Chemical: Drug
cisplatin

PharmGKB contains no prescribing info for this . Contact us to report known genotype-based dosing guidelines, or if you are interested in developing guidelines.


last updated 10/25/2013

1. Annotation of FDA Label for cisplatin and TPMT

Informative PGx

Summary

The FDA-approved drug label for cisplatin was changed (in 2015) to reflect the level of uncertainty about the relationship between TPMT and cisplatin-induced ototoxicity. The Pharmacogenomics section was removed, and text was modified in the Warnings, Precautions and Adverse Reactions sections.

Annotation

Excerpt from the cisplatin drug label:

Genetic factors (e.g. variants in the thiopurine S-methyltransferase (TPMT) gene) may contribute to cisplatin-induced ototoxicity; although this association has not been consistent across populations and study designs.

For the complete drug label text with sections containing pharmacogenetic information highlighted, see the cisplatin drug label.

*Disclaimer: The contents of this page have not been endorsed by the FDA and are the sole responsibility of PharmGKB.

Full label available at DailyMed

Genes and/or phenotypes found in this label

  • Anemia
    • Adverse reactions section
    • source: PHONT
  • Carcinoma, Non-Small-Cell Lung
    • Indications & usage section, Precautions section
    • source: PHONT
  • Carcinoma, Small Cell
    • Indications & usage section, Precautions section
    • source: PHONT
  • Neoplasms
    • Indications & usage section, Warnings section, Adverse reactions section, Precautions section
    • source: PHONT
  • Neutropenia
    • Adverse reactions section, Precautions section
    • source: PHONT
  • Ototoxicity
    • Boxed warning section, Warnings section, Adverse reactions section, Clinical pharmacology section, Precautions section
    • source: U.S. Food and Drug Administration
  • Ovarian Neoplasms
    • Precautions section
    • source: PHONT
  • Peripheral Nervous System Diseases
    • Warnings section, Adverse reactions section, Precautions section
    • source: PHONT
  • Thrombocytopenia
    • Adverse reactions section, Precautions section
    • source: PHONT
  • TPMT
    • toxicity, Adverse reactions section
    • source: PharmGKB

Clinical Variants that meet the highest level of criteria, manually curated by PharmGKB, are shown below.

To see more Clinical Variants with lower levels of criteria, click the button at the bottom of the page.

Disclaimer: The PharmGKB's clinical annotations reflect expert consensus based on clinical evidence and peer-reviewed literature available at the time they are written and are intended only to assist clinicians in decision-making and to identify questions for further research. New evidence may have emerged since the time an annotation was submitted to the PharmGKB. The annotations are limited in scope and are not applicable to interventions or diseases that are not specifically identified.

The annotations do not account for individual variations among patients, and cannot be considered inclusive of all proper methods of care or exclusive of other treatments. It remains the responsibility of the health-care provider to determine the best course of treatment for a patient. Adherence to any guideline is voluntary, with the ultimate determination regarding its application to be made solely by the clinician and the patient. PharmGKB assumes no responsibility for any injury or damage to persons or property arising out of or related to any use of the PharmGKB clinical annotations, or for any errors or omissions.

? = Mouse-over for quick help

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Links in the "Gene" column lead to PharmGKB Gene Pages.

List of all variant annotations for cisplatin

Gene ? Variant?
(147)
Alternate Names ? Chemicals ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
Translation
No VIP available No VIP available VA CYP3A4 *1 N/A N/A N/A
No VIP available No VIP available VA CYP3A4 *22 N/A N/A N/A
No VIP available No VIP available VA CYP3A5 *1A N/A N/A N/A
No VIP available No VIP available VA CYP3A5 *3A N/A N/A N/A
No VIP available CA VA GSTM1 non-null N/A N/A N/A
No VIP available CA VA GSTM1 null N/A N/A N/A
No VIP available CA VA GSTT1 non-null N/A N/A N/A
No VIP available CA VA GSTT1 null N/A N/A N/A
No VIP available CA VA TPMT *1 N/A N/A N/A
No VIP available CA VA TPMT *3A N/A N/A N/A
No VIP available No VIP available VA UGT1A1 *1 N/A N/A N/A
No VIP available No VIP available VA UGT1A1 *28 N/A N/A N/A
No VIP available No Clinical Annotations available VA
rs10209881 NC_000002.11:g.31246249T>C, NC_000002.12:g.31023383T>C, NM_001253826.1:c.315-57081A>G, NM_001253827.1:c.70-30376A>G, NM_024572.3:c.130-30376A>G, NR_045602.1:n.903-30376A>G, XM_005264559.1:c.25-30376A>G, XM_011533104.1:c.448-30376A>G, XM_011533105.1:c.70-30376A>G, XM_011533106.1:c.43-30376A>G, rs56517291, rs57849618, rs59539437
T > C
SNP
No VIP available CA VA
rs10276036 NC_000007.13:g.87180198C>T, NC_000007.14:g.87550882C>T, NG_011513.1:g.167367G>A, NM_000927.4:c.1000-44G>A, rs10488634, rs111193439, rs17276942, rs57688958, rs58206924
C > A
C > T
SNP
No VIP available CA VA
rs1042522 NC_000017.10:g.7579472G=, NC_000017.10:g.7579472G>C, NC_000017.10:g.7579472G>T, NC_000017.11:g.7676154G=, NC_000017.11:g.7676154G>C, NC_000017.11:g.7676154G>T, NG_017013.2:g.16397C=, NG_017013.2:g.16397C>A, NG_017013.2:g.16397C>G, NM_000546.5:c.215C=, NM_000546.5:c.215C>A, NM_000546.5:c.215C>G, NM_001126112.2:c.215C=, NM_001126112.2:c.215C>A, NM_001126112.2:c.215C>G, NM_001126113.2:c.215C=, NM_001126113.2:c.215C>A, NM_001126113.2:c.215C>G, NM_001126114.2:c.215C=, NM_001126114.2:c.215C>A, NM_001126114.2:c.215C>G, NM_001126115.1:c.-939C=, NM_001126115.1:c.-939C>A, NM_001126115.1:c.-939C>G, NM_001126116.1:c.-939C=, NM_001126116.1:c.-939C>A, NM_001126116.1:c.-939C>G, NM_001126117.1:c.-939C=, NM_001126117.1:c.-939C>A, NM_001126117.1:c.-939C>G, NM_001126118.1:c.98C=, NM_001126118.1:c.98C>A, NM_001126118.1:c.98C>G, NM_001276695.1:c.98C=, NM_001276695.1:c.98C>A, NM_001276695.1:c.98C>G, NM_001276696.1:c.98C=, NM_001276696.1:c.98C>A, NM_001276696.1:c.98C>G, NM_001276697.1:c.-1020C=, NM_001276697.1:c.-1020C>A, NM_001276697.1:c.-1020C>G, NM_001276698.1:c.-1020C=, NM_001276698.1:c.-1020C>A, NM_001276698.1:c.-1020C>G, NM_001276699.1:c.-1020C=, NM_001276699.1:c.-1020C>A, NM_001276699.1:c.-1020C>G, NM_001276760.1:c.98C=, NM_001276760.1:c.98C>A, NM_001276760.1:c.98C>G, NM_001276761.1:c.98C=, NM_001276761.1:c.98C>A, NM_001276761.1:c.98C>G, NP_000537.3:p.Pro72=, NP_000537.3:p.Pro72Arg, NP_000537.3:p.Pro72His, NP_001119584.1:p.Pro72=, NP_001119584.1:p.Pro72Arg, NP_001119584.1:p.Pro72His, NP_001119585.1:p.Pro72=, NP_001119585.1:p.Pro72Arg, NP_001119585.1:p.Pro72His, NP_001119586.1:p.Pro72=, NP_001119586.1:p.Pro72Arg, NP_001119586.1:p.Pro72His, NP_001119590.1:p.Pro33=, NP_001119590.1:p.Pro33Arg, NP_001119590.1:p.Pro33His, NP_001263624.1:p.Pro33=, NP_001263624.1:p.Pro33Arg, NP_001263624.1:p.Pro33His, NP_001263625.1:p.Pro33=, NP_001263625.1:p.Pro33Arg, NP_001263625.1:p.Pro33His, NP_001263689.1:p.Pro33=, NP_001263689.1:p.Pro33Arg, NP_001263689.1:p.Pro33His, NP_001263690.1:p.Pro33=, NP_001263690.1:p.Pro33Arg, NP_001263690.1:p.Pro33His, XM_005256778.1:c.176-21C=, XM_005256778.1:c.176-21C>A, XM_005256778.1:c.176-21C>G, XR_243565.1:n.354C=, XR_243565.1:n.354C>A, XR_243565.1:n.354C>G, XR_243566.1:n.354C=, XR_243566.1:n.354C>A, XR_243566.1:n.354C>G, rs17844988, rs17857747, rs17882155, rs2229076, rs3174747, rs4134781, rs60388830
G > C
SNP
P72R
No VIP available No Clinical Annotations available VA
rs1042858 NC_000011.10:g.4138236G>A, NC_000011.9:g.4159466G>A, NG_027992.2:g.48543G>A, NM_001033.3:c.2232G>A, NM_001033.4:c.2232G>A, NM_001318064.1:c.1941G>A, NM_001318065.1:c.1218G>A, NP_001024.1:p.Ala744=, NP_001304993.1:p.Ala647=, NP_001304994.1:p.Ala406=, XM_005253058.1:c.1989G>A, XM_005253059.1:c.1941G>A, XM_011520277.1:c.1941G>A, XM_011520278.1:c.1566G>A, XM_011520279.1:c.1218G>A, XP_005253115.1:p.Ala663=, XP_005253116.1:p.Ala647=, XP_011518579.1:p.Ala647=, XP_011518580.1:p.Ala522=, XP_011518581.1:p.Ala406=, rs17850107, rs2229195, rs2584873, rs3168060, rs57259172
G > A
SNP
A744A
No VIP available No Clinical Annotations available VA
rs1042927 NC_000011.10:g.4138699C>A, NC_000011.9:g.4159929C>A, NG_027992.2:g.49006C>A, NM_001033.3:c.*316C>A, NM_001033.4:c.*316C>A, NM_001318064.1:c.*316C>A, NM_001318065.1:c.*316C>A, XM_005253058.1:c.*316C>A, XM_005253059.1:c.*316C>A, XM_011520277.1:c.*316C>A, XM_011520278.1:c.*316C>A, XM_011520279.1:c.*316C>A, rs16930058, rs1735067, rs3168058, rs58834141
C > A
SNP
No VIP available No Clinical Annotations available VA
rs10434 NC_000006.11:g.43753212A>G, NC_000006.12:g.43785475A>G, NG_008732.1:g.20260A>G, NM_001025366.2:c.*913A>G, NM_001025367.2:c.*913A>G, NM_001025368.2:c.*913A>G, NM_001025369.2:c.*929A>G, NM_001025370.2:c.*913A>G, NM_001033756.2:c.*847A>G, NM_001171622.1:c.*913A>G, NM_001171623.1:c.*913A>G, NM_001171624.1:c.*913A>G, NM_001171625.1:c.*913A>G, NM_001171626.1:c.*913A>G, NM_001171627.1:c.*929A>G, NM_001171628.1:c.*913A>G, NM_001171629.1:c.*847A>G, NM_001171630.1:c.*913A>G, NM_001204384.1:c.*913A>G, NM_001204385.1:c.*913A>G, NM_001287044.1:c.*913A>G, NM_001317010.1:c.*847A>G, NM_003376.5:c.*913A>G, XM_005249363.1:c.*913A>G, rs3173233, rs60316096
A > G
SNP
No VIP available No Clinical Annotations available VA
rs1044457 NC_000001.10:g.47842777C>T, NC_000001.11:g.47377105C>T, NM_001136140.1:c.*360C>T, NM_016308.2:c.*360C>T, NR_046394.1:n.1119C>T, rs17378832, rs3184215, rs3767626
C > -
C > T
SNP
rs1045642 NC_000007.13:g.87138645A>G, NC_000007.14:g.87509329A>G, NG_011513.1:g.208920T>C, NM_000927.4:c.3435T>C, NP_000918.2:p.Ile1145=, rs10239679, rs11568726, rs117328163, rs17210003, rs2229108, rs386513066, rs60023214, rs9690664
A > G
SNP
I1145I
No VIP available CA VA
rs1051640 NC_000017.10:g.48768486A>G, NC_000017.11:g.50691125A>G, NM_003786.3:c.4509A>G, NP_003777.2:p.Glu1503=, XM_005257763.1:c.4317A>G, XM_005257763.2:c.4317A>G, XM_011525422.1:c.4422A>G, XM_011525423.1:c.4614A>G, XM_011525424.1:c.3834A>G, XM_011525425.1:c.3783A>G, XP_005257820.1:p.Glu1439=, XP_011523724.1:p.Glu1474=, XP_011523725.1:p.Glu1538=, XP_011523726.1:p.Glu1278=, XP_011523727.1:p.Glu1261=, XR_934586.1:n.4970A>G, rs17414117, rs17643255, rs3192040, rs57272614, rs60786737
A > G
SNP
E1503E
No VIP available CA VA
rs1051740 NC_000001.10:g.226019633T>C, NC_000001.11:g.225831932T>C, NG_009776.1:g.26837T>C, NM_000120.3:c.337T>C, NM_001136018.3:c.337T>C, NM_001291163.1:c.337T>C, NP_000111.1:p.Tyr113His, NP_001129490.1:p.Tyr113His, NP_001278092.1:p.Tyr113His, XM_005273085.1:c.337T>C, XP_005273142.1:p.Tyr113His, rs16845366, rs17417482, rs1800444, rs2259405, rs3192120, rs52794507, rs59266540
T > C
SNP
Y113H
No VIP available CA VA
rs1052536 NC_000017.10:g.33331575C>T, NC_000017.11:g.35004556C>T, NG_029221.1:g.29059C>T, NM_013975.3:c.*50C>T, XM_005257970.1:c.*50C>T, XM_005257970.2:c.*50C>T, XM_005257971.1:c.*50C>T, XM_011524797.1:c.2823+1767C>T, XM_011524798.1:c.2796+1767C>T, XM_011524799.1:c.2796+1767C>T, XM_011524800.1:c.2823+1767C>T, rs17667663, rs3192959, rs56593019, rs59815732, rs60821611
C > T
SNP
No VIP available No Clinical Annotations available VA
rs1056836 NC_000002.11:g.38298203C>G, NC_000002.12:g.38071060G=, NG_008386.2:g.10042C=, NG_008386.2:g.10042C>G, NM_000104.3:c.1294C=, NM_000104.3:c.1294C>G, NP_000095.2:p.Leu432=, NP_000095.2:p.Leu432Val, rs17405323, rs3731848, rs52802961, rs59494749
C > G
SNP
L432V
No VIP available CA VA
rs1065634 NC_000001.10:g.115259768T>C, NC_000001.11:g.114717147T>C, NG_007572.1:g.4748A>G, NM_001007553.2:c.*1022A>G, NM_001130523.2:c.*1022A>G, NM_001242891.1:c.*1022A>G, NM_001242892.1:c.*1022A>G, NM_001242893.1:c.*1022A>G, NM_002524.4:c.-507A>G, NM_007158.5:c.*1022A>G, XM_005271178.1:c.*1022A>G, rs3167734, rs57399409
T > C
SNP
No VIP available No Clinical Annotations available VA
rs10950831
G > T
SNP
No VIP available CA VA
rs10964552
C > A
SNP
No VIP available CA VA
rs10981694 NC_000009.11:g.115986409T>G, NC_000009.12:g.113224129T>G, NM_001859.3:c.-36+2451T>G, rs60407897
T > G
SNP
No VIP available No Clinical Annotations available VA
rs11030918 NC_000011.10:g.4094257T>C, NC_000011.9:g.4115487T>C, NG_016277.1:g.243555T>C, NG_027992.2:g.4564T>C, NM_001033.4:c.-756T>C, NM_001318064.1:c.-869T>C, XM_005253058.1:c.-756T>C, XM_005253059.1:c.-869T>C, XM_011520277.1:c.-869T>C, rs17210557, rs17554091
T > C
SNP
No VIP available No Clinical Annotations available VA
rs11211524 NC_000001.10:g.47833213A>C, NC_000001.11:g.47367541A>C, NM_001136140.1:c.172-5414A>C, NM_016308.2:c.172-928A>C, NR_046394.1:n.321-928A>C
A > C
SNP
No VIP available CA VA
rs11226 NC_000012.11:g.1021813G>A, NC_000012.12:g.912647G>A, NG_007984.2:g.164589G>A, NG_017078.2:g.82395C>T, NM_001297419.1:c.*744C>T, NM_001297421.1:c.*744C>T, NM_134424.3:c.*744C>T, NR_123713.1:n.2422C>T, XM_005253720.1:c.*744C>T, XM_005253720.3:c.*744C>T, XM_005253721.1:c.*744C>T, XM_005253721.2:c.*744C>T, XM_005253722.1:c.*744C>T, XM_005253723.1:c.*744C>T, XM_011520990.1:c.*744C>T, XM_011520991.1:c.*744C>T, XM_011520992.1:c.*744C>T, XM_011520995.1:c.*744C>T, XR_242986.1:n.2266C>T, XR_931521.1:n.2088C>T, XR_931522.1:n.2163C>T, rs11571479, rs3192069, rs57985635
G > -
G > A
SNP
No VIP available CA VA
rs1128503 NC_000007.13:g.87179601A>G, NC_000007.14:g.87550285A>G, NG_011513.1:g.167964T>C, NM_000927.4:c.1236T>C, NP_000918.2:p.Gly412=, rs116989428, rs17276907, rs2032587, rs2229105, rs28365046, rs386518005, rs58257317
A > G
SNP
G412G
No VIP available CA VA
rs1130214 NC_000014.8:g.105259734C>A, NC_000014.9:g.104793397C>A, NG_012188.1:g.7348G>T, NM_001014431.1:c.-79-675G>T, NM_001014432.1:c.-163-187G>T, NM_005163.2:c.-350G>T, XM_005267401.1:c.-79-675G>T, XM_011536543.1:c.-257-93G>T, XM_011536544.1:c.-350G>T, rs36214920, rs56526192, rs57753899
C > A
SNP
No VIP available No Clinical Annotations available VA
rs1131341 NC_000016.10:g.69714966G>A, NC_000016.9:g.69748869G>A, NG_011504.1:g.16665C>T, NM_000903.2:c.415C>T, NM_001025433.1:c.415C>T, NM_001025434.1:c.304-1837C>T, NM_001286137.1:c.303+3157C>T, NP_000894.1:p.Arg139Trp, NP_001020604.1:p.Arg139Trp, XM_005255830.1:c.303+3157C>T, rs11555214, rs117044374, rs17413734, rs3191186, rs386597012, rs4986998, rs52820907, rs57338209
G > A
SNP
R139W
rs1138272 NC_000011.10:g.67586108C>T, NC_000011.9:g.67353579C>T, NG_012075.1:g.7514C>T, NM_000852.3:c.341C>T, NP_000843.1:p.Ala114Val, XM_005273958.1:c.338C>T, XP_005274015.1:p.Ala113Val, rs11553894, rs17434783, rs1799811, rs1804665, rs3202011, rs4134657, rs52800258, rs61323549
C > T
SNP
A114V
No VIP available CA VA
rs1142345 NC_000006.11:g.18130918T>C, NC_000006.12:g.18130687T>C, NG_012137.2:g.29457A>G, NM_000367.3:c.719A>G, NP_000358.1:p.Tyr240Cys, XM_011514839.1:c.674A>G, XM_011514840.1:c.650A>G, XP_011513141.1:p.Tyr225Cys, XP_011513142.1:p.Tyr217Cys, rs16880254, rs1801205, rs29001646, rs52798150, rs61510596
T > C
SNP
Y240C
No VIP available No Clinical Annotations available VA
rs11479 NC_000022.10:g.50964236G>A, NC_000022.11:g.50525807G>A, NG_011860.1:g.9279C>T, NG_016235.1:g.5633C>T, NG_021419.1:g.22592G>A, NM_001113755.2:c.1412C>T, NM_001113756.2:c.1412C>T, NM_001169109.1:c.-14+439C>T, NM_001169110.1:c.-14+194C>T, NM_001169111.1:c.-379C>T, NM_001257988.1:c.1412C>T, NM_001257989.1:c.1427C>T, NM_001953.4:c.1412C>T, NM_005138.2:c.-349C>T, NP_001107227.1:p.Ser471Leu, NP_001107228.1:p.Ser471Leu, NP_001244917.1:p.Ser471Leu, NP_001244918.1:p.Ser476Leu, NP_001944.1:p.Ser471Leu, rs17846490, rs17859554, rs3202233, rs3829983
G > A
SNP
S471L
No VIP available CA VA
rs11615 NC_000019.10:g.45420395A>G, NC_000019.9:g.45923653A>G, NG_015839.2:g.63434T>C, NM_001166049.1:c.354T>C, NM_001983.3:c.354T>C, NM_202001.2:c.354T>C, NP_001159521.1:p.Asn118=, NP_001974.1:p.Asn118=, NP_973730.1:p.Asn118=, XM_005258634.1:c.354T>C, XM_005258635.1:c.354T>C, XM_005258635.2:c.354T>C, XM_005258636.1:c.354T>C, XM_005258636.3:c.354T>C, XM_005258637.1:c.354T>C, XM_005258638.1:c.138T>C, XM_011526610.1:c.354T>C, XP_005258691.1:p.Asn118=, XP_005258692.1:p.Asn118=, XP_005258693.1:p.Asn118=, XP_005258694.1:p.Asn118=, XP_005258695.1:p.Asn46=, XP_011524912.1:p.Asn118=, rs1130005, rs17285882, rs17359303, rs17845191, rs17858003, rs17859564, rs2228629, rs3177700, rs3188446, rs3752251, rs59923575
A > G
SNP
N118N
No VIP available No Clinical Annotations available VA
rs11646213
A > T
SNP
No VIP available CA VA
rs11710163 NC_000003.11:g.12696288A>G, NC_000003.12:g.12654789A>G, NG_007467.1:g.14391T>C, NM_002880.3:c.-27+9024T>C, XM_005265355.1:c.-27+8580T>C, XM_005265356.1:c.-120+9024T>C, XM_005265357.1:c.-27+9024T>C, XM_005265358.1:c.-157+9024T>C, XM_005265358.3:c.-157+9024T>C, XM_005265359.1:c.-157+9024T>C, XM_005265359.3:c.-157+9024T>C, XM_005265360.1:c.-27+9024T>C, XM_011533974.1:c.-120+9024T>C, XM_011533975.1:c.-250+9024T>C, rs58836253
A > G
SNP
No VIP available No Clinical Annotations available VA
rs12090346 NC_000001.10:g.47841557C>T, NC_000001.11:g.47375885C>T, NM_001136140.1:c.498+592C>T, NM_016308.2:c.645+592C>T, NR_046394.1:n.717+592C>T
C > T
SNP
No VIP available CA VA
rs12118636 NC_000001.10:g.53076159G>A, NC_000001.11:g.52610487G>A, rs34623603
G > A
SNP
No VIP available No Clinical Annotations available VA
rs12139042 NC_000001.10:g.11167146G>A, NC_000001.11:g.11107089G>A, NG_033239.1:g.160463C>T, NM_004958.3:c.*396C>T, XM_005263438.1:c.*396C>T, XM_005263439.1:c.*396C>T, XM_005263440.1:c.5038C>T, XM_005263441.1:c.4031-300C>T, XP_005263497.1:p.Gln1680Ter, rs17229270, rs17848573
G > A
SNP
No VIP available CA VA
rs12201199 NC_000006.11:g.18139802A>T, NC_000006.12:g.18139571A>T, NG_012137.2:g.20573T>A, NM_000367.3:c.419+94T>A, XM_011514839.1:c.419+94T>A, XM_011514840.1:c.350+94T>A, rs58109747
A > T
SNP
No VIP available CA VA
rs12613732 NC_000002.11:g.31249427T>G, NC_000002.12:g.31026561T>G, NM_001253826.1:c.315-60259A>C, NM_001253827.1:c.70-33554A>C, NM_024572.3:c.130-33554A>C, NR_045602.1:n.903-33554A>C, XM_005264559.1:c.25-33554A>C, XM_011533104.1:c.448-33554A>C, XM_011533105.1:c.70-33554A>C, XM_011533106.1:c.43-33554A>C, rs17393634, rs56739826, rs58514179
T > G
SNP
No VIP available CA VA
rs12659 NC_000021.8:g.46951556A>G, NC_000021.9:g.45531642A>G, NG_028278.1:g.15830T>C, NM_001205206.1:c.696T>C, NM_001205207.1:c.576T>C, NM_194255.2:c.696T>C, NP_001192135.1:p.Pro232=, NP_001192136.1:p.Pro192=, NP_919231.1:p.Pro232=, XM_005261163.1:c.696T>C, XM_005261164.1:c.342T>C, XM_005261164.2:c.342T>C, XM_011529696.1:c.987T>C, XM_011529697.1:c.987T>C, XM_011529698.1:c.762T>C, XM_011529699.1:c.723T>C, XM_011529700.1:c.696T>C, XM_011529701.1:c.696T>C, XM_011529702.1:c.696T>C, XM_011529703.1:c.696T>C, XM_011529704.1:c.696T>C, XM_011529705.1:c.987T>C, XM_011529706.1:c.558T>C, XM_011529707.1:c.987T>C, XM_011529708.1:c.696T>C, XM_011529709.1:c.342T>C, XM_011529710.1:c.342T>C, XP_005261220.1:p.Pro232=, XP_005261221.1:p.Pro114=, XP_011527998.1:p.Pro329=, XP_011527999.1:p.Pro329=, XP_011528000.1:p.Pro254=, XP_011528001.1:p.Pro241=, XP_011528002.1:p.Pro232=, XP_011528003.1:p.Pro232=, XP_011528004.1:p.Pro232=, XP_011528005.1:p.Pro232=, XP_011528006.1:p.Pro232=, XP_011528007.1:p.Pro329=, XP_011528008.1:p.Pro186=, XP_011528009.1:p.Pro329=, XP_011528010.1:p.Pro232=, XP_011528011.1:p.Pro114=, XP_011528012.1:p.Pro114=, rs17844976, rs17857725, rs3171495
A > G
SNP
P232P
No VIP available No Clinical Annotations available VA
rs12806698 NC_000011.10:g.4094744C>A, NC_000011.9:g.4115974C>A, NG_016277.1:g.244042C>A, NG_027992.2:g.5051C>A, NM_001033.3:c.-269C>A, NM_001033.4:c.-269C>A, NM_001318064.1:c.-382C>A, XM_005253058.1:c.-269C>A, XM_005253059.1:c.-382C>A, XM_011520277.1:c.-382C>A, rs17554111
C > A
SNP
No VIP available No Clinical Annotations available VA
rs12999804 NC_000002.11:g.31245650A>T, NC_000002.12:g.31022784A>T, NM_001253826.1:c.315-56482T>A, NM_001253827.1:c.70-29777T>A, NM_024572.3:c.130-29777T>A, NR_045602.1:n.903-29777T>A, XM_005264559.1:c.25-29777T>A, XM_011533104.1:c.448-29777T>A, XM_011533105.1:c.70-29777T>A, XM_011533106.1:c.43-29777T>A, rs58546060, rs59591816
A > T
SNP
No VIP available CA VA
rs13181 NC_000019.10:g.45351661T>G, NC_000019.9:g.45854919T>G, NG_007067.2:g.23927A>C, NM_000400.3:c.2251A>C, NM_177417.2:c.*304T>G, NP_000391.1:p.Lys751Gln, XM_005258536.1:c.*128T>G, XM_005258536.3:c.*128T>G, XM_005258537.1:c.*128T>G, XM_005258538.1:c.*304T>G, XM_005258539.1:c.*304T>G, XM_005258639.1:c.2179A>C, XM_005258640.1:c.2017A>C, XM_005258641.1:c.1513A>C, XM_011526611.1:c.2173A>C, XP_005258696.1:p.Lys727Gln, XP_005258697.1:p.Lys673Gln, XP_005258698.1:p.Lys505Gln, XP_011524913.1:p.Lys725Gln, rs1052559, rs17285142, rs17355147, rs17359310, rs3170171, rs3859422, rs60606175
T > G
SNP
K751Q
No VIP available No Clinical Annotations available VA
rs151264360 NC_000018.10:g.673444_673449delTTAAAG, NC_000018.9:g.673444_673449delTTAAAG, NG_028255.1:g.20841_20846delTTAAAG, NM_001071.2:c.*447_*452delTTAAAG, NM_001126123.3:c.*145-373_*145-368del, NM_001126123.3:c.*145-373_*145-368delCTTTAA, NM_001318759.1:c.*145-373_*145-368del, NM_001318759.1:c.*145-373_*145-368delCTTTAA, NM_001318760.1:c.*446+410_*446+415delCTTTAA, NM_001318760.1:c.*856_*861del, NM_017512.5:c.*856_*861delCTTTAA, NM_202758.3:c.*856_*861delCTTTAA, XM_005258111.1:c.*856_*861delCTTTAA, XM_005258112.1:c.*856_*861delCTTTAA, XM_005258113.1:c.*856_*861delCTTTAA, XM_005258114.1:c.*856_*861delCTTTAA, XM_005258115.1:c.*856_*861delCTTTAA, XM_005258116.1:c.*856_*861delCTTTAA, XM_005258117.1:c.*856_*861delCTTTAA, XM_005258118.1:c.*856_*861delCTTTAA, XM_005258118.2:c.*856_*861del, XM_005258120.1:c.*856_*861delCTTTAA, XM_005258137.1:c.*447_*452delTTAAAG, XM_005258138.1:c.*447_*452delTTAAAG, XM_011525677.1:c.*856_*861del, XM_011525678.1:c.*856_*861del, XM_011525679.1:c.*856_*861del, XM_011525680.1:c.*856_*861del, XM_011525681.1:c.*856_*861del, XM_011525682.1:c.*856_*861del, XM_011525683.1:c.*856_*861del, XM_011525684.1:c.*856_*861del, XM_011525685.1:c.*856_*861del, XM_011525686.1:c.*856_*861del, XM_011525687.1:c.*856_*861del, XM_011525688.1:c.*856_*861del, XM_011525689.1:c.*856_*861del, XM_011525690.1:c.*856_*861del, XM_011525691.1:c.*856_*861del, XM_011525692.1:c.*856_*861del, XM_011525693.1:c.*856_*861del, XM_011525694.1:c.*856_*861del, XM_011525695.1:c.*856_*861del, XM_011525696.1:c.*856_*861del, XM_011525697.1:c.*856_*861del, XM_011525698.1:c.*856_*861del, XM_011525699.1:c.*856_*861del, XR_243810.1:n.1672-373_1672-368delCTTTAA, XR_243810.3:n.1513-373_1513-368del, XR_243811.1:n.1538-373_1538-368delCTTTAA, XR_243811.2:n.1538-373_1538-368del, XR_243812.1:n.2112_2117delCTTTAA, XR_430041.2:n.1633-373_1633-368del, XR_935066.1:n.2109_2114del, XR_935067.1:n.1967_1972del
TTAAAG > -
indel
No VIP available No Clinical Annotations available VA
rs1617640 NC_000007.13:g.100317298C>A, NC_000007.14:g.100719675C>A, NG_021471.1:g.3876C>A, NM_000799.2:c.-1306C>A, XM_005250190.1:c.-1306C>A, rs10304599, rs10342152, rs57979509
C > A
SNP
No VIP available CA VA
rs16886403 NC_000005.10:g.56843419T>C, NC_000005.9:g.56139246T>C, NG_031884.1:g.33347T>C, NM_005921.1:c.483-13181T>C, XM_005248519.1:c.72-13181T>C, XM_005248519.3:c.105-13181T>C, XM_005248520.1:c.-7-13181T>C, XM_011543406.1:c.228-13181T>C, XM_011543407.1:c.483-13181T>C, XM_011543408.1:c.483-13181T>C, rs57623389, rs58749465
T > C
SNP
rs1695 NC_000011.10:g.67585218A>G, NC_000011.9:g.67352689A>G, NG_012075.1:g.6624A>G, NM_000852.3:c.313A>G, NP_000843.1:p.Ile105Val, XM_005273958.1:c.313A>G, XP_005274015.1:p.Ile105Val, rs1138257, rs11553891, rs17353321, rs17856342, rs2230827, rs4609, rs56971933, rs947894
A > G
SNP
I105V
No VIP available CA VA
rs16950650 NC_000013.10:g.95775432C>T, NC_000013.11:g.95123178C>T, NM_001105515.2:c.2456-7177G>A, NM_001301829.1:c.2315-7177G>A, NM_001301830.1:c.2231-7177G>A, NM_005845.4:c.2456-7177G>A, XM_005254025.1:c.2327-7177G>A, XM_005254025.2:c.2327-7177G>A, XM_005254026.1:c.2315-7177G>A, XM_005254027.1:c.2231-7177G>A, XM_005254028.1:c.2231-7177G>A, XM_006719914.1:c.2366-7177G>A, XM_011521047.1:c.1907-7177G>A, rs56643033, rs58582224
C > T
SNP
No VIP available No Clinical Annotations available VA
rs17216177 NC_000010.10:g.101603522T>C, NC_000010.11:g.99843765T>C, NG_011798.1:g.66060T>C, NM_000392.4:c.3742-34T>C, XM_005269536.1:c.3463-34T>C, XM_006717630.2:c.3046-34T>C, XR_945604.1:n.3931-34T>C, XR_945605.1:n.3806-34T>C, rs45616434
T > C
SNP
No VIP available CA VA
rs17309872 NC_000020.10:g.33515788A>T, NC_000020.11:g.34927985A>T, NG_008848.1:g.32814T>A, NG_011520.1:g.58044A>T, NM_000178.2:c.*843T>A, NM_001076552.2:c.*771A>T, NM_001242393.1:c.*771A>T, NM_018677.3:c.*771A>T, XM_005260405.1:c.*843T>A, XM_005260406.1:c.*843T>A, XM_005260406.3:c.*843T>A, XM_005260454.1:c.*771A>T, XM_005260455.1:c.*771A>T, XM_005260456.1:c.*771A>T, XM_005260457.1:c.*771A>T, XM_006723826.1:c.*771A>T, XM_011528796.1:c.*843T>A, XM_011528905.1:c.*771A>T, XM_011528906.1:c.*771A>T, XM_011528907.1:c.*771A>T, XM_011528908.1:c.*771A>T, XM_011528909.1:c.*771A>T, XM_011528910.1:c.*771A>T, XM_011528911.1:c.*771A>T, XM_011528912.1:c.*771A>T
A > G
A > T
SNP
No VIP available No Clinical Annotations available VA
rs1734787 AJ132917.1:c.27-27438T>G, NC_000023.10:g.153325446A>C, NC_000023.11:g.154059995A>C, NG_007107.2:g.82133T>G, NM_001110792.1:c.63-27438T>G, NM_001316337.1:c.-421-1429T>G, NM_004992.3:c.27-27438T>G, NW_003871103.3:g.1493974A>C, XM_005274681.1:c.27-27438T>G, XM_005274681.3:c.27-27438T>G, XM_005274682.1:c.-365-20092T>G, XM_005274682.3:c.-365-20092T>G, XM_005274683.1:c.-2264T>G, XM_005274683.3:c.-2264T>G, XM_005277851.1:c.27-27438T>G, XM_005277852.1:c.-365-20092T>G, XM_005277853.1:c.-2264T>G, XM_011531165.1:c.-421-1429T>G, rs17332596, rs56534075, rs58354099, rs61248129
A > C
SNP
No VIP available No Clinical Annotations available VA
rs1734791 AJ132917.1:c.26+26722T>A, NC_000023.10:g.153330920A>T, NC_000023.11:g.154065469A>T, NG_007107.2:g.76659T>A, NM_001110792.1:c.62+32141T>A, NM_001316337.1:c.-421-6903T>A, NM_004992.3:c.26+26722T>A, NW_003871103.3:g.1499448A>T, XM_005274681.1:c.26+26722T>A, XM_005274681.3:c.26+26715T>A, XM_005274682.1:c.-365-25566T>A, XM_005274682.3:c.-365-25566T>A, XM_005277851.1:c.26+26715T>A, XM_005277852.1:c.-365-25566T>A, XM_011531165.1:c.-421-6903T>A, rs111178553, rs60889458
A > T
SNP
No VIP available No Clinical Annotations available VA
rs17435 AJ132917.1:c.27-13972A>T, NC_000023.10:g.153311980T>A, NC_000023.11:g.154046529T>A, NG_007107.2:g.95599A>T, NM_001110792.1:c.63-13972A>T, NM_001316337.1:c.-254+11870A>T, NM_004992.3:c.27-13972A>T, NW_003871103.3:g.1480508T>A, XM_005274681.1:c.27-13972A>T, XM_005274681.3:c.27-13972A>T, XM_005274682.1:c.-365-6626A>T, XM_005274682.3:c.-365-6626A>T, XM_005274683.1:c.-254+10412A>T, XM_005274683.3:c.-254+10412A>T, XM_005277851.1:c.27-13972A>T, XM_005277852.1:c.-365-6626A>T, XM_005277853.1:c.-254+10412A>T, XM_011531165.1:c.-254+11870A>T, XM_011531166.1:c.-254+1988A>T, rs60248475, rs61484111
T > A
SNP
No VIP available CA VA
rs17574269 NC_000006.11:g.117816128A>G, NC_000006.12:g.117494965A>G, NM_173674.2:c.113-8802A>G, XM_005266941.1:c.254-8802A>G, XM_005266942.1:c.254-8802A>G, XM_006715463.1:c.254-8802A>G, XM_011535770.1:c.119-8802A>G, XM_011535771.1:c.-44-8802A>G, XM_011535772.1:c.-44-8802A>G, XM_011535773.1:c.254-8802A>G, XM_011535774.1:c.254-8802A>G, rs58365592
A > G
SNP
No VIP available No Clinical Annotations available VA
rs17655 NC_000013.10:g.103528002G>C, NC_000013.11:g.102875652G>C, NG_007146.1:g.34829G>C, NM_000123.3:c.3310G>C, NM_001204425.1:c.4672G>C, NP_000114.2:p.Asp1104His, NP_001191354.1:p.Asp1558His, rs16960665, rs3188002, rs3825521, rs52825398
G > C
SNP
D1104H
No VIP available CA VA
rs17661089 NC_000005.10:g.56810169A>G, NC_000005.9:g.56105996A>G, NG_031884.1:g.97A>G, rs57476699
A > G
SNP
No VIP available CA VA
rs1799735 unknown
No VIP available No Clinical Annotations available VA
rs1799782 NC_000019.10:g.43553422G>A, NC_000019.9:g.44057574G>A, NG_033799.1:g.27157C>T, NM_006297.2:c.580C>T, NP_006288.2:p.Arg194Trp, rs11553655, rs2229674, rs3213359, rs3826914, rs386545546
G > A
SNP
R194W
No VIP available CA VA
rs1799793 NC_000019.10:g.45364001C>T, NC_000019.9:g.45867259C>T, NG_007067.2:g.11587G>A, NM_000400.3:c.934G>A, NM_001130867.1:c.862G>A, NP_000391.1:p.Asp312Asn, NP_001124339.1:p.Asp288Asn, XM_005258639.1:c.862G>A, XM_005258640.1:c.700G>A, XM_005258641.1:c.196G>A, XM_005258642.1:c.934G>A, XM_011526611.1:c.856G>A, XP_005258696.1:p.Asp288Asn, XP_005258697.1:p.Asp234Asn, XP_005258698.1:p.Asp66Asn, XP_005258699.1:p.Asp312Asn, XP_011524913.1:p.Asp286Asn, XR_935763.1:n.981G>A, rs3916814, rs58989209
C > T
SNP
D312N
No VIP available No Clinical Annotations available VA
rs1800440 NC_000002.11:g.38298139T>C, NC_000002.12:g.38070996T>C, NG_008386.2:g.10106A>G, NM_000104.3:c.1358A>G, NP_000095.2:p.Asn453Ser, rs17405302, rs386545580, rs4134586, rs4986886, rs56879535
T > C
SNP
N453S
No VIP available CA VA
rs1800460 NC_000006.11:g.18139228C>T, NC_000006.12:g.18138997C>T, NG_012137.2:g.21147G>A, NM_000367.3:c.460G>A, NP_000358.1:p.Ala154Thr, XM_011514839.1:c.460G>A, XM_011514840.1:c.391G>A, XP_011513141.1:p.Ala154Thr, XP_011513142.1:p.Ala131Thr, rs11568060, rs16880273, rs386545583, rs57650974
C > T
SNP
A154T
rs1800566 NC_000016.10:g.69711242G>A, NC_000016.9:g.69745145G>A, NG_011504.1:g.20389C>T, NM_000903.2:c.559C>T, NM_001025433.1:c.457C>T, NM_001025434.1:c.445C>T, NM_001286137.1:c.343C>T, NP_000894.1:p.Pro187Ser, NP_001020604.1:p.Pro153Ser, NP_001020605.1:p.Pro149Ser, NP_001273066.1:p.Pro115Ser, XM_005255830.1:c.343C>T, XP_005255887.1:p.Pro115Ser, rs4134727, rs4149351, rs57135274
G > A
SNP
P187S
No VIP available CA VA
rs1801131 NC_000001.10:g.11854476T>G, NC_000001.11:g.11794419T>G, NG_013351.1:g.16685A>C, NM_005957.4:c.1286A>C, NP_005948.3:p.Glu429Ala, XM_005263458.1:c.1409A>C, XM_005263458.2:c.1409A>C, XM_005263459.1:c.1355A>C, XM_005263460.1:c.1286A>C, XM_005263460.3:c.1286A>C, XM_005263461.1:c.1286A>C, XM_005263461.3:c.1286A>C, XM_005263462.1:c.1286A>C, XM_005263462.3:c.1286A>C, XM_005263463.1:c.1040A>C, XM_005263463.2:c.1040A>C, XM_011541495.1:c.1406A>C, XM_011541496.1:c.1409A>C, XP_005263515.1:p.Glu470Ala, XP_005263516.1:p.Glu452Ala, XP_005263517.1:p.Glu429Ala, XP_005263518.1:p.Glu429Ala, XP_005263519.1:p.Glu429Ala, XP_005263520.1:p.Glu347Ala, XP_011539797.1:p.Glu469Ala, XP_011539798.1:p.Glu470Ala, rs17367365, rs17857426, rs4134712
T > G
SNP
E429A
No VIP available CA VA
rs1801133 NC_000001.10:g.11856378G>A, NC_000001.11:g.11796321G>A, NG_013351.1:g.14783C>T, NM_005957.4:c.665C>T, NP_005948.3:p.Ala222Val, XM_005263458.1:c.788C>T, XM_005263458.2:c.788C>T, XM_005263459.1:c.734C>T, XM_005263460.1:c.665C>T, XM_005263460.3:c.665C>T, XM_005263461.1:c.665C>T, XM_005263461.3:c.665C>T, XM_005263462.1:c.665C>T, XM_005263462.3:c.665C>T, XM_005263463.1:c.419C>T, XM_005263463.2:c.419C>T, XM_011541495.1:c.785C>T, XM_011541496.1:c.788C>T, XP_005263515.1:p.Ala263Val, XP_005263516.1:p.Ala245Val, XP_005263517.1:p.Ala222Val, XP_005263518.1:p.Ala222Val, XP_005263519.1:p.Ala222Val, XP_005263520.1:p.Ala140Val, XP_011539797.1:p.Ala262Val, XP_011539798.1:p.Ala263Val, rs386545618, rs4134713, rs59514310
G > A
SNP
A222V
No VIP available No Clinical Annotations available VA
rs1801158 NC_000001.10:g.97981421C>T, NC_000001.11:g.97515865C>T, NG_008807.2:g.410195G>A, NM_000110.3:c.1601G>A, NP_000101.2:p.Ser534Asn, XM_005270561.1:c.1490G>A, XM_005270562.1:c.1524+33695G>A, XM_005270562.3:c.1524+33695G>A, XM_005270563.1:c.1601G>A, XM_005270564.1:c.1601G>A, XM_006710397.2:c.1601G>A, XP_005270618.1:p.Ser497Asn, XP_005270620.1:p.Ser534Asn, XP_005270621.1:p.Ser534Asn, XP_006710460.1:p.Ser534Asn, rs199469539, rs52824375, rs59516208
C > T
SNP
S534N
No VIP available CA VA
rs1801280 NC_000008.10:g.18257854T>C, NC_000008.11:g.18400344T>C, NG_012246.1:g.14100T>C, NM_000015.2:c.341T>C, NP_000006.2:p.Ile114Thr, XM_011544358.1:c.341T>C, XP_011542660.1:p.Ile114Thr, rs4134724, rs56935242
T > C
SNP
I114T
No VIP available CA VA
rs1805087 NC_000001.10:g.237048500A>G, NC_000001.11:g.236885200A>G, NG_008959.1:g.94920A>G, NM_000254.2:c.2756A>G, NM_001291939.1:c.2603A>G, NM_001291940.1:c.1535A>G, NP_000245.2:p.Asp919Gly, NP_001278868.1:p.Asp868Gly, NP_001278869.1:p.Asp512Gly, XM_005273140.1:c.2924A>G, XM_005273141.1:c.2753A>G, XM_005273141.3:c.2753A>G, XM_005273142.1:c.2666A>G, XM_005273143.1:c.2603A>G, XM_005273144.1:c.2318A>G, XM_005273145.1:c.1118A>G, XM_006711769.2:c.2756A>G, XM_006711770.1:c.1820A>G, XM_011544193.1:c.2567A>G, XM_011544194.1:c.2924A>G, XP_005273197.1:p.Asp975Gly, XP_005273198.1:p.Asp918Gly, XP_005273199.1:p.Asp889Gly, XP_005273200.1:p.Asp868Gly, XP_005273201.1:p.Asp773Gly, XP_005273202.1:p.Asp373Gly, XP_006711832.1:p.Asp919Gly, XP_006711833.1:p.Asp607Gly, XP_011542495.1:p.Asp856Gly, XP_011542496.1:p.Asp975Gly, rs17658739, rs56618494, rs61036243
A > G
SNP
D919G
No VIP available No Clinical Annotations available VA
rs183484 NC_000011.10:g.4119902C>A, NC_000011.9:g.4141132C>A, NG_027992.2:g.30209C>A, NM_001033.3:c.850C>A, NM_001033.4:c.850C>A, NM_001318064.1:c.559C>A, NM_001318065.1:c.-207C>A, NP_001024.1:p.Arg284=, NP_001304993.1:p.Arg187=, XM_005253058.1:c.607C>A, XM_005253059.1:c.559C>A, XM_011520277.1:c.559C>A, XM_011520278.1:c.184C>A, XM_011520279.1:c.-207C>A, XP_005253115.1:p.Arg203=, XP_005253116.1:p.Arg187=, XP_011518579.1:p.Arg187=, XP_011518580.1:p.Arg62=, rs17210748, rs1735058, rs17850105, rs2228122
C > A
SNP
R284R
No VIP available No Clinical Annotations available VA
rs1870377 NC_000004.11:g.55972974T>A, NC_000004.12:g.55106807T>A, NG_012004.1:g.23789A>T, NM_002253.2:c.1416A>T, NP_002244.1:p.Gln472His, rs52810770
T > A
SNP
Q472H
No VIP available CA VA
rs1872328 NC_000002.11:g.54395259G>A, NC_000002.12:g.54168122G>A, NM_138448.3:c.185+29374G>A
G > A
SNP
No VIP available No Clinical Annotations available VA
rs1885301 NC_000010.10:g.101541053A>G, NC_000010.11:g.99781296A>G, NG_011798.1:g.3591A>G, NM_000392.4:c.-1549A>G, XM_005269536.1:c.-1549A>G, XM_006717631.2:c.-1549A>G, XM_011539291.1:c.-1549A>G, XR_945604.1:n.-1360A>G, XR_945605.1:n.-1358A>G, rs17216261, rs59934936
A > G
SNP
No VIP available No Clinical Annotations available VA
rs2010963 NC_000006.11:g.43738350C>G, NC_000006.12:g.43770613C>G, NG_008732.1:g.5398C>G, NM_001025366.2:c.-94C>G, NM_001025367.2:c.-94C>G, NM_001025368.2:c.-94C>G, NM_001025369.2:c.-94C>G, NM_001025370.2:c.-94C>G, NM_001033756.2:c.-94C>G, NM_001171622.1:c.-94C>G, NM_001171623.1:c.-634C>G, NM_001171624.1:c.-634C>G, NM_001171625.1:c.-634C>G, NM_001171626.1:c.-634C>G, NM_001171627.1:c.-634C>G, NM_001171628.1:c.-634C>G, NM_001171629.1:c.-634C>G, NM_001171630.1:c.-634C>G, NM_001204384.1:c.-634C>G, NM_001204385.1:c.-94C>G, NM_001287044.1:c.-1507C>G, NM_001317010.1:c.-634C>G, NM_003376.5:c.-94C>G, XM_005249363.1:c.-1507C>G
C > G
SNP
No VIP available No Clinical Annotations available VA
rs2018683 NC_000007.13:g.29014195G>T, NC_000007.14:g.28974579G>T, rs56487635, rs59311291
G > T
SNP
No VIP available No Clinical Annotations available VA
rs2031920 NC_000010.10:g.135339845C>T, NC_000010.11:g.133526341C>T, NG_008383.1:g.3979C>T, NM_000773.3:c.-1055C>T, XM_005252665.1:c.-512C>T, rs3813868
C > T
SNP
No VIP available No Clinical Annotations available VA
rs2032582 NC_000007.13:g.87160618A>C, NC_000007.13:g.87160618A>T, NC_000007.14:g.87531302A>C, NC_000007.14:g.87531302A>T, NG_011513.1:g.186947T>A, NG_011513.1:g.186947T>G, NM_000927.4:c.2677T>A, NM_000927.4:c.2677T>G, NP_000918.2:p.Ser893Ala, NP_000918.2:p.Ser893Thr, rs10228331, rs2229106, rs386553610, rs57135550, rs9641018
A > C
A > T
SNP
S893A
No VIP available CA VA
rs2070676 NC_000010.10:g.135351137G>C, NC_000010.11:g.133537633G>C, NG_008383.1:g.15271G>C, NM_000773.3:c.1156-118G>C, XM_005252665.1:c.1216-118G>C, rs17012756, rs56527359, rs59960595, rs60668193
G > C
SNP
No VIP available No Clinical Annotations available VA
rs2071559 NC_000004.11:g.55992366A>G, NC_000004.12:g.55126199A>G, NG_012004.1:g.4397T>C, NM_002253.2:c.-906T>C, rs59863954
A > G
SNP
No VIP available No Clinical Annotations available VA
rs2072671 NC_000001.10:g.20915701A>C, NC_000001.11:g.20589208A>C, NM_001785.2:c.79A>C, NP_001776.1:p.Lys27Gln, rs57221291
A > C
SNP
K27Q
No VIP available CA VA
rs2075252 NC_000002.11:g.170010985T>C, NC_000002.12:g.169154475T>C, NG_012634.1:g.213138A>G, NM_004525.2:c.12280A>G, NP_004516.2:p.Lys4094Glu, XM_005246551.1:c.9991A>G, XM_011511183.1:c.12151A>G, XM_011511184.1:c.9991A>G, XP_005246608.1:p.Lys3331Glu, XP_011509485.1:p.Lys4051Glu, XP_011509486.1:p.Lys3331Glu, rs17848193, rs386556527, rs52808684, rs59573352
T > C
SNP
K4094E
No VIP available No Clinical Annotations available VA
rs2166219 NC_000002.11:g.19617302T>C, NC_000002.12:g.19417541T>C, XR_939779.1:n.496-18349A>G, rs13008844, rs16986416, rs58751495
T > C
SNP
No VIP available CA VA
rs2207396 NC_000006.11:g.152382382G>A, NC_000006.12:g.152061247G>A, NG_008493.1:g.375752G>A, NM_000125.3:c.1369+123G>A, NM_001122740.1:c.1369+123G>A, NM_001122741.1:c.1369+123G>A, NM_001122742.1:c.1369+123G>A, NM_001291230.1:c.1375+123G>A, NM_001291241.1:c.1366+123G>A, XM_005266856.1:c.1375+123G>A, XM_005266857.1:c.1366+123G>A, XM_006715374.2:c.1369+123G>A, XM_006715375.2:c.850+123G>A, XM_011535543.1:c.1369+123G>A, XM_011535544.1:c.1369+123G>A, XM_011535545.1:c.1369+123G>A, XM_011535546.1:c.1369+123G>A, XM_011535547.1:c.1369+123G>A, XM_011535548.1:c.850+123G>A, XM_011535549.1:c.640+123G>A, XR_943116.1:n.7257C>T, rs17847072, rs57792040
G > A
SNP
No VIP available CA VA
rs2228001 NC_000003.11:g.14187449G>T, NC_000003.12:g.14145949G>T, NG_011763.1:g.37724C>A, NM_001145769.1:c.2704C>A, NM_004628.4:c.2815C>A, NP_001139241.1:p.Gln902Lys, NP_004619.3:p.Gln939Lys, NR_027299.1:n.2795C>A, rs17620623, rs17856505, rs3729583, rs60736379
G > T
SNP
Q902K
No VIP available CA VA
rs2228171 NC_000002.11:g.170053505C>T, NC_000002.12:g.169196995C>T, NG_012634.1:g.170618G>A, NM_004525.2:c.8614G>A, NP_004516.2:p.Ala2872Thr, XM_005246551.1:c.6325G>A, XM_005246552.1:c.8614G>A, XM_011511183.1:c.8614G>A, XM_011511184.1:c.6325G>A, XM_011511185.1:c.8614G>A, XP_005246608.1:p.Ala2109Thr, XP_005246609.1:p.Ala2872Thr, XP_011509485.1:p.Ala2872Thr, XP_011509486.1:p.Ala2109Thr, XP_011509487.1:p.Ala2872Thr, rs117432666, rs17848174, rs2302697, rs4668123, rs52816657, rs57579868
C > T
SNP
A2872T
No VIP available No Clinical Annotations available VA
rs2236225 NC_000014.8:g.64908845G>A, NC_000014.9:g.64442127G>A, NG_012450.1:g.59087G>A, NM_005956.3:c.1958G>A, NP_005947.3:p.Arg653Gln, XM_005267693.1:c.2126G>A, XP_005267750.1:p.Arg709Gln, rs117048039, rs17751608, rs17850560, rs52810262, rs56503831, rs58065500
G > A
SNP
R653Q
No VIP available No Clinical Annotations available VA
rs2273697 NC_000010.10:g.101563815G>A, NC_000010.11:g.99804058G>A, NG_011798.1:g.26353G>A, NM_000392.4:c.1249G>A, NP_000383.1:p.Val417Ile, XM_005269536.1:c.1249G>A, XM_006717630.2:c.553G>A, XM_006717631.2:c.1249G>A, XM_011539291.1:c.1249G>A, XP_005269593.1:p.Val417Ile, XP_006717693.1:p.Val185Ile, XP_006717694.1:p.Val417Ile, XP_011537593.1:p.Val417Ile, XR_945604.1:n.1438G>A, XR_945605.1:n.1440G>A, rs17216184, rs60620335
G > A
SNP
V417I
No VIP available CA VA
rs2284449 NC_000011.10:g.4099619T>C, NC_000011.9:g.4120849T>C, NG_027992.2:g.9926T>C, NM_001033.3:c.20-2374T>C, NM_001033.4:c.20-2374T>C, NM_001318064.1:c.-94-2374T>C, XM_005253058.1:c.20-2374T>C, XM_005253059.1:c.-94-2374T>C, XM_011520277.1:c.-94-2374T>C, rs52806873
T > C
SNP
No VIP available CA VA
rs2291767 NC_000002.11:g.241080132T>C, NC_000002.12:g.240140715T>C, NM_148961.3:c.-214A>G
T > C
SNP
No VIP available CA VA
rs2299939 NC_000010.10:g.89657150C>A, NC_000010.11:g.87897393C>A, NG_007466.2:g.38955C>A, NM_000314.4:c.164+3284C>A, NM_000314.6:c.164+3284C>A, NM_001304717.2:c.683+3284C>A, NM_001304718.1:c.-542+3284C>A, XM_006717926.2:c.164+3284C>A, XM_011539981.1:c.164+3284C>A, XM_011539982.1:c.68+16955C>A, XR_945789.1:n.876+3284C>A, XR_945790.1:n.876+3284C>A, XR_945791.1:n.876+3284C>A, rs17561756, rs52816835, rs60036687
C > A
C > T
SNP
No VIP available No Clinical Annotations available VA
rs2305948 NC_000004.11:g.55979558C>T, NC_000004.12:g.55113391C>T, NG_012004.1:g.17205G>A, NM_002253.2:c.889G>A, NP_002244.1:p.Val297Ile, rs386564519, rs52830740, rs56532927, rs56973163
C > T
SNP
V297I
No VIP available CA VA
rs232043 NC_000011.10:g.4117895G>A, NC_000011.9:g.4139125G>A, NG_027992.2:g.28202G>A, NM_001033.3:c.651-425G>A, NM_001033.4:c.651-425G>A, NM_001318064.1:c.360-425G>A, NM_001318065.1:c.-406-425G>A, XM_005253058.1:c.408-425G>A, XM_005253059.1:c.360-425G>A, XM_011520277.1:c.360-425G>A, XM_011520278.1:c.-16-425G>A, XM_011520279.1:c.-406-425G>A, rs1662167
G > A
SNP
No VIP available CA VA
rs244898
T > C
SNP
No VIP available No Clinical Annotations available VA
rs2494750 NC_000014.8:g.105262912G>C, NC_000014.9:g.104796575G>C, NG_012188.1:g.4169C>G, NG_042073.1:g.395G>C, NM_001014431.1:c.-1172C>G, NM_001014432.1:c.-1256C>G, rs57563070
G > C
SNP
No VIP available CA VA
rs2494752 NC_000014.8:g.105263608A>G, NC_000014.9:g.104797271A>G, NG_012188.1:g.3473T>C, NG_042073.1:g.1091A>G, NM_001014431.1:c.-1868T>C, NM_001014432.1:c.-1952T>C
A > G
SNP
No VIP available No Clinical Annotations available VA
rs2498786 NC_000014.8:g.105262368C>G, NC_000014.9:g.104796031C>G, NG_012188.1:g.4713G>C, NM_001014431.1:c.-628G>C, NM_001014432.1:c.-712G>C, XM_005267401.1:c.-1992G>C, XM_011536543.1:c.-2170G>C, XM_011536544.1:c.-2984G>C
C > G
SNP
No VIP available CA VA
rs2498804 NC_000014.8:g.105233095C>A, NC_000014.9:g.104766758C>A, XR_429419.2:n.-1209C>A, rs386568280, rs56890536
C > A
SNP
No VIP available CA VA
rs25487 NC_000019.10:g.43551574T>C, NC_000019.9:g.44055726T>C, NG_033799.1:g.29005A>G, NM_006297.2:c.1196A>G, NP_006288.2:p.Gln399Arg, rs11553658, rs17435395, rs3817410, rs386493716, rs57378728
T > C
SNP
Q399R
No VIP available No Clinical Annotations available VA
rs25489 NC_000019.10:g.43552260C>T, NC_000019.9:g.44056412C>T, NG_033799.1:g.28319G>A, NM_006297.2:c.839G>A, NP_006288.2:p.Arg280His, rs17435388, rs2229675, rs2307183
C > T
SNP
R280H
No VIP available CA VA
rs25648 NC_000006.11:g.43738977C>T, NC_000006.12:g.43771240C>T, NG_008732.1:g.6025C>T, NM_001025366.2:c.534C>T, NM_001025367.2:c.534C>T, NM_001025368.2:c.534C>T, NM_001025369.2:c.534C>T, NM_001025370.2:c.534C>T, NM_001033756.2:c.534C>T, NM_001171622.1:c.534C>T, NM_001171623.1:c.-7C>T, NM_001171624.1:c.-7C>T, NM_001171625.1:c.-7C>T, NM_001171626.1:c.-7C>T, NM_001171627.1:c.-7C>T, NM_001171628.1:c.-7C>T, NM_001171629.1:c.-7C>T, NM_001171630.1:c.-7C>T, NM_001204384.1:c.-7C>T, NM_001204385.1:c.534C>T, NM_001287044.1:c.-880C>T, NM_001317010.1:c.-7C>T, NM_003376.5:c.534C>T, NP_001020537.2:p.Ser178=, NP_001020538.2:p.Ser178=, NP_001020539.2:p.Ser178=, NP_001020540.2:p.Ser178=, NP_001020541.2:p.Ser178=, NP_001028928.1:p.Ser178=, NP_001165093.1:p.Ser178=, NP_001191314.1:p.Ser178=, NP_003367.4:p.Ser178=, XM_005249363.1:c.-880C>T
C > T
SNP
S178S
No VIP available No Clinical Annotations available VA
rs2612091 NC_000018.10:g.683607C>T, NC_000018.9:g.683607C>T, NM_001126123.3:c.496-227G>A, NM_001318759.1:c.742-227G>A, NM_001318760.1:c.199-227G>A, NM_017512.5:c.742-227G>A, NM_202758.3:c.805-227G>A, XM_005258111.1:c.886-227G>A, XM_005258112.1:c.661-227G>A, XM_005258113.1:c.658-227G>A, XM_005258114.1:c.514-227G>A, XM_005258115.1:c.496-227G>A, XM_005258116.1:c.496-227G>A, XM_005258117.1:c.310-227G>A, XM_005258118.1:c.199-227G>A, XM_005258118.2:c.199-227G>A, XM_005258120.1:c.157-227G>A, XM_011525677.1:c.769-212G>A, XM_011525678.1:c.760-212G>A, XM_011525679.1:c.769-227G>A, XM_011525680.1:c.742-212G>A, XM_011525681.1:c.730-212G>A, XM_011525682.1:c.703-212G>A, XM_011525683.1:c.580-212G>A, XM_011525684.1:c.553-212G>A, XM_011525685.1:c.541-212G>A, XM_011525686.1:c.517-212G>A, XM_011525687.1:c.514-227G>A, XM_011525688.1:c.496-212G>A, XM_011525689.1:c.364-212G>A, XM_011525690.1:c.364-212G>A, XM_011525691.1:c.310-212G>A, XM_011525692.1:c.310-212G>A, XM_011525693.1:c.310-212G>A, XM_011525694.1:c.310-227G>A, XM_011525695.1:c.271-212G>A, XM_011525696.1:c.199-212G>A, XM_011525697.1:c.157-212G>A, XM_011525698.1:c.157-212G>A, XM_011525699.1:c.157-212G>A, XR_243810.1:n.937-227G>A, XR_243810.3:n.778-227G>A, XR_243811.1:n.803-227G>A, XR_243811.2:n.803-227G>A, XR_243812.1:n.938-227G>A, XR_430041.2:n.940-227G>A, XR_935066.1:n.778-212G>A, XR_935067.1:n.778-212G>A, rs61671949
C > T
SNP
No VIP available CA VA
rs2699887 NC_000003.11:g.178866408C>T, NC_000003.12:g.179148620C>T, NG_012113.2:g.5098C>T, NM_006218.2:c.-77+17C>T, NR_125401.1:n.-647G>A, XM_006713658.2:c.-77+401C>T, XM_011512894.1:c.-1173C>T, XR_241620.1:n.-643G>A
C > T
SNP
No VIP available No Clinical Annotations available VA
rs2720376 NC_000004.11:g.185554300C>T, NC_000004.12:g.184633146C>T, NM_004346.3:c.179-750G>A, NM_032991.2:c.179-750G>A, XM_005263266.1:c.179-750G>A, XM_011532301.1:c.179-750G>A, rs17586243, rs58845854
C > T
SNP
No VIP available No Clinical Annotations available VA
rs2762939 NC_000020.10:g.52781251G>C, NC_000020.11:g.54164712G>C, NG_008334.1:g.14266C>G, NM_000782.4:c.733-149C>G, NM_001128915.1:c.733-149C>G, XM_005260304.1:c.733-149C>G, XM_005260304.3:c.733-149C>G, XM_005260305.1:c.733-149C>G, rs57991016
G > C
SNP
No VIP available No Clinical Annotations available VA
rs2804402 NC_000010.10:g.101541583A>G, NC_000010.11:g.99781826A>G, NG_011798.1:g.4121A>G, NM_000392.4:c.-1019A>G, XM_005269536.1:c.-1019A>G, XM_006717631.2:c.-1019A>G, XM_011539291.1:c.-1019A>G, XR_945604.1:n.-830A>G, XR_945605.1:n.-828A>G, rs17222526, rs60149027
A > G
SNP
No VIP available No Clinical Annotations available VA
rs3025039 NC_000006.11:g.43752536C>T, NC_000006.12:g.43784799C>T, NG_008732.1:g.19584C>T, NM_001025366.2:c.*237C>T, NM_001025367.2:c.*237C>T, NM_001025368.2:c.*237C>T, NM_001025369.2:c.*253C>T, NM_001025370.2:c.*237C>T, NM_001033756.2:c.*171C>T, NM_001171622.1:c.*237C>T, NM_001171623.1:c.*237C>T, NM_001171624.1:c.*237C>T, NM_001171625.1:c.*237C>T, NM_001171626.1:c.*237C>T, NM_001171627.1:c.*253C>T, NM_001171628.1:c.*237C>T, NM_001171629.1:c.*171C>T, NM_001171630.1:c.*237C>T, NM_001204384.1:c.*237C>T, NM_001204385.1:c.*237C>T, NM_001287044.1:c.*237C>T, NM_001317010.1:c.*171C>T, NM_003376.5:c.*237C>T, XM_005249363.1:c.*237C>T, rs11575898
C > T
SNP
No VIP available No Clinical Annotations available VA
rs307805 NC_000005.10:g.180650487T>C, NC_000005.9:g.180077487T>C, NG_011536.1:g.4138A>G, NM_002020.4:c.-942A>G, NM_182925.4:c.-942A>G, XM_011534482.1:c.-942A>G, XM_011534483.1:c.-289A>G, rs1309960, rs57113127
T > C
SNP
No VIP available No Clinical Annotations available VA
rs307822 NC_000005.10:g.180601717T>C, NC_000005.9:g.180028717T>C, NG_011536.1:g.52908A>G, NM_182925.4:c.*1475A>G, XM_011534477.1:c.*1475A>G, XM_011534478.1:c.*1475A>G, XM_011534482.1:c.*1475A>G, XM_011534483.1:c.*1475A>G, XM_011534484.1:c.*1475A>G, rs1309977
T > C
SNP
No VIP available No Clinical Annotations available VA
rs3087386 NC_000002.11:g.100055506A>G, NC_000002.12:g.99439044A>G, NM_001037872.1:c.770T>C, NM_016316.2:c.770T>C, NP_001032961.1:p.Phe257Ser, NP_057400.1:p.Phe257Ser, XM_005263967.1:c.770T>C, XM_005263968.1:c.560T>C, XM_005263969.1:c.-825T>C, XM_011511336.1:c.770T>C, XM_011511337.1:c.770T>C, XM_011511338.1:c.560T>C, XM_011511339.1:c.-825T>C, XP_005264024.1:p.Phe257Ser, XP_005264025.1:p.Phe187Ser, XP_011509638.1:p.Phe257Ser, XP_011509639.1:p.Phe257Ser, XP_011509640.1:p.Phe187Ser, XR_244891.1:n.931T>C, XR_427092.1:n.1151T>C, XR_922941.1:n.780T>C, rs3749086, rs58019413
A > G
SNP
F257S
No VIP available No Clinical Annotations available VA
rs3087399 NC_000002.11:g.100055158T>C, NC_000002.12:g.99438696T>C, NM_001037872.1:c.1118A>G, NM_016316.2:c.1118A>G, NP_001032961.1:p.Asn373Ser, NP_057400.1:p.Asn373Ser, XM_005263967.1:c.1118A>G, XM_005263968.1:c.908A>G, XM_005263969.1:c.-477A>G, XM_011511336.1:c.1118A>G, XM_011511337.1:c.1118A>G, XM_011511338.1:c.908A>G, XM_011511339.1:c.-477A>G, XP_005264024.1:p.Asn373Ser, XP_005264025.1:p.Asn303Ser, XP_011509638.1:p.Asn373Ser, XP_011509639.1:p.Asn373Ser, XP_011509640.1:p.Asn303Ser, XR_244891.1:n.1279A>G, XR_427092.1:n.1499A>G, XR_922941.1:n.1128A>G, rs52791165, rs57440453
T > C
SNP
N373S
No VIP available CA VA
rs3087403 NC_000002.11:g.100058870C>T, NC_000002.12:g.99442408C>T, NM_001037872.1:c.412G>A, NM_016316.2:c.412G>A, NP_001032961.1:p.Val138Met, NP_057400.1:p.Val138Met, XM_005263967.1:c.412G>A, XM_005263968.1:c.202G>A, XM_011511336.1:c.412G>A, XM_011511337.1:c.412G>A, XM_011511338.1:c.202G>A, XP_005264024.1:p.Val138Met, XP_005264025.1:p.Val68Met, XP_011509638.1:p.Val138Met, XP_011509639.1:p.Val138Met, XP_011509640.1:p.Val68Met, XR_244891.1:n.573G>A, XR_427092.1:n.793G>A, XR_922941.1:n.422G>A, rs17713429, rs52807598, rs58647355
C > T
SNP
V138M
No VIP available CA VA
rs316019 NC_000006.11:g.160670282A>C, NC_000006.12:g.160249250A>C, NM_003058.3:c.808T>G, NP_003049.2:p.Ser270Ala, rs1755917, rs17846267, rs17859289, rs386580336, rs52803175, rs60007366, rs666224
A > C
SNP
S270A
No VIP available No Clinical Annotations available VA
rs3204953 NC_000006.11:g.111628626C>T, NC_000006.12:g.111307423C>T, NM_001286431.1:c.8956G>A, NM_001286432.1:c.8956G>A, NM_002912.4:c.9190G>A, NP_001273360.1:p.Val2986Ile, NP_001273361.1:p.Val2986Ile, NP_002903.3:p.Val3064Ile, XM_005267088.1:c.8956G>A, XM_005267089.1:c.8824G>A, XM_006715543.2:c.9190G>A, XM_006715544.2:c.8956G>A, XM_011536028.1:c.9271G>A, XM_011536029.1:c.9268G>A, XM_011536030.1:c.9193G>A, XM_011536031.1:c.9037G>A, XM_011536032.1:c.9037G>A, XP_005267145.1:p.Val2986Ile, XP_005267146.1:p.Val2942Ile, XP_006715606.1:p.Val3064Ile, XP_006715607.1:p.Val2986Ile, XP_011534330.1:p.Val3091Ile, XP_011534331.1:p.Val3090Ile, XP_011534332.1:p.Val3065Ile, XP_011534333.1:p.Val3013Ile, XP_011534334.1:p.Val3013Ile, XR_942871.1:n.2045+29265C>T, rs17511539, rs386580771, rs52817805
C > T
SNP
V2986I
No VIP available CA VA
rs3212986 NC_000019.10:g.45409478C>A, NC_000019.9:g.45912736C>A, NG_015839.2:g.74351G>T, NM_001166049.1:c.*197G>T, NM_001297590.1:c.1516C>A, NM_001983.3:c.*197G>T, NM_012099.1:c.1510C>A, NP_001284519.1:p.Gln506Lys, NP_036231.1:p.Gln504Lys, XM_005258425.1:c.1516C>A, XM_005258638.1:c.*197G>T, XP_005258482.1:p.Gln506Lys, rs386580934, rs60333438
C > A
C > T
SNP
Q506K
No VIP available CA VA
rs3219484 NC_000001.10:g.45800156C>T, NC_000001.11:g.45334484C>T, NG_008189.1:g.10987G>A, NM_001048171.1:c.64G>A, NM_001048172.1:c.22G>A, NM_001048173.1:c.22G>A, NM_001048174.1:c.22G>A, NM_001128425.1:c.64G>A, NM_001293190.1:c.64G>A, NM_001293191.1:c.22G>A, NM_001293192.1:c.-191G>A, NM_001293195.1:c.22G>A, NM_001293196.1:c.-191G>A, NM_012222.2:c.64G>A, NP_001041636.1:p.Val22Met, NP_001041637.1:p.Val8Met, NP_001041638.1:p.Val8Met, NP_001041639.1:p.Val8Met, NP_001121897.1:p.Val22Met, NP_001280119.1:p.Val22Met, NP_001280120.1:p.Val8Met, NP_001280124.1:p.Val8Met, NP_036354.1:p.Val22Met, XM_005270880.1:c.64G>A, XM_005270881.1:c.22G>A, XM_005270882.1:c.22G>A, XM_005270883.1:c.-135G>A, XM_005270884.1:c.-191G>A, XM_005270885.1:c.-191G>A, XM_005270886.1:c.-52G>A, XM_011541497.1:c.40G>A, XM_011541498.1:c.22G>A, XM_011541499.1:c.22G>A, XM_011541500.1:c.22G>A, XM_011541501.1:c.22G>A, XM_011541502.1:c.22G>A, XM_011541503.1:c.64G>A, XM_011541504.1:c.22G>A, XM_011541505.1:c.-52G>A, XM_011541506.1:c.-52G>A, XM_011541507.1:c.-1167G>A, XM_011541508.1:c.-1194G>A, XP_005270937.1:p.Val22Met, XP_005270938.1:p.Val8Met, XP_005270939.1:p.Val8Met, XP_011539799.1:p.Val14Met, XP_011539800.1:p.Val8Met, XP_011539801.1:p.Val8Met, XP_011539802.1:p.Val8Met, XP_011539803.1:p.Val8Met, XP_011539804.1:p.Val8Met, XP_011539805.1:p.Val22Met, XP_011539806.1:p.Val8Met, XR_946658.1:n.111G>A, rs17784895, rs52809192, rs61197742
C > T
SNP
V22M
No VIP available No Clinical Annotations available VA
rs34716810 NC_000019.10:g.40286682G>A, NC_000019.9:g.40792589G>A, NG_012038.2:g.3677C>T, NM_001243027.2:c.-1735C>T, NM_001243028.2:c.-1642C>T, NM_001626.5:c.-1586C>T, XM_005258648.1:c.-1319C>T, XM_005258650.1:c.-1586C>T, XM_011526617.1:c.-2299C>T, XM_011526618.1:c.-2002C>T, XM_011526620.1:c.-1319C>T, XM_011526621.1:c.-1718C>T, XM_011526622.1:c.-1586C>T, XR_935967.1:n.169+83G>A, rs62107592
G > A
SNP
No VIP available No Clinical Annotations available VA
rs3740066 NC_000010.10:g.101604207C>T, NC_000010.11:g.99844450C>T, NG_011798.1:g.66745C>T, NM_000392.4:c.3972C>T, NP_000383.1:p.Ile1324=, XM_005269536.1:c.3693C>T, XM_006717630.2:c.3276C>T, XP_005269593.1:p.Ile1231=, XP_006717693.1:p.Ile1092=, XR_945604.1:n.4161C>T, XR_945605.1:n.4036C>T, rs12780340, rs17216303, rs59292214
C > T
SNP
I1324I
No VIP available CA VA
rs3740556 NC_000010.10:g.120840195G>A, NC_000010.11:g.119080683G>A, NM_003750.2:c.-7C>T, XM_005270259.1:c.-7C>T, XM_005270260.1:c.-357C>T
G > A
SNP
No VIP available No Clinical Annotations available VA
rs3787554 NC_000020.10:g.52782680G>A, NC_000020.11:g.54166141G>A, NG_008334.1:g.12837C>T, NM_000782.4:c.641-308C>T, NM_001128915.1:c.641-308C>T, XM_005260304.1:c.641-308C>T, XM_005260304.3:c.641-308C>T, XM_005260305.1:c.641-308C>T
G > A
SNP
No VIP available No Clinical Annotations available VA
rs3803304 NC_000014.8:g.105239146C>G, NC_000014.9:g.104772809C>G, NG_012188.1:g.27936G>C, NM_001014431.1:c.1172+69G>C, NM_001014432.1:c.1172+69G>C, NM_005163.2:c.1172+69G>C, XM_005267401.1:c.1172+69G>C, XM_005267402.1:c.1169+69G>C, XM_011536543.1:c.1172+69G>C, XM_011536544.1:c.1172+69G>C
C > G
SNP
No VIP available No Clinical Annotations available VA
rs3817657 NC_000011.10:g.4121362T>C, NC_000011.9:g.4142592T>C, NG_027992.2:g.31669T>C, NM_001033.3:c.877-242T>C, NM_001033.4:c.877-242T>C, NM_001318064.1:c.586-242T>C, NM_001318065.1:c.-138-242T>C, XM_005253058.1:c.634-242T>C, XM_005253059.1:c.586-242T>C, XM_011520277.1:c.586-242T>C, XM_011520278.1:c.211-242T>C, XM_011520279.1:c.-138-242T>C, rs57325561
T > C
SNP
No VIP available No Clinical Annotations available VA
rs3832043 NC_000002.11:g.234580454delT, NC_000002.12:g.233671808delT, NG_002601.2:g.87065delT, NM_019075.2:c.855+34431del, NM_019075.2:c.855+34431delT, NM_019076.4:c.855+53246del, NM_019076.4:c.855+53246delT, NM_021027.2:c.-127del, NM_021027.2:c.-127delT, XR_241241.1:n.-41delT, rs150487502, rs35426722, rs371526135, rs57111427, rs67695772, rs67695773
T > -
indel
No VIP available CA VA
rs3957357 NC_000006.11:g.52668687A>G, NC_000006.12:g.52803889A>G, NM_001319059.1:c.-281T>C, NM_145740.4:c.-135T>C, XM_005249034.1:c.-135T>C, XM_005249034.2:c.-135T>C, rs58145964
A > G
SNP
No VIP available No Clinical Annotations available VA
rs4124874 NC_000002.11:g.234665659T>G, NC_000002.12:g.233757013T>G, NG_002601.2:g.172270T>G, NG_033238.1:g.1741T>G, NM_001072.3:c.862-10021T>G, NM_007120.2:c.868-10021T>G, NM_019075.2:c.856-10021T>G, NM_019076.4:c.856-10021T>G, NM_019077.2:c.856-10021T>G, NM_019078.1:c.868-10021T>G, NM_019093.2:c.868-10021T>G, NM_021027.2:c.856-10021T>G, NM_205862.1:c.61-10021T>G, NR_037694.1:n.-1668A>C, NR_037695.1:n.-1668A>C, NR_037696.1:n.-1668A>C, XR_241238.1:n.924-10021T>G, XR_241240.1:n.1023-10021T>G, XR_241241.1:n.942-10021T>G, rs57409706
T > G
SNP
No VIP available No Clinical Annotations available VA
rs4148323 NC_000002.11:g.234669144G>A, NC_000002.12:g.233760498G>A, NG_002601.2:g.175755G>A, NG_033238.1:g.5226G>A, NM_000463.2:c.211G>A, NM_001072.3:c.862-6536G>A, NM_007120.2:c.868-6536G>A, NM_019075.2:c.856-6536G>A, NM_019076.4:c.856-6536G>A, NM_019077.2:c.856-6536G>A, NM_019078.1:c.868-6536G>A, NM_019093.2:c.868-6536G>A, NM_021027.2:c.856-6536G>A, NM_205862.1:c.61-6536G>A, NP_000454.1:p.Gly71Arg, XR_241238.1:n.924-6536G>A, XR_241239.1:n.233G>A, XR_241240.1:n.1023-6536G>A, XR_241241.1:n.942-6536G>A, rs113525835, rs34360183, rs58105808, rs58585123
G > A
SNP
G71R
No VIP available CA VA
rs4148416 NC_000017.10:g.48753423C>T, NC_000017.11:g.50676062C>T, NM_003786.3:c.3039C>T, NP_003777.2:p.Gly1013=, XM_005257763.1:c.2847C>T, XM_005257763.2:c.2847C>T, XM_011525422.1:c.2952C>T, XM_011525423.1:c.3144C>T, XM_011525424.1:c.2364C>T, XM_011525425.1:c.2313C>T, XP_005257820.1:p.Gly949=, XP_011523724.1:p.Gly984=, XP_011523725.1:p.Gly1048=, XP_011523726.1:p.Gly788=, XP_011523727.1:p.Gly771=, XR_934586.1:n.3237C>T
C > T
SNP
G1013G
No VIP available CA VA
rs4148737 NC_000007.13:g.87171152T>C, NC_000007.14:g.87541836T>C, NG_011513.1:g.176413A>G, NM_000927.4:c.2212-372A>G, rs386591482, rs60838665
T > C
SNP
No VIP available CA VA
rs4492666 NC_000001.10:g.47800845A>C, NC_000001.11:g.47335173A>C, NM_001136140.1:c.171+1057A>C, NM_016308.2:c.171+1057A>C, NR_046394.1:n.320+1057A>C, NR_046395.1:n.320+1057A>C, rs61400292
A > C
A > T
SNP
No VIP available CA VA
rs451774 NC_000006.11:g.28502550A>G, NC_000006.12:g.28534773A>G, NM_001509.2:c.*606A>G, NM_003996.3:c.*851A>G, NT_113891.2:g.24754A>G, NT_113891.3:g.24654A>G, XM_011514527.1:c.*606A>G, XM_011514528.1:c.*606A>G, XM_011514529.1:c.*606A>G, XM_011514530.1:c.*606A>G, XM_011547233.1:c.*606A>G, XM_011547234.1:c.*606A>G, XM_011547235.1:c.*606A>G, XM_011547236.1:c.*606A>G, rs115878751, rs118080793, rs60258350
A > G
SNP
No VIP available No Clinical Annotations available VA
rs45445694 NC_000018.10:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NC_000018.9:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NG_028255.1:g.5043_5070CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NM_001012716.2:c.*34+169_*34+196CGGGACGGAGGCAGGCCAAGTGGCGCGG[2][3][4][7][8][9], NM_001071.2:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258137.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258138.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], rs34743033 (retired)
(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2
(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)4
(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)7
(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)8
(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)9
microsatellite
No VIP available CA VA
rs462779 NC_000006.11:g.111695887G>A, NC_000006.12:g.111374684G>A, NM_001286431.1:c.3437C>T, NM_001286432.1:c.3437C>T, NM_002912.4:c.3671C>T, NP_001273360.1:p.Thr1146Ile, NP_001273361.1:p.Thr1146Ile, NP_002903.3:p.Thr1224Ile, XM_005267088.1:c.3437C>T, XM_005267089.1:c.3305C>T, XM_005267090.1:c.3671C>T, XM_005267091.1:c.3671C>T, XM_006715543.2:c.3671C>T, XM_006715544.2:c.3437C>T, XM_011536028.1:c.3674C>T, XM_011536029.1:c.3671C>T, XM_011536030.1:c.3674C>T, XM_011536031.1:c.3440C>T, XM_011536032.1:c.3440C>T, XM_011536033.1:c.3674C>T, XM_011536034.1:c.3674C>T, XM_011536035.1:c.3674C>T, XM_011536036.1:c.3674C>T, XP_005267145.1:p.Thr1146Ile, XP_005267146.1:p.Thr1102Ile, XP_005267147.1:p.Thr1224Ile, XP_005267148.1:p.Thr1224Ile, XP_006715606.1:p.Thr1224Ile, XP_006715607.1:p.Thr1146Ile, XP_011534330.1:p.Thr1225Ile, XP_011534331.1:p.Thr1224Ile, XP_011534332.1:p.Thr1225Ile, XP_011534333.1:p.Thr1147Ile, XP_011534334.1:p.Thr1147Ile, XP_011534335.1:p.Thr1225Ile, XP_011534336.1:p.Thr1225Ile, XP_011534337.1:p.Thr1225Ile, XP_011534338.1:p.Thr1225Ile, XR_942545.1:n.4223C>T, XR_942546.1:n.4223C>T, rs17510886, rs386594115, rs52812261, rs56811779
G > A
SNP
T1146I
No VIP available No Clinical Annotations available VA
rs4638843 NC_000002.11:g.47704027G>C, NC_000002.12:g.47476888G>C, NG_007110.2:g.78765G>C, NM_000251.2:c.2210+317G>C, NM_001258281.1:c.2012+317G>C, XM_005264332.1:c.2210+317G>C, XM_005264332.2:c.2210+317G>C, XM_005264333.1:c.2060+317G>C, XM_011532867.1:c.2210+317G>C, XR_939685.1:n.2282+317G>C, rs17224885, rs5023612, rs61203271
G > C
SNP
No VIP available CA VA
rs4646316 NC_000022.10:g.19952132C>T, NC_000022.11:g.19964609C>T, NG_011526.1:g.27870C>T, NM_000754.3:c.615+310C>T, NM_001135161.1:c.615+310C>T, NM_001135162.1:c.615+310C>T, NM_007310.2:c.465+310C>T, XM_005261229.1:c.615+310C>T, XM_011529885.1:c.729+310C>T, XM_011529886.1:c.729+310C>T, XM_011529887.1:c.615+310C>T, XM_011529888.1:c.615+310C>T, XM_011529889.1:c.615+310C>T, XM_011529890.1:c.615+310C>T, XM_011529891.1:c.615+310C>T, rs58510682
C > T
SNP
No VIP available No Clinical Annotations available VA
rs4646437 NC_000007.13:g.99365083G>A, NC_000007.14:g.99767460G>A, NG_008421.1:g.21726C>T, NM_001202855.2:c.671-205C>T, NM_017460.5:c.671-202C>T, XM_011515841.1:c.671-202C>T, XM_011515842.1:c.671-205C>T, rs386594232, rs57997883
G > A
SNP
No VIP available No Clinical Annotations available VA
rs4655567 NC_000001.10:g.68101640G>C, NC_000001.11:g.67635957G>C, rs57378090, rs57576059
G > C
SNP
No VIP available No Clinical Annotations available VA
rs465646 NC_000006.11:g.111620758G>A, NC_000006.12:g.111299555G>A, NM_001286431.1:c.*461C>T, NM_001286432.1:c.*461C>T, NM_002912.4:c.*461C>T, XM_005267088.1:c.*461C>T, XM_005267089.1:c.*461C>T, XM_006715543.2:c.*461C>T, XM_006715544.2:c.*461C>T, XM_011536028.1:c.*461C>T, XM_011536029.1:c.*461C>T, XM_011536030.1:c.*461C>T, XM_011536031.1:c.*461C>T, XM_011536032.1:c.*461C>T, XR_942871.1:n.2045+21397G>A, rs17511609, rs3805825, rs59824672
G > A
SNP
No VIP available CA VA
rs4788863
T > C
SNP
L41L
No VIP available No Clinical Annotations available VA
rs4834232 NC_000004.11:g.129024273C>T, NC_000004.12:g.128103118C>T, NM_001278604.1:c.814-4021C>T, NM_018078.3:c.814-4021C>T, NM_032239.3:c.814-4021C>T, NM_178043.2:c.814-4021C>T, XM_005263086.1:c.1417-4021C>T, XM_005263087.1:c.1417-4021C>T, XM_005263088.1:c.1417-4021C>T, XM_005263089.1:c.1273-4021C>T, XM_005263090.1:c.1417-4021C>T, XM_005263091.1:c.1417-4021C>T, XM_005263092.1:c.1417-4021C>T, XM_005263093.1:c.1417-4021C>T, XM_005263094.1:c.1417-4021C>T, XM_005263095.1:c.1417-4021C>T, XM_005263096.1:c.1417-4021C>T, XM_005263097.1:c.1417-4021C>T, XM_005263098.1:c.1417-4021C>T, XM_005263099.1:c.91-4021C>T, XM_005263100.1:c.91-4021C>T, XM_005263101.1:c.1417-4021C>T, XM_011532057.1:c.814-4021C>T, XM_011532058.1:c.814-4021C>T, XM_011532059.1:c.814-4021C>T, XM_011532060.1:c.814-4021C>T, XM_011532061.1:c.1276-4021C>T, XM_011532062.1:c.814-4021C>T, XM_011532063.1:c.814-4021C>T, XM_011532064.1:c.814-4021C>T, XM_011532065.1:c.1276-4021C>T, XM_011532066.1:c.814-4021C>T, XM_011532067.1:c.814-4021C>T, XM_011532068.1:c.673-4021C>T, XM_011532069.1:c.673-4021C>T, XM_011532070.1:c.814-4021C>T, XM_011532071.1:c.814-4021C>T, XM_011532072.1:c.814-4021C>T, XM_011532073.1:c.814-4021C>T, XM_011532074.1:c.814-4021C>T, XM_011532075.1:c.91-4021C>T, XM_011532076.1:c.91-4021C>T, XM_011532077.1:c.91-4021C>T, XM_011532078.1:c.814-4021C>T, XR_938753.1:n.891-4021C>T, XR_938754.1:n.891-4021C>T, XR_938755.1:n.891-4021C>T, XR_938756.1:n.891-4021C>T, XR_938757.1:n.891-4021C>T, XR_938758.1:n.891-4021C>T, XR_938759.1:n.891-4021C>T, XR_938760.1:n.891-4021C>T, XR_938761.1:n.891-4021C>T, XR_938762.1:n.891-4021C>T, rs17394472, rs59780448
C > T
SNP
No VIP available No Clinical Annotations available VA
rs4932551 NC_000015.10:g.91528728G>C, NC_000015.9:g.92071958G>C, rs17772730, rs56529178, rs57899076, rs58182249
G > C
SNP
No VIP available No Clinical Annotations available VA
rs5009910 NC_000002.11:g.31249014T>C, NC_000002.12:g.31026148T>C, NM_001253826.1:c.315-59846A>G, NM_001253827.1:c.70-33141A>G, NM_024572.3:c.130-33141A>G, NR_045602.1:n.903-33141A>G, XM_005264559.1:c.25-33141A>G, XM_011533104.1:c.448-33141A>G, XM_011533105.1:c.70-33141A>G, XM_011533106.1:c.43-33141A>G, rs56597185, rs59566663, rs60531112
T > C
SNP
No VIP available No Clinical Annotations available VA
rs560018 NC_000001.10:g.110200360T>C, NC_000001.11:g.109657738T>C, NM_000850.4:c.260-34T>C, NM_147148.2:c.260-34T>C, NR_024538.1:n.492-34T>C, XM_011541297.1:c.260-34T>C, XM_011541298.1:c.-53-34T>C, rs17531990, rs1800657, rs58086519
T > C
SNP
No VIP available No Clinical Annotations available VA
rs56038477 NC_000001.10:g.98039419C>T, NC_000001.11:g.97573863C>T, NG_008807.2:g.352197G>A, NM_000110.3:c.1236G>A, NP_000101.2:p.Glu412=, XM_005270561.1:c.1125G>A, XM_005270562.1:c.1236G>A, XM_005270562.3:c.1236G>A, XM_005270563.1:c.1236G>A, XM_005270564.1:c.1236G>A, XM_006710397.2:c.1236G>A, XP_005270618.1:p.Glu375=, XP_005270619.1:p.Glu412=, XP_005270619.2:p.Glu412=, XP_005270620.1:p.Glu412=, XP_005270621.1:p.Glu412=, XP_006710460.1:p.Glu412=, rs199469533, rs61730901
C > T
SNP
E412E
No VIP available No Clinical Annotations available VA
rs5906072 NC_000023.10:g.45640507T>C, NC_000023.11:g.45781104T>C, NW_004070879.1:g.105769T>C, rs59017433, rs59105359, rs6609373
T > C
SNP
No VIP available No Clinical Annotations available VA
rs5934731 NC_000023.10:g.9935844C>T, NC_000023.11:g.9967804C>T, NM_001195081.1:c.447C>T, NP_001182010.1:p.Tyr149=, XM_006724448.2:c.579C>T, XP_006724511.2:p.Tyr193=, rs56455686, rs57784312, rs6640581
C > T
SNP
Y149Y
No VIP available No Clinical Annotations available VA
rs60369023 NC_000001.10:g.20931474G>A, NC_000001.11:g.20604981G>A, NM_001785.2:c.208G>A, NP_001776.1:p.Ala70Thr
G > A
SNP
A70T
No VIP available No Clinical Annotations available VA
rs62107593 NC_000019.10:g.40287019C>G, NC_000019.9:g.40792926C>G, NG_012038.2:g.3340G>C, NM_001243027.2:c.-2072G>C, NM_001243028.2:c.-1979G>C, NM_001626.5:c.-1923G>C, XM_005258648.1:c.-1656G>C, XM_005258650.1:c.-1923G>C, XM_011526620.1:c.-1656G>C, XM_011526621.1:c.-2055G>C, XM_011526622.1:c.-1923G>C, XR_935967.1:n.169+420C>G
C > G
SNP
No VIP available CA VA
rs6413432 NC_000010.10:g.135348544T>A, NC_000010.11:g.133535040T>A, NG_008383.1:g.12678T>A, NM_000773.3:c.967+1143T>A, XM_005252665.1:c.1027+1143T>A
T > A
SNP
No VIP available No Clinical Annotations available VA
rs6458232 NC_000006.11:g.41629726C>A, NC_000006.12:g.41661988C>A, rs59690886
C > A
SNP
No VIP available No Clinical Annotations available VA
rs664393 NC_000013.10:g.29071001T>C, NC_000013.11:g.28496864T>C, NG_012003.1:g.3265A>G, NM_001159920.1:c.-2021A>G, NM_001160030.1:c.-2021A>G, NM_001160031.1:c.-2021A>G, NM_002019.4:c.-2021A>G, XM_011535014.1:c.-2021A>G, rs59180014
T > C
SNP
No VIP available No Clinical Annotations available VA
rs6721961 NC_000002.11:g.178130037T>G, NC_000002.12:g.177265309T>G, NM_001145412.3:c.-1910A>C, NM_001145413.3:c.-1910A>C, NM_001313900.1:c.-1784A>C, NM_001313901.1:c.-1876A>C, NM_001313902.1:c.-733A>C, NM_001313903.1:c.-733A>C, NM_001313904.1:c.-2091A>C, NM_006164.4:c.-733A>C, rs117801448
T > C
T > G
SNP
No VIP available No Clinical Annotations available VA
rs67376798 NC_000001.10:g.97547947T>A, NC_000001.11:g.97082391T>A, NG_008807.2:g.843669A>T, NM_000110.3:c.2846A>T, NP_000101.2:p.Asp949Val, XM_005270561.1:c.2735A>T, XM_005270562.1:c.2630A>T, XM_005270562.3:c.2630A>T, XP_005270618.1:p.Asp912Val, XP_005270619.1:p.Asp877Val, XP_005270619.2:p.Asp877Val, rs199469564, rs386467430, rs67376799
T > A
SNP
D949V
No VIP available No Clinical Annotations available VA
rs6752303 NC_000002.11:g.31247485T>C, NC_000002.12:g.31024619T>C, NM_001253826.1:c.315-58317A>G, NM_001253827.1:c.70-31612A>G, NM_024572.3:c.130-31612A>G, NR_045602.1:n.903-31612A>G, XM_005264559.1:c.25-31612A>G, XM_011533104.1:c.448-31612A>G, XM_011533105.1:c.70-31612A>G, XM_011533106.1:c.43-31612A>G, rs111184598, rs56566923, rs56952366, rs61068192
T > C
SNP
No VIP available No Clinical Annotations available VA
rs6848982 NC_000004.11:g.128959213G>A, NC_000004.12:g.128038058G>A, NM_001319305.1:c.*2245G>A, NM_001319306.1:c.*2245G>A, NM_001319307.1:c.*2245G>A
G > A
SNP
No VIP available No Clinical Annotations available VA
rs6877011 NC_000005.10:g.180602471C>G, NC_000005.9:g.180029471C>G, NG_011536.1:g.52154G>C, NM_182925.4:c.*721G>C, XM_011534477.1:c.*721G>C, XM_011534478.1:c.*721G>C, XM_011534482.1:c.*721G>C, XM_011534483.1:c.*721G>C, XM_011534484.1:c.*721G>C, rs59862001
C > G
SNP
No VIP available CA VA
rs698 NC_000004.11:g.100260789T>C, NC_000004.12:g.99339632T>C, NG_011718.1:g.18129A>G, NM_000669.4:c.1048A>G, NP_000660.1:p.Ile350Val, NR_133005.1:n.1374A>G, XM_011531588.1:c.946A>G, XM_011531589.1:c.928A>G, XP_011529890.1:p.Ile316Val, XP_011529891.1:p.Ile310Val, rs1042758, rs117472071, rs1693473, rs17399447, rs17855753, rs3182222, rs4134508, rs56906178
T > -
T > C
SNP
I350V
No VIP available No Clinical Annotations available VA
rs7121 NC_000020.10:g.57478807C>T, NC_000020.11:g.58903752C>T, NG_016194.1:g.69013C>T, NM_000516.5:c.393C>T, NM_001077488.3:c.396C>T, NM_001077489.3:c.348C>T, NM_001077490.2:c.*254C>T, NM_001309840.1:c.216C>T, NM_001309861.1:c.216C>T, NM_016592.3:c.*299C>T, NM_080425.3:c.2322C>T, NM_080426.3:c.351C>T, NP_000507.1:p.Ile131=, NP_001070956.1:p.Ile132=, NP_001070957.1:p.Ile116=, NP_001296769.1:p.Ile72=, NP_001296790.1:p.Ile72=, NP_536350.2:p.Ile774=, NP_536351.1:p.Ile117=, NR_003259.1:n.483C>T, XM_005260396.1:c.336C>T, XM_005260397.1:c.297C>T, XM_005260398.1:c.252C>T, XM_005260399.1:c.171C>T, XM_005260400.1:c.171C>T, XM_005260401.1:c.171C>T, XM_005260402.1:c.219C>T, XP_005260453.1:p.Ile112=, XP_005260454.1:p.Ile99=, XP_005260455.1:p.Ile84=, XP_005260456.1:p.Ile57=, XP_005260457.1:p.Ile57=, XP_005260458.1:p.Ile57=, XP_005260459.1:p.Ile73=, XR_244140.1:n.1443C>T, rs1053389, rs17829840, rs3171206, rs3730167, rs61041002
C > -
C > T
SNP
I131I
No VIP available No Clinical Annotations available VA
rs7131224 NC_000011.10:g.24225985T>C, NC_000011.9:g.24247531T>C, rs111186995, rs58002303, rs58056067
T > C
SNP
No VIP available No Clinical Annotations available VA
rs715171 NC_000023.10:g.9341848C>T, NC_000023.11:g.9373808C>T, rs61410664
C > T
SNP
No VIP available No Clinical Annotations available VA
rs7170769 NC_000015.10:g.91526975C>T, NC_000015.9:g.92070205C>T, rs58543442
C > T
SNP
No VIP available No Clinical Annotations available VA
rs717620 NC_000010.10:g.101542578C>T, NC_000010.11:g.99782821C>T, NG_011798.1:g.5116C>T, NM_000392.4:c.-24C>T, XM_005269536.1:c.-24C>T, XM_006717631.2:c.-24C>T, XM_011539291.1:c.-24C>T, XR_945604.1:n.166C>T, XR_945605.1:n.168C>T, rs17216163, rs386485129, rs58371376
C > T
SNP
No VIP available CA VA
rs7186128 NC_000016.10:g.16864058G=, NC_000016.10:g.16864058G>A, NC_000016.9:g.16957915G>A, NT_187607.1:g.2524971A=, NT_187607.1:g.2524971A>G, rs56576370, rs57245322, rs58011988
G > A
SNP
No VIP available CA VA
rs720106 NC_000011.10:g.4118748T>C, NC_000011.9:g.4139978T>C, NG_027992.2:g.29055T>C, NM_001033.3:c.792+287T>C, NM_001033.4:c.792+287T>C, NM_001318064.1:c.501+287T>C, NM_001318065.1:c.-265+287T>C, XM_005253058.1:c.549+287T>C, XM_005253059.1:c.501+287T>C, XM_011520277.1:c.501+287T>C, XM_011520278.1:c.126+287T>C, XM_011520279.1:c.-265+287T>C
T > C
SNP
No VIP available No Clinical Annotations available VA
rs725518 NC_000011.10:g.4107615G>A, NC_000011.9:g.4128845G>A, NG_027992.2:g.17922G>A, NM_001033.3:c.387+80G>A, NM_001033.4:c.387+80G>A, NM_001318064.1:c.96+80G>A, XM_005253058.1:c.202+1476G>A, XM_005253059.1:c.96+80G>A, XM_011520277.1:c.96+80G>A, rs17423023, rs386608733, rs61333041
G > A
SNP
No VIP available CA VA
rs726501 NC_000005.10:g.56832039G>A, NC_000005.9:g.56127866G>A, NG_031884.1:g.21967G>A, NM_005921.1:c.482+15984G>A, XM_005248519.1:c.71+11223G>A, XM_005248519.3:c.104+11223G>A, XM_005248520.1:c.-8+14923G>A, XM_011543406.1:c.227+15704G>A, XM_011543407.1:c.482+15984G>A, XM_011543408.1:c.482+15984G>A, rs57031684
G > A
SNP
No VIP available No Clinical Annotations available VA
rs74090038 NC_000014.8:g.105262781C>T, NC_000014.9:g.104796444C>T, NG_012188.1:g.4300G>A, NG_042073.1:g.264C>T, NM_001014431.1:c.-1041G>A, NM_001014432.1:c.-1125G>A, XM_005267401.1:c.-2405G>A, XM_011536543.1:c.-2583G>A, XM_011536544.1:c.-3397G>A
C > T
SNP
No VIP available No Clinical Annotations available VA
rs7483 NC_000001.10:g.110279701C>T, NC_000001.11:g.109737079C>T, NM_000849.4:c.670G>A, NP_000840.2:p.Val224Ile, NR_024537.1:n.904G>A, XM_011541296.1:c.889G>A, XP_011539598.1:p.Val297Ile, rs17845187, rs17857997, rs3167664, rs386610559, rs52802282, rs58618587
C > -
C > T
SNP
V224I
No VIP available No Clinical Annotations available VA
rs7608731 NC_000002.11:g.31249974T>C, NC_000002.12:g.31027108T>C, NM_001253826.1:c.315-60806A>G, NM_001253827.1:c.70-34101A>G, NM_024572.3:c.130-34101A>G, NR_045602.1:n.903-34101A>G, XM_005264559.1:c.25-34101A>G, XM_011533104.1:c.448-34101A>G, XM_011533105.1:c.70-34101A>G, XM_011533106.1:c.43-34101A>G, rs56452495, rs57143999
T > C
SNP
No VIP available No Clinical Annotations available VA
rs763110 NC_000001.10:g.172627498C=, NC_000001.10:g.172627498C>T, NC_000001.11:g.172658358C=, NC_000001.11:g.172658358C>T, NG_007269.1:g.4314C=, NG_007269.1:g.4314C>T, NM_000639.2:c.-157-687C>T, NM_000639.2:c.-844C=, NM_001302746.1:c.-844C=, NM_001302746.1:c.-844C>T, rs59042607
C > T
SNP
No VIP available No Clinical Annotations available VA
rs7664413 NC_000004.11:g.177608707C>T, NC_000004.12:g.176687553C>T, NG_034216.1:g.110193G>A, NM_005429.4:c.812-33G>A, XR_939498.1:n.260+7803C>T, XR_939499.1:n.209+17844C>T, rs58304891
C > T
SNP
No VIP available No Clinical Annotations available VA
rs7667298 NC_000004.11:g.55991731T>C, NC_000004.12:g.55125564T>C, NG_012004.1:g.5032A>G, NM_002253.2:c.-271A>G, rs386485376, rs60563091
T > C
SNP
No VIP available CA VA
rs7851395 NC_000009.11:g.116002464A>G, NC_000009.12:g.113240184A>G, NM_001859.3:c.-35-15930A>G
A > G
SNP
No VIP available CA VA
rs7937567
G > A
SNP
No VIP available No Clinical Annotations available VA
rs7940013 NC_000011.10:g.4117074C>T, NC_000011.9:g.4138304C>T, NG_027992.2:g.27381C>T, NM_001033.3:c.651-1246C>T, NM_001033.4:c.651-1246C>T, NM_001318064.1:c.360-1246C>T, NM_001318065.1:c.-407+714C>T, XM_005253058.1:c.408-1246C>T, XM_005253059.1:c.360-1246C>T, XM_011520277.1:c.360-1246C>T, XM_011520278.1:c.-17+714C>T, XM_011520279.1:c.-407+714C>T, rs59381386, rs61670155
C > T
SNP
No VIP available No Clinical Annotations available VA
rs7993418 NC_000013.10:g.28883061G>A, NC_000013.11:g.28308924G>A, NG_012003.1:g.191205C>T, NM_002019.4:c.3639C>T, NP_002010.2:p.Tyr1213=, rs117224149, rs57281829
G > A
SNP
Y1213Y
No VIP available No Clinical Annotations available VA
rs8020368 NC_000014.8:g.95943548T>C, NC_000014.9:g.95477211T>C, NM_152592.3:c.-1390A>G, XM_005267376.1:c.-14-1376A>G, XM_005267376.3:c.176-1376A>G, XM_005267377.1:c.-14-1376A>G, XM_005267377.2:c.-14-1376A>G, XM_005267378.1:c.-14-1376A>G, XM_005267379.1:c.-14-1376A>G, XM_005267380.1:c.-14-1376A>G, XM_006720063.2:c.-14-1376A>G, XM_011536513.1:c.176-1376A>G, XM_011536514.1:c.176-1376A>G, XM_011536515.1:c.11-1376A>G, XM_011536516.1:c.176-1376A>G, rs56427699, rs58836477, rs59378010
T > C
SNP
No VIP available No Clinical Annotations available VA
rs8175347
(TA)6 > (TA)5
(TA)6 > (TA)7
(TA)6 > (TA)8
microsatellite
No VIP available No Clinical Annotations available VA
rs8187710 NC_000010.10:g.101611294G>A, NC_000010.11:g.99851537G>A, NG_011798.1:g.73832G>A, NM_000392.4:c.4544G>A, NP_000383.1:p.Cys1515Tyr, XM_005269536.1:c.4265G>A, XM_006717630.2:c.3848G>A, XP_005269593.1:p.Cys1422Tyr, XP_006717693.1:p.Cys1283Tyr, XR_945605.1:n.4608G>A, rs17222568, rs52804507, rs58135906
G > A
SNP
C1515Y
No VIP available No Clinical Annotations available VA
rs833061 NC_000006.11:g.43737486C>T, NC_000006.12:g.43769749C>T, NG_008732.1:g.4534C>T, NM_001025366.2:c.-958C>T, NM_001025367.2:c.-958C>T, NM_001025368.2:c.-958C>T, NM_001025369.2:c.-958C>T, NM_001025370.2:c.-958C>T, NM_001033756.2:c.-958C>T, NM_001171622.1:c.-958C>T, NM_001171623.1:c.-1498C>T, NM_001171624.1:c.-1498C>T, NM_001171625.1:c.-1498C>T, NM_001171626.1:c.-1498C>T, NM_001171627.1:c.-1498C>T, NM_001171628.1:c.-1498C>T, NM_001171629.1:c.-1498C>T, NM_001171630.1:c.-1498C>T, NM_001204384.1:c.-1498C>T, NM_001204385.1:c.-958C>T, NM_001317010.1:c.-1498C>T, NM_003376.5:c.-958C>T, rs36208046, rs60746584
C > T
SNP
No VIP available No Clinical Annotations available VA
rs861539 NC_000014.8:g.104165753G>A, NC_000014.9:g.103699416G>A, NG_011516.1:g.21071C>T, NG_012307.1:g.75229G>A, NM_001100118.1:c.722C>T, NM_001100119.1:c.722C>T, NM_001130107.1:c.1782-1239G>A, NM_005432.3:c.722C>T, NM_182923.3:c.1651-1239G>A, NP_001093588.1:p.Thr241Met, NP_001093589.1:p.Thr241Met, NP_005423.1:p.Thr241Met, XM_005267599.1:c.1924-1239G>A, XM_005267600.1:c.*17-1239G>A, XM_005267602.1:c.1897-1239G>A, XM_005267603.1:c.*17-1239G>A, XM_005267604.1:c.1857-1239G>A, XM_005267605.1:c.1849-1239G>A, XM_005267606.1:c.*17-1239G>A, XM_005267607.1:c.1830-1239G>A, XM_005267608.1:c.1825-1239G>A, XM_005267609.1:c.1822-1239G>A, XM_005267610.1:c.*46-1239G>A, XM_005267612.1:c.*17-1239G>A, XM_005267613.1:c.1758-1239G>A, XM_005267614.1:c.1755-1239G>A, XM_005267615.1:c.1726-1239G>A, XM_005267616.1:c.*17-1239G>A, XM_005267617.1:c.1699-1239G>A, XM_005267618.1:c.*17-1239G>A, XM_005267624.1:c.1624-1239G>A, XM_005268045.1:c.722C>T, XM_005268046.1:c.722C>T, XM_005268047.1:c.722C>T, XM_011537138.1:c.722C>T, XP_005268102.1:p.Thr241Met, XP_005268103.1:p.Thr241Met, XP_005268104.1:p.Thr241Met, XP_011535440.1:p.Thr241Met, rs1734804, rs17435402, rs17850783, rs3212111, rs56934996
G > A
SNP
T241M
No VIP available CA VA
rs9332377 NC_000022.10:g.19955692C>T, NC_000022.11:g.19968169C>T, NG_011526.1:g.31430C>T, NG_023326.1:g.53618G>A, NM_000754.3:c.616-367C>T, NM_001135161.1:c.616-367C>T, NM_001135162.1:c.616-367C>T, NM_007310.2:c.466-367C>T, XM_005261229.1:c.616-367C>T, XM_005261242.1:c.2764-960G>A, XM_006724243.1:c.2782-960G>A, XM_006724246.2:c.2536-960G>A, XM_011529885.1:c.*742C>T, XM_011529886.1:c.730-367C>T, XM_011529887.1:c.*742C>T, XM_011529888.1:c.*742C>T, XM_011529889.1:c.*742C>T, XM_011529890.1:c.*742C>T, XM_011529891.1:c.*742C>T, XM_011530179.1:c.2749-960G>A, XM_011530182.1:c.1348-960G>A, rs60676269
C > T
SNP
No VIP available No Clinical Annotations available VA
rs939338 NC_000003.11:g.183704068G>A, NC_000003.12:g.183986280G>A, NM_001023587.2:c.592-902C>T, NM_001320032.1:c.-941+1490C>T, NM_005688.3:c.591+1490C>T, NR_135125.1:n.778-825C>T, XM_005247058.1:c.591+1490C>T, XM_005247058.3:c.591+1490C>T, XM_005247059.1:c.591+1490C>T, XM_005247059.3:c.591+1490C>T, XM_005247060.1:c.591+1490C>T, XM_005247061.1:c.591+1490C>T, XM_005247062.1:c.-941+1490C>T, XM_011512314.1:c.591+1490C>T, XM_011512315.1:c.591+1490C>T, XM_011512316.1:c.-941+1490C>T, rs17218204, rs3749439, rs56440939, rs59349069
G > A
SNP
No VIP available CA VA
rs9597 NC_000016.10:g.1324950C>G, NC_000016.9:g.1374951C>G, NM_003345.4:c.*157C>G, NM_194259.2:c.*157C>G, NM_194260.2:c.*157C>G, NM_194261.2:c.*157C>G, XM_005255544.1:c.*157C>G, rs74248366
C > G
SNP
No VIP available CA VA
rs9679162 NC_000002.11:g.31247514G>T, NC_000002.12:g.31024648G>T, NM_001253826.1:c.315-58346C>A, NM_001253827.1:c.70-31641C>A, NM_024572.3:c.130-31641C>A, NR_045602.1:n.903-31641C>A, XM_005264559.1:c.25-31641C>A, XM_011533104.1:c.448-31641C>A, XM_011533105.1:c.70-31641C>A, XM_011533106.1:c.43-31641C>A, rs56573917, rs57478659, rs60984987
G > T
SNP
No VIP available No Clinical Annotations available VA
rs9937 NC_000011.10:g.4138227A>G, NC_000011.9:g.4159457A>G, NG_027992.2:g.48534A>G, NM_001033.3:c.2223A>G, NM_001033.4:c.2223A>G, NM_001318064.1:c.1932A>G, NM_001318065.1:c.1209A>G, NP_001024.1:p.Thr741=, NP_001304993.1:p.Thr644=, NP_001304994.1:p.Thr403=, XM_005253058.1:c.1980A>G, XM_005253059.1:c.1932A>G, XM_011520277.1:c.1932A>G, XM_011520278.1:c.1557A>G, XM_011520279.1:c.1209A>G, XP_005253115.1:p.Thr660=, XP_005253116.1:p.Thr644=, XP_011518579.1:p.Thr644=, XP_011518580.1:p.Thr519=, XP_011518581.1:p.Thr403=, rs1042857, rs17295553, rs17349998, rs17398272, rs17850106, rs2228120, rs3177016, rs59628733
A > G
SNP
T741T
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 147

Overview

Generic Names
  • CACP
  • CPDC
  • CPDD
  • Cis-DDP
  • Cis-Diaminedichloroplatinum
  • Cis-Diamminedichloroplatinum
  • DDP
  • DDPT
  • Diamminedichloroplatinum
  • Platinum Ammine Chloride
  • Platinum Ammonium Chloride
  • Platinum Diamine Dichloride
  • Trans-DDP
  • Trans-Diaminedichloroplatinum
  • Trans-Diamminedichloroplatinum
  • Trans-Dichlorodiammine Platinum
  • Trans-Platinumdiammine Dichloride
Trade Names
  • Abiplatin
  • Biocisplatinum
  • Briplatin
  • Carboquone
  • Cis Pt II
  • Cismaplat
  • Cisplatine
  • Cisplatyl
  • Citoplationo
  • Lederplatin
  • Neoplatin
  • Plastin
  • Platamine
  • Platiblastin
  • Platidiam
  • Platinex
  • Platinol
  • Platinol-AQ
  • Platinoxan
  • Randa
Brand Mixture Names

PharmGKB Accession Id

PA449014

Type(s):

Drug

Description

Cisplatin, cisplatinum or cis-diamminedichloroplatinum(II) (CDDP) is a platinum-based chemotherapy drug used to treat various types of cancers, including sarcomas, some carcinomas (e.g. small cell lung cancer, and ovarian cancer), lymphomas and germ cell tumors. It was the first member of its class, which now also includes carboplatin and oxaliplatin.

Source: Drug Bank

Pharmacogenetics

Cisplatin is one of the most widely used platinum-based antineoplastic agents for treatment of various forms of cancer, including solid tumour and haematological malignancies, cancers of the Testicular Neoplasms, Ovarian Neoplasms, Urinary Bladder Neoplasms, Head and Neck Neoplasms, Esophageal Neoplasms, Stomach Neoplasms and Lung Neoplasms in addition to Lymphoma and Osteosarcoma. Cisplatin is an alkylating agent which destroys cancerous cells through DNA crosslinking, thereby preventing cell division and growth [Article:19525887]. The efficacy of cisplatin is often compromised because of the substantial risk for severe toxicities due to non-specific targeting and intrinsic and/or acquired resistance. Cisplatin has a narrow therapeutic index, and patients may experience toxicities affecting hearing (Ototoxicity) or affecting renal, gastrointestinal, neurological or haematological systems even when administered at standard doses [Articles:19139108, 3538860, 19243296, 19851045].

Pharmacokinetics

Cellular detoxification of cisplatin is regulated by the glutathione-S-transferase (GST) enzymes (GSTP1, GSTM1, GSTM3). Genetic changes influencing the activity of these enzymes may result in variations in cisplatin-induced toxicity or resistance. Association studies have revealed that cisplatin-induced toxicity is associated with genetic variations in GSTP1 [Articles:18855538, 18162130, 17228018, 19638079, 16317430], GSTM1 [Article:18162130], GSTM3 [Article:11081456], LRP2 (megalin) [Article:17457342], TPMT (rs12201199, [Article:19898482]), COMT (rs9332377, [Article:19898482]), TYMS [Article:16317430] and XPC [Article:19434073]. Variants associated with cisplatin-based treatment response are listed on the PGx tab attached to this page.

Transport

The influx of carboplatin into the cell can occur via SLC31A1 (CTR1) [Articles:12391279, 19509135] and SLC31A2 [Article:19509135]. The efflux of cisplatin is mediated by two copper efflux transporters ATP7A and ATP7B [Articles:17318448, 20045993, 18998134]. ATP7A and ATP7B are thought to be involved in resistance to cisplatin, either by sequestering drug away from its targets (ATP7A) or by exporting the drug from the cell (ATP7B). Drug transporters ABCC1 [Articles:17318448, 20045993, 18998134], ABCC2 [Articles:8797578, 19568750], ABCB1 [Article:20189873] and ABCG2 [Articles:20082278, 19900859, 15014021] may also play a role in cisplatin transport and response.

Pharmacodynamics

Cisplatin acts by forming platinum-DNA adducts, and this leads to cell-cycle arrest and apoptosis [Article:19525887]. Candidate genes for cisplatin pharmacodynamics include those involved in excision repair, mismatch repair and double strand break repair. Variants in ERCC1 [Articles:19638079, 19955911, 19620936, 16957145, 19620936, 20189873], ERCC2 [Articles:19434073, 19786980, 19620936], MLH1, MSH2 [Article:20458443], and XRCC1 (Arg399Gln, [Articles:18400332, 20331623]) are associated with cisplatin response. Other candidate genes include BRCA1 [Articles:19638079, 20331623, 19403936, 19249193] and TP53 [Article:19620936].

Genes involved in transport, detoxification and action of the platinum-based drugs including cisplatin are depicted in the Platinum Pathway, Pharmacokinetics/Pharmacodynamics.

An extensive list of candidate SNPs obtained by treatment of Coriell cell lines with cisplatin is available at PACdb [Article:20216476].

Source: PharmGKB [Article:20458443] [Article:20331623] [Article:20216476] [Article:20189873] [Article:19568750] [Article:19786980] [Article:19955911] [Article:19898482] [Article:19900859] [Article:19851045] [Article:19434073] [Article:19249193] [Article:19620936] [Article:19509135] [Article:19525887] [Article:18998134] [Article:19638079] [Article:19403936] [Article:19243296] [Article:19139108] [Article:20045993] [Article:20082278] [Article:18400332] [Article:18855538] [Article:17457342] [Article:17318448] [Article:17228018] [Article:18162130] [Article:16957145] [Article:16317430] [Article:15014021] [Article:12391279] [Article:11081456] [Article:8797578] [Article:3538860]

Indication

For the treatment of metastatic testicular tumors, metastatic ovarian tumors and advanced bladder cancer.

Source: Drug Bank

Other Vocabularies

Information pulled from DrugBank has not been reviewed by PharmGKB.

Pharmacology, Interactions, and Contraindications

Mechanism of Action

Alkylating agents work by three different mechanisms: 1) attachment of alkyl groups to DNA bases, resulting in the DNA being fragmented by repair enzymes in their attempts to replace the alkylated bases, preventing DNA synthesis and RNA transcription from the affected DNA, 2) DNA damage via the formation of cross-links (bonds between atoms in the DNA) which prevents DNA from being separated for synthesis or transcription, and 3) the induction of mispairing of the nucleotides leading to mutations.

Source: Drug Bank

Pharmacology

Cisplatin is an antineoplastic in the class of alkylating agents and is used to treat various forms of cancer. Alkylating agents are so named because of their ability to add alkyl groups to many electronegative groups under conditions present in cells. They stop tumor growth by cross-linking guanine bases in DNA double-helix strands - directly attacking DNA. This makes the strands unable to uncoil and separate. As this is necessary in DNA replication, the cells can no longer divide. In addition, these drugs add methyl or other alkyl groups onto molecules where they do not belong which in turn inhibits their correct utilization by base pairing and causes a miscoding of DNA. Alkylating agents are cell cycle-nonspecific. Alkylating agents work by three different mechanisms all of which achieve the same end result - disruption of DNA function and cell death.

Source: Drug Bank

Food Interaction

Echinacea should be used with caution, if at all, in patients receiving therapeutic immunosuppressants. Monitor for reduced efficacy of the immunosuppressant during concomitant use.

Source: Drug Bank

Absorption, Distribution, Metabolism, Elimination & Toxicity

Protein Binding

Greater than 90%.

Source: Drug Bank

Half-Life

20-30 minutes

Source: Drug Bank

Clearance

* 15 - 16 L/h/m2 [After infusions of 100 mg/m2.]

Source: Drug Bank

Route of Elimination

The parent compound, cisplatin, is excreted in the urine. Although small amounts of platinum are present in the bile and large intestine after administration of cisplatin, the fecal excretion of platinum appears to be insignificant.

Source: Drug Bank

Chemical Properties

Chemical Formula

Cl2H6N2Pt

Source: Drug Bank

Isomeric SMILES

[NH3][Pt]([NH3])(Cl)Cl

Source: OpenEye

Canonical SMILES

N[Pt](N)(Cl)Cl

Source: Drug Bank

Average Molecular Weight

300.051

Source: Drug Bank

Monoisotopic Molecular Weight

298.955578065

Source: Drug Bank

SMILES

N[Pt](N)(Cl)Cl

Source: Drug Bank

InChI String

InChI=1S/2ClH.2H2N.Pt/h2*1H;2*1H2;/q;;2*-1;+4/p-2

Source: Drug Bank

Genes that are associated with this drug in PharmGKB's database based on (1) variant annotations, (2) literature review, (3) pathways or (4) information automatically retrieved from DrugBank, depending on the "evidence" and "source" listed below.

Curated Information ?

Drug Interactions

Interaction Description
amikacin - cisplatin Increased risk of nephrotoxicity (source: Drug Bank )
bumetanide - cisplatin Increased ototoxicity (source: Drug Bank )
bumetanide - cisplatin Increased ototoxicity (source: Drug Bank )
ethacrynic acid - cisplatin Increased ototoxicity (source: Drug Bank )
ethacrynic acid - cisplatin Increased ototoxicity (source: Drug Bank )
fosphenytoin - cisplatin The antineoplasic agent decreases the effect of hydantoin (source: Drug Bank )
furosemide - cisplatin Increased ototoxicity (source: Drug Bank )
furosemide - cisplatin Increased ototoxicity (source: Drug Bank )
gentamicin - cisplatin Increased risk of nephrotoxicity (source: Drug Bank )
gentamicin - cisplatin Increased risk of nephrotoxicity (source: Drug Bank )
methotrexate - cisplatin Cisplatin increases methotrexate toxicity (source: Drug Bank )
methotrexate - cisplatin Cisplatin increases methotrexate toxicity (source: Drug Bank )
netilmicin - cisplatin Increased risk of nephrotoxicity (source: Drug Bank )
paclitaxel - cisplatin Cisplatin increases the effect and toxicity of paclitaxel (source: Drug Bank )
paclitaxel - cisplatin Cisplatin increases the effect and toxicity of paclitaxel (source: Drug Bank )
phenytoin - cisplatin The antineoplasic agent decreases the effect of hydantoin (source: Drug Bank )
phenytoin - cisplatin The antineoplasic agent decreases the effect of hydantoin (source: Drug Bank )
topotecan - cisplatin Administration of Topotecan after Cisplatin therapy may increase the risk of hematologic toxicity, such as neutropenia and/or thrombocytopenia. A dose adjustment may be required or the sequence of administration reversed. (source: Drug Bank )
trastuzumab - cisplatin Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )

Curated Information ?

Relationships from National Drug File - Reference Terminology (NDF-RT)

May Treat
Contraindicated With

Publications related to cisplatin: 212

No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
TPMT, COMT and ACYP2 genetic variants in paediatric cancer patients with cisplatin-induced ototoxicity. Pharmacogenetics and genomics. 2017. Thiesen Signe, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association Between SLC16A5 Genetic Variation and Cisplatin-Induced Ototoxic Effects in Adult Patients With Testicular Cancer. JAMA oncology. 2017. Drögemöller Britt I, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Clinical-pharmacogenetic models for personalized cancer treatment: application to malignant mesothelioma. Scientific reports. 2017. Goričar Katja, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic variants in TPMT alter cellular responses to cisplatin in inner ear cell lines. PloS one. 2017. Bhavsar Amit P, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic variants associated with outcome in patients with advanced gastric cancer treated with fluoropyrimidine and platinum-based triplet combinations: a pooled analysis of three prospective studies. The pharmacogenomics journal. 2016. Meulendijks D, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic predictors of toxicity to platinum based chemotherapy in non-small cell lung cancer patients. Pharmacological research. 2016. Pérez-Ramírez Cristina, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Promoter region variation in NFE2L2 influences susceptibility to ototoxicity in patients exposed to high cumulative doses of cisplatin. The pharmacogenomics journal. 2016. Spracklen T F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacokinetics and pharmacogenetics of Gemcitabine as a mainstay in adult and pediatric oncology: an EORTC-PAMM perspective. Cancer chemotherapy and pharmacology. 2016. Ciccolini Joseph, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Clinical Evaluation of Cisplatin Sensitivity of Germline Polymorphisms in Neoadjuvant Chemotherapy for Urothelial Cancer. Clinical genitourinary cancer. 2016. O'Donnell Peter H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacokinetic interaction between pazopanib and cisplatin regimen. Cancer chemotherapy and pharmacology. 2016. Imbs Diane-Charlotte, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Replication of a genetic variant in ACYP2 associated with cisplatin-induced hearing loss in patients with osteosarcoma. Pharmacogenetics and genomics. 2016. Vos Hanneke I, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GALNT14 genotype effectively predicts the therapeutic response in unresectable hepatocellular carcinoma treated with transcatheter arterial chemoembolization. Pharmacogenomics. 2016. Liang Kung-Hao, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MicroRNA-509-3p increases the sensitivity of epithelial ovarian cancer cells to cisplatin-induced apoptosis. Pharmacogenomics. 2016. Chen Wei, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Targeting therapeutic liabilities engendered by PIK3R1 mutations for cancer treatment. Pharmacogenomics. 2016. Cheung Lydia Wt, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
TP53 Codon 72 Polymorphism Predicts Efficacy of Paclitaxel Plus Capecitabine Chemotherapy in Advanced Gastric Cancer Patients. Archives of medical research. 2016. Zha Yong, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Improvement of a predictive model in ovarian cancer patients submitted to platinum-based chemotherapy: implications of a GST activity profile. European journal of clinical pharmacology. 2016. Pereira Deolinda, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Molecular determinants of chemotherapy resistance in ovarian cancer. Pharmacogenomics. 2015. Cooley Megan, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics in the treatment of lung cancer: an update. Pharmacogenomics. 2015. Morales-Espinosa Daniela, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
A First Step toward Personalized Medicine in Osteosarcoma: Pharmacogenetics as Predictive Marker of Outcome after Chemotherapy-Based Treatment. Clinical cancer research : an official journal of the American Association for Cancer Research. 2015. Hagleitner Melanie M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Carboplatin/taxane-induced gastrointestinal toxicity: a pharmacogenomics study on the SCOTROC1 trial. The pharmacogenomics journal. 2015. He Y J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Translesion polymerase genes polymorphisms and haplotypes influence survival of osteosarcoma patients. Omics : a journal of integrative biology. 2015. Goričar Katja, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Human OCT2 variant c.808G>T confers protection effect against cisplatin-induced ototoxicity. Pharmacogenomics. 2015. Lanvers-Kaminsky Claudia, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Report of New Haplotype for ABCC2 Gene: rs17222723 and rs8187718 in cis. The Journal of molecular diagnostics : JMD. 2015. Pratt Victoria M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Common variants in ACYP2 influence susceptibility to cisplatin-induced hearing loss. Nature genetics. 2015. Xu Heng, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variability of DNA repair mechanisms and glutathione-S-transferase genes influences treatment outcome in osteosarcoma. Cancer epidemiology. 2015. Goričar Katja, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Correlation of UGT1A1 and ERCC1 gene polymorphisms with the outcome of combined irinotecan plus cisplatin treatment in recurrent ovarian cancer. Genetics and molecular research : GMR. 2015. Xu Q, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CD24 and APC Genetic Polymorphisms in Pancreatic Cancers as Potential Biomarkers for Clinical Outcome. PloS one. 2015. Shamai Sivan, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Glutathione S-Transferase Gene Polymorphisms and Treatment Outcome in Cervical Cancer Patients under Concomitant Chemoradiation. PloS one. 2015. Abbas Mohammad, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of the DNA repair pathways in advanced non-small cell lung cancer patients treated with platinum-based chemotherapy. Cancer letters. 2014. Sullivan Ivana, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic markers of cisplatin-induced hearing loss in children. Clinical pharmacology and therapeutics. 2014. Carleton B C, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variation in Otos is associated with cisplatin-induced ototoxicity. Pharmacogenomics. 2014. Spracklen Timothy F, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Evaluation of pharmacogenetic markers to predict the risk of Cisplatin-induced ototoxicity. Clinical pharmacology and therapeutics. 2014. Lanvers-Kaminsky C, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic variants in the glutathione S-transferase genes and survival in colorectal cancer patients after chemotherapy and differences according to treatment with oxaliplatin. Pharmacogenetics and genomics. 2014. Kap Elisabeth J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Application of next generation sequencing to CEPH cell lines to discover variants associated with FDA approved chemotherapeutics. BMC research notes. 2014. Hariani Gunjan D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PharmGKB summary: very important pharmacogene information for N-acetyltransferase 2. Pharmacogenetics and genomics. 2014. McDonagh Ellen M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Epigenetic perspectives on cancer chemotherapy response. Pharmacogenomics. 2014. Liu Mou-Ze, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenomic assessment of cisplatin-based chemotherapy outcomes in ovarian cancer. Pharmacogenomics. 2014. Khrunin Andrey V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Challenges in interpreting the evidence for genetic predictors of ototoxicity. Clinical pharmacology and therapeutics. 2013. Ratain M J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of DNA repair gene polymorphisms in non-small-cell lung carcinoma patients on platinum-based chemotherapy. Genetics and molecular research : GMR. 2014. Zhang L, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Tumor angiogenesis genotyping and efficacy of first-line chemotherapy in metastatic gastric cancer patients. Pharmacogenomics. 2013. Scartozzi Mario, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ERCC1 Cys8092Ala and XRCC1 Arg399Gln polymorphisms predict progression-free survival after curative radiotherapy for nasopharyngeal carcinoma. PloS one. 2014. Jin Hekun, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Influence of genetic variants in TPMT and COMT associated with cisplatin induced hearing loss in patients with cancer: two new cohorts and a meta-analysis reveal significant heterogeneity between cohorts. PloS one. 2014. Hagleitner Melanie M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Replication of TPMT and ABCC3 Genetic Variants Highly Associated With Cisplatin-Induced Hearing Loss in Children. Clinical pharmacology and therapeutics. 2013. Pussegoda K, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The Role of Inherited TPMT and COMT Genetic Variation in Cisplatin-Induced Ototoxicity in Children With Cancer. Clinical pharmacology and therapeutics. 2013. Yang J J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ERCC1 C8092A (rs3212986) polymorphism as a predictive marker in esophageal cancer patients treated with cisplatin/5-FU-based neoadjuvant therapy. Pharmacogenetics and genomics. 2013. Rumiato Enrica, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Understanding platinum-induced ototoxicity. Trends in pharmacological sciences. 2013. Langer Thorsten, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of ABCB1 genetic polymorphisms with susceptibility to colorectal cancer and therapeutic prognosis. Pharmacogenomics. 2013. Wu Huizhe, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
A phase I/II pharmacokinetic and pharmacogenomic study of calcitriol in combination with cisplatin and docetaxel in advanced non-small-cell lung cancer. Cancer chemotherapy and pharmacology. 2013. Ramnath N, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Cisplatin-induced ototoxicity in pediatric solid tumors: the role of glutathione S-transferases and megalin genetic polymorphisms. Journal of pediatric hematology/oncology. 2013. Choeyprasert Worawut, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Glutathione S-transferase P1 single nucleotide polymorphism predicts permanent ototoxicity in children with medulloblastoma. Pediatric blood & cancer. 2013. Rednam Surya, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DNA repair and cytotoxic drugs: the potential role of RAD51 in clinical outcome of non-small-cell lung cancer patients. Pharmacogenomics. 2013. Nogueira Augusto, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A genome-wide association study of survival in small-cell lung cancer patients treated with irinotecan plus cisplatin chemotherapy. The pharmacogenomics journal. 2013. Han J-Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Association between eIF3alpha polymorphism and severe toxicity caused by platinum-based chemotherapy in non-small cell lung cancer patients. British journal of clinical pharmacology. 2013. Xu Xiaojing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Excision repair cross-complementing gene-1, ribonucleotide reductase subunit M1, ribonucleotide reductase subunit M2, and human equilibrative nucleoside transporter-1 expression and prognostic value in biliary tract malignancy. Cancer. 2013. Fisher Sarah B, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The A/G allele of eIF3a rs3740556 predicts platinum-based chemotherapy resistance in lung cancer patients. Lung cancer (Amsterdam, Netherlands). 2013. Xu Xiaojing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The TRPM6/EGF Pathway Is Downregulated in a Rat Model of Cisplatin Nephrotoxicity. PloS one. 2013. Ledeganck Kristien J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Epigenomics and Interindividual Differences in Drug Response. Clinical pharmacology and therapeutics. 2012. Ivanov M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
PharmGKB summary: very important pharmacogene information for GSTT1. Pharmacogenetics and genomics. 2012. Thorn Caroline F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
siRNA-mediated knock-down of NOX3: therapy for hearing loss?. Cellular and molecular life sciences : CMLS. 2012. Rybak Leonard P, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic polymorphism of copper transporter protein 1 is related to platinum resistance in Chinese non-small cell lung carcinoma patients. Clinical and experimental pharmacology & physiology. 2012. Xu Xiaojing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Associations Between ABCC2 Polymorphisms and Cisplatin Disposition and Efficacy. Clinical pharmacology and therapeutics. 2012. Sprowl J A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
First-SIGNAL: first-line single-agent iressa versus gemcitabine and cisplatin trial in never-smokers with adenocarcinoma of the lung. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2012. Han Ji-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Prediction of copper transport protein 1 (CTR1) genotype on severe cisplatin induced toxicity in non-small cell lung cancer (NSCLC) patients. Lung cancer (Amsterdam, Netherlands). 2012. Xu Xiaojing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gene therapy for cisplatin-induced ototoxicity: a systematic review of in vitro and experimental animal studies. Otology & neurotology : official publication of the American Otological Society, American Neurotology Society [and] European Academy of Otology and Neurotology. 2012. Waissbluth Sofia, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association between polymorphisms of ERCC1 and survival in epithelial ovarian cancer patients with chemotherapy. Pharmacogenomics. 2012. Yan Li, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Proximal Tubular Secretion of Creatinine by Organic Cation Transporter OCT2 in Cancer Patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2012. Ciarimboli Giuliano, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genomic approach towards personalized anticancer drug therapy. Pharmacogenomics. 2012. Midorikawa Yutaka, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenomics of cisplatin-based chemotherapy in ovarian cancer patients of different ethnic origins. Pharmacogenomics. 2012. Khrunin Andrey, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Arylamine N-acetyltransferase 1: a novel drug target in cancer development. Pharmacological reviews. 2012. Butcher Neville J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variants in the PI3K/PTEN/AKT/mTOR pathway predict platinum-based chemotherapy response of advanced non-small cell lung cancers in a Chinese population. Asian Pacific journal of cancer prevention : APJCP. 2012. Xu Jia-Li, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ERCC1 as a biomarker for bladder cancer patients likely to benefit from adjuvant chemotherapy. BMC cancer. 2012. Sun Jong-Mu, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association between DNA-repair polymorphisms and survival in pancreatic cancer patients treated with combination chemotherapy. Pharmacogenomics. 2011. Giovannetti Elisa, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Meta-analysis on pharmacogenetics of platinum-based chemotherapy in non small cell lung cancer (NSCLC) patients. PloS one. 2012. Yin Ji-Ye, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic analyses of cisplatin-induced nephrotoxicity indicate a renoprotective effect of ERCC1 polymorphisms. Pharmacogenomics. 2011. Tzvetkov Mladen V, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Differential effect of polymorphisms of CMPK1 and RRM1 on survival in advanced non-small cell lung cancer patients treated with gemcitabine or taxane/cisplatinum. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2011. Ryu Jeong-Seon, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Genome-wide meta-analysis identifies variants associated with platinating agent susceptibility across populations. The pharmacogenomics journal. 2011. Wheeler H E, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Nucleotide excision repair gene variants and association with survival in osteosarcoma patients treated with neoadjuvant chemotherapy. The pharmacogenomics journal. 2011. Biason P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic effects and modifiers of radiotherapy and chemotherapy on survival in pancreatic cancer. Pancreas. 2011. Zeng Hongmei, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
GALNT14 SNP as a potential predictor of response to combination chemotherapy using 5-FU, mitoxantrone and cisplatin in advanced HCC. Pharmacogenomics. 2011. Liang Kung-Hao, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics of cisplatin-induced ototoxicity. Pharmacogenomics. 2011. Mukherjea Debashree, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Transporter-mediated drug-drug interactions. Pharmacogenomics. 2011. Müller Fabian, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variations in multiple drug action pathways and survival in advanced stage non-small cell lung cancer treated with chemotherapy. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Li Yafei, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The NQO1*2/*2 polymorphism is associated with poor overall survival in patients following resection of stages II and IIIa non-small cell lung cancer. Oncology reports. 2011. Kolesar Jill M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Influence of polymorphisms in MTHFR 677 C¿T, TYMS 3R¿2R and MTR 2756 A¿G on NSCLC risk and response to platinum-based chemotherapy in advanced NSCLC. Pharmacogenomics. 2011. Cui Lian-Hua, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Estrogen receptor alpha single nucleotide polymorphism modifies the risk of azoospermia in childhood cancer survivors. Pharmacogenetics and genomics. 2011. Romerius Patrik, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Transporter-Mediated Drug Uptake and Efflux: Important Determinants of Adverse Drug Reactions. Clinical pharmacology and therapeutics. 2011. Zolk O, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Economic impact of a genetic test for cisplatin-induced ototoxicity. The pharmacogenomics journal. 2011. Dionne F, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Phase II trial of pemetrexed and bevacizumab in patients with recurrent or metastatic head and neck cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2011. Argiris Athanassios, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Very important pharmacogene summary: ABCB1 (MDR1, P-glycoprotein). Pharmacogenetics and genomics. 2011. Hodges Laura M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Use of a comprehensive panel of biomarkers to predict response to a fluorouracil-oxaliplatin regimen in patients with metastatic colorectal cancer. Pharmacogenomics. 2011. Lamas Maria J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Impact of ABCB1 C3435T polymorphism on lymph node regression in multimodality treatment of locally advanced esophageal cancer. Pharmacogenomics. 2011. Narumiya Kosuke, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
THYMIDYLATE SYNTHASE AND EXCISION REPAIR-CROSS-COMPLEMENTING GROUP-1 AS PREDICTORS OF RESPONSIVENESS IN MESOTHELIOMA PATIENTS TREATED WITH PEMETREXED-CARBOPLATIN. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Zucali Paolo Andrea, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
PI3K/PTEN/AKT/mTOR pathway genetic variation predicts toxicity and distant progression in lung cancer patients receiving platinum-based chemotherapy. Lung cancer (Amsterdam, Netherlands). 2011. Pu Xia, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Multiple genetic polymorphisms in the prediction of clinical outcome of metastatic colorectal cancer patients treated with first-line FOLFOX-4 chemotherapy. Pharmacogenetics and genomics. 2011. Huang Ming-Yii, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genome-wide interrogation identifies YAP1 variants associated with survival of small-cell lung cancer patients. Cancer research. 2010. Wu Chen, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Effect of ABCB1 and ABCC3 polymorphisms on osteosarcoma survival after chemotherapy: a pharmacogenetic study. PloS one. 2011. Caronia Daniela, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Three-gene predictor of clinical outcome for gastric cancer patients treated with chemotherapy. The pharmacogenomics journal. 2010. Kim H K, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Distribution of TYMS, MTHFR, p53 and MDR1 gene polymorphisms in patients with breast cancer treated with neoadjuvant chemotherapy. Cancer epidemiology. 2010. Henríquez-Hernández Luis Alberto, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Nucleotide excision repair gene polymorphisms may predict acute toxicity in patients treated with chemoradiotherapy for bladder cancer. Pharmacogenomics. 2010. Sakano Shigeru, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A phase I/II and pharmacogenomic study of pemetrexed and cisplatin in patients with unresectable, advanced gastric carcinoma. Anti-cancer drugs. 2010. Chen Jen-Shi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Host genetic variants in the IGF binding protein-3 impact on survival of patients with advanced gastric cancer treated with palliative chemotherapy. Pharmacogenomics. 2010. Graziano Francesco, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Glutathione S-transferase polymorphisms in osteosarcoma patients. Pharmacogenetics and genomics. 2010. Salinas-Souza Carolina, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic predictors of adverse events and response to chemotherapy in metastatic colorectal cancer: results from North American Gastrointestinal Intergroup Trial N9741. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2010. McLeod Howard L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of the copper transporter, CTR1, in platinum-induced ototoxicity. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2010. More Swati S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Blood-based CHRNA3 single nucleotide polymorphism and outcome in advanced non-small-cell lung cancer patients. Lung cancer (Amsterdam, Netherlands). 2010. Carcereny Enric, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Expression of gemcitabine- and cisplatin-related genes in non-small-cell lung cancer. The pharmacogenomics journal. 2010. Toffalorio F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Population differences in platinum toxicity as a means to identify novel genetic susceptibility variants. Pharmacogenetics and genomics. 2010. O'Donnell Peter H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Chemotherapeutic drug susceptibility associated SNPs are enriched in expression quantitative trait loci. Proceedings of the National Academy of Sciences of the United States of America. 2010. Gamazon Eric R, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PACdb: a database for cell-based pharmacogenomics. Pharmacogenetics and genomics. 2010. Gamazon Eric R, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics of membrane transporters: past, present and future. Pharmacogenomics. 2010. Yee Sook Wah, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of SUMO1 and UBC9 genotypes with tumor response in non-small-cell lung cancer treated with irinotecan-based chemotherapy. The pharmacogenomics journal. 2010. Han Ji-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Glutathione pathway genetic polymorphisms and lung cancer survival after platinum-based chemotherapy. Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology. 2010. Moyer Ann M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Association of MDR1 and ERCC1 polymorphisms with response and toxicity to cisplatin-based chemotherapy in non-small-cell lung cancer patients. International journal of hygiene and environmental health. 2010. Chen Songjian, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BRCA1 185delAG mutant protein, BRAt, up-regulates maspin in ovarian epithelial cells. Gynecologic oncology. 2010. O'Donnell Joshua D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABC transporters in cancer: more than just drug efflux pumps. Nature reviews. Cancer. 2010. Fletcher Jamie I, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gefitinib versus cisplatin plus docetaxel in patients with non-small-cell lung cancer harbouring mutations of the epidermal growth factor receptor (WJTOG3405): an open label, randomised phase 3 trial. The lancet oncology. 2010. Mitsudomi Tetsuya, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic polymorphisms and the efficacy and toxicity of cisplatin-based chemotherapy in ovarian cancer patients. The pharmacogenomics journal. 2010. Khrunin A V, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Methylenetetrahydrofolate reductase (MTHFR) gene polymorphisms and FOLFOX response in colorectal cancer patients. British journal of clinical pharmacology. 2010. Etienne-Grimaldi Marie-Christine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Effects of excision repair cross-complementation group 1 (ERCC1) single nucleotide polymorphisms on the prognosis of non-small cell lung cancer patients. Lung cancer (Amsterdam, Netherlands). 2010. Takenaka Tomoyoshi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TaqMan low-density arrays and analysis by artificial neuronal networks predict response to neoadjuvant chemoradiation in esophageal cancer. Pharmacogenomics. 2010. Warnecke-Eberz Ute, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics of taxane/platinum therapy in ovarian cancer. International journal of gynecological cancer : official journal of the International Gynecological Cancer Society. 2009. Marsh Sharon. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variants in TPMT and COMT are associated with hearing loss in children receiving cisplatin chemotherapy. Nature genetics. 2009. Ross Colin J D, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Contribution of organic cation transporter 2 (OCT2) to cisplatin-induced nephrotoxicity. Clinical pharmacology and therapeutics. 2009. Filipski K K, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Common variations in ERCC2 are associated with response to cisplatin chemotherapy and clinical outcome in osteosarcoma patients. The pharmacogenomics journal. 2009. Caronia D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The increasing role of pharmacogenetics in the treatment of gastrointestinal cancers. Gastrointestinal cancer research : GCR. 2009. Yalçin Suayib. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Cisplatin pharmacogenetics, DNA repair polymorphisms, and esophageal cancer outcomes. Pharmacogenetics and genomics. 2009. Bradbury Penelope A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Influx and efflux transport as determinants of melphalan cytotoxicity: Resistance to melphalan in MDR1 overexpressing tumor cell lines. Biochemical pharmacology. 2009. Kühne Annett, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
TP53 codon 72 polymorphism associated with prognosis in patients with advanced gastric cancer treated with paclitaxel and cisplatin. Cancer chemotherapy and pharmacology. 2009. Kim Jong Gwang, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Histone deacetylase inhibitors induce a very broad, pleiotropic anticancer drug resistance phenotype in acute myeloid leukemia cells by modulation of multiple ABC transporter genes. Clinical cancer research : an official journal of the American Association for Cancer Research. 2009. Hauswald Stefanie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic analyses of a phase III trial in metastatic gastroesophageal adenocarcinoma with fluorouracil and leucovorin plus either oxaliplatin or cisplatin: a study of the arbeitsgemeinschaft internistische onkologie. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2009. Goekkurt Eray, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
GNAS1 T393C polymorphism is associated with histopathological response to neoadjuvant radiochemotherapy in esophageal cancer. The pharmacogenomics journal. 2009. Alakus H, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms affecting clinical outcomes in epithelial ovarian cancer patients treated with taxanes and platinum compounds: a Korean population-based study. Gynecologic oncology. 2009. Kim Hee Seung, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Phase III trial of irinotecan/cisplatin compared with etoposide/cisplatin in extensive-stage small-cell lung cancer: clinical and pharmacogenomic results from SWOG S0124. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2009. Lara Primo N, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Methotrexate in pediatric osteosarcoma: response and toxicity in relation to genetic polymorphisms and dihydrofolate reductase and reduced folate carrier 1 expression. The Journal of pediatrics. 2009. Patiño-García Ana, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Genetic determinants of response to clopidogrel and cardiovascular events. The New England journal of medicine. 2009. Simon Tabassome, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Randomized phase II and pharmacogenetic study of pemetrexed compared with pemetrexed plus carboplatin in pretreated patients with advanced non-small-cell lung cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2009. Smit Egbert F, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
DNA repair gene polymorphisms predict favorable clinical outcome in advanced non-small-cell lung cancer. Clinical lung cancer. 2009. Kalikaki Aristea, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Cost-effectiveness of 99mTc-sestamibi in predicting response to chemotherapy in patients with lung cancer: systematic review and meta-analysis. Journal of nuclear medicine : official publication, Society of Nuclear Medicine. 2009. Mohan Hosahalli K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Induction of multiple drug transporters by efavirenz. Journal of pharmacological sciences. 2009. Weiss Johanna, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Redox regulation of multidrug resistance in cancer chemotherapy: molecular mechanisms and therapeutic opportunities. Antioxidants & redox signaling. 2009. Kuo Macus Tien. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Platinum neurotoxicity pharmacogenetics. Molecular cancer therapeutics. 2009. McWhinney Sarah R, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Resistance gene expression determines the in vitro chemosensitivity of non-small cell lung cancer (NSCLC). BMC cancer. 2009. Glaysher Sharon, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms of copper- and platinum drug-efflux transporters ATP7A and ATP7B in Japanese cancer patients. Drug metabolism and pharmacokinetics. 2009. Fukushima-Uesaka Hiromi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Several major antiepileptic drugs are substrates for human P-glycoprotein. Neuropharmacology. 2008. Luna-Tortós Carlos, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Clinical significance of UDP-glucuronosyltransferase 1A1*6 for toxicities of combination chemotherapy with irinotecan and cisplatin in gynecologic cancers: a prospective multi-institutional study. Oncology. 2009. Takano Masashi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
High orotate phosphoribosyltransferase gene expression predicts complete response to chemoradiotherapy in patients with squamous cell carcinoma of the esophagus. Oncology. 2009. Kajiwara Takeshi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Expression of MRP1, BCRP, LRP and ERCC1 as prognostic factors in non-small cell lung cancer patients receiving postoperative cisplatin-based chemotherapy. The International journal of biological markers. 2009. Li Xiao-Qin, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Cisplatin plus weekly CPT-11/docetaxel in advanced esophagogastric cancer: a phase I study with pharmacogenetic assessment of XPD, XRCC3 and UGT1A1 polymorphisms. Cancer chemotherapy and pharmacology. 2008. Font Albert, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Prognostic role of p53 codon 72 polymorphism in gastric cancer patients treated with fluorouracil-based adjuvant chemotherapy. Journal of cancer research and clinical oncology. 2008. Huang Zhao-Hui, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of glutathione S-transferase P1-1 in the cellular detoxification of cisplatin. Molecular cancer therapeutics. 2008. Peklak-Scott Christina, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Integrated pathway analysis of rat urine metabolic profiles and kidney transcriptomic profiles to elucidate the systems toxicology of model nephrotoxicants. Chemical research in toxicology. 2008. Xu Ethan Yixun, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Structure, function and regulation of P-glycoprotein and its clinical relevance in drug disposition. Xenobiotica; the fate of foreign compounds in biological systems. 2008. Zhou S-F. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Identification of the xenobiotic-metabolizing enzyme arylamine N-acetyltransferase 1 as a new target of cisplatin in breast cancer cells: molecular and cellular mechanisms of inhibition. Molecular pharmacology. 2008. Ragunathan Nilusha, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Tumor suppressor FUS1 signaling pathway. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2008. Ji Lin, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Correlation of CDA, ERCC1, and XPD polymorphisms with response and survival in gemcitabine/cisplatin-treated advanced non-small cell lung cancer patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2008. Tibaldi Carmelo, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Secondary mutations as a mechanism of cisplatin resistance in BRCA2-mutated cancers. Nature. 2008. Sakai Wataru, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Megalin genetic polymorphisms and individual sensitivity to the ototoxic effect of cisplatin. The pharmacogenomics journal. 2008. Riedemann L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Enhancement of antitumor activity of cisplatin in human lung cancer cells by tumor suppressor FUS1. Cancer gene therapy. 2008. Deng W-G, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Polymorphisms in the drug transporter gene ABCB1 predict antidepressant treatment response in depression. Neuron. 2008. Uhr Manfred, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Citalopram enantiomers in plasma and cerebrospinal fluid of ABCB1 genotyped depressive patients and clinical response: a pilot study. Pharmacological research : the official journal of the Italian Pharmacological Society. 2008. Nikisch Georg, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cisplatin and fluorouracil alone or with docetaxel in head and neck cancer. The New England journal of medicine. 2007. Posner Marshall R, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cisplatin, fluorouracil, and docetaxel in unresectable head and neck cancer. The New England journal of medicine. 2007. Vermorken Jan B, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Identification of genetic variants contributing to cisplatin-induced cytotoxicity by use of a genomewide approach. American journal of human genetics. 2007. Huang R Stephanie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gene expression response to cisplatin treatment in drug-sensitive and drug-resistant ovarian cancer cells. Oncogene. 2007. Li J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Tariquidar (XR9576): a P-glycoprotein drug efflux pump inhibitor. Expert review of anticancer therapy. 2007. Fox Elizabeth, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Cisplatin-induced long-term hearing impairment is associated with specific glutathione s-transferase genotypes in testicular cancer survivors. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2007. Oldenburg Jan, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A naturally occurring genetic variant of human XRCC2 (R188H) confers increased resistance to cisplatin-induced DNA damage. Biochemical and biophysical research communications. 2007. Danoy Patrick, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Effect of population and gender on chemotherapeutic agent-induced cytotoxicity. Molecular cancer therapeutics. 2007. Huang Rong Stephanie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Cobalamin potentiates vinblastine cytotoxicity through downregulation of mdr-1 gene expression in HepG2 cells. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology. 2007. Marguerite Véronique, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
XRCC1 R399Q polymorphism is associated with response to platinum-based neoadjuvant chemotherapy in bulky cervical cancer. Gynecologic oncology. 2006. Chung Hyun Hoon, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Mechanism of inhibition of P-glycoprotein mediated efflux by vitamin E TPGS: influence on ATPase activity and membrane fluidity. Molecular pharmaceutics. 2007. Collnot Eva-Maria, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinical relevance of different dihydropyrimidine dehydrogenase gene single nucleotide polymorphisms on 5-fluorouracil tolerance. Molecular cancer therapeutics. 2006. Morel Alain, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Organic cation transporters are determinants of oxaliplatin cytotoxicity. Cancer research. 2006. Zhang Shuzhong, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Glutathione-S-transferase P1 isoenzyme polymorphisms, platinum-based chemotherapy, and non-small cell lung cancer. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2006. Booton Richard, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DNA repair by ERCC1 in non-small-cell lung cancer and cisplatin-based adjuvant chemotherapy. The New England journal of medicine. 2006. Olaussen Ken A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cancer and leukemia group B gastrointestinal cancer committee. Clinical cancer research : an official journal of the American Association for Cancer Research. 2006. Goldberg Richard M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Gefitinib modulates the function of multiple ATP-binding cassette transporters in vivo. Cancer research. 2006. Leggas Markos, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Impact of P-glycoprotein on clopidogrel absorption. Clinical pharmacology and therapeutics. 2006. Taubert Dirk, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Comprehensive analysis of UGT1A polymorphisms predictive for pharmacokinetics and treatment outcome in patients with non-small-cell lung cancer treated with irinotecan and cisplatin. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2006. Han Ji-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cisplatin-induced hepatotoxicity is enhanced by elevated expression of cytochrome P450 2E1. Toxicological sciences : an official journal of the Society of Toxicology. 2006. Lu Yongke, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of GADD34 in modulation of cisplatin cytotoxicity. Biochemical pharmacology. 2006. Fishel Melissa L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Polymorphisms of glutathione S-transferases (GST) and thymidylate synthase (TS)--novel predictors for response and survival in gastric cancer patients. British journal of cancer. 2006. Goekkurt E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Single nucleotide polymorphisms in human P-glycoprotein: its impact on drug delivery and disposition. Expert opinion on drug delivery. 2006. Dey Surajit. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Hearing genes and cisplatin deafness: a pilot study. The Laryngoscope. 2006. Knoll Christine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of long-term responses to antiretroviral regimens containing Efavirenz and/or Nelfinavir: an Adult Aids Clinical Trials Group Study. The Journal of infectious diseases. 2005. Haas David W, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacogenetics of extraordinary responses to 5-FU/cisplatin chemotherapy in advanced gastric cancer -- report of 2 cases. Onkologie. 2005. Wolschke Christine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
The pregnane X receptor regulates gene expression in a ligand- and promoter-selective fashion. Molecular endocrinology (Baltimore, Md.). 2005. Masuyama Hisashi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Severe drug toxicity associated with a single-nucleotide polymorphism of the cytidine deaminase gene in a Japanese cancer patient treated with gemcitabine plus cisplatin. Clinical cancer research : an official journal of the American Association for Cancer Research. 2005. Yonemori Kan, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
The relationship of the human glutathione S-transferase P1 polymorphism and chemotherapeutic sensitivity in head and neck squamous carcinoma. International journal of molecular medicine. 2004. Kimura Shinobu, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A multivariate analysis of genomic polymorphisms: prediction of clinical outcome to 5-FU/oxaliplatin combination chemotherapy in refractory colorectal cancer. British journal of cancer. 2004. Stoehlmacher J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Increased expression of the copper efflux transporter ATP7A mediates resistance to cisplatin, carboplatin, and oxaliplatin in ovarian cancer cells. Clinical cancer research : an official journal of the American Association for Cancer Research. 2004. Samimi Goli, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
XPD and XRCC1 genetic polymorphisms are prognostic factors in advanced non-small-cell lung cancer patients treated with platinum chemotherapy. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2004. Gurubhagavatula Sarada, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Heritability and linkage analysis of sensitivity to cisplatin-induced cytotoxicity. Cancer research. 2004. Dolan M Eileen, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Influence of lipid lowering fibrates on P-glycoprotein activity in vitro. Biochemical pharmacology. 2004. Ehrhardt Manuela, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Interactions of human P-glycoprotein with simvastatin, simvastatin acid, and atorvastatin. Pharmaceutical research. 2004. Hochman Jerome H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Breast cancer resistance protein impacts clinical outcome in platinum-based chemotherapy for advanced non-small cell lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2004. Yoh Kiyotaka, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Ribonucleotide reductase messenger RNA expression and survival in gemcitabine/cisplatin-treated advanced non-small cell lung cancer patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2004. Rosell Rafael, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Polymorphisms in human MDR1 (P-glycoprotein): recent advances and clinical relevance. Clinical pharmacology and therapeutics. 2004. Marzolini Catia, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Genetic polymorphisms of the human MDR1 drug transporter. Annual review of pharmacology and toxicology. 2003. Schwab Matthias, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Evaluation of NQO1 gene expression and variant allele in human NSCLC tumors and matched normal lung tissue. International journal of oncology. 2002. Kolesar Jill M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Efficacy of a glutathione S-transferase pi-activated prodrug in platinum-resistant ovarian cancer cells. Molecular cancer therapeutics. 2002. Townsend Danyelle M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Interaction of omeprazole, lansoprazole and pantoprazole with P-glycoprotein. Naunyn-Schmiedeberg's archives of pharmacology. 2001. Pauli-Magnus C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A family of drug transporters: the multidrug resistance-associated proteins. Journal of the National Cancer Institute. 2000. Borst P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
The role of intestinal P-glycoprotein in the interaction of digoxin and rifampin. The Journal of clinical investigation. 1999. Greiner B, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Anti-psychotic drugs reverse multidrug resistance of tumor cell lines and human AML cells ex-vivo. Cancer letters. 1999. Szabó D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Biochemical, cellular, and pharmacological aspects of the multidrug transporter. Annual review of pharmacology and toxicology. 1999. Ambudkar S V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Increased systemic toxicity of sarcoma chemotherapy due to combination with the P-glycoprotein inhibitor cyclosporin. International journal of clinical pharmacology and therapeutics. 1998. Theis J G, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Competitive, non-competitive and cooperative interactions between substrates of P-glycoprotein as measured by its ATPase activity. Biochimica et biophysica acta. 1997. Litman T, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
MDR1 P-glycoprotein is a lipid translocase of broad specificity, while MDR3 P-glycoprotein specifically translocates phosphatidylcholine. Cell. 1996. van Helvoort A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Preclinical evaluation of CPT-11 and its active metabolite SN-38. Seminars in oncology. 1996. Lavelle F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Synergistic reversal of multidrug-resistance phenotype in acute myeloid leukemia cells by cyclosporin A and cremophor EL. Blood. 1994. Ross D D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
P-glycoprotein structure and evolutionary homologies. Cytotechnology. 1993. Croop J M. PubMed

LinkOuts

Web Resource:
Wikipedia
National Drug Code Directory:
0015-3072-20
DrugBank:
DB00515
ChEBI:
27899
KEGG Compound:
C06911
KEGG Drug:
D00275
PubChem Compound:
441203
PubChem Substance:
46504561
7847341
Drugs Product Database (DPD):
2126613
ChemSpider:
389985
Therapeutic Targets Database:
DAP000215

Clinical Trials

These are trials that mention cisplatin and are related to either pharmacogenetics or pharmacogenomics.

No trials loaded.

NURSA Datasets

provided by nursa.org

No NURSA datasets available.

Common Searches

Search PubMed
Search Medline Plus
Search PubChem
Search CTD

Sources for PharmGKB drug information: DrugBank, PubChem.