Chemical: Drug
cisplatin

PharmGKB contains no dosing guidelines for this . To report known genotype-based dosing guidelines, or if you are interested in developing guidelines, click here.


last updated 08/26/2016

1. FDA Label for cisplatin and TPMT

Informative PGx

Summary

The FDA-approved drug label for cisplatin was changed (in 2015) to reflect the level of uncertainty about the relationship between TPMT and cisplatin-induced ototoxicity. The Pharmacogenomics section was removed, and text was modified in the Warnings, Precautions and Adverse Reactions sections.

Annotation

Excerpt from the cisplatin drug label:

Genetic factors (e.g. variants in the thiopurine S-methyltransferase TPMT gene) may contribute to cisplatin-induced ototoxicity; although this association has not been consistent across populations and study designs.

For the complete drug label text with sections containing pharmacogenetic information highlighted, see the cisplatin drug label.

*Disclaimer: The contents of this page have not been endorsed by the FDA and are the sole responsibility of PharmGKB.

Full label available at DailyMed

Genes and/or phenotypes found in this label

  • Anemia
    • Adverse reactions section
    • source: PHONT
  • Carcinoma, Non-Small-Cell Lung
    • Indications & usage section, Precautions section
    • source: PHONT
  • Carcinoma, Small Cell
    • Indications & usage section, Precautions section
    • source: PHONT
  • Neoplasms
    • Indications & usage section, Warnings section, Adverse reactions section, Precautions section
    • source: PHONT
  • Neutropenia
    • Adverse reactions section, Precautions section
    • source: PHONT
  • Ototoxicity
    • Boxed warning section, Warnings section, Adverse reactions section, Clinical pharmacology section, Precautions section
    • source: U.S. Food and Drug Administration
  • Ovarian Neoplasms
    • Precautions section
    • source: PHONT
  • Peripheral Nervous System Diseases
    • Warnings section, Adverse reactions section, Precautions section
    • source: PHONT
  • Thrombocytopenia
    • Adverse reactions section, Precautions section
    • source: PHONT
  • TPMT
    • toxicity, Adverse reactions section
    • source: PharmGKB

Clinical Variants that meet the highest level of criteria, manually curated by PharmGKB, are shown below.

To see more Clinical Variants with lower levels of criteria, click the button at the bottom of the page.

Disclaimer: The PharmGKB's clinical annotations reflect expert consensus based on clinical evidence and peer-reviewed literature available at the time they are written and are intended only to assist clinicians in decision-making and to identify questions for further research. New evidence may have emerged since the time an annotation was submitted to the PharmGKB. The annotations are limited in scope and are not applicable to interventions or diseases that are not specifically identified.

The annotations do not account for individual variations among patients, and cannot be considered inclusive of all proper methods of care or exclusive of other treatments. It remains the responsibility of the health-care provider to determine the best course of treatment for a patient. Adherence to any guideline is voluntary, with the ultimate determination regarding its application to be made solely by the clinician and the patient. PharmGKB assumes no responsibility for any injury or damage to persons or property arising out of or related to any use of the PharmGKB clinical annotations, or for any errors or omissions.

? = Mouse-over for quick help

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Links in the "Gene" column lead to PharmGKB Gene Pages.

List of all variant annotations for cisplatin

Gene ? Variant?
(147)
Alternate Names ? Chemicals ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
Translation
No VIP available CA VA GSTM1 non-null N/A N/A N/A
No VIP available CA VA GSTM1 null N/A N/A N/A
No VIP available CA VA GSTT1 non-null N/A N/A N/A
No VIP available CA VA GSTT1 null N/A N/A N/A
No VIP available No VIP available VA UGT1A1 *1 N/A N/A N/A
No VIP available No VIP available VA UGT1A1 *28 N/A N/A N/A
No VIP available No Clinical Annotations available VA
rs10209881 NC_000002.11:g.31246249T>C, NC_000002.12:g.31023383T>C, NM_001253826.1:c.315-57081A>G, NM_001253827.1:c.70-30376A>G, NM_024572.3:c.130-30376A>G, NR_045602.1:n.903-30376A>G, XM_005264559.1:c.25-30376A>G, XM_011533104.1:c.448-30376A>G, XM_011533105.1:c.70-30376A>G, XM_011533106.1:c.43-30376A>G, rs56517291, rs57849618, rs59539437
T > C
SNP
No VIP available CA VA
rs10276036 NC_000007.13:g.87180198C>T, NC_000007.14:g.87550882C>T, NG_011513.1:g.167367G>A, NM_000927.4:c.1000-44G>A, rs10488634, rs111193439, rs17276942, rs57688958, rs58206924
C > A
C > T
SNP
No VIP available CA VA
rs1042522 NC_000017.10:g.7579472G=, NC_000017.10:g.7579472G>C, NC_000017.10:g.7579472G>T, NC_000017.11:g.7676154G=, NC_000017.11:g.7676154G>C, NC_000017.11:g.7676154G>T, NG_017013.2:g.16397C=, NG_017013.2:g.16397C>A, NG_017013.2:g.16397C>G, NM_000546.5:c.215C=, NM_000546.5:c.215C>A, NM_000546.5:c.215C>G, NM_001126112.2:c.215C=, NM_001126112.2:c.215C>A, NM_001126112.2:c.215C>G, NM_001126113.2:c.215C=, NM_001126113.2:c.215C>A, NM_001126113.2:c.215C>G, NM_001126114.2:c.215C=, NM_001126114.2:c.215C>A, NM_001126114.2:c.215C>G, NM_001126115.1:c.-939C=, NM_001126115.1:c.-939C>A, NM_001126115.1:c.-939C>G, NM_001126116.1:c.-939C=, NM_001126116.1:c.-939C>A, NM_001126116.1:c.-939C>G, NM_001126117.1:c.-939C=, NM_001126117.1:c.-939C>A, NM_001126117.1:c.-939C>G, NM_001126118.1:c.98C=, NM_001126118.1:c.98C>A, NM_001126118.1:c.98C>G, NM_001276695.1:c.98C=, NM_001276695.1:c.98C>A, NM_001276695.1:c.98C>G, NM_001276696.1:c.98C=, NM_001276696.1:c.98C>A, NM_001276696.1:c.98C>G, NM_001276697.1:c.-1020C=, NM_001276697.1:c.-1020C>A, NM_001276697.1:c.-1020C>G, NM_001276698.1:c.-1020C=, NM_001276698.1:c.-1020C>A, NM_001276698.1:c.-1020C>G, NM_001276699.1:c.-1020C=, NM_001276699.1:c.-1020C>A, NM_001276699.1:c.-1020C>G, NM_001276760.1:c.98C=, NM_001276760.1:c.98C>A, NM_001276760.1:c.98C>G, NM_001276761.1:c.98C=, NM_001276761.1:c.98C>A, NM_001276761.1:c.98C>G, NP_000537.3:p.Pro72=, NP_000537.3:p.Pro72Arg, NP_000537.3:p.Pro72His, NP_001119584.1:p.Pro72=, NP_001119584.1:p.Pro72Arg, NP_001119584.1:p.Pro72His, NP_001119585.1:p.Pro72=, NP_001119585.1:p.Pro72Arg, NP_001119585.1:p.Pro72His, NP_001119586.1:p.Pro72=, NP_001119586.1:p.Pro72Arg, NP_001119586.1:p.Pro72His, NP_001119590.1:p.Pro33=, NP_001119590.1:p.Pro33Arg, NP_001119590.1:p.Pro33His, NP_001263624.1:p.Pro33=, NP_001263624.1:p.Pro33Arg, NP_001263624.1:p.Pro33His, NP_001263625.1:p.Pro33=, NP_001263625.1:p.Pro33Arg, NP_001263625.1:p.Pro33His, NP_001263689.1:p.Pro33=, NP_001263689.1:p.Pro33Arg, NP_001263689.1:p.Pro33His, NP_001263690.1:p.Pro33=, NP_001263690.1:p.Pro33Arg, NP_001263690.1:p.Pro33His, XM_005256778.1:c.176-21C=, XM_005256778.1:c.176-21C>A, XM_005256778.1:c.176-21C>G, XR_243565.1:n.354C=, XR_243565.1:n.354C>A, XR_243565.1:n.354C>G, XR_243566.1:n.354C=, XR_243566.1:n.354C>A, XR_243566.1:n.354C>G, rs17844988, rs17857747, rs17882155, rs2229076, rs3174747, rs4134781, rs60388830
G > C
SNP
P72R
No VIP available No Clinical Annotations available VA
rs1042858 NC_000011.10:g.4138236G>A, NC_000011.9:g.4159466G>A, NG_027992.2:g.48543G>A, NM_001033.3:c.2232G>A, NM_001033.4:c.2232G>A, NM_001318064.1:c.1941G>A, NM_001318065.1:c.1218G>A, NP_001024.1:p.Ala744=, NP_001304993.1:p.Ala647=, NP_001304994.1:p.Ala406=, XM_005253058.1:c.1989G>A, XM_005253059.1:c.1941G>A, XM_011520277.1:c.1941G>A, XM_011520278.1:c.1566G>A, XM_011520279.1:c.1218G>A, XP_005253115.1:p.Ala663=, XP_005253116.1:p.Ala647=, XP_011518579.1:p.Ala647=, XP_011518580.1:p.Ala522=, XP_011518581.1:p.Ala406=, rs17850107, rs2229195, rs2584873, rs3168060, rs57259172
G > A
SNP
A744A
No VIP available No Clinical Annotations available VA
rs10434 NC_000006.11:g.43753212A>G, NC_000006.12:g.43785475A>G, NG_008732.1:g.20260A>G, NM_001025366.2:c.*913A>G, NM_001025367.2:c.*913A>G, NM_001025368.2:c.*913A>G, NM_001025369.2:c.*929A>G, NM_001025370.2:c.*913A>G, NM_001033756.2:c.*847A>G, NM_001171622.1:c.*913A>G, NM_001171623.1:c.*913A>G, NM_001171624.1:c.*913A>G, NM_001171625.1:c.*913A>G, NM_001171626.1:c.*913A>G, NM_001171627.1:c.*929A>G, NM_001171628.1:c.*913A>G, NM_001171629.1:c.*847A>G, NM_001171630.1:c.*913A>G, NM_001204384.1:c.*913A>G, NM_001204385.1:c.*913A>G, NM_001287044.1:c.*913A>G, NM_001317010.1:c.*847A>G, NM_003376.5:c.*913A>G, XM_005249363.1:c.*913A>G, rs3173233, rs60316096
A > G
SNP
No VIP available No Clinical Annotations available VA
rs1044457 NC_000001.10:g.47842777C>T, NC_000001.11:g.47377105C>T, NM_001136140.1:c.*360C>T, NM_016308.2:c.*360C>T, NR_046394.1:n.1119C>T, rs17378832, rs3184215, rs3767626
C > -
C > T
SNP
rs1045642 NC_000007.13:g.87138645A>G, NC_000007.14:g.87509329A>G, NG_011513.1:g.208920T>C, NM_000927.4:c.3435T>C, NP_000918.2:p.Ile1145=, rs10239679, rs11568726, rs117328163, rs17210003, rs2229108, rs386513066, rs60023214, rs9690664
A > G
SNP
I1145I
No VIP available CA VA
rs1051640 NC_000017.10:g.48768486A>G, NC_000017.11:g.50691125A>G, NM_003786.3:c.4509A>G, NP_003777.2:p.Glu1503=, XM_005257763.1:c.4317A>G, XM_005257763.2:c.4317A>G, XM_011525422.1:c.4422A>G, XM_011525423.1:c.4614A>G, XM_011525424.1:c.3834A>G, XM_011525425.1:c.3783A>G, XP_005257820.1:p.Glu1439=, XP_011523724.1:p.Glu1474=, XP_011523725.1:p.Glu1538=, XP_011523726.1:p.Glu1278=, XP_011523727.1:p.Glu1261=, XR_934586.1:n.4970A>G, rs17414117, rs17643255, rs3192040, rs57272614, rs60786737
A > G
SNP
E1503E
No VIP available CA VA
rs1051740 NC_000001.10:g.226019633T>C, NC_000001.11:g.225831932T>C, NG_009776.1:g.26837T>C, NM_000120.3:c.337T>C, NM_001136018.3:c.337T>C, NM_001291163.1:c.337T>C, NP_000111.1:p.Tyr113His, NP_001129490.1:p.Tyr113His, NP_001278092.1:p.Tyr113His, XM_005273085.1:c.337T>C, XP_005273142.1:p.Tyr113His, rs16845366, rs17417482, rs1800444, rs2259405, rs3192120, rs52794507, rs59266540
T > C
SNP
Y113H
No VIP available CA VA
rs1052536 NC_000017.10:g.33331575C>T, NC_000017.11:g.35004556C>T, NG_029221.1:g.29059C>T, NM_013975.3:c.*50C>T, XM_005257970.1:c.*50C>T, XM_005257970.2:c.*50C>T, XM_005257971.1:c.*50C>T, XM_011524797.1:c.2823+1767C>T, XM_011524798.1:c.2796+1767C>T, XM_011524799.1:c.2796+1767C>T, XM_011524800.1:c.2823+1767C>T, rs17667663, rs3192959, rs56593019, rs59815732, rs60821611
C > T
SNP
No VIP available No Clinical Annotations available VA
rs1056836 NC_000002.11:g.38298203C>G, NC_000002.12:g.38071060G=, NG_008386.2:g.10042C=, NG_008386.2:g.10042C>G, NM_000104.3:c.1294C=, NM_000104.3:c.1294C>G, NP_000095.2:p.Leu432=, NP_000095.2:p.Leu432Val, rs17405323, rs3731848, rs52802961, rs59494749
C > G
SNP
L432V
No VIP available CA VA
rs1065634 NC_000001.10:g.115259768T>C, NC_000001.11:g.114717147T>C, NG_007572.1:g.4748A>G, NM_001007553.2:c.*1022A>G, NM_001130523.2:c.*1022A>G, NM_001242891.1:c.*1022A>G, NM_001242892.1:c.*1022A>G, NM_001242893.1:c.*1022A>G, NM_002524.4:c.-507A>G, NM_007158.5:c.*1022A>G, XM_005271178.1:c.*1022A>G, rs3167734, rs57399409
T > C
SNP
No VIP available CA VA
rs10964552
C > A
SNP
No VIP available CA VA
rs10981694 NC_000009.11:g.115986409T>G, NC_000009.12:g.113224129T>G, NM_001859.3:c.-36+2451T>G, rs60407897
T > G
SNP
No VIP available No Clinical Annotations available VA
rs11030918 NC_000011.10:g.4094257T>C, NC_000011.9:g.4115487T>C, NG_016277.1:g.243555T>C, NG_027992.2:g.4564T>C, NM_001033.4:c.-756T>C, NM_001318064.1:c.-869T>C, XM_005253058.1:c.-756T>C, XM_005253059.1:c.-869T>C, XM_011520277.1:c.-869T>C, rs17210557, rs17554091
T > C
SNP
No VIP available No Clinical Annotations available VA
rs11211524 NC_000001.10:g.47833213A>C, NC_000001.11:g.47367541A>C, NM_001136140.1:c.172-5414A>C, NM_016308.2:c.172-928A>C, NR_046394.1:n.321-928A>C
A > C
SNP
No VIP available CA VA
rs11226 NC_000012.11:g.1021813G>A, NC_000012.12:g.912647G>A, NG_007984.2:g.164589G>A, NG_017078.2:g.82395C>T, NM_001297419.1:c.*744C>T, NM_001297421.1:c.*744C>T, NM_134424.3:c.*744C>T, NR_123713.1:n.2422C>T, XM_005253720.1:c.*744C>T, XM_005253720.3:c.*744C>T, XM_005253721.1:c.*744C>T, XM_005253721.2:c.*744C>T, XM_005253722.1:c.*744C>T, XM_005253723.1:c.*744C>T, XM_011520990.1:c.*744C>T, XM_011520991.1:c.*744C>T, XM_011520992.1:c.*744C>T, XM_011520995.1:c.*744C>T, XR_242986.1:n.2266C>T, XR_931521.1:n.2088C>T, XR_931522.1:n.2163C>T, rs11571479, rs3192069, rs57985635
G > -
G > A
SNP
No VIP available CA VA
rs1128503 NC_000007.13:g.87179601A>G, NC_000007.14:g.87550285A>G, NG_011513.1:g.167964T>C, NM_000927.4:c.1236T>C, NP_000918.2:p.Gly412=, rs116989428, rs17276907, rs2032587, rs2229105, rs28365046, rs386518005, rs58257317
A > G
SNP
G412G
No VIP available CA VA
rs1130214 NC_000014.8:g.105259734C>A, NC_000014.9:g.104793397C>A, NG_012188.1:g.7348G>T, NM_001014431.1:c.-79-675G>T, NM_001014432.1:c.-163-187G>T, NM_005163.2:c.-350G>T, XM_005267401.1:c.-79-675G>T, XM_011536543.1:c.-257-93G>T, XM_011536544.1:c.-350G>T, rs36214920, rs56526192, rs57753899
C > A
SNP
No VIP available No Clinical Annotations available VA
rs1131341 NC_000016.10:g.69714966G>A, NC_000016.9:g.69748869G>A, NG_011504.1:g.16665C>T, NM_000903.2:c.415C>T, NM_001025433.1:c.415C>T, NM_001025434.1:c.304-1837C>T, NM_001286137.1:c.303+3157C>T, NP_000894.1:p.Arg139Trp, NP_001020604.1:p.Arg139Trp, XM_005255830.1:c.303+3157C>T, rs11555214, rs117044374, rs17413734, rs3191186, rs386597012, rs4986998, rs52820907, rs57338209
G > A
SNP
R139W
rs1138272 NC_000011.10:g.67586108C>T, NC_000011.9:g.67353579C>T, NG_012075.1:g.7514C>T, NM_000852.3:c.341C>T, NP_000843.1:p.Ala114Val, XM_005273958.1:c.338C>T, XP_005274015.1:p.Ala113Val, rs11553894, rs17434783, rs1799811, rs1804665, rs3202011, rs4134657, rs52800258, rs61323549
C > T
SNP
A114V
No VIP available CA VA
rs1142345 NC_000006.11:g.18130918T>C, NC_000006.12:g.18130687T>C, NG_012137.2:g.29457A>G, NM_000367.3:c.719A>G, NP_000358.1:p.Tyr240Cys, XM_011514839.1:c.674A>G, XM_011514840.1:c.650A>G, XP_011513141.1:p.Tyr225Cys, XP_011513142.1:p.Tyr217Cys, rs16880254, rs1801205, rs29001646, rs52798150, rs61510596
T > C
SNP
Y240C
No VIP available CA VA
rs11615 NC_000019.10:g.45420395A>G, NC_000019.9:g.45923653A>G, NG_015839.2:g.63434T>C, NM_001166049.1:c.354T>C, NM_001983.3:c.354T>C, NM_202001.2:c.354T>C, NP_001159521.1:p.Asn118=, NP_001974.1:p.Asn118=, NP_973730.1:p.Asn118=, XM_005258634.1:c.354T>C, XM_005258635.1:c.354T>C, XM_005258635.2:c.354T>C, XM_005258636.1:c.354T>C, XM_005258636.3:c.354T>C, XM_005258637.1:c.354T>C, XM_005258638.1:c.138T>C, XM_011526610.1:c.354T>C, XP_005258691.1:p.Asn118=, XP_005258692.1:p.Asn118=, XP_005258693.1:p.Asn118=, XP_005258694.1:p.Asn118=, XP_005258695.1:p.Asn46=, XP_011524912.1:p.Asn118=, rs1130005, rs17285882, rs17359303, rs17845191, rs17858003, rs17859564, rs2228629, rs3177700, rs3188446, rs3752251, rs59923575
A > G
SNP
N118N
No VIP available CA VA
rs11710163 NC_000003.11:g.12696288A>G, NC_000003.12:g.12654789A>G, NG_007467.1:g.14391T>C, NM_002880.3:c.-27+9024T>C, XM_005265355.1:c.-27+8580T>C, XM_005265356.1:c.-120+9024T>C, XM_005265357.1:c.-27+9024T>C, XM_005265358.1:c.-157+9024T>C, XM_005265358.3:c.-157+9024T>C, XM_005265359.1:c.-157+9024T>C, XM_005265359.3:c.-157+9024T>C, XM_005265360.1:c.-27+9024T>C, XM_011533974.1:c.-120+9024T>C, XM_011533975.1:c.-250+9024T>C, rs58836253
A > G
SNP
No VIP available No Clinical Annotations available VA
rs12090346 NC_000001.10:g.47841557C>T, NC_000001.11:g.47375885C>T, NM_001136140.1:c.498+592C>T, NM_016308.2:c.645+592C>T, NR_046394.1:n.717+592C>T
C > T
SNP
No VIP available CA VA
rs12118636 NC_000001.10:g.53076159G>A, NC_000001.11:g.52610487G>A, rs34623603
G > A
SNP
No VIP available No Clinical Annotations available VA
rs12139042 NC_000001.10:g.11167146G>A, NC_000001.11:g.11107089G>A, NG_033239.1:g.160463C>T, NM_004958.3:c.*396C>T, XM_005263438.1:c.*396C>T, XM_005263439.1:c.*396C>T, XM_005263440.1:c.5038C>T, XM_005263441.1:c.4031-300C>T, XP_005263497.1:p.Gln1680Ter, rs17229270, rs17848573
G > A
SNP
No VIP available CA VA
rs12201199 NC_000006.11:g.18139802A>T, NC_000006.12:g.18139571A>T, NG_012137.2:g.20573T>A, NM_000367.3:c.419+94T>A, XM_011514839.1:c.419+94T>A, XM_011514840.1:c.350+94T>A, rs58109747
A > T
SNP
No VIP available CA VA
rs12613732 NC_000002.11:g.31249427T>G, NC_000002.12:g.31026561T>G, NM_001253826.1:c.315-60259A>C, NM_001253827.1:c.70-33554A>C, NM_024572.3:c.130-33554A>C, NR_045602.1:n.903-33554A>C, XM_005264559.1:c.25-33554A>C, XM_011533104.1:c.448-33554A>C, XM_011533105.1:c.70-33554A>C, XM_011533106.1:c.43-33554A>C, rs17393634, rs56739826, rs58514179
T > G
SNP
No VIP available CA VA
rs12659 NC_000021.8:g.46951556A>G, NC_000021.9:g.45531642A>G, NG_028278.1:g.15830T>C, NM_001205206.1:c.696T>C, NM_001205207.1:c.576T>C, NM_194255.2:c.696T>C, NP_001192135.1:p.Pro232=, NP_001192136.1:p.Pro192=, NP_919231.1:p.Pro232=, XM_005261163.1:c.696T>C, XM_005261164.1:c.342T>C, XM_005261164.2:c.342T>C, XM_011529696.1:c.987T>C, XM_011529697.1:c.987T>C, XM_011529698.1:c.762T>C, XM_011529699.1:c.723T>C, XM_011529700.1:c.696T>C, XM_011529701.1:c.696T>C, XM_011529702.1:c.696T>C, XM_011529703.1:c.696T>C, XM_011529704.1:c.696T>C, XM_011529705.1:c.987T>C, XM_011529706.1:c.558T>C, XM_011529707.1:c.987T>C, XM_011529708.1:c.696T>C, XM_011529709.1:c.342T>C, XM_011529710.1:c.342T>C, XP_005261220.1:p.Pro232=, XP_005261221.1:p.Pro114=, XP_011527998.1:p.Pro329=, XP_011527999.1:p.Pro329=, XP_011528000.1:p.Pro254=, XP_011528001.1:p.Pro241=, XP_011528002.1:p.Pro232=, XP_011528003.1:p.Pro232=, XP_011528004.1:p.Pro232=, XP_011528005.1:p.Pro232=, XP_011528006.1:p.Pro232=, XP_011528007.1:p.Pro329=, XP_011528008.1:p.Pro186=, XP_011528009.1:p.Pro329=, XP_011528010.1:p.Pro232=, XP_011528011.1:p.Pro114=, XP_011528012.1:p.Pro114=, rs17844976, rs17857725, rs3171495
A > G
SNP
P232P
No VIP available No Clinical Annotations available VA
rs12806698 NC_000011.10:g.4094744C>A, NC_000011.9:g.4115974C>A, NG_016277.1:g.244042C>A, NG_027992.2:g.5051C>A, NM_001033.3:c.-269C>A, NM_001033.4:c.-269C>A, NM_001318064.1:c.-382C>A, XM_005253058.1:c.-269C>A, XM_005253059.1:c.-382C>A, XM_011520277.1:c.-382C>A, rs17554111
C > A
SNP
No VIP available No Clinical Annotations available VA
rs12999804 NC_000002.11:g.31245650A>T, NC_000002.12:g.31022784A>T, NM_001253826.1:c.315-56482T>A, NM_001253827.1:c.70-29777T>A, NM_024572.3:c.130-29777T>A, NR_045602.1:n.903-29777T>A, XM_005264559.1:c.25-29777T>A, XM_011533104.1:c.448-29777T>A, XM_011533105.1:c.70-29777T>A, XM_011533106.1:c.43-29777T>A, rs58546060, rs59591816
A > T
SNP
No VIP available CA VA
rs13181 NC_000019.10:g.45351661T>G, NC_000019.9:g.45854919T>G, NG_007067.2:g.23927A>C, NM_000400.3:c.2251A>C, NM_177417.2:c.*304T>G, NP_000391.1:p.Lys751Gln, XM_005258536.1:c.*128T>G, XM_005258536.3:c.*128T>G, XM_005258537.1:c.*128T>G, XM_005258538.1:c.*304T>G, XM_005258539.1:c.*304T>G, XM_005258639.1:c.2179A>C, XM_005258640.1:c.2017A>C, XM_005258641.1:c.1513A>C, XM_011526611.1:c.2173A>C, XP_005258696.1:p.Lys727Gln, XP_005258697.1:p.Lys673Gln, XP_005258698.1:p.Lys505Gln, XP_011524913.1:p.Lys725Gln, rs1052559, rs17285142, rs17355147, rs17359310, rs3170171, rs3859422, rs60606175
T > G
SNP
K751Q
No VIP available No Clinical Annotations available VA
rs1617640 NC_000007.13:g.100317298C>A, NC_000007.14:g.100719675C>A, NG_021471.1:g.3876C>A, NM_000799.2:c.-1306C>A, XM_005250190.1:c.-1306C>A, rs10304599, rs10342152, rs57979509
C > A
SNP
No VIP available CA VA
rs16886403 NC_000005.10:g.56843419T>C, NC_000005.9:g.56139246T>C, NG_031884.1:g.33347T>C, NM_005921.1:c.483-13181T>C, XM_005248519.1:c.72-13181T>C, XM_005248519.3:c.105-13181T>C, XM_005248520.1:c.-7-13181T>C, XM_011543406.1:c.228-13181T>C, XM_011543407.1:c.483-13181T>C, XM_011543408.1:c.483-13181T>C, rs57623389, rs58749465
T > C
SNP
rs1695 NC_000011.10:g.67585218A>G, NC_000011.9:g.67352689A>G, NG_012075.1:g.6624A>G, NM_000852.3:c.313A>G, NP_000843.1:p.Ile105Val, XM_005273958.1:c.313A>G, XP_005274015.1:p.Ile105Val, rs1138257, rs11553891, rs17353321, rs17856342, rs2230827, rs4609, rs56971933, rs947894
A > G
SNP
I105V
No VIP available CA VA
rs16950650 NC_000013.10:g.95775432C>T, NC_000013.11:g.95123178C>T, NM_001105515.2:c.2456-7177G>A, NM_001301829.1:c.2315-7177G>A, NM_001301830.1:c.2231-7177G>A, NM_005845.4:c.2456-7177G>A, XM_005254025.1:c.2327-7177G>A, XM_005254025.2:c.2327-7177G>A, XM_005254026.1:c.2315-7177G>A, XM_005254027.1:c.2231-7177G>A, XM_005254028.1:c.2231-7177G>A, XM_006719914.1:c.2366-7177G>A, XM_011521047.1:c.1907-7177G>A, rs56643033, rs58582224
C > T
SNP
No VIP available No Clinical Annotations available VA
rs17216177 NC_000010.10:g.101603522T>C, NC_000010.11:g.99843765T>C, NG_011798.1:g.66060T>C, NM_000392.4:c.3742-34T>C, XM_005269536.1:c.3463-34T>C, XM_006717630.2:c.3046-34T>C, XR_945604.1:n.3931-34T>C, XR_945605.1:n.3806-34T>C, rs45616434
T > C
SNP
No VIP available CA VA
rs17309872 NC_000020.10:g.33515788A>T, NC_000020.11:g.34927985A>T, NG_008848.1:g.32814T>A, NG_011520.1:g.58044A>T, NM_000178.2:c.*843T>A, NM_001076552.2:c.*771A>T, NM_001242393.1:c.*771A>T, NM_018677.3:c.*771A>T, XM_005260405.1:c.*843T>A, XM_005260406.1:c.*843T>A, XM_005260406.3:c.*843T>A, XM_005260454.1:c.*771A>T, XM_005260455.1:c.*771A>T, XM_005260456.1:c.*771A>T, XM_005260457.1:c.*771A>T, XM_006723826.1:c.*771A>T, XM_011528796.1:c.*843T>A, XM_011528905.1:c.*771A>T, XM_011528906.1:c.*771A>T, XM_011528907.1:c.*771A>T, XM_011528908.1:c.*771A>T, XM_011528909.1:c.*771A>T, XM_011528910.1:c.*771A>T, XM_011528911.1:c.*771A>T, XM_011528912.1:c.*771A>T
A > G
A > T
SNP
No VIP available No Clinical Annotations available VA
rs1734787 AJ132917.1:c.27-27438T>G, NC_000023.10:g.153325446A>C, NC_000023.11:g.154059995A>C, NG_007107.2:g.82133T>G, NM_001110792.1:c.63-27438T>G, NM_001316337.1:c.-421-1429T>G, NM_004992.3:c.27-27438T>G, NW_003871103.3:g.1493974A>C, XM_005274681.1:c.27-27438T>G, XM_005274681.3:c.27-27438T>G, XM_005274682.1:c.-365-20092T>G, XM_005274682.3:c.-365-20092T>G, XM_005274683.1:c.-2264T>G, XM_005274683.3:c.-2264T>G, XM_005277851.1:c.27-27438T>G, XM_005277852.1:c.-365-20092T>G, XM_005277853.1:c.-2264T>G, XM_011531165.1:c.-421-1429T>G, rs17332596, rs56534075, rs58354099, rs61248129
A > C
SNP
No VIP available No Clinical Annotations available VA
rs1734791 AJ132917.1:c.26+26722T>A, NC_000023.10:g.153330920A>T, NC_000023.11:g.154065469A>T, NG_007107.2:g.76659T>A, NM_001110792.1:c.62+32141T>A, NM_001316337.1:c.-421-6903T>A, NM_004992.3:c.26+26722T>A, NW_003871103.3:g.1499448A>T, XM_005274681.1:c.26+26722T>A, XM_005274681.3:c.26+26715T>A, XM_005274682.1:c.-365-25566T>A, XM_005274682.3:c.-365-25566T>A, XM_005277851.1:c.26+26715T>A, XM_005277852.1:c.-365-25566T>A, XM_011531165.1:c.-421-6903T>A, rs111178553, rs60889458
A > T
SNP
No VIP available No Clinical Annotations available VA
rs17435 AJ132917.1:c.27-13972A>T, NC_000023.10:g.153311980T>A, NC_000023.11:g.154046529T>A, NG_007107.2:g.95599A>T, NM_001110792.1:c.63-13972A>T, NM_001316337.1:c.-254+11870A>T, NM_004992.3:c.27-13972A>T, NW_003871103.3:g.1480508T>A, XM_005274681.1:c.27-13972A>T, XM_005274681.3:c.27-13972A>T, XM_005274682.1:c.-365-6626A>T, XM_005274682.3:c.-365-6626A>T, XM_005274683.1:c.-254+10412A>T, XM_005274683.3:c.-254+10412A>T, XM_005277851.1:c.27-13972A>T, XM_005277852.1:c.-365-6626A>T, XM_005277853.1:c.-254+10412A>T, XM_011531165.1:c.-254+11870A>T, XM_011531166.1:c.-254+1988A>T, rs60248475, rs61484111
T > A
SNP
No VIP available CA VA
rs17574269 NC_000006.11:g.117816128A>G, NC_000006.12:g.117494965A>G, NM_173674.2:c.113-8802A>G, XM_005266941.1:c.254-8802A>G, XM_005266942.1:c.254-8802A>G, XM_006715463.1:c.254-8802A>G, XM_011535770.1:c.119-8802A>G, XM_011535771.1:c.-44-8802A>G, XM_011535772.1:c.-44-8802A>G, XM_011535773.1:c.254-8802A>G, XM_011535774.1:c.254-8802A>G, rs58365592
A > G
SNP
No VIP available No Clinical Annotations available VA
rs17655 NC_000013.10:g.103528002G>C, NC_000013.11:g.102875652G>C, NG_007146.1:g.34829G>C, NM_000123.3:c.3310G>C, NM_001204425.1:c.4672G>C, NP_000114.2:p.Asp1104His, NP_001191354.1:p.Asp1558His, rs16960665, rs3188002, rs3825521, rs52825398
G > C
SNP
D1104H
No VIP available CA VA
rs17661089 NC_000005.10:g.56810169A>G, NC_000005.9:g.56105996A>G, NG_031884.1:g.97A>G, rs57476699
A > G
SNP
No VIP available CA VA
rs1799735 unknown
No VIP available No Clinical Annotations available VA
rs1799782 NC_000019.10:g.43553422G>A, NC_000019.9:g.44057574G>A, NG_033799.1:g.27157C>T, NM_006297.2:c.580C>T, NP_006288.2:p.Arg194Trp, rs11553655, rs2229674, rs3213359, rs3826914, rs386545546
G > A
SNP
R194W
No VIP available CA VA
rs1799793 NC_000019.10:g.45364001C>T, NC_000019.9:g.45867259C>T, NG_007067.2:g.11587G>A, NM_000400.3:c.934G>A, NM_001130867.1:c.862G>A, NP_000391.1:p.Asp312Asn, NP_001124339.1:p.Asp288Asn, XM_005258639.1:c.862G>A, XM_005258640.1:c.700G>A, XM_005258641.1:c.196G>A, XM_005258642.1:c.934G>A, XM_011526611.1:c.856G>A, XP_005258696.1:p.Asp288Asn, XP_005258697.1:p.Asp234Asn, XP_005258698.1:p.Asp66Asn, XP_005258699.1:p.Asp312Asn, XP_011524913.1:p.Asp286Asn, XR_935763.1:n.981G>A, rs3916814, rs58989209
C > T
SNP
D312N
No VIP available No Clinical Annotations available VA
rs1800440 NC_000002.11:g.38298139T>C, NC_000002.12:g.38070996T>C, NG_008386.2:g.10106A>G, NM_000104.3:c.1358A>G, NP_000095.2:p.Asn453Ser, rs17405302, rs386545580, rs4134586, rs4986886, rs56879535
T > C
SNP
N453S
No VIP available CA VA
rs1800460 NC_000006.11:g.18139228C>T, NC_000006.12:g.18138997C>T, NG_012137.2:g.21147G>A, NM_000367.3:c.460G>A, NP_000358.1:p.Ala154Thr, XM_011514839.1:c.460G>A, XM_011514840.1:c.391G>A, XP_011513141.1:p.Ala154Thr, XP_011513142.1:p.Ala131Thr, rs11568060, rs16880273, rs386545583, rs57650974
C > T
SNP
A154T
rs1800566 NC_000016.10:g.69711242G>A, NC_000016.9:g.69745145G>A, NG_011504.1:g.20389C>T, NM_000903.2:c.559C>T, NM_001025433.1:c.457C>T, NM_001025434.1:c.445C>T, NM_001286137.1:c.343C>T, NP_000894.1:p.Pro187Ser, NP_001020604.1:p.Pro153Ser, NP_001020605.1:p.Pro149Ser, NP_001273066.1:p.Pro115Ser, XM_005255830.1:c.343C>T, XP_005255887.1:p.Pro115Ser, rs4134727, rs4149351, rs57135274
G > A
SNP
P187S
No VIP available CA VA
rs1801131 NC_000001.10:g.11854476T>G, NC_000001.11:g.11794419T>G, NG_013351.1:g.16685A>C, NM_005957.4:c.1286A>C, NP_005948.3:p.Glu429Ala, XM_005263458.1:c.1409A>C, XM_005263458.2:c.1409A>C, XM_005263459.1:c.1355A>C, XM_005263460.1:c.1286A>C, XM_005263460.3:c.1286A>C, XM_005263461.1:c.1286A>C, XM_005263461.3:c.1286A>C, XM_005263462.1:c.1286A>C, XM_005263462.3:c.1286A>C, XM_005263463.1:c.1040A>C, XM_005263463.2:c.1040A>C, XM_011541495.1:c.1406A>C, XM_011541496.1:c.1409A>C, XP_005263515.1:p.Glu470Ala, XP_005263516.1:p.Glu452Ala, XP_005263517.1:p.Glu429Ala, XP_005263518.1:p.Glu429Ala, XP_005263519.1:p.Glu429Ala, XP_005263520.1:p.Glu347Ala, XP_011539797.1:p.Glu469Ala, XP_011539798.1:p.Glu470Ala, rs17367365, rs17857426, rs4134712
T > G
SNP
E429A
No VIP available CA VA
rs1801133 NC_000001.10:g.11856378G>A, NC_000001.11:g.11796321G>A, NG_013351.1:g.14783C>T, NM_005957.4:c.665C>T, NP_005948.3:p.Ala222Val, XM_005263458.1:c.788C>T, XM_005263458.2:c.788C>T, XM_005263459.1:c.734C>T, XM_005263460.1:c.665C>T, XM_005263460.3:c.665C>T, XM_005263461.1:c.665C>T, XM_005263461.3:c.665C>T, XM_005263462.1:c.665C>T, XM_005263462.3:c.665C>T, XM_005263463.1:c.419C>T, XM_005263463.2:c.419C>T, XM_011541495.1:c.785C>T, XM_011541496.1:c.788C>T, XP_005263515.1:p.Ala263Val, XP_005263516.1:p.Ala245Val, XP_005263517.1:p.Ala222Val, XP_005263518.1:p.Ala222Val, XP_005263519.1:p.Ala222Val, XP_005263520.1:p.Ala140Val, XP_011539797.1:p.Ala262Val, XP_011539798.1:p.Ala263Val, rs386545618, rs4134713, rs59514310
G > A
SNP
A222V
No VIP available CA VA
rs1801280 NC_000008.10:g.18257854T>C, NC_000008.11:g.18400344T>C, NG_012246.1:g.14100T>C, NM_000015.2:c.341T>C, NP_000006.2:p.Ile114Thr, XM_011544358.1:c.341T>C, XP_011542660.1:p.Ile114Thr, rs4134724, rs56935242
T > C
SNP
I114T
No VIP available CA VA
rs1805087 NC_000001.10:g.237048500A>G, NC_000001.11:g.236885200A>G, NG_008959.1:g.94920A>G, NM_000254.2:c.2756A>G, NM_001291939.1:c.2603A>G, NM_001291940.1:c.1535A>G, NP_000245.2:p.Asp919Gly, NP_001278868.1:p.Asp868Gly, NP_001278869.1:p.Asp512Gly, XM_005273140.1:c.2924A>G, XM_005273141.1:c.2753A>G, XM_005273141.3:c.2753A>G, XM_005273142.1:c.2666A>G, XM_005273143.1:c.2603A>G, XM_005273144.1:c.2318A>G, XM_005273145.1:c.1118A>G, XM_006711769.2:c.2756A>G, XM_006711770.1:c.1820A>G, XM_011544193.1:c.2567A>G, XM_011544194.1:c.2924A>G, XP_005273197.1:p.Asp975Gly, XP_005273198.1:p.Asp918Gly, XP_005273199.1:p.Asp889Gly, XP_005273200.1:p.Asp868Gly, XP_005273201.1:p.Asp773Gly, XP_005273202.1:p.Asp373Gly, XP_006711832.1:p.Asp919Gly, XP_006711833.1:p.Asp607Gly, XP_011542495.1:p.Asp856Gly, XP_011542496.1:p.Asp975Gly, rs17658739, rs56618494, rs61036243
A > G
SNP
D919G
No VIP available No Clinical Annotations available VA
rs183484 NC_000011.10:g.4119902C>A, NC_000011.9:g.4141132C>A, NG_027992.2:g.30209C>A, NM_001033.3:c.850C>A, NM_001033.4:c.850C>A, NM_001318064.1:c.559C>A, NM_001318065.1:c.-207C>A, NP_001024.1:p.Arg284=, NP_001304993.1:p.Arg187=, XM_005253058.1:c.607C>A, XM_005253059.1:c.559C>A, XM_011520277.1:c.559C>A, XM_011520278.1:c.184C>A, XM_011520279.1:c.-207C>A, XP_005253115.1:p.Arg203=, XP_005253116.1:p.Arg187=, XP_011518579.1:p.Arg187=, XP_011518580.1:p.Arg62=, rs17210748, rs1735058, rs17850105, rs2228122
C > A
SNP
R284R
No VIP available No Clinical Annotations available VA
rs1870377 NC_000004.11:g.55972974T>A, NC_000004.12:g.55106807T>A, NG_012004.1:g.23789A>T, NM_002253.2:c.1416A>T, NP_002244.1:p.Gln472His, rs52810770
T > A
SNP
Q472H
No VIP available CA VA
rs1872328 NC_000002.11:g.54395259G>A, NC_000002.12:g.54168122G>A, NM_138448.3:c.185+29374G>A
G > A
SNP
No VIP available No Clinical Annotations available VA
rs1885301 NC_000010.10:g.101541053A>G, NC_000010.11:g.99781296A>G, NG_011798.1:g.3591A>G, NM_000392.4:c.-1549A>G, XM_005269536.1:c.-1549A>G, XM_006717631.2:c.-1549A>G, XM_011539291.1:c.-1549A>G, XR_945604.1:n.-1360A>G, XR_945605.1:n.-1358A>G, rs17216261, rs59934936
A > G
SNP
No VIP available No Clinical Annotations available VA
rs2010963 NC_000006.11:g.43738350C>G, NC_000006.12:g.43770613C>G, NG_008732.1:g.5398C>G, NM_001025366.2:c.-94C>G, NM_001025367.2:c.-94C>G, NM_001025368.2:c.-94C>G, NM_001025369.2:c.-94C>G, NM_001025370.2:c.-94C>G, NM_001033756.2:c.-94C>G, NM_001171622.1:c.-94C>G, NM_001171623.1:c.-634C>G, NM_001171624.1:c.-634C>G, NM_001171625.1:c.-634C>G, NM_001171626.1:c.-634C>G, NM_001171627.1:c.-634C>G, NM_001171628.1:c.-634C>G, NM_001171629.1:c.-634C>G, NM_001171630.1:c.-634C>G, NM_001204384.1:c.-634C>G, NM_001204385.1:c.-94C>G, NM_001287044.1:c.-1507C>G, NM_001317010.1:c.-634C>G, NM_003376.5:c.-94C>G, XM_005249363.1:c.-1507C>G
C > G
SNP
No VIP available No Clinical Annotations available VA
rs2018683 NC_000007.13:g.29014195G>T, NC_000007.14:g.28974579G>T, rs56487635, rs59311291
G > T
SNP
No VIP available No Clinical Annotations available VA
rs2031920 NC_000010.10:g.135339845C>T, NC_000010.11:g.133526341C>T, NG_008383.1:g.3979C>T, NM_000773.3:c.-1055C>T, XM_005252665.1:c.-512C>T, rs3813868
C > T
SNP
No VIP available No Clinical Annotations available VA
rs2032582 NC_000007.13:g.87160618A>C, NC_000007.13:g.87160618A>T, NC_000007.14:g.87531302A>C, NC_000007.14:g.87531302A>T, NG_011513.1:g.186947T>A, NG_011513.1:g.186947T>G, NM_000927.4:c.2677T>A, NM_000927.4:c.2677T>G, NP_000918.2:p.Ser893Ala, NP_000918.2:p.Ser893Thr, rs10228331, rs2229106, rs386553610, rs57135550, rs9641018
A > C
SNP
S893A
No VIP available CA VA
rs2070676 NC_000010.10:g.135351137G>C, NC_000010.11:g.133537633G>C, NG_008383.1:g.15271G>C, NM_000773.3:c.1156-118G>C, XM_005252665.1:c.1216-118G>C, rs17012756, rs56527359, rs59960595, rs60668193
G > C
SNP
No VIP available No Clinical Annotations available VA
rs2071559 NC_000004.11:g.55992366A>G, NC_000004.12:g.55126199A>G, NG_012004.1:g.4397T>C, NM_002253.2:c.-906T>C, rs59863954
A > G
SNP
No VIP available No Clinical Annotations available VA
rs2072671 NC_000001.10:g.20915701A>C, NC_000001.11:g.20589208A>C, NM_001785.2:c.79A>C, NP_001776.1:p.Lys27Gln, rs57221291
A > C
SNP
K27Q
No VIP available CA VA
rs2075252 NC_000002.11:g.170010985T>C, NC_000002.12:g.169154475T>C, NG_012634.1:g.213138A>G, NM_004525.2:c.12280A>G, NP_004516.2:p.Lys4094Glu, XM_005246551.1:c.9991A>G, XM_011511183.1:c.12151A>G, XM_011511184.1:c.9991A>G, XP_005246608.1:p.Lys3331Glu, XP_011509485.1:p.Lys4051Glu, XP_011509486.1:p.Lys3331Glu, rs17848193, rs386556527, rs52808684, rs59573352
T > C
SNP
K4094E
No VIP available No Clinical Annotations available VA
rs2166219 NC_000002.11:g.19617302T>C, NC_000002.12:g.19417541T>C, XR_939779.1:n.496-18349A>G, rs13008844, rs16986416, rs58751495
T > C
SNP
No VIP available CA VA
rs2207396 NC_000006.11:g.152382382G>A, NC_000006.12:g.152061247G>A, NG_008493.1:g.375752G>A, NM_000125.3:c.1369+123G>A, NM_001122740.1:c.1369+123G>A, NM_001122741.1:c.1369+123G>A, NM_001122742.1:c.1369+123G>A, NM_001291230.1:c.1375+123G>A, NM_001291241.1:c.1366+123G>A, XM_005266856.1:c.1375+123G>A, XM_005266857.1:c.1366+123G>A, XM_006715374.2:c.1369+123G>A, XM_006715375.2:c.850+123G>A, XM_011535543.1:c.1369+123G>A, XM_011535544.1:c.1369+123G>A, XM_011535545.1:c.1369+123G>A, XM_011535546.1:c.1369+123G>A, XM_011535547.1:c.1369+123G>A, XM_011535548.1:c.850+123G>A, XM_011535549.1:c.640+123G>A, XR_943116.1:n.7257C>T, rs17847072, rs57792040
G > A
SNP
No VIP available CA VA
rs2228001 NC_000003.11:g.14187449G>T, NC_000003.12:g.14145949G>T, NG_011763.1:g.37724C>A, NM_001145769.1:c.2704C>A, NM_004628.4:c.2815C>A, NP_001139241.1:p.Gln902Lys, NP_004619.3:p.Gln939Lys, NR_027299.1:n.2795C>A, rs17620623, rs17856505, rs3729583, rs60736379
G > T
SNP
Q902K
No VIP available CA VA
rs2228171 NC_000002.11:g.170053505C>T, NC_000002.12:g.169196995C>T, NG_012634.1:g.170618G>A, NM_004525.2:c.8614G>A, NP_004516.2:p.Ala2872Thr, XM_005246551.1:c.6325G>A, XM_005246552.1:c.8614G>A, XM_011511183.1:c.8614G>A, XM_011511184.1:c.6325G>A, XM_011511185.1:c.8614G>A, XP_005246608.1:p.Ala2109Thr, XP_005246609.1:p.Ala2872Thr, XP_011509485.1:p.Ala2872Thr, XP_011509486.1:p.Ala2109Thr, XP_011509487.1:p.Ala2872Thr, rs117432666, rs17848174, rs2302697, rs4668123, rs52816657, rs57579868
C > T
SNP
A2872T
No VIP available No Clinical Annotations available VA
rs2273697 NC_000010.10:g.101563815G>A, NC_000010.11:g.99804058G>A, NG_011798.1:g.26353G>A, NM_000392.4:c.1249G>A, NP_000383.1:p.Val417Ile, XM_005269536.1:c.1249G>A, XM_006717630.2:c.553G>A, XM_006717631.2:c.1249G>A, XM_011539291.1:c.1249G>A, XP_005269593.1:p.Val417Ile, XP_006717693.1:p.Val185Ile, XP_006717694.1:p.Val417Ile, XP_011537593.1:p.Val417Ile, XR_945604.1:n.1438G>A, XR_945605.1:n.1440G>A, rs17216184, rs60620335
G > A
SNP
V417I
No VIP available CA VA
rs2284449 NC_000011.10:g.4099619T>C, NC_000011.9:g.4120849T>C, NG_027992.2:g.9926T>C, NM_001033.3:c.20-2374T>C, NM_001033.4:c.20-2374T>C, NM_001318064.1:c.-94-2374T>C, XM_005253058.1:c.20-2374T>C, XM_005253059.1:c.-94-2374T>C, XM_011520277.1:c.-94-2374T>C, rs52806873
T > C
SNP
No VIP available CA VA
rs2291767 NC_000002.11:g.241080132T>C, NC_000002.12:g.240140715T>C, NM_148961.3:c.-214A>G
T > C
SNP
No VIP available CA VA
rs2299939 NC_000010.10:g.89657150C>A, NC_000010.11:g.87897393C>A, NG_007466.2:g.38955C>A, NM_000314.4:c.164+3284C>A, NM_000314.6:c.164+3284C>A, NM_001304717.2:c.683+3284C>A, NM_001304718.1:c.-542+3284C>A, XM_006717926.2:c.164+3284C>A, XM_011539981.1:c.164+3284C>A, XM_011539982.1:c.68+16955C>A, XR_945789.1:n.876+3284C>A, XR_945790.1:n.876+3284C>A, XR_945791.1:n.876+3284C>A, rs17561756, rs52816835, rs60036687
C > A
C > T
SNP
No VIP available No Clinical Annotations available VA
rs2305948 NC_000004.11:g.55979558C>T, NC_000004.12:g.55113391C>T, NG_012004.1:g.17205G>A, NM_002253.2:c.889G>A, NP_002244.1:p.Val297Ile, rs386564519, rs52830740, rs56532927, rs56973163
C > T
SNP
V297I
No VIP available CA VA
rs232043 NC_000011.10:g.4117895G>A, NC_000011.9:g.4139125G>A, NG_027992.2:g.28202G>A, NM_001033.3:c.651-425G>A, NM_001033.4:c.651-425G>A, NM_001318064.1:c.360-425G>A, NM_001318065.1:c.-406-425G>A, XM_005253058.1:c.408-425G>A, XM_005253059.1:c.360-425G>A, XM_011520277.1:c.360-425G>A, XM_011520278.1:c.-16-425G>A, XM_011520279.1:c.-406-425G>A, rs1662167
G > A
SNP
No VIP available CA VA
rs244898
T > C
SNP
No VIP available No Clinical Annotations available VA
rs2494750 NC_000014.8:g.105262912G>C, NC_000014.9:g.104796575G>C, NG_012188.1:g.4169C>G, NG_042073.1:g.395G>C, NM_001014431.1:c.-1172C>G, NM_001014432.1:c.-1256C>G, rs57563070
G > C
SNP
No VIP available CA VA
rs2494752 NC_000014.8:g.105263608A>G, NC_000014.9:g.104797271A>G, NG_012188.1:g.3473T>C, NG_042073.1:g.1091A>G, NM_001014431.1:c.-1868T>C, NM_001014432.1:c.-1952T>C
A > G
SNP
No VIP available No Clinical Annotations available VA
rs2498786 NC_000014.8:g.105262368C>G, NC_000014.9:g.104796031C>G, NG_012188.1:g.4713G>C, NM_001014431.1:c.-628G>C, NM_001014432.1:c.-712G>C, XM_005267401.1:c.-1992G>C, XM_011536543.1:c.-2170G>C, XM_011536544.1:c.-2984G>C
C > G
SNP
No VIP available CA VA
rs2498804 NC_000014.8:g.105233095C>A, NC_000014.9:g.104766758C>A, XR_429419.2:n.-1209C>A, rs386568280, rs56890536
C > A
SNP
No VIP available CA VA
rs25487 NC_000019.10:g.43551574T>C, NC_000019.9:g.44055726T>C, NG_033799.1:g.29005A>G, NM_006297.2:c.1196A>G, NP_006288.2:p.Gln399Arg, rs11553658, rs17435395, rs3817410, rs386493716, rs57378728
T > C
SNP
Q399R
No VIP available No Clinical Annotations available VA
rs25489 NC_000019.10:g.43552260C>T, NC_000019.9:g.44056412C>T, NG_033799.1:g.28319G>A, NM_006297.2:c.839G>A, NP_006288.2:p.Arg280His, rs17435388, rs2229675, rs2307183
C > T
SNP
R280H
No VIP available CA VA
rs25648 NC_000006.11:g.43738977C>T, NC_000006.12:g.43771240C>T, NG_008732.1:g.6025C>T, NM_001025366.2:c.534C>T, NM_001025367.2:c.534C>T, NM_001025368.2:c.534C>T, NM_001025369.2:c.534C>T, NM_001025370.2:c.534C>T, NM_001033756.2:c.534C>T, NM_001171622.1:c.534C>T, NM_001171623.1:c.-7C>T, NM_001171624.1:c.-7C>T, NM_001171625.1:c.-7C>T, NM_001171626.1:c.-7C>T, NM_001171627.1:c.-7C>T, NM_001171628.1:c.-7C>T, NM_001171629.1:c.-7C>T, NM_001171630.1:c.-7C>T, NM_001204384.1:c.-7C>T, NM_001204385.1:c.534C>T, NM_001287044.1:c.-880C>T, NM_001317010.1:c.-7C>T, NM_003376.5:c.534C>T, NP_001020537.2:p.Ser178=, NP_001020538.2:p.Ser178=, NP_001020539.2:p.Ser178=, NP_001020540.2:p.Ser178=, NP_001020541.2:p.Ser178=, NP_001028928.1:p.Ser178=, NP_001165093.1:p.Ser178=, NP_001191314.1:p.Ser178=, NP_003367.4:p.Ser178=, XM_005249363.1:c.-880C>T
C > T
SNP
S178S
No VIP available CA VA
rs2699887 NC_000003.11:g.178866408C>T, NC_000003.12:g.179148620C>T, NG_012113.2:g.5098C>T, NM_006218.2:c.-77+17C>T, NR_125401.1:n.-647G>A, XM_006713658.2:c.-77+401C>T, XM_011512894.1:c.-1173C>T, XR_241620.1:n.-643G>A
C > T
SNP
No VIP available No Clinical Annotations available VA
rs2720376 NC_000004.11:g.185554300C>T, NC_000004.12:g.184633146C>T, NM_004346.3:c.179-750G>A, NM_032991.2:c.179-750G>A, XM_005263266.1:c.179-750G>A, XM_011532301.1:c.179-750G>A, rs17586243, rs58845854
C > T
SNP
No VIP available No Clinical Annotations available VA
rs2762939 NC_000020.10:g.52781251G>C, NC_000020.11:g.54164712G>C, NG_008334.1:g.14266C>G, NM_000782.4:c.733-149C>G, NM_001128915.1:c.733-149C>G, XM_005260304.1:c.733-149C>G, XM_005260304.3:c.733-149C>G, XM_005260305.1:c.733-149C>G, rs57991016
G > C
SNP
No VIP available No Clinical Annotations available VA
rs2804402 NC_000010.10:g.101541583A>G, NC_000010.11:g.99781826A>G, NG_011798.1:g.4121A>G, NM_000392.4:c.-1019A>G, XM_005269536.1:c.-1019A>G, XM_006717631.2:c.-1019A>G, XM_011539291.1:c.-1019A>G, XR_945604.1:n.-830A>G, XR_945605.1:n.-828A>G, rs17222526, rs60149027
A > G
SNP
No VIP available No Clinical Annotations available VA
rs3025039 NC_000006.11:g.43752536C>T, NC_000006.12:g.43784799C>T, NG_008732.1:g.19584C>T, NM_001025366.2:c.*237C>T, NM_001025367.2:c.*237C>T, NM_001025368.2:c.*237C>T, NM_001025369.2:c.*253C>T, NM_001025370.2:c.*237C>T, NM_001033756.2:c.*171C>T, NM_001171622.1:c.*237C>T, NM_001171623.1:c.*237C>T, NM_001171624.1:c.*237C>T, NM_001171625.1:c.*237C>T, NM_001171626.1:c.*237C>T, NM_001171627.1:c.*253C>T, NM_001171628.1:c.*237C>T, NM_001171629.1:c.*171C>T, NM_001171630.1:c.*237C>T, NM_001204384.1:c.*237C>T, NM_001204385.1:c.*237C>T, NM_001287044.1:c.*237C>T, NM_001317010.1:c.*171C>T, NM_003376.5:c.*237C>T, XM_005249363.1:c.*237C>T, rs11575898
C > T
SNP
No VIP available No Clinical Annotations available VA
rs307805 NC_000005.10:g.180650487T>C, NC_000005.9:g.180077487T>C, NG_011536.1:g.4138A>G, NM_002020.4:c.-942A>G, NM_182925.4:c.-942A>G, XM_011534482.1:c.-942A>G, XM_011534483.1:c.-289A>G, rs1309960, rs57113127
T > C
SNP
No VIP available No Clinical Annotations available VA
rs307822 NC_000005.10:g.180601717T>C, NC_000005.9:g.180028717T>C, NG_011536.1:g.52908A>G, NM_182925.4:c.*1475A>G, XM_011534477.1:c.*1475A>G, XM_011534478.1:c.*1475A>G, XM_011534482.1:c.*1475A>G, XM_011534483.1:c.*1475A>G, XM_011534484.1:c.*1475A>G, rs1309977
T > C
SNP
No VIP available No Clinical Annotations available VA
rs3087386 NC_000002.11:g.100055506A>G, NC_000002.12:g.99439044A>G, NM_001037872.1:c.770T>C, NM_016316.2:c.770T>C, NP_001032961.1:p.Phe257Ser, NP_057400.1:p.Phe257Ser, XM_005263967.1:c.770T>C, XM_005263968.1:c.560T>C, XM_005263969.1:c.-825T>C, XM_011511336.1:c.770T>C, XM_011511337.1:c.770T>C, XM_011511338.1:c.560T>C, XM_011511339.1:c.-825T>C, XP_005264024.1:p.Phe257Ser, XP_005264025.1:p.Phe187Ser, XP_011509638.1:p.Phe257Ser, XP_011509639.1:p.Phe257Ser, XP_011509640.1:p.Phe187Ser, XR_244891.1:n.931T>C, XR_427092.1:n.1151T>C, XR_922941.1:n.780T>C, rs3749086, rs58019413
A > G
SNP
F257S
No VIP available No Clinical Annotations available VA
rs3087399 NC_000002.11:g.100055158T>C, NC_000002.12:g.99438696T>C, NM_001037872.1:c.1118A>G, NM_016316.2:c.1118A>G, NP_001032961.1:p.Asn373Ser, NP_057400.1:p.Asn373Ser, XM_005263967.1:c.1118A>G, XM_005263968.1:c.908A>G, XM_005263969.1:c.-477A>G, XM_011511336.1:c.1118A>G, XM_011511337.1:c.1118A>G, XM_011511338.1:c.908A>G, XM_011511339.1:c.-477A>G, XP_005264024.1:p.Asn373Ser, XP_005264025.1:p.Asn303Ser, XP_011509638.1:p.Asn373Ser, XP_011509639.1:p.Asn373Ser, XP_011509640.1:p.Asn303Ser, XR_244891.1:n.1279A>G, XR_427092.1:n.1499A>G, XR_922941.1:n.1128A>G, rs52791165, rs57440453
T > C
SNP
N373S
No VIP available CA VA
rs3087403 NC_000002.11:g.100058870C>T, NC_000002.12:g.99442408C>T, NM_001037872.1:c.412G>A, NM_016316.2:c.412G>A, NP_001032961.1:p.Val138Met, NP_057400.1:p.Val138Met, XM_005263967.1:c.412G>A, XM_005263968.1:c.202G>A, XM_011511336.1:c.412G>A, XM_011511337.1:c.412G>A, XM_011511338.1:c.202G>A, XP_005264024.1:p.Val138Met, XP_005264025.1:p.Val68Met, XP_011509638.1:p.Val138Met, XP_011509639.1:p.Val138Met, XP_011509640.1:p.Val68Met, XR_244891.1:n.573G>A, XR_427092.1:n.793G>A, XR_922941.1:n.422G>A, rs17713429, rs52807598, rs58647355
C > T
SNP
V138M
No VIP available CA VA
rs316019 NC_000006.11:g.160670282A>C, NC_000006.12:g.160249250A>C, NM_003058.3:c.808T>G, NP_003049.2:p.Ser270Ala, rs1755917, rs17846267, rs17859289, rs386580336, rs52803175, rs60007366, rs666224
A > C
SNP
S270A
No VIP available No Clinical Annotations available VA
rs3204953 NC_000006.11:g.111628626C>T, NC_000006.12:g.111307423C>T, NM_001286431.1:c.8956G>A, NM_001286432.1:c.8956G>A, NM_002912.4:c.9190G>A, NP_001273360.1:p.Val2986Ile, NP_001273361.1:p.Val2986Ile, NP_002903.3:p.Val3064Ile, XM_005267088.1:c.8956G>A, XM_005267089.1:c.8824G>A, XM_006715543.2:c.9190G>A, XM_006715544.2:c.8956G>A, XM_011536028.1:c.9271G>A, XM_011536029.1:c.9268G>A, XM_011536030.1:c.9193G>A, XM_011536031.1:c.9037G>A, XM_011536032.1:c.9037G>A, XP_005267145.1:p.Val2986Ile, XP_005267146.1:p.Val2942Ile, XP_006715606.1:p.Val3064Ile, XP_006715607.1:p.Val2986Ile, XP_011534330.1:p.Val3091Ile, XP_011534331.1:p.Val3090Ile, XP_011534332.1:p.Val3065Ile, XP_011534333.1:p.Val3013Ile, XP_011534334.1:p.Val3013Ile, XR_942871.1:n.2045+29265C>T, rs17511539, rs386580771, rs52817805
C > T
SNP
V2986I
No VIP available CA VA
rs3212986 NC_000019.10:g.45409478C>A, NC_000019.9:g.45912736C>A, NG_015839.2:g.74351G>T, NM_001166049.1:c.*197G>T, NM_001297590.1:c.1516C>A, NM_001983.3:c.*197G>T, NM_012099.1:c.1510C>A, NP_001284519.1:p.Gln506Lys, NP_036231.1:p.Gln504Lys, XM_005258425.1:c.1516C>A, XM_005258638.1:c.*197G>T, XP_005258482.1:p.Gln506Lys, rs386580934, rs60333438
C > A
C > T
SNP
Q506K
No VIP available CA VA
rs3219484 NC_000001.10:g.45800156C>T, NC_000001.11:g.45334484C>T, NG_008189.1:g.10987G>A, NM_001048171.1:c.64G>A, NM_001048172.1:c.22G>A, NM_001048173.1:c.22G>A, NM_001048174.1:c.22G>A, NM_001128425.1:c.64G>A, NM_001293190.1:c.64G>A, NM_001293191.1:c.22G>A, NM_001293192.1:c.-191G>A, NM_001293195.1:c.22G>A, NM_001293196.1:c.-191G>A, NM_012222.2:c.64G>A, NP_001041636.1:p.Val22Met, NP_001041637.1:p.Val8Met, NP_001041638.1:p.Val8Met, NP_001041639.1:p.Val8Met, NP_001121897.1:p.Val22Met, NP_001280119.1:p.Val22Met, NP_001280120.1:p.Val8Met, NP_001280124.1:p.Val8Met, NP_036354.1:p.Val22Met, XM_005270880.1:c.64G>A, XM_005270881.1:c.22G>A, XM_005270882.1:c.22G>A, XM_005270883.1:c.-135G>A, XM_005270884.1:c.-191G>A, XM_005270885.1:c.-191G>A, XM_005270886.1:c.-52G>A, XM_011541497.1:c.40G>A, XM_011541498.1:c.22G>A, XM_011541499.1:c.22G>A, XM_011541500.1:c.22G>A, XM_011541501.1:c.22G>A, XM_011541502.1:c.22G>A, XM_011541503.1:c.64G>A, XM_011541504.1:c.22G>A, XM_011541505.1:c.-52G>A, XM_011541506.1:c.-52G>A, XM_011541507.1:c.-1167G>A, XM_011541508.1:c.-1194G>A, XP_005270937.1:p.Val22Met, XP_005270938.1:p.Val8Met, XP_005270939.1:p.Val8Met, XP_011539799.1:p.Val14Met, XP_011539800.1:p.Val8Met, XP_011539801.1:p.Val8Met, XP_011539802.1:p.Val8Met, XP_011539803.1:p.Val8Met, XP_011539804.1:p.Val8Met, XP_011539805.1:p.Val22Met, XP_011539806.1:p.Val8Met, XR_946658.1:n.111G>A, rs17784895, rs52809192, rs61197742
C > T
SNP
V22M
No VIP available No Clinical Annotations available VA
rs34716810 NC_000019.10:g.40286682G>A, NC_000019.9:g.40792589G>A, NG_012038.2:g.3677C>T, NM_001243027.2:c.-1735C>T, NM_001243028.2:c.-1642C>T, NM_001626.5:c.-1586C>T, XM_005258648.1:c.-1319C>T, XM_005258650.1:c.-1586C>T, XM_011526617.1:c.-2299C>T, XM_011526618.1:c.-2002C>T, XM_011526620.1:c.-1319C>T, XM_011526621.1:c.-1718C>T, XM_011526622.1:c.-1586C>T, XR_935967.1:n.169+83G>A, rs62107592
G > A
SNP
No VIP available No Clinical Annotations available VA
rs3740066 NC_000010.10:g.101604207C>T, NC_000010.11:g.99844450C>T, NG_011798.1:g.66745C>T, NM_000392.4:c.3972C>T, NP_000383.1:p.Ile1324=, XM_005269536.1:c.3693C>T, XM_006717630.2:c.3276C>T, XP_005269593.1:p.Ile1231=, XP_006717693.1:p.Ile1092=, XR_945604.1:n.4161C>T, XR_945605.1:n.4036C>T, rs12780340, rs17216303, rs59292214
C > T
SNP
I1324I
No VIP available CA VA
rs3740556 NC_000010.10:g.120840195G>A, NC_000010.11:g.119080683G>A, NM_003750.2:c.-7C>T, XM_005270259.1:c.-7C>T, XM_005270260.1:c.-357C>T
G > A
SNP
No VIP available No Clinical Annotations available VA
rs3787554 NC_000020.10:g.52782680G>A, NC_000020.11:g.54166141G>A, NG_008334.1:g.12837C>T, NM_000782.4:c.641-308C>T, NM_001128915.1:c.641-308C>T, XM_005260304.1:c.641-308C>T, XM_005260304.3:c.641-308C>T, XM_005260305.1:c.641-308C>T
G > A
SNP
No VIP available No Clinical Annotations available VA
rs3803304 NC_000014.8:g.105239146C>G, NC_000014.9:g.104772809C>G, NG_012188.1:g.27936G>C, NM_001014431.1:c.1172+69G>C, NM_001014432.1:c.1172+69G>C, NM_005163.2:c.1172+69G>C, XM_005267401.1:c.1172+69G>C, XM_005267402.1:c.1169+69G>C, XM_011536543.1:c.1172+69G>C, XM_011536544.1:c.1172+69G>C
C > G
SNP
No VIP available No Clinical Annotations available VA
rs3817657 NC_000011.10:g.4121362T>C, NC_000011.9:g.4142592T>C, NG_027992.2:g.31669T>C, NM_001033.3:c.877-242T>C, NM_001033.4:c.877-242T>C, NM_001318064.1:c.586-242T>C, NM_001318065.1:c.-138-242T>C, XM_005253058.1:c.634-242T>C, XM_005253059.1:c.586-242T>C, XM_011520277.1:c.586-242T>C, XM_011520278.1:c.211-242T>C, XM_011520279.1:c.-138-242T>C, rs57325561
T > C
SNP
No VIP available No Clinical Annotations available VA
rs3832043 NC_000002.11:g.234580454delT, NC_000002.12:g.233671808delT, NG_002601.2:g.87065delT, NM_019075.2:c.855+34431del, NM_019075.2:c.855+34431delT, NM_019076.4:c.855+53246del, NM_019076.4:c.855+53246delT, NM_021027.2:c.-127del, NM_021027.2:c.-127delT, XR_241241.1:n.-41delT, rs150487502, rs35426722, rs371526135, rs57111427, rs67695772, rs67695773
T > -
indel
No VIP available CA VA
rs3957357 NC_000006.11:g.52668687A>G, NC_000006.12:g.52803889A>G, NM_001319059.1:c.-281T>C, NM_145740.4:c.-135T>C, XM_005249034.1:c.-135T>C, XM_005249034.2:c.-135T>C, rs58145964
A > G
SNP
No VIP available No Clinical Annotations available VA
rs4124874 NC_000002.11:g.234665659T>G, NC_000002.12:g.233757013T>G, NG_002601.2:g.172270T>G, NG_033238.1:g.1741T>G, NM_001072.3:c.862-10021T>G, NM_007120.2:c.868-10021T>G, NM_019075.2:c.856-10021T>G, NM_019076.4:c.856-10021T>G, NM_019077.2:c.856-10021T>G, NM_019078.1:c.868-10021T>G, NM_019093.2:c.868-10021T>G, NM_021027.2:c.856-10021T>G, NM_205862.1:c.61-10021T>G, NR_037694.1:n.-1668A>C, NR_037695.1:n.-1668A>C, NR_037696.1:n.-1668A>C, XR_241238.1:n.924-10021T>G, XR_241240.1:n.1023-10021T>G, XR_241241.1:n.942-10021T>G, rs57409706
T > G
SNP
No VIP available No Clinical Annotations available VA
rs4148323 NC_000002.11:g.234669144G>A, NC_000002.12:g.233760498G>A, NG_002601.2:g.175755G>A, NG_033238.1:g.5226G>A, NM_000463.2:c.211G>A, NM_001072.3:c.862-6536G>A, NM_007120.2:c.868-6536G>A, NM_019075.2:c.856-6536G>A, NM_019076.4:c.856-6536G>A, NM_019077.2:c.856-6536G>A, NM_019078.1:c.868-6536G>A, NM_019093.2:c.868-6536G>A, NM_021027.2:c.856-6536G>A, NM_205862.1:c.61-6536G>A, NP_000454.1:p.Gly71Arg, XR_241238.1:n.924-6536G>A, XR_241239.1:n.233G>A, XR_241240.1:n.1023-6536G>A, XR_241241.1:n.942-6536G>A, rs113525835, rs34360183, rs58105808, rs58585123
G > A
SNP
G71R
No VIP available CA VA
rs4148416 NC_000017.10:g.48753423C>T, NC_000017.11:g.50676062C>T, NM_003786.3:c.3039C>T, NP_003777.2:p.Gly1013=, XM_005257763.1:c.2847C>T, XM_005257763.2:c.2847C>T, XM_011525422.1:c.2952C>T, XM_011525423.1:c.3144C>T, XM_011525424.1:c.2364C>T, XM_011525425.1:c.2313C>T, XP_005257820.1:p.Gly949=, XP_011523724.1:p.Gly984=, XP_011523725.1:p.Gly1048=, XP_011523726.1:p.Gly788=, XP_011523727.1:p.Gly771=, XR_934586.1:n.3237C>T
C > T
SNP
G1013G
No VIP available CA VA
rs4148737 NC_000007.13:g.87171152T>C, NC_000007.14:g.87541836T>C, NG_011513.1:g.176413A>G, NM_000927.4:c.2212-372A>G, rs386591482, rs60838665
T > C
SNP
No VIP available CA VA
rs4492666 NC_000001.10:g.47800845A>C, NC_000001.11:g.47335173A>C, NM_001136140.1:c.171+1057A>C, NM_016308.2:c.171+1057A>C, NR_046394.1:n.320+1057A>C, NR_046395.1:n.320+1057A>C, rs61400292
A > C
A > T
SNP
No VIP available CA VA
rs451774 NC_000006.11:g.28502550A>G, NC_000006.12:g.28534773A>G, NM_001509.2:c.*606A>G, NM_003996.3:c.*851A>G, NT_113891.2:g.24754A>G, NT_113891.3:g.24654A>G, XM_011514527.1:c.*606A>G, XM_011514528.1:c.*606A>G, XM_011514529.1:c.*606A>G, XM_011514530.1:c.*606A>G, XM_011547233.1:c.*606A>G, XM_011547234.1:c.*606A>G, XM_011547235.1:c.*606A>G, XM_011547236.1:c.*606A>G, rs115878751, rs118080793, rs60258350
A > G
SNP
No VIP available No Clinical Annotations available VA
rs45445694 NC_000018.10:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NC_000018.9:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NG_028255.1:g.5043_5070CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NM_001012716.2:c.*34+169_*34+196CGGGACGGAGGCAGGCCAAGTGGCGCGG[2][3][4][7][8][9], NM_001071.2:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258137.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258138.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9]
CCGCGC(CACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2
CCGCGC(CACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)4
CCGCGC(CACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)7
CCGCGC(CACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)8
CCGCGC(CACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)9
microsatellite
No VIP available CA VA
rs462779 NC_000006.11:g.111695887G>A, NC_000006.12:g.111374684G>A, NM_001286431.1:c.3437C>T, NM_001286432.1:c.3437C>T, NM_002912.4:c.3671C>T, NP_001273360.1:p.Thr1146Ile, NP_001273361.1:p.Thr1146Ile, NP_002903.3:p.Thr1224Ile, XM_005267088.1:c.3437C>T, XM_005267089.1:c.3305C>T, XM_005267090.1:c.3671C>T, XM_005267091.1:c.3671C>T, XM_006715543.2:c.3671C>T, XM_006715544.2:c.3437C>T, XM_011536028.1:c.3674C>T, XM_011536029.1:c.3671C>T, XM_011536030.1:c.3674C>T, XM_011536031.1:c.3440C>T, XM_011536032.1:c.3440C>T, XM_011536033.1:c.3674C>T, XM_011536034.1:c.3674C>T, XM_011536035.1:c.3674C>T, XM_011536036.1:c.3674C>T, XP_005267145.1:p.Thr1146Ile, XP_005267146.1:p.Thr1102Ile, XP_005267147.1:p.Thr1224Ile, XP_005267148.1:p.Thr1224Ile, XP_006715606.1:p.Thr1224Ile, XP_006715607.1:p.Thr1146Ile, XP_011534330.1:p.Thr1225Ile, XP_011534331.1:p.Thr1224Ile, XP_011534332.1:p.Thr1225Ile, XP_011534333.1:p.Thr1147Ile, XP_011534334.1:p.Thr1147Ile, XP_011534335.1:p.Thr1225Ile, XP_011534336.1:p.Thr1225Ile, XP_011534337.1:p.Thr1225Ile, XP_011534338.1:p.Thr1225Ile, XR_942545.1:n.4223C>T, XR_942546.1:n.4223C>T, rs17510886, rs386594115, rs52812261, rs56811779
G > A
SNP
T1146I
No VIP available No Clinical Annotations available VA
rs4638843 NC_000002.11:g.47704027G>C, NC_000002.12:g.47476888G>C, NG_007110.2:g.78765G>C, NM_000251.2:c.2210+317G>C, NM_001258281.1:c.2012+317G>C, XM_005264332.1:c.2210+317G>C, XM_005264332.2:c.2210+317G>C, XM_005264333.1:c.2060+317G>C, XM_011532867.1:c.2210+317G>C, XR_939685.1:n.2282+317G>C, rs17224885, rs5023612, rs61203271
G > C
SNP
No VIP available CA VA
rs4646316 NC_000022.10:g.19952132C>T, NC_000022.11:g.19964609C>T, NG_011526.1:g.27870C>T, NM_000754.3:c.615+310C>T, NM_001135161.1:c.615+310C>T, NM_001135162.1:c.615+310C>T, NM_007310.2:c.465+310C>T, XM_005261229.1:c.615+310C>T, XM_011529885.1:c.729+310C>T, XM_011529886.1:c.729+310C>T, XM_011529887.1:c.615+310C>T, XM_011529888.1:c.615+310C>T, XM_011529889.1:c.615+310C>T, XM_011529890.1:c.615+310C>T, XM_011529891.1:c.615+310C>T, rs58510682
C > T
SNP
No VIP available No Clinical Annotations available VA
rs4646437 NC_000007.13:g.99365083G>A, NC_000007.14:g.99767460G>A, NG_008421.1:g.21726C>T, NM_001202855.2:c.671-205C>T, NM_017460.5:c.671-202C>T, XM_011515841.1:c.671-202C>T, XM_011515842.1:c.671-205C>T, rs386594232, rs57997883
G > A
SNP
No VIP available No Clinical Annotations available VA
rs4655567 NC_000001.10:g.68101640G>C, NC_000001.11:g.67635957G>C, rs57378090, rs57576059
G > C
SNP
No VIP available No Clinical Annotations available VA
rs465646 NC_000006.11:g.111620758G>A, NC_000006.12:g.111299555G>A, NM_001286431.1:c.*461C>T, NM_001286432.1:c.*461C>T, NM_002912.4:c.*461C>T, XM_005267088.1:c.*461C>T, XM_005267089.1:c.*461C>T, XM_006715543.2:c.*461C>T, XM_006715544.2:c.*461C>T, XM_011536028.1:c.*461C>T, XM_011536029.1:c.*461C>T, XM_011536030.1:c.*461C>T, XM_011536031.1:c.*461C>T, XM_011536032.1:c.*461C>T, XR_942871.1:n.2045+21397G>A, rs17511609, rs3805825, rs59824672
G > A
SNP
No VIP available No Clinical Annotations available VA
rs4834232 NC_000004.11:g.129024273C>T, NC_000004.12:g.128103118C>T, NM_001278604.1:c.814-4021C>T, NM_018078.3:c.814-4021C>T, NM_032239.3:c.814-4021C>T, NM_178043.2:c.814-4021C>T, XM_005263086.1:c.1417-4021C>T, XM_005263087.1:c.1417-4021C>T, XM_005263088.1:c.1417-4021C>T, XM_005263089.1:c.1273-4021C>T, XM_005263090.1:c.1417-4021C>T, XM_005263091.1:c.1417-4021C>T, XM_005263092.1:c.1417-4021C>T, XM_005263093.1:c.1417-4021C>T, XM_005263094.1:c.1417-4021C>T, XM_005263095.1:c.1417-4021C>T, XM_005263096.1:c.1417-4021C>T, XM_005263097.1:c.1417-4021C>T, XM_005263098.1:c.1417-4021C>T, XM_005263099.1:c.91-4021C>T, XM_005263100.1:c.91-4021C>T, XM_005263101.1:c.1417-4021C>T, XM_011532057.1:c.814-4021C>T, XM_011532058.1:c.814-4021C>T, XM_011532059.1:c.814-4021C>T, XM_011532060.1:c.814-4021C>T, XM_011532061.1:c.1276-4021C>T, XM_011532062.1:c.814-4021C>T, XM_011532063.1:c.814-4021C>T, XM_011532064.1:c.814-4021C>T, XM_011532065.1:c.1276-4021C>T, XM_011532066.1:c.814-4021C>T, XM_011532067.1:c.814-4021C>T, XM_011532068.1:c.673-4021C>T, XM_011532069.1:c.673-4021C>T, XM_011532070.1:c.814-4021C>T, XM_011532071.1:c.814-4021C>T, XM_011532072.1:c.814-4021C>T, XM_011532073.1:c.814-4021C>T, XM_011532074.1:c.814-4021C>T, XM_011532075.1:c.91-4021C>T, XM_011532076.1:c.91-4021C>T, XM_011532077.1:c.91-4021C>T, XM_011532078.1:c.814-4021C>T, XR_938753.1:n.891-4021C>T, XR_938754.1:n.891-4021C>T, XR_938755.1:n.891-4021C>T, XR_938756.1:n.891-4021C>T, XR_938757.1:n.891-4021C>T, XR_938758.1:n.891-4021C>T, XR_938759.1:n.891-4021C>T, XR_938760.1:n.891-4021C>T, XR_938761.1:n.891-4021C>T, XR_938762.1:n.891-4021C>T, rs17394472, rs59780448
C > T
SNP
No VIP available No Clinical Annotations available VA
rs4932551 NC_000015.10:g.91528728G>C, NC_000015.9:g.92071958G>C, rs17772730, rs56529178, rs57899076, rs58182249
G > C
SNP
No VIP available No Clinical Annotations available VA
rs5009910 NC_000002.11:g.31249014T>C, NC_000002.12:g.31026148T>C, NM_001253826.1:c.315-59846A>G, NM_001253827.1:c.70-33141A>G, NM_024572.3:c.130-33141A>G, NR_045602.1:n.903-33141A>G, XM_005264559.1:c.25-33141A>G, XM_011533104.1:c.448-33141A>G, XM_011533105.1:c.70-33141A>G, XM_011533106.1:c.43-33141A>G, rs56597185, rs59566663, rs60531112
T > C
SNP
No VIP available No Clinical Annotations available VA
rs560018 NC_000001.10:g.110200360T>C, NC_000001.11:g.109657738T>C, NM_000850.4:c.260-34T>C, NM_147148.2:c.260-34T>C, NR_024538.1:n.492-34T>C, XM_011541297.1:c.260-34T>C, XM_011541298.1:c.-53-34T>C, rs17531990, rs1800657, rs58086519
T > C
SNP
No VIP available No Clinical Annotations available VA
rs5906072 NC_000023.10:g.45640507T>C, NC_000023.11:g.45781104T>C, NW_004070879.1:g.105769T>C, rs59017433, rs59105359, rs6609373
T > C
SNP
No VIP available No Clinical Annotations available VA
rs5934731 NC_000023.10:g.9935844C>T, NC_000023.11:g.9967804C>T, NM_001195081.1:c.447C>T, NP_001182010.1:p.Tyr149=, XM_006724448.2:c.579C>T, XP_006724511.2:p.Tyr193=, rs56455686, rs57784312, rs6640581
C > T
SNP
Y149Y
No VIP available No Clinical Annotations available VA
rs60369023 NC_000001.10:g.20931474G>A, NC_000001.11:g.20604981G>A, NM_001785.2:c.208G>A, NP_001776.1:p.Ala70Thr
G > A
SNP
A70T
No VIP available No Clinical Annotations available VA
rs62107593 NC_000019.10:g.40287019C>G, NC_000019.9:g.40792926C>G, NG_012038.2:g.3340G>C, NM_001243027.2:c.-2072G>C, NM_001243028.2:c.-1979G>C, NM_001626.5:c.-1923G>C, XM_005258648.1:c.-1656G>C, XM_005258650.1:c.-1923G>C, XM_011526620.1:c.-1656G>C, XM_011526621.1:c.-2055G>C, XM_011526622.1:c.-1923G>C, XR_935967.1:n.169+420C>G
C > G
SNP
No VIP available CA VA
rs6413432 NC_000010.10:g.135348544T>A, NC_000010.11:g.133535040T>A, NG_008383.1:g.12678T>A, NM_000773.3:c.967+1143T>A, XM_005252665.1:c.1027+1143T>A
T > A
SNP
No VIP available No Clinical Annotations available VA
rs6458232 NC_000006.11:g.41629726C>A, NC_000006.12:g.41661988C>A, rs59690886
C > A
SNP
No VIP available No Clinical Annotations available VA
rs664393 NC_000013.10:g.29071001T>C, NC_000013.11:g.28496864T>C, NG_012003.1:g.3265A>G, NM_001159920.1:c.-2021A>G, NM_001160030.1:c.-2021A>G, NM_001160031.1:c.-2021A>G, NM_002019.4:c.-2021A>G, XM_011535014.1:c.-2021A>G, rs59180014
T > C
SNP
No VIP available No Clinical Annotations available VA
rs6752303 NC_000002.11:g.31247485T>C, NC_000002.12:g.31024619T>C, NM_001253826.1:c.315-58317A>G, NM_001253827.1:c.70-31612A>G, NM_024572.3:c.130-31612A>G, NR_045602.1:n.903-31612A>G, XM_005264559.1:c.25-31612A>G, XM_011533104.1:c.448-31612A>G, XM_011533105.1:c.70-31612A>G, XM_011533106.1:c.43-31612A>G, rs111184598, rs56566923, rs56952366, rs61068192
T > C
SNP
No VIP available No Clinical Annotations available VA
rs6848982 NC_000004.11:g.128959213G>A, NC_000004.12:g.128038058G>A, NM_001319305.1:c.*2245G>A, NM_001319306.1:c.*2245G>A, NM_001319307.1:c.*2245G>A
G > A
SNP
No VIP available No Clinical Annotations available VA
rs6877011 NC_000005.10:g.180602471C>G, NC_000005.9:g.180029471C>G, NG_011536.1:g.52154G>C, NM_182925.4:c.*721G>C, XM_011534477.1:c.*721G>C, XM_011534478.1:c.*721G>C, XM_011534482.1:c.*721G>C, XM_011534483.1:c.*721G>C, XM_011534484.1:c.*721G>C, rs59862001
C > G
SNP
No VIP available CA VA
rs698 NC_000004.11:g.100260789T>C, NC_000004.12:g.99339632T>C, NG_011718.1:g.18129A>G, NM_000669.4:c.1048A>G, NP_000660.1:p.Ile350Val, NR_133005.1:n.1374A>G, XM_011531588.1:c.946A>G, XM_011531589.1:c.928A>G, XP_011529890.1:p.Ile316Val, XP_011529891.1:p.Ile310Val, rs1042758, rs117472071, rs1693473, rs17399447, rs17855753, rs3182222, rs4134508, rs56906178
T > -
T > C
SNP
I350V
No VIP available No Clinical Annotations available VA
rs7121 NC_000020.10:g.57478807C>T, NC_000020.11:g.58903752C>T, NG_016194.1:g.69013C>T, NM_000516.5:c.393C>T, NM_001077488.3:c.396C>T, NM_001077489.3:c.348C>T, NM_001077490.2:c.*254C>T, NM_001309840.1:c.216C>T, NM_001309861.1:c.216C>T, NM_016592.3:c.*299C>T, NM_080425.3:c.2322C>T, NM_080426.3:c.351C>T, NP_000507.1:p.Ile131=, NP_001070956.1:p.Ile132=, NP_001070957.1:p.Ile116=, NP_001296769.1:p.Ile72=, NP_001296790.1:p.Ile72=, NP_536350.2:p.Ile774=, NP_536351.1:p.Ile117=, NR_003259.1:n.483C>T, XM_005260396.1:c.336C>T, XM_005260397.1:c.297C>T, XM_005260398.1:c.252C>T, XM_005260399.1:c.171C>T, XM_005260400.1:c.171C>T, XM_005260401.1:c.171C>T, XM_005260402.1:c.219C>T, XP_005260453.1:p.Ile112=, XP_005260454.1:p.Ile99=, XP_005260455.1:p.Ile84=, XP_005260456.1:p.Ile57=, XP_005260457.1:p.Ile57=, XP_005260458.1:p.Ile57=, XP_005260459.1:p.Ile73=, XR_244140.1:n.1443C>T, rs1053389, rs17829840, rs3171206, rs3730167, rs61041002
C > -
C > T
SNP
I131I
No VIP available No Clinical Annotations available VA
rs7131224 NC_000011.10:g.24225985T>C, NC_000011.9:g.24247531T>C, rs111186995, rs58002303, rs58056067
T > C
SNP
No VIP available No Clinical Annotations available VA
rs715171 NC_000023.10:g.9341848C>T, NC_000023.11:g.9373808C>T, rs61410664
C > T
SNP
No VIP available No Clinical Annotations available VA
rs7170769 NC_000015.10:g.91526975C>T, NC_000015.9:g.92070205C>T, rs58543442
C > T
SNP
No VIP available No Clinical Annotations available VA
rs717620 NC_000010.10:g.101542578C>T, NC_000010.11:g.99782821C>T, NG_011798.1:g.5116C>T, NM_000392.4:c.-24C>T, XM_005269536.1:c.-24C>T, XM_006717631.2:c.-24C>T, XM_011539291.1:c.-24C>T, XR_945604.1:n.166C>T, XR_945605.1:n.168C>T, rs17216163, rs386485129, rs58371376
C > T
SNP
No VIP available CA VA
rs7186128 NC_000016.10:g.16864058G=, NC_000016.10:g.16864058G>A, NC_000016.9:g.16957915G>A, NT_187607.1:g.2524971A=, NT_187607.1:g.2524971A>G, rs56576370, rs57245322, rs58011988
G > A
SNP
No VIP available CA VA
rs720106 NC_000011.10:g.4118748T>C, NC_000011.9:g.4139978T>C, NG_027992.2:g.29055T>C, NM_001033.3:c.792+287T>C, NM_001033.4:c.792+287T>C, NM_001318064.1:c.501+287T>C, NM_001318065.1:c.-265+287T>C, XM_005253058.1:c.549+287T>C, XM_005253059.1:c.501+287T>C, XM_011520277.1:c.501+287T>C, XM_011520278.1:c.126+287T>C, XM_011520279.1:c.-265+287T>C
T > C
SNP
No VIP available No Clinical Annotations available VA
rs725518 NC_000011.10:g.4107615G>A, NC_000011.9:g.4128845G>A, NG_027992.2:g.17922G>A, NM_001033.3:c.387+80G>A, NM_001033.4:c.387+80G>A, NM_001318064.1:c.96+80G>A, XM_005253058.1:c.202+1476G>A, XM_005253059.1:c.96+80G>A, XM_011520277.1:c.96+80G>A, rs17423023, rs386608733, rs61333041
G > A
SNP
No VIP available CA VA
rs726501 NC_000005.10:g.56832039G>A, NC_000005.9:g.56127866G>A, NG_031884.1:g.21967G>A, NM_005921.1:c.482+15984G>A, XM_005248519.1:c.71+11223G>A, XM_005248519.3:c.104+11223G>A, XM_005248520.1:c.-8+14923G>A, XM_011543406.1:c.227+15704G>A, XM_011543407.1:c.482+15984G>A, XM_011543408.1:c.482+15984G>A, rs57031684
G > A
SNP
No VIP available No Clinical Annotations available VA
rs74090038 NC_000014.8:g.105262781C>T, NC_000014.9:g.104796444C>T, NG_012188.1:g.4300G>A, NG_042073.1:g.264C>T, NM_001014431.1:c.-1041G>A, NM_001014432.1:c.-1125G>A, XM_005267401.1:c.-2405G>A, XM_011536543.1:c.-2583G>A, XM_011536544.1:c.-3397G>A
C > T
SNP
No VIP available No Clinical Annotations available VA
rs7483 NC_000001.10:g.110279701C>T, NC_000001.11:g.109737079C>T, NM_000849.4:c.670G>A, NP_000840.2:p.Val224Ile, NR_024537.1:n.904G>A, XM_011541296.1:c.889G>A, XP_011539598.1:p.Val297Ile, rs17845187, rs17857997, rs3167664, rs386610559, rs52802282, rs58618587
C > -
C > T
SNP
V224I
No VIP available No Clinical Annotations available VA
rs7608731 NC_000002.11:g.31249974T>C, NC_000002.12:g.31027108T>C, NM_001253826.1:c.315-60806A>G, NM_001253827.1:c.70-34101A>G, NM_024572.3:c.130-34101A>G, NR_045602.1:n.903-34101A>G, XM_005264559.1:c.25-34101A>G, XM_011533104.1:c.448-34101A>G, XM_011533105.1:c.70-34101A>G, XM_011533106.1:c.43-34101A>G, rs56452495, rs57143999
T > C
SNP
No VIP available No Clinical Annotations available VA
rs763110 NC_000001.10:g.172627498C=, NC_000001.10:g.172627498C>T, NC_000001.11:g.172658358C=, NC_000001.11:g.172658358C>T, NG_007269.1:g.4314C=, NG_007269.1:g.4314C>T, NM_000639.2:c.-157-687C>T, NM_000639.2:c.-844C=, NM_001302746.1:c.-844C=, NM_001302746.1:c.-844C>T, rs59042607
C > T
SNP
No VIP available No Clinical Annotations available VA
rs7664413 NC_000004.11:g.177608707C>T, NC_000004.12:g.176687553C>T, NG_034216.1:g.110193G>A, NM_005429.4:c.812-33G>A, XR_939498.1:n.260+7803C>T, XR_939499.1:n.209+17844C>T, rs58304891
C > T
SNP
No VIP available No Clinical Annotations available VA
rs7667298 NC_000004.11:g.55991731T>C, NC_000004.12:g.55125564T>C, NG_012004.1:g.5032A>G, NM_002253.2:c.-271A>G, rs386485376, rs60563091
T > C
SNP
No VIP available CA VA
rs7851395 NC_000009.11:g.116002464A>G, NC_000009.12:g.113240184A>G, NM_001859.3:c.-35-15930A>G
A > G
SNP
No VIP available CA VA
rs7937567
G > A
SNP
No VIP available No Clinical Annotations available VA
rs7940013 NC_000011.10:g.4117074C>T, NC_000011.9:g.4138304C>T, NG_027992.2:g.27381C>T, NM_001033.3:c.651-1246C>T, NM_001033.4:c.651-1246C>T, NM_001318064.1:c.360-1246C>T, NM_001318065.1:c.-407+714C>T, XM_005253058.1:c.408-1246C>T, XM_005253059.1:c.360-1246C>T, XM_011520277.1:c.360-1246C>T, XM_011520278.1:c.-17+714C>T, XM_011520279.1:c.-407+714C>T, rs59381386, rs61670155
C > T
SNP
No VIP available No Clinical Annotations available VA
rs7993418 NC_000013.10:g.28883061G>A, NC_000013.11:g.28308924G>A, NG_012003.1:g.191205C>T, NM_002019.4:c.3639C>T, NP_002010.2:p.Tyr1213=, rs117224149, rs57281829
G > A
SNP
Y1213Y
No VIP available No Clinical Annotations available VA
rs8020368 NC_000014.8:g.95943548T>C, NC_000014.9:g.95477211T>C, NM_152592.3:c.-1390A>G, XM_005267376.1:c.-14-1376A>G, XM_005267376.3:c.176-1376A>G, XM_005267377.1:c.-14-1376A>G, XM_005267377.2:c.-14-1376A>G, XM_005267378.1:c.-14-1376A>G, XM_005267379.1:c.-14-1376A>G, XM_005267380.1:c.-14-1376A>G, XM_006720063.2:c.-14-1376A>G, XM_011536513.1:c.176-1376A>G, XM_011536514.1:c.176-1376A>G, XM_011536515.1:c.11-1376A>G, XM_011536516.1:c.176-1376A>G, rs56427699, rs58836477, rs59378010
T > C
SNP
No VIP available No Clinical Annotations available VA
rs8175347
(TA)6 > (TA)5
(TA)6 > (TA)7
(TA)6 > (TA)8
microsatellite
No VIP available No Clinical Annotations available VA
rs8187710 NC_000010.10:g.101611294G>A, NC_000010.11:g.99851537G>A, NG_011798.1:g.73832G>A, NM_000392.4:c.4544G>A, NP_000383.1:p.Cys1515Tyr, XM_005269536.1:c.4265G>A, XM_006717630.2:c.3848G>A, XP_005269593.1:p.Cys1422Tyr, XP_006717693.1:p.Cys1283Tyr, XR_945605.1:n.4608G>A, rs17222568, rs52804507, rs58135906
G > A
SNP
C1515Y
No VIP available No Clinical Annotations available VA
rs833061 NC_000006.11:g.43737486C>T, NC_000006.12:g.43769749C>T, NG_008732.1:g.4534C>T, NM_001025366.2:c.-958C>T, NM_001025367.2:c.-958C>T, NM_001025368.2:c.-958C>T, NM_001025369.2:c.-958C>T, NM_001025370.2:c.-958C>T, NM_001033756.2:c.-958C>T, NM_001171622.1:c.-958C>T, NM_001171623.1:c.-1498C>T, NM_001171624.1:c.-1498C>T, NM_001171625.1:c.-1498C>T, NM_001171626.1:c.-1498C>T, NM_001171627.1:c.-1498C>T, NM_001171628.1:c.-1498C>T, NM_001171629.1:c.-1498C>T, NM_001171630.1:c.-1498C>T, NM_001204384.1:c.-1498C>T, NM_001204385.1:c.-958C>T, NM_001317010.1:c.-1498C>T, NM_003376.5:c.-958C>T, rs36208046, rs60746584
C > T
SNP
No VIP available No Clinical Annotations available VA
rs861539 NC_000014.8:g.104165753G>A, NC_000014.9:g.103699416G>A, NG_011516.1:g.21071C>T, NG_012307.1:g.75229G>A, NM_001100118.1:c.722C>T, NM_001100119.1:c.722C>T, NM_001130107.1:c.1782-1239G>A, NM_005432.3:c.722C>T, NM_182923.3:c.1651-1239G>A, NP_001093588.1:p.Thr241Met, NP_001093589.1:p.Thr241Met, NP_005423.1:p.Thr241Met, XM_005267599.1:c.1924-1239G>A, XM_005267600.1:c.*17-1239G>A, XM_005267602.1:c.1897-1239G>A, XM_005267603.1:c.*17-1239G>A, XM_005267604.1:c.1857-1239G>A, XM_005267605.1:c.1849-1239G>A, XM_005267606.1:c.*17-1239G>A, XM_005267607.1:c.1830-1239G>A, XM_005267608.1:c.1825-1239G>A, XM_005267609.1:c.1822-1239G>A, XM_005267610.1:c.*46-1239G>A, XM_005267612.1:c.*17-1239G>A, XM_005267613.1:c.1758-1239G>A, XM_005267614.1:c.1755-1239G>A, XM_005267615.1:c.1726-1239G>A, XM_005267616.1:c.*17-1239G>A, XM_005267617.1:c.1699-1239G>A, XM_005267618.1:c.*17-1239G>A, XM_005267624.1:c.1624-1239G>A, XM_005268045.1:c.722C>T, XM_005268046.1:c.722C>T, XM_005268047.1:c.722C>T, XM_011537138.1:c.722C>T, XP_005268102.1:p.Thr241Met, XP_005268103.1:p.Thr241Met, XP_005268104.1:p.Thr241Met, XP_011535440.1:p.Thr241Met, rs1734804, rs17435402, rs17850783, rs3212111, rs56934996
G > A
SNP
T241M
No VIP available CA VA
rs9332377 NC_000022.10:g.19955692C>T, NC_000022.11:g.19968169C>T, NG_011526.1:g.31430C>T, NG_023326.1:g.53618G>A, NM_000754.3:c.616-367C>T, NM_001135161.1:c.616-367C>T, NM_001135162.1:c.616-367C>T, NM_007310.2:c.466-367C>T, XM_005261229.1:c.616-367C>T, XM_005261242.1:c.2764-960G>A, XM_006724243.1:c.2782-960G>A, XM_006724246.2:c.2536-960G>A, XM_011529885.1:c.*742C>T, XM_011529886.1:c.730-367C>T, XM_011529887.1:c.*742C>T, XM_011529888.1:c.*742C>T, XM_011529889.1:c.*742C>T, XM_011529890.1:c.*742C>T, XM_011529891.1:c.*742C>T, XM_011530179.1:c.2749-960G>A, XM_011530182.1:c.1348-960G>A, rs60676269
C > T
SNP
No VIP available No Clinical Annotations available VA
rs939338 NC_000003.11:g.183704068G>A, NC_000003.12:g.183986280G>A, NM_001023587.2:c.592-902C>T, NM_001320032.1:c.-941+1490C>T, NM_005688.3:c.591+1490C>T, NR_135125.1:n.778-825C>T, XM_005247058.1:c.591+1490C>T, XM_005247058.3:c.591+1490C>T, XM_005247059.1:c.591+1490C>T, XM_005247059.3:c.591+1490C>T, XM_005247060.1:c.591+1490C>T, XM_005247061.1:c.591+1490C>T, XM_005247062.1:c.-941+1490C>T, XM_011512314.1:c.591+1490C>T, XM_011512315.1:c.591+1490C>T, XM_011512316.1:c.-941+1490C>T, rs17218204, rs3749439, rs56440939, rs59349069
G > A
SNP
No VIP available CA VA
rs9597 NC_000016.10:g.1324950C>G, NC_000016.9:g.1374951C>G, NM_003345.4:c.*157C>G, NM_194259.2:c.*157C>G, NM_194260.2:c.*157C>G, NM_194261.2:c.*157C>G, XM_005255544.1:c.*157C>G, rs74248366
C > G
SNP
No VIP available CA VA
rs9679162 NC_000002.11:g.31247514G>T, NC_000002.12:g.31024648G>T, NM_001253826.1:c.315-58346C>A, NM_001253827.1:c.70-31641C>A, NM_024572.3:c.130-31641C>A, NR_045602.1:n.903-31641C>A, XM_005264559.1:c.25-31641C>A, XM_011533104.1:c.448-31641C>A, XM_011533105.1:c.70-31641C>A, XM_011533106.1:c.43-31641C>A, rs56573917, rs57478659, rs60984987
G > T
SNP
No VIP available No Clinical Annotations available VA
rs9937 NC_000011.10:g.4138227A>G, NC_000011.9:g.4159457A>G, NG_027992.2:g.48534A>G, NM_001033.3:c.2223A>G, NM_001033.4:c.2223A>G, NM_001318064.1:c.1932A>G, NM_001318065.1:c.1209A>G, NP_001024.1:p.Thr741=, NP_001304993.1:p.Thr644=, NP_001304994.1:p.Thr403=, XM_005253058.1:c.1980A>G, XM_005253059.1:c.1932A>G, XM_011520277.1:c.1932A>G, XM_011520278.1:c.1557A>G, XM_011520279.1:c.1209A>G, XP_005253115.1:p.Thr660=, XP_005253116.1:p.Thr644=, XP_011518579.1:p.Thr644=, XP_011518580.1:p.Thr519=, XP_011518581.1:p.Thr403=, rs1042857, rs17295553, rs17349998, rs17398272, rs17850106, rs2228120, rs3177016, rs59628733
A > G
SNP
T741T
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 147

Overview

Generic Names
  • CACP
  • CPDC
  • CPDD
  • Cis-DDP
  • Cis-Diaminedichloroplatinum
  • Cis-Diamminedichloroplatinum
  • DDP
  • DDPT
  • Diamminedichloroplatinum
  • Platinum Ammine Chloride
  • Platinum Ammonium Chloride
  • Platinum Diamine Dichloride
  • Trans-DDP
  • Trans-Diaminedichloroplatinum
  • Trans-Diamminedichloroplatinum
  • Trans-Dichlorodiammine Platinum
  • Trans-Platinumdiammine Dichloride
Trade Names
  • Abiplatin
  • Biocisplatinum
  • Briplatin
  • Carboquone
  • Cis Pt II
  • Cismaplat
  • Cisplatine
  • Cisplatyl
  • Citoplationo
  • Lederplatin
  • Neoplatin
  • Plastin
  • Platamine
  • Platiblastin
  • Platidiam
  • Platinex
  • Platinol
  • Platinol-AQ
  • Platinoxan
  • Randa
Brand Mixture Names

PharmGKB Accession Id

PA449014

Type(s):

Drug

Description

Cisplatin, cisplatinum or cis-diamminedichloroplatinum(II) (CDDP) is a platinum-based chemotherapy drug used to treat various types of cancers, including sarcomas, some carcinomas (e.g. small cell lung cancer, and ovarian cancer), lymphomas and germ cell tumors. It was the first member of its class, which now also includes carboplatin and oxaliplatin.

Source: Drug Bank

Indication

For the treatment of metastatic testicular tumors, metastatic ovarian tumors and advanced bladder cancer.

Source: Drug Bank

Other Vocabularies

Information pulled from DrugBank has not been reviewed by PharmGKB.

Pharmacology, Interactions, and Contraindications

Mechanism of Action

Alkylating agents work by three different mechanisms: 1) attachment of alkyl groups to DNA bases, resulting in the DNA being fragmented by repair enzymes in their attempts to replace the alkylated bases, preventing DNA synthesis and RNA transcription from the affected DNA, 2) DNA damage via the formation of cross-links (bonds between atoms in the DNA) which prevents DNA from being separated for synthesis or transcription, and 3) the induction of mispairing of the nucleotides leading to mutations.

Source: Drug Bank

Pharmacology

Cisplatin is an antineoplastic in the class of alkylating agents and is used to treat various forms of cancer. Alkylating agents are so named because of their ability to add alkyl groups to many electronegative groups under conditions present in cells. They stop tumor growth by cross-linking guanine bases in DNA double-helix strands - directly attacking DNA. This makes the strands unable to uncoil and separate. As this is necessary in DNA replication, the cells can no longer divide. In addition, these drugs add methyl or other alkyl groups onto molecules where they do not belong which in turn inhibits their correct utilization by base pairing and causes a miscoding of DNA. Alkylating agents are cell cycle-nonspecific. Alkylating agents work by three different mechanisms all of which achieve the same end result - disruption of DNA function and cell death.

Source: Drug Bank

Food Interaction

Echinacea should be used with caution, if at all, in patients receiving therapeutic immunosuppressants. Monitor for reduced efficacy of the immunosuppressant during concomitant use.

Source: Drug Bank

Absorption, Distribution, Metabolism, Elimination & Toxicity

Protein Binding

Greater than 90%.

Source: Drug Bank

Half-Life

20-30 minutes

Source: Drug Bank

Clearance

Source: Drug Bank

Route of Elimination

The parent compound, cisplatin, is excreted in the urine. Although small amounts of platinum are present in the bile and large intestine after administration of cisplatin, the fecal excretion of platinum appears to be insignificant.

Source: Drug Bank

Chemical Properties

Chemical Formula

Cl2H6N2Pt

Source: Drug Bank

Isomeric SMILES

[NH3][Pt]([NH3])(Cl)Cl

Source: OpenEye

Canonical SMILES

N[Pt](N)(Cl)Cl

Source: Drug Bank

Average Molecular Weight

300.051

Source: Drug Bank

Monoisotopic Molecular Weight

298.955578065

Source: Drug Bank

SMILES

N[Pt](N)(Cl)Cl

Source: Drug Bank

InChI String

InChI=1S/2ClH.2H2N.Pt/h2*1H;2*1H2;/q;;2*-1;+4/p-2

Source: Drug Bank

Genes that are associated with this drug in PharmGKB's database based on (1) variant annotations, (2) literature review, (3) pathways or (4) information automatically retrieved from DrugBank, depending on the "evidence" and "source" listed below.

Curated Information ?

EvidenceGene
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABCA1
ABCB1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABCB11
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABCB4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABCC1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ABCC2
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ABCC3
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ABCC4
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ABCC5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABCC8
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABCG2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABL1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ACSS2
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ACYP2
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ADH1C
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
AKT1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
AKT2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ALDH7A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
APAF1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
APC
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ATAD5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ATM
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ATP7A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ATP7B
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ATP8B4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BAX
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BCL2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BCL2L1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BHLHE41
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BID
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BIRC3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BRCA1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BRCA2
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
C18orf56
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CAMTA1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CASP3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CCNG2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CD24
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CDA
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CDKN2A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CDKN2D
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CHRNA3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CHRNA5
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CMPK1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
COMT
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
CSNK2A3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CTSA
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CYP1B1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CYP24A1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
CYP2E1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
CYP3A4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DBP
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
DCBLD1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DCK
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DCTD
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DDIT4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DHFR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DNAJC15
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DPYD
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
DUX1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
EBF3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
EGFR
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
EIF3A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
EPHA2
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
EPHX1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
EPO
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ERBB2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ERBB3
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ERCC1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ERCC2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ERCC4
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
ERCC5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ERCC6
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ESR1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FAM57A
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
FASLG
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FCHSD1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FGFR2
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
FLT1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
FLT4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FPGS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
FUS
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
GALNT14
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
GALNT18
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GATM
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GCLC
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GCLM
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GDNF
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GJA1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GJB2
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
GNAS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GPX1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GPX2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GPX3
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
GPX5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GPX6
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GPX7
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSS
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
GSTA1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTA2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTA3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTA4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTA5
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
GSTM1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTM2
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
GSTM3
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
GSTM4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTM5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTO1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTO2
GSTP1
GSTT1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTT2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GSTZ1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GTF2H2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HAVCR1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HDAC10
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HIF1A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HIST1H4D
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HMOX1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HNF1A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HNF1B
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HOXB9
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HPRT1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HYKK
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IGFBP1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IGFBP2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IGFBP3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IL15
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IQGAP2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IRF2BP2
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
KDR
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
KIT
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
KLC3
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
LARP1B
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
LIG3
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
LRP2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
LRRC32
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
MAP3K1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MAPK12
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MCL1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MDM2
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
MECP2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MET
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MGMT
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MKI67
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MLH1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
MLLT3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MMP9
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
MSH2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MT-RNR1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MT-TL1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MT-TS1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
MTHFR
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
MTOR
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
MTR
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
MUTYH
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MVP
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MYC
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MYO5B
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NAT1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
NAT2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NBAS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NBEAL2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NEK2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NFE2L2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NOX1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NOX3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NOX4
NQO1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
NR1I2
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
NRAS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NRG3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NT5C2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NTF3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
NUF2
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
OTOS
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PARD6B
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PDGFRA
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PDGFRB
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PFKFB4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PGM1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
PIK3CA
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PPP1R15A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PQLC3
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
PTEN
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
RAD51
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
RAD52
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
RAF1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
RARS
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
REV1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
REV3L
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
RRM1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
RRM2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
RUNX3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SERPINA3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SERPINB5
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SHMT1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SHMT2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC16A7
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SLC19A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC22A1
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SLC22A2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC22A6
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC22A8
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC26A4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC29A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC29A2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC2A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC2A2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC2A9
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
SLC31A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC47A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC47A2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC5A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC5A2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC6A10P
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC6A18
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC6A4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLC6A8
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLCO1A2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLCO1B1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLCO1B3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SLCO2B1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SORBS2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
STK17A
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
SUMO1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
SYNE3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TAF9B
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TAP1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TAP2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TGM2
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
THOC6
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TMEM154
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TMEM37
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TOP1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TOP2A
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
TP53
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TP73
No Dosing Guideline available DL CA VA No VIP available No VIP available
TPMT
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TRPM6
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TRPV1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TWIST1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
TYMS
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
UBE2I
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
UGT1A1
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
UGT1A9
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
UMPS
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
VEGFA
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
WDFY4
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
WDR54
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
XIAP
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
XPA
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
XPC
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
XRCC1
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
XRCC2
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
XRCC3
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
XRCC5

Drug Interactions

Interaction Description
amikacin - cisplatin Increased risk of nephrotoxicity (source: Drug Bank)
bumetanide - cisplatin Increased ototoxicity (source: Drug Bank)
bumetanide - cisplatin Increased ototoxicity (source: Drug Bank)
ethacrynic acid - cisplatin Increased ototoxicity (source: Drug Bank)
ethacrynic acid - cisplatin Increased ototoxicity (source: Drug Bank)
fosphenytoin - cisplatin The antineoplasic agent decreases the effect of hydantoin (source: Drug Bank)
furosemide - cisplatin Increased ototoxicity (source: Drug Bank)
furosemide - cisplatin Increased ototoxicity (source: Drug Bank)
gentamicin - cisplatin Increased risk of nephrotoxicity (source: Drug Bank)
gentamicin - cisplatin Increased risk of nephrotoxicity (source: Drug Bank)
methotrexate - cisplatin Cisplatin increases methotrexate toxicity (source: Drug Bank)
methotrexate - cisplatin Cisplatin increases methotrexate toxicity (source: Drug Bank)
netilmicin - cisplatin Increased risk of nephrotoxicity (source: Drug Bank)
paclitaxel - cisplatin Cisplatin increases the effect and toxicity of paclitaxel (source: Drug Bank)
paclitaxel - cisplatin Cisplatin increases the effect and toxicity of paclitaxel (source: Drug Bank)
phenytoin - cisplatin The antineoplasic agent decreases the effect of hydantoin (source: Drug Bank)
phenytoin - cisplatin The antineoplasic agent decreases the effect of hydantoin (source: Drug Bank)
topotecan - cisplatin Administration of Topotecan after Cisplatin therapy may increase the risk of hematologic toxicity, such as neutropenia and/or thrombocytopenia. A dose adjustment may be required or the sequence of administration reversed. (source: Drug Bank)
trastuzumab - cisplatin Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank)

Curated Information ?

EvidenceDisease
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Acquired Immunodeficiency Syndrome
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Adenocarcinoma
No Dosing Guideline available DL CA VA No VIP available No VIP available
Anemia
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Brain Neoplasms
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Breast Neoplasms
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Carcinoma, Hepatocellular
No Dosing Guideline available DL CA VA No VIP available No VIP available
Carcinoma, Non-Small-Cell Lung
No Dosing Guideline available DL CA VA No VIP available No VIP available
Carcinoma, Small Cell
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cholangiocarcinoma
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cholestasis
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Colitis, Ulcerative
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Colonic Neoplasms
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Colorectal Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
creatinine clearance
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Crohn Disease
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Deafness
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Death
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Diarrhea
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Disease Progression
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Drug Resistance
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Drug Toxicity
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
drug-induced liver injury
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Earache
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Esophageal Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Esophogeal Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
event-free survival
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gallbladder Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gastrointestinal Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gastrointestinal Stromal Tumors
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genital Neoplasms, Female
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Head and Neck Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Hepatitis
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HIV
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Hypertension
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Kidney Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukopenia
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Lung Diseases
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Lung Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Lupus Erythematosus, Systemic
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Lymphoma, Non-Hodgkin
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Medulloblastoma
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Mesothelioma
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Muscular Diseases
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Myalgia unspecified
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Myopathy, Central Core
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Nasopharyngeal Neoplasms
No Dosing Guideline available DL CA VA No VIP available No VIP available
Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Neoplasms, Germ Cell and Embryonal
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
nephrotoxicity
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Neuroblastoma
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Neurotoxicity Syndromes
No Dosing Guideline available DL CA VA No VIP available No VIP available
Neutropenia
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Oligospermia
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Osteosarcoma
No Dosing Guideline available DL CA VA No VIP available No VIP available
Ototoxicity
No Dosing Guideline available DL CA VA No VIP available No VIP available
Ovarian Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
overall survival
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pancreatic Neoplasms
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
Peripheral Nervous System Diseases
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pneumonia
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
progression-free survival
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Rectal Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Recurrence
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Stevens-Johnson Syndrome
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Stomach Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Teratoma
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Testicular Neoplasms
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
Thrombocytopenia
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Tinnitus
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Tobacco Use Disorder
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Toxic liver disease
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Tuberculosis
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Urinary Bladder Neoplasms
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Uterine Cervical Neoplasms

Relationships from National Drug File - Reference Terminology (NDF-RT)

May Treat
Contraindicated With

Publications related to cisplatin: 169

No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic predictors of toxicity to platinum based chemotherapy in non-small cell lung cancer patients. Pharmacological research. 2016. Pérez-Ramírez Cristina, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Clinical Evaluation of Cisplatin Sensitivity of Germline Polymorphisms in Neoadjuvant Chemotherapy for Urothelial Cancer. Clinical genitourinary cancer. 2016. O'Donnell Peter H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacokinetic interaction between pazopanib and cisplatin regimen. Cancer chemotherapy and pharmacology. 2016. Imbs Diane-Charlotte, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Replication of a genetic variant in ACYP2 associated with cisplatin-induced hearing loss in patients with osteosarcoma. Pharmacogenetics and genomics. 2016. Vos Hanneke I, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MicroRNA-509-3p increases the sensitivity of epithelial ovarian cancer cells to cisplatin-induced apoptosis. Pharmacogenomics. 2016. Chen Wei, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Targeting therapeutic liabilities engendered by PIK3R1 mutations for cancer treatment. Pharmacogenomics. 2016. Cheung Lydia Wt, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Improvement of a predictive model in ovarian cancer patients submitted to platinum-based chemotherapy: implications of a GST activity profile. European journal of clinical pharmacology. 2016. Pereira Deolinda, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Molecular determinants of chemotherapy resistance in ovarian cancer. Pharmacogenomics. 2015. Cooley Megan, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics in the treatment of lung cancer: an update. Pharmacogenomics. 2015. Morales-Espinosa Daniela, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
A First Step toward Personalized Medicine in Osteosarcoma: Pharmacogenetics as Predictive Marker of Outcome after Chemotherapy-Based Treatment. Clinical cancer research : an official journal of the American Association for Cancer Research. 2015. Hagleitner Melanie M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Carboplatin/taxane-induced gastrointestinal toxicity: a pharmacogenomics study on the SCOTROC1 trial. The pharmacogenomics journal. 2015. He Y J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Translesion polymerase genes polymorphisms and haplotypes influence survival of osteosarcoma patients. Omics : a journal of integrative biology. 2015. Goričar Katja, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Human OCT2 variant c.808G>T confers protection effect against cisplatin-induced ototoxicity. Pharmacogenomics. 2015. Lanvers-Kaminsky Claudia, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Report of New Haplotype for ABCC2 Gene: rs17222723 and rs8187718 in cis. The Journal of molecular diagnostics : JMD. 2015. Pratt Victoria M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Common variants in ACYP2 influence susceptibility to cisplatin-induced hearing loss. Nature genetics. 2015. Xu Heng, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variability of DNA repair mechanisms and glutathione-S-transferase genes influences treatment outcome in osteosarcoma. Cancer epidemiology. 2015. Goričar Katja, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Correlation of UGT1A1 and ERCC1 gene polymorphisms with the outcome of combined irinotecan plus cisplatin treatment in recurrent ovarian cancer. Genetics and molecular research : GMR. 2015. Xu Q, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CD24 and APC Genetic Polymorphisms in Pancreatic Cancers as Potential Biomarkers for Clinical Outcome. PloS one. 2015. Shamai Sivan, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Glutathione S-Transferase Gene Polymorphisms and Treatment Outcome in Cervical Cancer Patients under Concomitant Chemoradiation. PloS one. 2015. Abbas Mohammad, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of the DNA repair pathways in advanced non-small cell lung cancer patients treated with platinum-based chemotherapy. Cancer letters. 2014. Sullivan Ivana, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic markers of cisplatin-induced hearing loss in children. Clinical pharmacology and therapeutics. 2014. Carleton B C, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variation in Otos is associated with cisplatin-induced ototoxicity. Pharmacogenomics. 2014. Spracklen Timothy F, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Evaluation of pharmacogenetic markers to predict the risk of Cisplatin-induced ototoxicity. Clinical pharmacology and therapeutics. 2014. Lanvers-Kaminsky C, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic variants in the glutathione S-transferase genes and survival in colorectal cancer patients after chemotherapy and differences according to treatment with oxaliplatin. Pharmacogenetics and genomics. 2014. Kap Elisabeth J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Application of next generation sequencing to CEPH cell lines to discover variants associated with FDA approved chemotherapeutics. BMC research notes. 2014. Hariani Gunjan D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PharmGKB summary: very important pharmacogene information for N-acetyltransferase 2. Pharmacogenetics and genomics. 2014. McDonagh Ellen M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Epigenetic perspectives on cancer chemotherapy response. Pharmacogenomics. 2014. Liu Mou-Ze, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenomic assessment of cisplatin-based chemotherapy outcomes in ovarian cancer. Pharmacogenomics. 2014. Khrunin Andrey V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Challenges in interpreting the evidence for genetic predictors of ototoxicity. Clinical pharmacology and therapeutics. 2013. Ratain M J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of DNA repair gene polymorphisms in non-small-cell lung carcinoma patients on platinum-based chemotherapy. Genetics and molecular research : GMR. 2014. Zhang L, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Tumor angiogenesis genotyping and efficacy of first-line chemotherapy in metastatic gastric cancer patients. Pharmacogenomics. 2013. Scartozzi Mario, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ERCC1 Cys8092Ala and XRCC1 Arg399Gln polymorphisms predict progression-free survival after curative radiotherapy for nasopharyngeal carcinoma. PloS one. 2014. Jin Hekun, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Influence of genetic variants in TPMT and COMT associated with cisplatin induced hearing loss in patients with cancer: two new cohorts and a meta-analysis reveal significant heterogeneity between cohorts. PloS one. 2014. Hagleitner Melanie M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Replication of TPMT and ABCC3 Genetic Variants Highly Associated With Cisplatin-Induced Hearing Loss in Children. Clinical pharmacology and therapeutics. 2013. Pussegoda K, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The Role of Inherited TPMT and COMT Genetic Variation in Cisplatin-Induced Ototoxicity in Children With Cancer. Clinical pharmacology and therapeutics. 2013. Yang J J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ERCC1 C8092A (rs3212986) polymorphism as a predictive marker in esophageal cancer patients treated with cisplatin/5-FU-based neoadjuvant therapy. Pharmacogenetics and genomics. 2013. Rumiato Enrica, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Understanding platinum-induced ototoxicity. Trends in pharmacological sciences. 2013. Langer Thorsten, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of ABCB1 genetic polymorphisms with susceptibility to colorectal cancer and therapeutic prognosis. Pharmacogenomics. 2013. Wu Huizhe, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
A phase I/II pharmacokinetic and pharmacogenomic study of calcitriol in combination with cisplatin and docetaxel in advanced non-small-cell lung cancer. Cancer chemotherapy and pharmacology. 2013. Ramnath N, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Cisplatin-induced ototoxicity in pediatric solid tumors: the role of glutathione S-transferases and megalin genetic polymorphisms. Journal of pediatric hematology/oncology. 2013. Choeyprasert Worawut, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Glutathione S-transferase P1 single nucleotide polymorphism predicts permanent ototoxicity in children with medulloblastoma. Pediatric blood & cancer. 2013. Rednam Surya, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DNA repair and cytotoxic drugs: the potential role of RAD51 in clinical outcome of non-small-cell lung cancer patients. Pharmacogenomics. 2013. Nogueira Augusto, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A genome-wide association study of survival in small-cell lung cancer patients treated with irinotecan plus cisplatin chemotherapy. The pharmacogenomics journal. 2013. Han J-Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Association between eIF3alpha polymorphism and severe toxicity caused by platinum-based chemotherapy in non-small cell lung cancer patients. British journal of clinical pharmacology. 2013. Xu Xiaojing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Excision repair cross-complementing gene-1, ribonucleotide reductase subunit M1, ribonucleotide reductase subunit M2, and human equilibrative nucleoside transporter-1 expression and prognostic value in biliary tract malignancy. Cancer. 2013. Fisher Sarah B, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The A/G allele of eIF3a rs3740556 predicts platinum-based chemotherapy resistance in lung cancer patients. Lung cancer (Amsterdam, Netherlands). 2013. Xu Xiaojing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The TRPM6/EGF Pathway Is Downregulated in a Rat Model of Cisplatin Nephrotoxicity. PloS one. 2013. Ledeganck Kristien J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Epigenomics and Interindividual Differences in Drug Response. Clinical pharmacology and therapeutics. 2012. Ivanov M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
PharmGKB summary: very important pharmacogene information for GSTT1. Pharmacogenetics and genomics. 2012. Thorn Caroline F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
siRNA-mediated knock-down of NOX3: therapy for hearing loss?. Cellular and molecular life sciences : CMLS. 2012. Rybak Leonard P, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic polymorphism of copper transporter protein 1 is related to platinum resistance in Chinese non-small cell lung carcinoma patients. Clinical and experimental pharmacology & physiology. 2012. Xu Xiaojing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Associations Between ABCC2 Polymorphisms and Cisplatin Disposition and Efficacy. Clinical pharmacology and therapeutics. 2012. Sprowl J A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
First-SIGNAL: first-line single-agent iressa versus gemcitabine and cisplatin trial in never-smokers with adenocarcinoma of the lung. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2012. Han Ji-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Prediction of copper transport protein 1 (CTR1) genotype on severe cisplatin induced toxicity in non-small cell lung cancer (NSCLC) patients. Lung cancer (Amsterdam, Netherlands). 2012. Xu Xiaojing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gene therapy for cisplatin-induced ototoxicity: a systematic review of in vitro and experimental animal studies. Otology & neurotology : official publication of the American Otological Society, American Neurotology Society [and] European Academy of Otology and Neurotology. 2012. Waissbluth Sofia, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association between polymorphisms of ERCC1 and survival in epithelial ovarian cancer patients with chemotherapy. Pharmacogenomics. 2012. Yan Li, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Proximal Tubular Secretion of Creatinine by Organic Cation Transporter OCT2 in Cancer Patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2012. Ciarimboli Giuliano, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genomic approach towards personalized anticancer drug therapy. Pharmacogenomics. 2012. Midorikawa Yutaka, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenomics of cisplatin-based chemotherapy in ovarian cancer patients of different ethnic origins. Pharmacogenomics. 2012. Khrunin Andrey, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Arylamine N-acetyltransferase 1: a novel drug target in cancer development. Pharmacological reviews. 2012. Butcher Neville J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variants in the PI3K/PTEN/AKT/mTOR pathway predict platinum-based chemotherapy response of advanced non-small cell lung cancers in a Chinese population. Asian Pacific journal of cancer prevention : APJCP. 2012. Xu Jia-Li, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ERCC1 as a biomarker for bladder cancer patients likely to benefit from adjuvant chemotherapy. BMC cancer. 2012. Sun Jong-Mu, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association between DNA-repair polymorphisms and survival in pancreatic cancer patients treated with combination chemotherapy. Pharmacogenomics. 2011. Giovannetti Elisa, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Meta-analysis on pharmacogenetics of platinum-based chemotherapy in non small cell lung cancer (NSCLC) patients. PloS one. 2012. Yin Ji-Ye, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic analyses of cisplatin-induced nephrotoxicity indicate a renoprotective effect of ERCC1 polymorphisms. Pharmacogenomics. 2011. Tzvetkov Mladen V, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Differential effect of polymorphisms of CMPK1 and RRM1 on survival in advanced non-small cell lung cancer patients treated with gemcitabine or taxane/cisplatinum. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2011. Ryu Jeong-Seon, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Genome-wide meta-analysis identifies variants associated with platinating agent susceptibility across populations. The pharmacogenomics journal. 2011. Wheeler H E, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Nucleotide excision repair gene variants and association with survival in osteosarcoma patients treated with neoadjuvant chemotherapy. The pharmacogenomics journal. 2011. Biason P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic effects and modifiers of radiotherapy and chemotherapy on survival in pancreatic cancer. Pancreas. 2011. Zeng Hongmei, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
GALNT14 SNP as a potential predictor of response to combination chemotherapy using 5-FU, mitoxantrone and cisplatin in advanced HCC. Pharmacogenomics. 2011. Liang Kung-Hao, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics of cisplatin-induced ototoxicity. Pharmacogenomics. 2011. Mukherjea Debashree, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Transporter-mediated drug-drug interactions. Pharmacogenomics. 2011. Müller Fabian, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variations in multiple drug action pathways and survival in advanced stage non-small cell lung cancer treated with chemotherapy. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Li Yafei, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The NQO1*2/*2 polymorphism is associated with poor overall survival in patients following resection of stages II and IIIa non-small cell lung cancer. Oncology reports. 2011. Kolesar Jill M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Influence of polymorphisms in MTHFR 677 C¿T, TYMS 3R¿2R and MTR 2756 A¿G on NSCLC risk and response to platinum-based chemotherapy in advanced NSCLC. Pharmacogenomics. 2011. Cui Lian-Hua, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Estrogen receptor alpha single nucleotide polymorphism modifies the risk of azoospermia in childhood cancer survivors. Pharmacogenetics and genomics. 2011. Romerius Patrik, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Transporter-Mediated Drug Uptake and Efflux: Important Determinants of Adverse Drug Reactions. Clinical pharmacology and therapeutics. 2011. Zolk O, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Economic impact of a genetic test for cisplatin-induced ototoxicity. The pharmacogenomics journal. 2011. Dionne F, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Phase II trial of pemetrexed and bevacizumab in patients with recurrent or metastatic head and neck cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2011. Argiris Athanassios, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Very important pharmacogene summary: ABCB1 (MDR1, P-glycoprotein). Pharmacogenetics and genomics. 2011. Hodges Laura M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Use of a comprehensive panel of biomarkers to predict response to a fluorouracil-oxaliplatin regimen in patients with metastatic colorectal cancer. Pharmacogenomics. 2011. Lamas Maria J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Impact of ABCB1 C3435T polymorphism on lymph node regression in multimodality treatment of locally advanced esophageal cancer. Pharmacogenomics. 2011. Narumiya Kosuke, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
THYMIDYLATE SYNTHASE AND EXCISION REPAIR-CROSS-COMPLEMENTING GROUP-1 AS PREDICTORS OF RESPONSIVENESS IN MESOTHELIOMA PATIENTS TREATED WITH PEMETREXED-CARBOPLATIN. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Zucali Paolo Andrea, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
PI3K/PTEN/AKT/mTOR pathway genetic variation predicts toxicity and distant progression in lung cancer patients receiving platinum-based chemotherapy. Lung cancer (Amsterdam, Netherlands). 2011. Pu Xia, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Multiple genetic polymorphisms in the prediction of clinical outcome of metastatic colorectal cancer patients treated with first-line FOLFOX-4 chemotherapy. Pharmacogenetics and genomics. 2011. Huang Ming-Yii, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genome-wide interrogation identifies YAP1 variants associated with survival of small-cell lung cancer patients. Cancer research. 2010. Wu Chen, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Effect of ABCB1 and ABCC3 polymorphisms on osteosarcoma survival after chemotherapy: a pharmacogenetic study. PloS one. 2011. Caronia Daniela, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Three-gene predictor of clinical outcome for gastric cancer patients treated with chemotherapy. The pharmacogenomics journal. 2010. Kim H K, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Distribution of TYMS, MTHFR, p53 and MDR1 gene polymorphisms in patients with breast cancer treated with neoadjuvant chemotherapy. Cancer epidemiology. 2010. Henríquez-Hernández Luis Alberto, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Nucleotide excision repair gene polymorphisms may predict acute toxicity in patients treated with chemoradiotherapy for bladder cancer. Pharmacogenomics. 2010. Sakano Shigeru, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A phase I/II and pharmacogenomic study of pemetrexed and cisplatin in patients with unresectable, advanced gastric carcinoma. Anti-cancer drugs. 2010. Chen Jen-Shi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Host genetic variants in the IGF binding protein-3 impact on survival of patients with advanced gastric cancer treated with palliative chemotherapy. Pharmacogenomics. 2010. Graziano Francesco, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Glutathione S-transferase polymorphisms in osteosarcoma patients. Pharmacogenetics and genomics. 2010. Salinas-Souza Carolina, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of the copper transporter, CTR1, in platinum-induced ototoxicity. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2010. More Swati S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Blood-based CHRNA3 single nucleotide polymorphism and outcome in advanced non-small-cell lung cancer patients. Lung cancer (Amsterdam, Netherlands). 2010. Carcereny Enric, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Expression of gemcitabine- and cisplatin-related genes in non-small-cell lung cancer. The pharmacogenomics journal. 2010. Toffalorio F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Population differences in platinum toxicity as a means to identify novel genetic susceptibility variants. Pharmacogenetics and genomics. 2010. O'Donnell Peter H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Chemotherapeutic drug susceptibility associated SNPs are enriched in expression quantitative trait loci. Proceedings of the National Academy of Sciences of the United States of America. 2010. Gamazon Eric R, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PACdb: a database for cell-based pharmacogenomics. Pharmacogenetics and genomics. 2010. Gamazon Eric R, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics of membrane transporters: past, present and future. Pharmacogenomics. 2010. Yee Sook Wah, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of SUMO1 and UBC9 genotypes with tumor response in non-small-cell lung cancer treated with irinotecan-based chemotherapy. The pharmacogenomics journal. 2010. Han Ji-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Glutathione pathway genetic polymorphisms and lung cancer survival after platinum-based chemotherapy. Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology. 2010. Moyer Ann M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Association of MDR1 and ERCC1 polymorphisms with response and toxicity to cisplatin-based chemotherapy in non-small-cell lung cancer patients. International journal of hygiene and environmental health. 2010. Chen Songjian, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BRCA1 185delAG mutant protein, BRAt, up-regulates maspin in ovarian epithelial cells. Gynecologic oncology. 2010. O'Donnell Joshua D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABC transporters in cancer: more than just drug efflux pumps. Nature reviews. Cancer. 2010. Fletcher Jamie I, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gefitinib versus cisplatin plus docetaxel in patients with non-small-cell lung cancer harbouring mutations of the epidermal growth factor receptor (WJTOG3405): an open label, randomised phase 3 trial. The lancet oncology. 2010. Mitsudomi Tetsuya, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic polymorphisms and the efficacy and toxicity of cisplatin-based chemotherapy in ovarian cancer patients. The pharmacogenomics journal. 2010. Khrunin A V, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Methylenetetrahydrofolate reductase (MTHFR) gene polymorphisms and FOLFOX response in colorectal cancer patients. British journal of clinical pharmacology. 2010. Etienne-Grimaldi Marie-Christine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Effects of excision repair cross-complementation group 1 (ERCC1) single nucleotide polymorphisms on the prognosis of non-small cell lung cancer patients. Lung cancer (Amsterdam, Netherlands). 2010. Takenaka Tomoyoshi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TaqMan low-density arrays and analysis by artificial neuronal networks predict response to neoadjuvant chemoradiation in esophageal cancer. Pharmacogenomics. 2010. Warnecke-Eberz Ute, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics of taxane/platinum therapy in ovarian cancer. International journal of gynecological cancer : official journal of the International Gynecological Cancer Society. 2009. Marsh Sharon. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variants in TPMT and COMT are associated with hearing loss in children receiving cisplatin chemotherapy. Nature genetics. 2009. Ross Colin J D, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Contribution of organic cation transporter 2 (OCT2) to cisplatin-induced nephrotoxicity. Clinical pharmacology and therapeutics. 2009. Filipski K K, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Common variations in ERCC2 are associated with response to cisplatin chemotherapy and clinical outcome in osteosarcoma patients. The pharmacogenomics journal. 2009. Caronia D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The increasing role of pharmacogenetics in the treatment of gastrointestinal cancers. Gastrointestinal cancer research : GCR. 2009. Yalçin Suayib. PubMed
No Dosing Guideline available No Drug Label available