journal of pharmacy and pharmacology. 1999. Behnia K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
L-carnitine prevents doxorubicin-induced apoptosis of cardiac myocytes: role of inhibition of ceramide generation. The FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 1999. Andrieu-Abadie N, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Drug-induced apoptosis is delayed and reduced in XPD lymphoblastoid cell lines: possible role of TFIIH in p53-mediated apoptotic cell death. Oncogene. 1999. Robles A I, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Topoisomerase poisoning activity of novel disaccharide anthracyclines. Molecular pharmacology. 1999. Guano F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A critical evaluation of the mechanisms of action proposed for the antitumor effects of the anthracycline antibiotics adriamycin and daunorubicin. Biochemical pharmacology. 1999. Gewirtz D A. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of MRP1 in multidrug resistance in acute myeloid leukemia. Leukemia : official journal of the Leukemia Society of America, Leukemia Research Fund, U.K. 1999. Legrand O, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Characterization of vincristine transport by the M(r) 190,000 multidrug resistance protein (MRP): evidence for cotransport with reduced glutathione. Cancer research. 1998. Loe D W, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Dexrazoxane. A review of its use as a cardioprotective agent in patients receiving anthracycline-based chemotherapy. Drugs. 1998. Wiseman L R, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Coordinated action of glutathione S-transferases (GSTs) and multidrug resistance protein 1 (MRP1) in antineoplastic drug detoxification. Mechanism of GST A1-1- and MRP1-associated resistance to chlorambucil in MCF7 breast carcinoma cells. The Journal of biological chemistry. 1998. Morrow C S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Doxorubicin- and daunorubicin-glutathione conjugates, but not unconjugated drugs, competitively inhibit leukotriene C4 transport mediated by MRP/GS-X pump. Biochemical and biophysical research communications. 1998. Priebe W, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The secondary alcohol metabolite of doxorubicin irreversibly inactivates aconitase/iron regulatory protein-1 in cytosolic fractions from human myocardium. The FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 1998. Minotti G, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The exogenous NADH dehydrogenase of heart mitochondria is the key enzyme responsible for selective cardiotoxicity of anthracyclines. Zeitschrift für Naturforschung. C, Journal of biosciences. 1998. Nohl H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Comparison of oxygen radical generation from the reductive activation of doxorubicin, streptonigrin, and menadione by xanthine oxidase and xanthine dehydrogenase. Archives of biochemistry and biophysics. 1997. Yee S B, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Endothelial nitric oxide synthase-dependent superoxide generation from adriamycin. Biochemistry. 1997. Vásquez-Vivar J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cardioprotection with dexrazoxane for doxorubicin-containing therapy in advanced breast cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 1997. Swain S M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Delayed administration of dexrazoxane provides cardioprotection for patients with advanced breast cancer treated with doxorubicin-containing therapy. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 1997. Swain S M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Analyses of the molecular mechanism of adriamycin-induced cardiotoxicity. Free radical biology & medicine. 1997. Gille L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Iron homeostasis, oxidative stress, and DNA damage. Free radical biology & medicine. 1997. Meneghini R. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Glucose-6-phosphate dehydrogenase deficiency severely restricts the biotransformation of daunorubicin in human erythrocytes. The Journal of laboratory and clinical medicine. 1996. Amitai Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Relation among the resistance factor, kinetics of uptake, and kinetics of the P-glycoprotein-mediated efflux of doxorubicin, daunorubicin, 8-(S)-fluoroidarubicin, and idarubicin in multidrug-resistant K562 cells. Molecular pharmacology. 1996. Mankhetkorn S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Protection against daunorubicin cytotoxicity by expression of a cloned human carbonyl reductase cDNA in K562 leukemia cells. Cancer research. 1995. Gonzalez B, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Disruption of mitochondrial calcium homeostasis following chronic doxorubicin administration. Toxicology and applied pharmacology. 1994. Solem L E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacological characterization of multidrug resistant MRP-transfected human tumor cells. Cancer research. 1994. Cole S P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
p53 status and the efficacy of cancer therapy in vivo. Science (New York, N.Y.). 1994. Lowe S W, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The human multidrug resistance-associated protein MRP is a plasma membrane drug-efflux pump. Proceedings of the National Academy of Sciences of the United States of America. 1994. Zaman G J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Interference by doxorubicin with DNA unwinding in MCF-7 breast tumor cells. Molecular pharmacology. 1994. Fornari F A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Overexpression of multidrug resistance-associated protein (MRP) increases resistance to natural product drugs. Cancer research. 1994. Grant C E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Overexpression of a transporter gene in a multidrug-resistant human lung cancer cell line. Science (New York, N.Y.). 1992. Cole S P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The anthracyclines: will we ever find a better doxorubicin?. Seminars in oncology. 1992. Weiss R B. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of cytochrome P-450 from the human CYP3A gene family in the potentiation of morpholino doxorubicin by human liver microsomes. Cancer research. 1992. Lewis A D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Efficient inhibition of P-glycoprotein-mediated multidrug resistance with a monoclonal antibody. Proceedings of the National Academy of Sciences of the United States of America. 1992. Mechetner E B, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Helicase inhibition by anthracycline anticancer agents. Molecular pharmacology. 1992. Bachur N R, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of xanthine oxidase in the potentiation of doxorubicin-induced cardiotoxicity by mitomycin C. Cancer communications. 1991. Gustafson D L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Doxorubicin resistance conferred by selective enhancement of intracellular glutathione peroxidase or superoxide dismutase content in human MCF-7 breast cancer cells. Free radical research communications. 1991. Doroshow J H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Antioxidant and xenobiotic-metabolizing enzyme gene expression in doxorubicin-resistant MCF-7 breast cancer cells. Cancer research. 1990. Akman S A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DNA topoisomerase II-mediated interaction of doxorubicin and daunorubicin congeners with DNA. Cancer research. 1989. Bodley A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Adriamycin activation and oxygen free radical formation in human breast tumor cells: protective role of glutathione peroxidase in adriamycin resistance. Cancer research. 1989. Sinha B K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Effect of adriamycin on the activities of superoxide dismutase, glutathione peroxidase and catalase in tissues of mice. Japanese journal of cancer research : Gann. 1989. Sazuka Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Verapamil reversal of doxorubicin resistance in multidrug-resistant human myeloma cells and association with drug accumulation and DNA damage. Cancer research. 1988. Bellamy W T, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The role of oxygen-derived free radicals in the cytotoxicity of doxorubicin in multidrug resistant and sensitive human ovarian cancer cells. Cancer letters. 1988. Cervantes A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Detection of the effects of intercalating and non-intercalating drugs on DNA structure. Biochemical pharmacology. 1988. Montecucco A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of iron in adriamycin biochemistry. Federation proceedings. 1986. Myers C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of hydrogen peroxide and hydroxyl radical formation in the killing of Ehrlich tumor cells by anticancer quinones. Proceedings of the National Academy of Sciences of the United States of America. 1986. Doroshow J H. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DNA polymerases and DNA topoisomerases as targets for the development of anticancer drugs. Anticancer research. 1986. Spadari S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Reduction of oxygen by NADH/NADH dehydrogenase in the presence of adriamycin. Free radical research communications. 1986. Thornalley P J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Augmentation of adriamycin, melphalan, and cisplatin cytotoxicity in drug-resistant and -sensitive human ovarian carcinoma cell lines by buthionine sulfoximine mediated glutathione depletion. Biochemical pharmacology. 1985. Hamilton T C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Adriamycin-induced DNA damage mediated by mammalian DNA topoisomerase II. Science (New York, N.Y.). 1984. Tewey K M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Reduced cardiotoxicity of doxorubicin delivered on a weekly schedule. Assessment by endomyocardial biopsy. Annals of internal medicine. 1983. Torti F M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Effect of anthracycline antibiotics on oxygen radical formation in rat heart. Cancer research. 1983. Doroshow J H. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Enzymatic defenses of the mouse heart against reactive oxygen metabolites: alterations produced by doxorubicin. The Journal of clinical investigation. 1980. Doroshow J H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Risk factors for doxorubicin-induced congestive heart failure. Annals of internal medicine. 1979. Von Hoff D D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
The effect of BCNU and adriamycin on normal and G6PD deficient erythrocytes. American journal of hematology. 1979. Sagone A L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Inability to isolate the 3beta-hydroxysteroid dehydrogenase from bovine ovaries using a procedure which isolates the adrenal enzyme. Journal of steroid biochemistry. 1976. Gibb W, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A clinicopathologic analysis of adriamycin cardiotoxicity. Cancer. 1973. Lefrak E A, et al. PubMed


Web Resource:
National Drug Code Directory:
KEGG Compound:
KEGG Drug:
PubChem Compound:
PubChem Substance:
Drugs Product Database (DPD):
Therapeutic Targets Database:
FDA Drug Label at DailyMed:

Clinical Trials

These are trials that mention doxorubicin and are related to either pharmacogenetics or pharmacogenomics.

No trials found.

Common Searches

Search PubMed
Search Medline Plus
Search PubChem
Search CTD

Sources for PharmGKB drug information: DrugBank, PubChem.