Chemical: Drug

PharmGKB contains no prescribing info for this . Contact us to report known genotype-based dosing guidelines, or if you are interested in developing guidelines.

last updated 10/25/2013

1. Annotation of FDA Label for cisplatin and TPMT

Informative PGx


The FDA-approved drug label for cisplatin was changed (in 2015) to reflect the level of uncertainty about the relationship between TPMT and cisplatin-induced ototoxicity. The Pharmacogenomics section was removed, and text was modified in the Warnings, Precautions and Adverse Reactions sections.


Excerpt from the cisplatin drug label:

Genetic factors (e.g. variants in the thiopurine S-methyltransferase (TPMT) gene) may contribute to cisplatin-induced ototoxicity; although this association has not been consistent across populations and study designs.

For the complete drug label text with sections containing pharmacogenetic information highlighted, see the cisplatin drug label.

*Disclaimer: The contents of this page have not been endorsed by the FDA and are the sole responsibility of PharmGKB.

Full label available at DailyMed

Genes and/or phenotypes found in this label

  • Anemia
    • Adverse reactions section
    • source: PHONT
  • Carcinoma, Non-Small-Cell Lung
    • Indications & usage section, Precautions section
    • source: PHONT
  • Carcinoma, Small Cell
    • Indications & usage section, Precautions section
    • source: PHONT
  • Neoplasms
    • Indications & usage section, Warnings section, Adverse reactions section, Precautions section
    • source: PHONT
  • Neutropenia
    • Adverse reactions section, Precautions section
    • source: PHONT
  • Ototoxicity
    • Boxed warning section, Warnings section, Adverse reactions section, Clinical pharmacology section, Precautions section
    • source: U.S. Food and Drug Administration
  • Ovarian Neoplasms
    • Precautions section
    • source: PHONT
  • Peripheral Nervous System Diseases
    • Warnings section, Adverse reactions section, Precautions section
    • source: PHONT
  • Thrombocytopenia
    • Adverse reactions section, Precautions section
    • source: PHONT
  • TPMT
    • toxicity, Adverse reactions section
    • source: PharmGKB

Clinical Variants that meet the highest level of criteria, manually curated by PharmGKB, are shown below.

To see more Clinical Variants with lower levels of criteria, click the button at the bottom of the page.

Disclaimer: The PharmGKB's clinical annotations reflect expert consensus based on clinical evidence and peer-reviewed literature available at the time they are written and are intended only to assist clinicians in decision-making and to identify questions for further research. New evidence may have emerged since the time an annotation was submitted to the PharmGKB. The annotations are limited in scope and are not applicable to interventions or diseases that are not specifically identified.

The annotations do not account for individual variations among patients, and cannot be considered inclusive of all proper methods of care or exclusive of other treatments. It remains the responsibility of the health-care provider to determine the best course of treatment for a patient. Adherence to any guideline is voluntary, with the ultimate determination regarding its application to be made solely by the clinician and the patient. PharmGKB assumes no responsibility for any injury or damage to persons or property arising out of or related to any use of the PharmGKB clinical annotations, or for any errors or omissions.

? = Mouse-over for quick help

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Links in the "Gene" column lead to PharmGKB Gene Pages.

List of all variant annotations for cisplatin

Gene ? Variant?
Alternate Names ? Chemicals ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
No VIP available No VIP available VA CYP3A4 *1 N/A N/A N/A
No VIP available No VIP available VA CYP3A4 *22 N/A N/A N/A
No VIP available No VIP available VA CYP3A5 *1A N/A N/A N/A
No VIP available No VIP available VA CYP3A5 *3A N/A N/A N/A
No VIP available CA VA GSTM1 non-null N/A N/A N/A
No VIP available CA VA GSTM1 null N/A N/A N/A
No VIP available CA VA GSTT1 non-null N/A N/A N/A
No VIP available CA VA GSTT1 null N/A N/A N/A
No VIP available CA VA TPMT *1 N/A N/A N/A
No VIP available CA VA TPMT *3A N/A N/A N/A
No VIP available No VIP available VA UGT1A1 *1 N/A N/A N/A
No VIP available No VIP available VA UGT1A1 *28 N/A N/A N/A
No VIP available No Clinical Annotations available VA
rs10209881 NC_000002.11:g.31246249T>C, NC_000002.12:g.31023383T>C, NM_001253826.1:c.315-57081A>G, NM_001253827.1:c.70-30376A>G, NM_024572.3:c.130-30376A>G, NR_045602.1:n.903-30376A>G, XM_005264559.1:c.25-30376A>G, XM_011533104.1:c.448-30376A>G, XM_011533105.1:c.70-30376A>G, XM_011533106.1:c.43-30376A>G, rs56517291, rs57849618, rs59539437
T > C
No VIP available CA VA
rs10276036 NC_000007.13:g.87180198C>T, NC_000007.14:g.87550882C>T, NG_011513.1:g.167367G>A, NM_000927.4:c.1000-44G>A, rs10488634, rs111193439, rs17276942, rs57688958, rs58206924
C > A
C > T
No VIP available CA VA
rs1042522 NC_000017.10:g.7579472G=, NC_000017.10:g.7579472G>C, NC_000017.10:g.7579472G>T, NC_000017.11:g.7676154G=, NC_000017.11:g.7676154G>C, NC_000017.11:g.7676154G>T, NG_017013.2:g.16397C=, NG_017013.2:g.16397C>A, NG_017013.2:g.16397C>G, NM_000546.5:c.215C=, NM_000546.5:c.215C>A, NM_000546.5:c.215C>G, NM_001126112.2:c.215C=, NM_001126112.2:c.215C>A, NM_001126112.2:c.215C>G, NM_001126113.2:c.215C=, NM_001126113.2:c.215C>A, NM_001126113.2:c.215C>G, NM_001126114.2:c.215C=, NM_001126114.2:c.215C>A, NM_001126114.2:c.215C>G, NM_001126115.1:c.-939C=, NM_001126115.1:c.-939C>A, NM_001126115.1:c.-939C>G, NM_001126116.1:c.-939C=, NM_001126116.1:c.-939C>A, NM_001126116.1:c.-939C>G, NM_001126117.1:c.-939C=, NM_001126117.1:c.-939C>A, NM_001126117.1:c.-939C>G, NM_001126118.1:c.98C=, NM_001126118.1:c.98C>A, NM_001126118.1:c.98C>G, NM_001276695.1:c.98C=, NM_001276695.1:c.98C>A, NM_001276695.1:c.98C>G, NM_001276696.1:c.98C=, NM_001276696.1:c.98C>A, NM_001276696.1:c.98C>G, NM_001276697.1:c.-1020C=, NM_001276697.1:c.-1020C>A, NM_001276697.1:c.-1020C>G, NM_001276698.1:c.-1020C=, NM_001276698.1:c.-1020C>A, NM_001276698.1:c.-1020C>G, NM_001276699.1:c.-1020C=, NM_001276699.1:c.-1020C>A, NM_001276699.1:c.-1020C>G, NM_001276760.1:c.98C=, NM_001276760.1:c.98C>A, NM_001276760.1:c.98C>G, NM_001276761.1:c.98C=, NM_001276761.1:c.98C>A, NM_001276761.1:c.98C>G, NP_000537.3:p.Pro72=, NP_000537.3:p.Pro72Arg, NP_000537.3:p.Pro72His, NP_001119584.1:p.Pro72=, NP_001119584.1:p.Pro72Arg, NP_001119584.1:p.Pro72His, NP_001119585.1:p.Pro72=, NP_001119585.1:p.Pro72Arg, NP_001119585.1:p.Pro72His, NP_001119586.1:p.Pro72=, NP_001119586.1:p.Pro72Arg, NP_001119586.1:p.Pro72His, NP_001119590.1:p.Pro33=, NP_001119590.1:p.Pro33Arg, NP_001119590.1:p.Pro33His, NP_001263624.1:p.Pro33=, NP_001263624.1:p.Pro33Arg, NP_001263624.1:p.Pro33His, NP_001263625.1:p.Pro33=, NP_001263625.1:p.Pro33Arg, NP_001263625.1:p.Pro33His, NP_001263689.1:p.Pro33=, NP_001263689.1:p.Pro33Arg, NP_001263689.1:p.Pro33His, NP_001263690.1:p.Pro33=, NP_001263690.1:p.Pro33Arg, NP_001263690.1:p.Pro33His, XM_005256778.1:c.176-21C=, XM_005256778.1:c.176-21C>A, XM_005256778.1:c.176-21C>G, XR_243565.1:n.354C=, XR_243565.1:n.354C>A, XR_243565.1:n.354C>G, XR_243566.1:n.354C=, XR_243566.1:n.354C>A, XR_243566.1:n.354C>G, rs17844988, rs17857747, rs17882155, rs2229076, rs3174747, rs4134781, rs60388830
G > C
No VIP available No Clinical Annotations available VA
rs1042858 NC_000011.10:g.4138236G>A, NC_000011.9:g.4159466G>A, NG_027992.2:g.48543G>A, NM_001033.3:c.2232G>A, NM_001033.4:c.2232G>A, NM_001318064.1:c.1941G>A, NM_001318065.1:c.1218G>A, NP_001024.1:p.Ala744=, NP_001304993.1:p.Ala647=, NP_001304994.1:p.Ala406=, XM_005253058.1:c.1989G>A, XM_005253059.1:c.1941G>A, XM_011520277.1:c.1941G>A, XM_011520278.1:c.1566G>A, XM_011520279.1:c.1218G>A, XP_005253115.1:p.Ala663=, XP_005253116.1:p.Ala647=, XP_011518579.1:p.Ala647=, XP_011518580.1:p.Ala522=, XP_011518581.1:p.Ala406=, rs17850107, rs2229195, rs2584873, rs3168060, rs57259172
G > A
No VIP available No Clinical Annotations available VA
rs1042927 NC_000011.10:g.4138699C>A, NC_000011.9:g.4159929C>A, NG_027992.2:g.49006C>A, NM_001033.3:c.*316C>A, NM_001033.4:c.*316C>A, NM_001318064.1:c.*316C>A, NM_001318065.1:c.*316C>A, XM_005253058.1:c.*316C>A, XM_005253059.1:c.*316C>A, XM_011520277.1:c.*316C>A, XM_011520278.1:c.*316C>A, XM_011520279.1:c.*316C>A, rs16930058, rs1735067, rs3168058, rs58834141
C > A
No VIP available No Clinical Annotations available VA
rs10434 NC_000006.11:g.43753212A>G, NC_000006.12:g.43785475A>G, NG_008732.1:g.20260A>G, NM_001025366.2:c.*913A>G, NM_001025367.2:c.*913A>G, NM_001025368.2:c.*913A>G, NM_001025369.2:c.*929A>G, NM_001025370.2:c.*913A>G, NM_001033756.2:c.*847A>G, NM_001171622.1:c.*913A>G, NM_001171623.1:c.*913A>G, NM_001171624.1:c.*913A>G, NM_001171625.1:c.*913A>G, NM_001171626.1:c.*913A>G, NM_001171627.1:c.*929A>G, NM_001171628.1:c.*913A>G, NM_001171629.1:c.*847A>G, NM_001171630.1:c.*913A>G, NM_001204384.1:c.*913A>G, NM_001204385.1:c.*913A>G, NM_001287044.1:c.*913A>G, NM_001317010.1:c.*847A>G, NM_003376.5:c.*913A>G, XM_005249363.1:c.*913A>G, rs3173233, rs60316096
A > G
No VIP available No Clinical Annotations available VA
rs1044457 NC_000001.10:g.47842777C>T, NC_000001.11:g.47377105C>T, NM_001136140.1:c.*360C>T, NM_016308.2:c.*360C>T, NR_046394.1:n.1119C>T, rs17378832, rs3184215, rs3767626
C > -
C > T
rs1045642 NC_000007.13:g.87138645A>G, NC_000007.14:g.87509329A>G, NG_011513.1:g.208920T>C, NM_000927.4:c.3435T>C, NP_000918.2:p.Ile1145=, rs10239679, rs11568726, rs117328163, rs17210003, rs2229108, rs386513066, rs60023214, rs9690664
A > G
No VIP available CA VA
rs1051640 NC_000017.10:g.48768486A>G, NC_000017.11:g.50691125A>G, NM_003786.3:c.4509A>G, NP_003777.2:p.Glu1503=, XM_005257763.1:c.4317A>G, XM_005257763.2:c.4317A>G, XM_011525422.1:c.4422A>G, XM_011525423.1:c.4614A>G, XM_011525424.1:c.3834A>G, XM_011525425.1:c.3783A>G, XP_005257820.1:p.Glu1439=, XP_011523724.1:p.Glu1474=, XP_011523725.1:p.Glu1538=, XP_011523726.1:p.Glu1278=, XP_011523727.1:p.Glu1261=, XR_934586.1:n.4970A>G, rs17414117, rs17643255, rs3192040, rs57272614, rs60786737
A > G
No VIP available CA VA
rs1051740 NC_000001.10:g.226019633T>C, NC_000001.11:g.225831932T>C, NG_009776.1:g.26837T>C, NM_000120.3:c.337T>C, NM_001136018.3:c.337T>C, NM_001291163.1:c.337T>C, NP_000111.1:p.Tyr113His, NP_001129490.1:p.Tyr113His, NP_001278092.1:p.Tyr113His, XM_005273085.1:c.337T>C, XP_005273142.1:p.Tyr113His, rs16845366, rs17417482, rs1800444, rs2259405, rs3192120, rs52794507, rs59266540
T > C
No VIP available CA VA
rs1052536 NC_000017.10:g.33331575C>T, NC_000017.11:g.35004556C>T, NG_029221.1:g.29059C>T, NM_013975.3:c.*50C>T, XM_005257970.1:c.*50C>T, XM_005257970.2:c.*50C>T, XM_005257971.1:c.*50C>T, XM_011524797.1:c.2823+1767C>T, XM_011524798.1:c.2796+1767C>T, XM_011524799.1:c.2796+1767C>T, XM_011524800.1:c.2823+1767C>T, rs17667663, rs3192959, rs56593019, rs59815732, rs60821611
C > T
No VIP available No Clinical Annotations available VA
rs1056836 NC_000002.11:g.38298203C>G, NC_000002.12:g.38071060G=, NG_008386.2:g.10042C=, NG_008386.2:g.10042C>G, NM_000104.3:c.1294C=, NM_000104.3:c.1294C>G, NP_000095.2:p.Leu432=, NP_000095.2:p.Leu432Val, rs17405323, rs3731848, rs52802961, rs59494749
C > G
No VIP available CA VA
rs1065634 NC_000001.10:g.115259768T>C, NC_000001.11:g.114717147T>C, NG_007572.1:g.4748A>G, NM_001007553.2:c.*1022A>G, NM_001130523.2:c.*1022A>G, NM_001242891.1:c.*1022A>G, NM_001242892.1:c.*1022A>G, NM_001242893.1:c.*1022A>G, NM_002524.4:c.-507A>G, NM_007158.5:c.*1022A>G, XM_005271178.1:c.*1022A>G, rs3167734, rs57399409
T > C
No VIP available No Clinical Annotations available VA
G > T
No VIP available CA VA
C > A
No VIP available CA VA
rs10981694 NC_000009.11:g.115986409T>G, NC_000009.12:g.113224129T>G, NM_001859.3:c.-36+2451T>G, rs60407897
T > G
No VIP available No Clinical Annotations available VA
rs11030918 NC_000011.10:g.4094257T>C, NC_000011.9:g.4115487T>C, NG_016277.1:g.243555T>C, NG_027992.2:g.4564T>C, NM_001033.4:c.-756T>C, NM_001318064.1:c.-869T>C, XM_005253058.1:c.-756T>C, XM_005253059.1:c.-869T>C, XM_011520277.1:c.-869T>C, rs17210557, rs17554091
T > C
No VIP available No Clinical Annotations available VA
rs11211524 NC_000001.10:g.47833213A>C, NC_000001.11:g.47367541A>C, NM_001136140.1:c.172-5414A>C, NM_016308.2:c.172-928A>C, NR_046394.1:n.321-928A>C
A > C
No VIP available CA VA
rs11226 NC_000012.11:g.1021813G>A, NC_000012.12:g.912647G>A, NG_007984.2:g.164589G>A, NG_017078.2:g.82395C>T, NM_001297419.1:c.*744C>T, NM_001297421.1:c.*744C>T, NM_134424.3:c.*744C>T, NR_123713.1:n.2422C>T, XM_005253720.1:c.*744C>T, XM_005253720.3:c.*744C>T, XM_005253721.1:c.*744C>T, XM_005253721.2:c.*744C>T, XM_005253722.1:c.*744C>T, XM_005253723.1:c.*744C>T, XM_011520990.1:c.*744C>T, XM_011520991.1:c.*744C>T, XM_011520992.1:c.*744C>T, XM_011520995.1:c.*744C>T, XR_242986.1:n.2266C>T, XR_931521.1:n.2088C>T, XR_931522.1:n.2163C>T, rs11571479, rs3192069, rs57985635
G > -
G > A
No VIP available CA VA
rs1128503 NC_000007.13:g.87179601A>G, NC_000007.14:g.87550285A>G, NG_011513.1:g.167964T>C, NM_000927.4:c.1236T>C, NP_000918.2:p.Gly412=, rs116989428, rs17276907, rs2032587, rs2229105, rs28365046, rs386518005, rs58257317
A > G
No VIP available CA VA
rs1130214 NC_000014.8:g.105259734C>A, NC_000014.9:g.104793397C>A, NG_012188.1:g.7348G>T, NM_001014431.1:c.-79-675G>T, NM_001014432.1:c.-163-187G>T, NM_005163.2:c.-350G>T, XM_005267401.1:c.-79-675G>T, XM_011536543.1:c.-257-93G>T, XM_011536544.1:c.-350G>T, rs36214920, rs56526192, rs57753899
C > A
No VIP available No Clinical Annotations available VA
rs1131341 NC_000016.10:g.69714966G>A, NC_000016.9:g.69748869G>A, NG_011504.1:g.16665C>T, NM_000903.2:c.415C>T, NM_001025433.1:c.415C>T, NM_001025434.1:c.304-1837C>T, NM_001286137.1:c.303+3157C>T, NP_000894.1:p.Arg139Trp, NP_001020604.1:p.Arg139Trp, XM_005255830.1:c.303+3157C>T, rs11555214, rs117044374, rs17413734, rs3191186, rs386597012, rs4986998, rs52820907, rs57338209
G > A
rs1138272 NC_000011.10:g.67586108C>T, NC_000011.9:g.67353579C>T, NG_012075.1:g.7514C>T, NM_000852.3:c.341C>T, NP_000843.1:p.Ala114Val, XM_005273958.1:c.338C>T, XP_005274015.1:p.Ala113Val, rs11553894, rs17434783, rs1799811, rs1804665, rs3202011, rs4134657, rs52800258, rs61323549
C > T
No VIP available CA VA
rs1142345 NC_000006.11:g.18130918T>C, NC_000006.12:g.18130687T>C, NG_012137.2:g.29457A>G, NM_000367.3:c.719A>G, NP_000358.1:p.Tyr240Cys, XM_011514839.1:c.674A>G, XM_011514840.1:c.650A>G, XP_011513141.1:p.Tyr225Cys, XP_011513142.1:p.Tyr217Cys, rs16880254, rs1801205, rs29001646, rs52798150, rs61510596
T > C
No VIP available No Clinical Annotations available VA
rs11479 NC_000022.10:g.50964236G>A, NC_000022.11:g.50525807G>A, NG_011860.1:g.9279C>T, NG_016235.1:g.5633C>T, NG_021419.1:g.22592G>A, NM_001113755.2:c.1412C>T, NM_001113756.2:c.1412C>T, NM_001169109.1:c.-14+439C>T, NM_001169110.1:c.-14+194C>T, NM_001169111.1:c.-379C>T, NM_001257988.1:c.1412C>T, NM_001257989.1:c.1427C>T, NM_001953.4:c.1412C>T, NM_005138.2:c.-349C>T, NP_001107227.1:p.Ser471Leu, NP_001107228.1:p.Ser471Leu, NP_001244917.1:p.Ser471Leu, NP_001244918.1:p.Ser476Leu, NP_001944.1:p.Ser471Leu, rs17846490, rs17859554, rs3202233, rs3829983
G > A
No VIP available CA VA
rs11615 NC_000019.10:g.45420395A>G, NC_000019.9:g.45923653A>G, NG_015839.2:g.63434T>C, NM_001166049.1:c.354T>C, NM_001983.3:c.354T>C, NM_202001.2:c.354T>C, NP_001159521.1:p.Asn118=, NP_001974.1:p.Asn118=, NP_973730.1:p.Asn118=, XM_005258634.1:c.354T>C, XM_005258635.1:c.354T>C, XM_005258635.2:c.354T>C, XM_005258636.1:c.354T>C, XM_005258636.3:c.354T>C, XM_005258637.1:c.354T>C, XM_005258638.1:c.138T>C, XM_011526610.1:c.354T>C, XP_005258691.1:p.Asn118=, XP_005258692.1:p.Asn118=, XP_005258693.1:p.Asn118=, XP_005258694.1:p.Asn118=, XP_005258695.1:p.Asn46=, XP_011524912.1:p.Asn118=, rs1130005, rs17285882, rs17359303, rs17845191, rs17858003, rs17859564, rs2228629, rs3177700, rs3188446, rs3752251, rs59923575
A > G
No VIP available No Clinical Annotations available VA
A > T
No VIP available CA VA
rs11710163 NC_000003.11:g.12696288A>G, NC_000003.12:g.12654789A>G, NG_007467.1:g.14391T>C, NM_002880.3:c.-27+9024T>C, XM_005265355.1:c.-27+8580T>C, XM_005265356.1:c.-120+9024T>C, XM_005265357.1:c.-27+9024T>C, XM_005265358.1:c.-157+9024T>C, XM_005265358.3:c.-157+9024T>C, XM_005265359.1:c.-157+9024T>C, XM_005265359.3:c.-157+9024T>C, XM_005265360.1:c.-27+9024T>C, XM_011533974.1:c.-120+9024T>C, XM_011533975.1:c.-250+9024T>C, rs58836253
A > G
No VIP available No Clinical Annotations available VA
rs12090346 NC_000001.10:g.47841557C>T, NC_000001.11:g.47375885C>T, NM_001136140.1:c.498+592C>T, NM_016308.2:c.645+592C>T, NR_046394.1:n.717+592C>T
C > T
No VIP available CA VA
rs12118636 NC_000001.10:g.53076159G>A, NC_000001.11:g.52610487G>A, rs34623603
G > A
No VIP available No Clinical Annotations available VA
rs12139042 NC_000001.10:g.11167146G>A, NC_000001.11:g.11107089G>A, NG_033239.1:g.160463C>T, NM_004958.3:c.*396C>T, XM_005263438.1:c.*396C>T, XM_005263439.1:c.*396C>T, XM_005263440.1:c.5038C>T, XM_005263441.1:c.4031-300C>T, XP_005263497.1:p.Gln1680Ter, rs17229270, rs17848573
G > A
No VIP available CA VA
rs12201199 NC_000006.11:g.18139802A>T, NC_000006.12:g.18139571A>T, NG_012137.2:g.20573T>A, NM_000367.3:c.419+94T>A, XM_011514839.1:c.419+94T>A, XM_011514840.1:c.350+94T>A, rs58109747
A > T
No VIP available CA VA
rs12613732 NC_000002.11:g.31249427T>G, NC_000002.12:g.31026561T>G, NM_001253826.1:c.315-60259A>C, NM_001253827.1:c.70-33554A>C, NM_024572.3:c.130-33554A>C, NR_045602.1:n.903-33554A>C, XM_005264559.1:c.25-33554A>C, XM_011533104.1:c.448-33554A>C, XM_011533105.1:c.70-33554A>C, XM_011533106.1:c.43-33554A>C, rs17393634, rs56739826, rs58514179
T > G
No VIP available CA VA
rs12659 NC_000021.8:g.46951556A>G, NC_000021.9:g.45531642A>G, NG_028278.1:g.15830T>C, NM_001205206.1:c.696T>C, NM_001205207.1:c.576T>C, NM_194255.2:c.696T>C, NP_001192135.1:p.Pro232=, NP_001192136.1:p.Pro192=, NP_919231.1:p.Pro232=, XM_005261163.1:c.696T>C, XM_005261164.1:c.342T>C, XM_005261164.2:c.342T>C, XM_011529696.1:c.987T>C, XM_011529697.1:c.987T>C, XM_011529698.1:c.762T>C, XM_011529699.1:c.723T>C, XM_011529700.1:c.696T>C, XM_011529701.1:c.696T>C, XM_011529702.1:c.696T>C, XM_011529703.1:c.696T>C, XM_011529704.1:c.696T>C, XM_011529705.1:c.987T>C, XM_011529706.1:c.558T>C, XM_011529707.1:c.987T>C, XM_011529708.1:c.696T>C, XM_011529709.1:c.342T>C, XM_011529710.1:c.342T>C, XP_005261220.1:p.Pro232=, XP_005261221.1:p.Pro114=, XP_011527998.1:p.Pro329=, XP_011527999.1:p.Pro329=, XP_011528000.1:p.Pro254=, XP_011528001.1:p.Pro241=, XP_011528002.1:p.Pro232=, XP_011528003.1:p.Pro232=, XP_011528004.1:p.Pro232=, XP_011528005.1:p.Pro232=, XP_011528006.1:p.Pro232=, XP_011528007.1:p.Pro329=, XP_011528008.1:p.Pro186=, XP_011528009.1:p.Pro329=, XP_011528010.1:p.Pro232=, XP_011528011.1:p.Pro114=, XP_011528012.1:p.Pro114=, rs17844976, rs17857725, rs3171495
A > G
No VIP available No Clinical Annotations available VA
rs12806698 NC_000011.10:g.4094744C>A, NC_000011.9:g.4115974C>A, NG_016277.1:g.244042C>A, NG_027992.2:g.5051C>A, NM_001033.3:c.-269C>A, NM_001033.4:c.-269C>A, NM_001318064.1:c.-382C>A, XM_005253058.1:c.-269C>A, XM_005253059.1:c.-382C>A, XM_011520277.1:c.-382C>A, rs17554111
C > A
No VIP available No Clinical Annotations available VA
rs12999804 NC_000002.11:g.31245650A>T, NC_000002.12:g.31022784A>T, NM_001253826.1:c.315-56482T>A, NM_001253827.1:c.70-29777T>A, NM_024572.3:c.130-29777T>A, NR_045602.1:n.903-29777T>A, XM_005264559.1:c.25-29777T>A, XM_011533104.1:c.448-29777T>A, XM_011533105.1:c.70-29777T>A, XM_011533106.1:c.43-29777T>A, rs58546060, rs59591816
A > T
No VIP available CA VA
rs13181 NC_000019.10:g.45351661T>G, NC_000019.9:g.45854919T>G, NG_007067.2:g.23927A>C, NM_000400.3:c.2251A>C, NM_177417.2:c.*304T>G, NP_000391.1:p.Lys751Gln, XM_005258536.1:c.*128T>G, XM_005258536.3:c.*128T>G, XM_005258537.1:c.*128T>G, XM_005258538.1:c.*304T>G, XM_005258539.1:c.*304T>G, XM_005258639.1:c.2179A>C, XM_005258640.1:c.2017A>C, XM_005258641.1:c.1513A>C, XM_011526611.1:c.2173A>C, XP_005258696.1:p.Lys727Gln, XP_005258697.1:p.Lys673Gln, XP_005258698.1:p.Lys505Gln, XP_011524913.1:p.Lys725Gln, rs1052559, rs17285142, rs17355147, rs17359310, rs3170171, rs3859422, rs60606175
T > G
No VIP available No Clinical Annotations available VA
rs151264360 NC_000018.10:g.673444_673449delTTAAAG, NC_000018.9:g.673444_673449delTTAAAG, NG_028255.1:g.20841_20846delTTAAAG, NM_001071.2:c.*447_*452delTTAAAG, NM_001126123.3:c.*145-373_*145-368del, NM_001126123.3:c.*145-373_*145-368delCTTTAA, NM_001318759.1:c.*145-373_*145-368del, NM_001318759.1:c.*145-373_*145-368delCTTTAA, NM_001318760.1:c.*446+410_*446+415delCTTTAA, NM_001318760.1:c.*856_*861del, NM_017512.5:c.*856_*861delCTTTAA, NM_202758.3:c.*856_*861delCTTTAA, XM_005258111.1:c.*856_*861delCTTTAA, XM_005258112.1:c.*856_*861delCTTTAA, XM_005258113.1:c.*856_*861delCTTTAA, XM_005258114.1:c.*856_*861delCTTTAA, XM_005258115.1:c.*856_*861delCTTTAA, XM_005258116.1:c.*856_*861delCTTTAA, XM_005258117.1:c.*856_*861delCTTTAA, XM_005258118.1:c.*856_*861delCTTTAA, XM_005258118.2:c.*856_*861del, XM_005258120.1:c.*856_*861delCTTTAA, XM_005258137.1:c.*447_*452delTTAAAG, XM_005258138.1:c.*447_*452delTTAAAG, XM_011525677.1:c.*856_*861del, XM_011525678.1:c.*856_*861del, XM_011525679.1:c.*856_*861del, XM_011525680.1:c.*856_*861del, XM_011525681.1:c.*856_*861del, XM_011525682.1:c.*856_*861del, XM_011525683.1:c.*856_*861del, XM_011525684.1:c.*856_*861del, XM_011525685.1:c.*856_*861del, XM_011525686.1:c.*856_*861del, XM_011525687.1:c.*856_*861del, XM_011525688.1:c.*856_*861del, XM_011525689.1:c.*856_*861del, XM_011525690.1:c.*856_*861del, XM_011525691.1:c.*856_*861del, XM_011525692.1:c.*856_*861del, XM_011525693.1:c.*856_*861del, XM_011525694.1:c.*856_*861del, XM_011525695.1:c.*856_*861del, XM_011525696.1:c.*856_*861del, XM_011525697.1:c.*856_*861del, XM_011525698.1:c.*856_*861del, XM_011525699.1:c.*856_*861del, XR_243810.1:n.1672-373_1672-368delCTTTAA, XR_243810.3:n.1513-373_1513-368del, XR_243811.1:n.1538-373_1538-368delCTTTAA, XR_243811.2:n.1538-373_1538-368del, XR_243812.1:n.2112_2117delCTTTAA, XR_430041.2:n.1633-373_1633-368del, XR_935066.1:n.2109_2114del, XR_935067.1:n.1967_1972del
No VIP available No Clinical Annotations available VA
rs1617640 NC_000007.13:g.100317298C>A, NC_000007.14:g.100719675C>A, NG_021471.1:g.3876C>A, NM_000799.2:c.-1306C>A, XM_005250190.1:c.-1306C>A, rs10304599, rs10342152, rs57979509
C > A
No VIP available CA VA
rs16886403 NC_000005.10:g.56843419T>C, NC_000005.9:g.56139246T>C, NG_031884.1:g.33347T>C, NM_005921.1:c.483-13181T>C, XM_005248519.1:c.72-13181T>C, XM_005248519.3:c.105-13181T>C, XM_005248520.1:c.-7-13181T>C, XM_011543406.1:c.228-13181T>C, XM_011543407.1:c.483-13181T>C, XM_011543408.1:c.483-13181T>C, rs57623389, rs58749465
T > C
rs1695 NC_000011.10:g.67585218A>G, NC_000011.9:g.67352689A>G, NG_012075.1:g.6624A>G, NM_000852.3:c.313A>G, NP_000843.1:p.Ile105Val, XM_005273958.1:c.313A>G, XP_005274015.1:p.Ile105Val, rs1138257, rs11553891, rs17353321, rs17856342, rs2230827, rs4609, rs56971933, rs947894
A > G
No VIP available CA VA
rs16950650 NC_000013.10:g.95775432C>T, NC_000013.11:g.95123178C>T, NM_001105515.2:c.2456-7177G>A, NM_001301829.1:c.2315-7177G>A, NM_001301830.1:c.2231-7177G>A, NM_005845.4:c.2456-7177G>A, XM_005254025.1:c.2327-7177G>A, XM_005254025.2:c.2327-7177G>A, XM_005254026.1:c.2315-7177G>A, XM_005254027.1:c.2231-7177G>A, XM_005254028.1:c.2231-7177G>A, XM_006719914.1:c.2366-7177G>A, XM_011521047.1:c.1907-7177G>A, rs56643033, rs58582224
C > T
No VIP available No Clinical Annotations available VA
rs17216177 NC_000010.10:g.101603522T>C, NC_000010.11:g.99843765T>C, NG_011798.1:g.66060T>C, NM_000392.4:c.3742-34T>C, XM_005269536.1:c.3463-34T>C, XM_006717630.2:c.3046-34T>C, XR_945604.1:n.3931-34T>C, XR_945605.1:n.3806-34T>C, rs45616434
T > C
No VIP available CA VA
rs17309872 NC_000020.10:g.33515788A>T, NC_000020.11:g.34927985A>T, NG_008848.1:g.32814T>A, NG_011520.1:g.58044A>T, NM_000178.2:c.*843T>A, NM_001076552.2:c.*771A>T, NM_001242393.1:c.*771A>T, NM_018677.3:c.*771A>T, XM_005260405.1:c.*843T>A, XM_005260406.1:c.*843T>A, XM_005260406.3:c.*843T>A, XM_005260454.1:c.*771A>T, XM_005260455.1:c.*771A>T, XM_005260456.1:c.*771A>T, XM_005260457.1:c.*771A>T, XM_006723826.1:c.*771A>T, XM_011528796.1:c.*843T>A, XM_011528905.1:c.*771A>T, XM_011528906.1:c.*771A>T, XM_011528907.1:c.*771A>T, XM_011528908.1:c.*771A>T, XM_011528909.1:c.*771A>T, XM_011528910.1:c.*771A>T, XM_011528911.1:c.*771A>T, XM_011528912.1:c.*771A>T
A > G
A > T
No VIP available No Clinical Annotations available VA
rs1734787 AJ132917.1:c.27-27438T>G, NC_000023.10:g.153325446A>C, NC_000023.11:g.154059995A>C, NG_007107.2:g.82133T>G, NM_001110792.1:c.63-27438T>G, NM_001316337.1:c.-421-1429T>G, NM_004992.3:c.27-27438T>G, NW_003871103.3:g.1493974A>C, XM_005274681.1:c.27-27438T>G, XM_005274681.3:c.27-27438T>G, XM_005274682.1:c.-365-20092T>G, XM_005274682.3:c.-365-20092T>G, XM_005274683.1:c.-2264T>G, XM_005274683.3:c.-2264T>G, XM_005277851.1:c.27-27438T>G, XM_005277852.1:c.-365-20092T>G, XM_005277853.1:c.-2264T>G, XM_011531165.1:c.-421-1429T>G, rs17332596, rs56534075, rs58354099, rs61248129
A > C
No VIP available No Clinical Annotations available VA
rs1734791 AJ132917.1:c.26+26722T>A, NC_000023.10:g.153330920A>T, NC_000023.11:g.154065469A>T, NG_007107.2:g.76659T>A, NM_001110792.1:c.62+32141T>A, NM_001316337.1:c.-421-6903T>A, NM_004992.3:c.26+26722T>A, NW_003871103.3:g.1499448A>T, XM_005274681.1:c.26+26722T>A, XM_005274681.3:c.26+26715T>A, XM_005274682.1:c.-365-25566T>A, XM_005274682.3:c.-365-25566T>A, XM_005277851.1:c.26+26715T>A, XM_005277852.1:c.-365-25566T>A, XM_011531165.1:c.-421-6903T>A, rs111178553, rs60889458
A > T
No VIP available No Clinical Annotations available VA
rs17435 AJ132917.1:c.27-13972A>T, NC_000023.10:g.153311980T>A, NC_000023.11:g.154046529T>A, NG_007107.2:g.95599A>T, NM_001110792.1:c.63-13972A>T, NM_001316337.1:c.-254+11870A>T, NM_004992.3:c.27-13972A>T, NW_003871103.3:g.1480508T>A, XM_005274681.1:c.27-13972A>T, XM_005274681.3:c.27-13972A>T, XM_005274682.1:c.-365-6626A>T, XM_005274682.3:c.-365-6626A>T, XM_005274683.1:c.-254+10412A>T, XM_005274683.3:c.-254+10412A>T, XM_005277851.1:c.27-13972A>T, XM_005277852.1:c.-365-6626A>T, XM_005277853.1:c.-254+10412A>T, XM_011531165.1:c.-254+11870A>T, XM_011531166.1:c.-254+1988A>T, rs60248475, rs61484111
T > A
No VIP available CA VA
rs17574269 NC_000006.11:g.117816128A>G, NC_000006.12:g.117494965A>G, NM_173674.2:c.113-8802A>G, XM_005266941.1:c.254-8802A>G, XM_005266942.1:c.254-8802A>G, XM_006715463.1:c.254-8802A>G, XM_011535770.1:c.119-8802A>G, XM_011535771.1:c.-44-8802A>G, XM_011535772.1:c.-44-8802A>G, XM_011535773.1:c.254-8802A>G, XM_011535774.1:c.254-8802A>G, rs58365592
A > G
No VIP available No Clinical Annotations available VA
rs17655 NC_000013.10:g.103528002G>C, NC_000013.11:g.102875652G>C, NG_007146.1:g.34829G>C, NM_000123.3:c.3310G>C, NM_001204425.1:c.4672G>C, NP_000114.2:p.Asp1104His, NP_001191354.1:p.Asp1558His, rs16960665, rs3188002, rs3825521, rs52825398
G > C
No VIP available CA VA
rs17661089 NC_000005.10:g.56810169A>G, NC_000005.9:g.56105996A>G, NG_031884.1:g.97A>G, rs57476699
A > G
No VIP available CA VA
rs1799735 unknown
No VIP available No Clinical Annotations available VA
rs1799782 NC_000019.10:g.43553422G>A, NC_000019.9:g.44057574G>A, NG_033799.1:g.27157C>T, NM_006297.2:c.580C>T, NP_006288.2:p.Arg194Trp, rs11553655, rs2229674, rs3213359, rs3826914, rs386545546
G > A
No VIP available CA VA
rs1799793 NC_000019.10:g.45364001C>T, NC_000019.9:g.45867259C>T, NG_007067.2:g.11587G>A, NM_000400.3:c.934G>A, NM_001130867.1:c.862G>A, NP_000391.1:p.Asp312Asn, NP_001124339.1:p.Asp288Asn, XM_005258639.1:c.862G>A, XM_005258640.1:c.700G>A, XM_005258641.1:c.196G>A, XM_005258642.1:c.934G>A, XM_011526611.1:c.856G>A, XP_005258696.1:p.Asp288Asn, XP_005258697.1:p.Asp234Asn, XP_005258698.1:p.Asp66Asn, XP_005258699.1:p.Asp312Asn, XP_011524913.1:p.Asp286Asn, XR_935763.1:n.981G>A, rs3916814, rs58989209
C > T
No VIP available No Clinical Annotations available VA
rs1800440 NC_000002.11:g.38298139T>C, NC_000002.12:g.38070996T>C, NG_008386.2:g.10106A>G, NM_000104.3:c.1358A>G, NP_000095.2:p.Asn453Ser, rs17405302, rs386545580, rs4134586, rs4986886, rs56879535
T > C
No VIP available CA VA
rs1800460 NC_000006.11:g.18139228C>T, NC_000006.12:g.18138997C>T, NG_012137.2:g.21147G>A, NM_000367.3:c.460G>A, NP_000358.1:p.Ala154Thr, XM_011514839.1:c.460G>A, XM_011514840.1:c.391G>A, XP_011513141.1:p.Ala154Thr, XP_011513142.1:p.Ala131Thr, rs11568060, rs16880273, rs386545583, rs57650974
C > T
rs1800566 NC_000016.10:g.69711242G>A, NC_000016.9:g.69745145G>A, NG_011504.1:g.20389C>T, NM_000903.2:c.559C>T, NM_001025433.1:c.457C>T, NM_001025434.1:c.445C>T, NM_001286137.1:c.343C>T, NP_000894.1:p.Pro187Ser, NP_001020604.1:p.Pro153Ser, NP_001020605.1:p.Pro149Ser, NP_001273066.1:p.Pro115Ser, XM_005255830.1:c.343C>T, XP_005255887.1:p.Pro115Ser, rs4134727, rs4149351, rs57135274
G > A
No VIP available CA VA
rs1801131 NC_000001.10:g.11854476T>G, NC_000001.11:g.11794419T>G, NG_013351.1:g.16685A>C, NM_005957.4:c.1286A>C, NP_005948.3:p.Glu429Ala, XM_005263458.1:c.1409A>C, XM_005263458.2:c.1409A>C, XM_005263459.1:c.1355A>C, XM_005263460.1:c.1286A>C, XM_005263460.3:c.1286A>C, XM_005263461.1:c.1286A>C, XM_005263461.3:c.1286A>C, XM_005263462.1:c.1286A>C, XM_005263462.3:c.1286A>C, XM_005263463.1:c.1040A>C, XM_005263463.2:c.1040A>C, XM_011541495.1:c.1406A>C, XM_011541496.1:c.1409A>C, XP_005263515.1:p.Glu470Ala, XP_005263516.1:p.Glu452Ala, XP_005263517.1:p.Glu429Ala, XP_005263518.1:p.Glu429Ala, XP_005263519.1:p.Glu429Ala, XP_005263520.1:p.Glu347Ala, XP_011539797.1:p.Glu469Ala, XP_011539798.1:p.Glu470Ala, rs17367365, rs17857426, rs4134712
T > G
No VIP available CA VA
rs1801133 NC_000001.10:g.11856378G>A, NC_000001.11:g.11796321G>A, NG_013351.1:g.14783C>T, NM_005957.4:c.665C>T, NP_005948.3:p.Ala222Val, XM_005263458.1:c.788C>T, XM_005263458.2:c.788C>T, XM_005263459.1:c.734C>T, XM_005263460.1:c.665C>T, XM_005263460.3:c.665C>T, XM_005263461.1:c.665C>T, XM_005263461.3:c.665C>T, XM_005263462.1:c.665C>T, XM_005263462.3:c.665C>T, XM_005263463.1:c.419C>T, XM_005263463.2:c.419C>T, XM_011541495.1:c.785C>T, XM_011541496.1:c.788C>T, XP_005263515.1:p.Ala263Val, XP_005263516.1:p.Ala245Val, XP_005263517.1:p.Ala222Val, XP_005263518.1:p.Ala222Val, XP_005263519.1:p.Ala222Val, XP_005263520.1:p.Ala140Val, XP_011539797.1:p.Ala262Val, XP_011539798.1:p.Ala263Val, rs386545618, rs4134713, rs59514310
G > A
No VIP available No Clinical Annotations available VA
rs1801158 NC_000001.10:g.97981421C>T, NC_000001.11:g.97515865C>T, NG_008807.2:g.410195G>A, NM_000110.3:c.1601G>A, NP_000101.2:p.Ser534Asn, XM_005270561.1:c.1490G>A, XM_005270562.1:c.1524+33695G>A, XM_005270562.3:c.1524+33695G>A, XM_005270563.1:c.1601G>A, XM_005270564.1:c.1601G>A, XM_006710397.2:c.1601G>A, XP_005270618.1:p.Ser497Asn, XP_005270620.1:p.Ser534Asn, XP_005270621.1:p.Ser534Asn, XP_006710460.1:p.Ser534Asn, rs199469539, rs52824375, rs59516208
C > T
No VIP available CA VA
rs1801280 NC_000008.10:g.18257854T>C, NC_000008.11:g.18400344T>C, NG_012246.1:g.14100T>C, NM_000015.2:c.341T>C, NP_000006.2:p.Ile114Thr, XM_011544358.1:c.341T>C, XP_011542660.1:p.Ile114Thr, rs4134724, rs56935242
T > C
No VIP available CA VA
rs1805087 NC_000001.10:g.237048500A>G, NC_000001.11:g.236885200A>G, NG_008959.1:g.94920A>G, NM_000254.2:c.2756A>G, NM_001291939.1:c.2603A>G, NM_001291940.1:c.1535A>G, NP_000245.2:p.Asp919Gly, NP_001278868.1:p.Asp868Gly, NP_001278869.1:p.Asp512Gly, XM_005273140.1:c.2924A>G, XM_005273141.1:c.2753A>G, XM_005273141.3:c.2753A>G, XM_005273142.1:c.2666A>G, XM_005273143.1:c.2603A>G, XM_005273144.1:c.2318A>G, XM_005273145.1:c.1118A>G, XM_006711769.2:c.2756A>G, XM_006711770.1:c.1820A>G, XM_011544193.1:c.2567A>G, XM_011544194.1:c.2924A>G, XP_005273197.1:p.Asp975Gly, XP_005273198.1:p.Asp918Gly, XP_005273199.1:p.Asp889Gly, XP_005273200.1:p.Asp868Gly, XP_005273201.1:p.Asp773Gly, XP_005273202.1:p.Asp373Gly, XP_006711832.1:p.Asp919Gly, XP_006711833.1:p.Asp607Gly, XP_011542495.1:p.Asp856Gly, XP_011542496.1:p.Asp975Gly, rs17658739, rs56618494, rs61036243
A > G
No VIP available No Clinical Annotations available VA
rs183484 NC_000011.10:g.4119902C>A, NC_000011.9:g.4141132C>A, NG_027992.2:g.30209C>A, NM_001033.3:c.850C>A, NM_001033.4:c.850C>A, NM_001318064.1:c.559C>A, NM_001318065.1:c.-207C>A, NP_001024.1:p.Arg284=, NP_001304993.1:p.Arg187=, XM_005253058.1:c.607C>A, XM_005253059.1:c.559C>A, XM_011520277.1:c.559C>A, XM_011520278.1:c.184C>A, XM_011520279.1:c.-207C>A, XP_005253115.1:p.Arg203=, XP_005253116.1:p.Arg187=, XP_011518579.1:p.Arg187=, XP_011518580.1:p.Arg62=, rs17210748, rs1735058, rs17850105, rs2228122
C > A
No VIP available No Clinical Annotations available VA
rs1870377 NC_000004.11:g.55972974T>A, NC_000004.12:g.55106807T>A, NG_012004.1:g.23789A>T, NM_002253.2:c.1416A>T, NP_002244.1:p.Gln472His, rs52810770
T > A
No VIP available CA VA
rs1872328 NC_000002.11:g.54395259G>A, NC_000002.12:g.54168122G>A, NM_138448.3:c.185+29374G>A
G > A
No VIP available No Clinical Annotations available VA
rs1885301 NC_000010.10:g.101541053A>G, NC_000010.11:g.99781296A>G, NG_011798.1:g.3591A>G, NM_000392.4:c.-1549A>G, XM_005269536.1:c.-1549A>G, XM_006717631.2:c.-1549A>G, XM_011539291.1:c.-1549A>G, XR_945604.1:n.-1360A>G, XR_945605.1:n.-1358A>G, rs17216261, rs59934936
A > G
No VIP available No Clinical Annotations available VA
rs2010963 NC_000006.11:g.43738350C>G, NC_000006.12:g.43770613C>G, NG_008732.1:g.5398C>G, NM_001025366.2:c.-94C>G, NM_001025367.2:c.-94C>G, NM_001025368.2:c.-94C>G, NM_001025369.2:c.-94C>G, NM_001025370.2:c.-94C>G, NM_001033756.2:c.-94C>G, NM_001171622.1:c.-94C>G, NM_001171623.1:c.-634C>G, NM_001171624.1:c.-634C>G, NM_001171625.1:c.-634C>G, NM_001171626.1:c.-634C>G, NM_001171627.1:c.-634C>G, NM_001171628.1:c.-634C>G, NM_001171629.1:c.-634C>G, NM_001171630.1:c.-634C>G, NM_001204384.1:c.-634C>G, NM_001204385.1:c.-94C>G, NM_001287044.1:c.-1507C>G, NM_001317010.1:c.-634C>G, NM_003376.5:c.-94C>G, XM_005249363.1:c.-1507C>G
C > G
No VIP available No Clinical Annotations available VA
rs2018683 NC_000007.13:g.29014195G>T, NC_000007.14:g.28974579G>T, rs56487635, rs59311291
G > T
No VIP available No Clinical Annotations available VA
rs2031920 NC_000010.10:g.135339845C>T, NC_000010.11:g.133526341C>T, NG_008383.1:g.3979C>T, NM_000773.3:c.-1055C>T, XM_005252665.1:c.-512C>T, rs3813868
C > T
No VIP available No Clinical Annotations available VA
rs2032582 NC_000007.13:g.87160618A>C, NC_000007.13:g.87160618A>T, NC_000007.14:g.87531302A>C, NC_000007.14:g.87531302A>T, NG_011513.1:g.186947T>A, NG_011513.1:g.186947T>G, NM_000927.4:c.2677T>A, NM_000927.4:c.2677T>G, NP_000918.2:p.Ser893Ala, NP_000918.2:p.Ser893Thr, rs10228331, rs2229106, rs386553610, rs57135550, rs9641018
A > C
A > T
No VIP available CA VA
rs2070676 NC_000010.10:g.135351137G>C, NC_000010.11:g.133537633G>C, NG_008383.1:g.15271G>C, NM_000773.3:c.1156-118G>C, XM_005252665.1:c.1216-118G>C, rs17012756, rs56527359, rs59960595, rs60668193
G > C
No VIP available No Clinical Annotations available VA
rs2071559 NC_000004.11:g.55992366A>G, NC_000004.12:g.55126199A>G, NG_012004.1:g.4397T>C, NM_002253.2:c.-906T>C, rs59863954
A > G
No VIP available No Clinical Annotations available VA
rs2072671 NC_000001.10:g.20915701A>C, NC_000001.11:g.20589208A>C, NM_001785.2:c.79A>C, NP_001776.1:p.Lys27Gln, rs57221291
A > C
No VIP available CA VA
rs2075252 NC_000002.11:g.170010985T>C, NC_000002.12:g.169154475T>C, NG_012634.1:g.213138A>G, NM_004525.2:c.12280A>G, NP_004516.2:p.Lys4094Glu, XM_005246551.1:c.9991A>G, XM_011511183.1:c.12151A>G, XM_011511184.1:c.9991A>G, XP_005246608.1:p.Lys3331Glu, XP_011509485.1:p.Lys4051Glu, XP_011509486.1:p.Lys3331Glu, rs17848193, rs386556527, rs52808684, rs59573352
T > C
No VIP available No Clinical Annotations available VA
rs2166219 NC_000002.11:g.19617302T>C, NC_000002.12:g.19417541T>C, XR_939779.1:n.496-18349A>G, rs13008844, rs16986416, rs58751495
T > C
No VIP available CA VA
rs2207396 NC_000006.11:g.152382382G>A, NC_000006.12:g.152061247G>A, NG_008493.1:g.375752G>A, NM_000125.3:c.1369+123G>A, NM_001122740.1:c.1369+123G>A, NM_001122741.1:c.1369+123G>A, NM_001122742.1:c.1369+123G>A, NM_001291230.1:c.1375+123G>A, NM_001291241.1:c.1366+123G>A, XM_005266856.1:c.1375+123G>A, XM_005266857.1:c.1366+123G>A, XM_006715374.2:c.1369+123G>A, XM_006715375.2:c.850+123G>A, XM_011535543.1:c.1369+123G>A, XM_011535544.1:c.1369+123G>A, XM_011535545.1:c.1369+123G>A, XM_011535546.1:c.1369+123G>A, XM_011535547.1:c.1369+123G>A, XM_011535548.1:c.850+123G>A, XM_011535549.1:c.640+123G>A, XR_943116.1:n.7257C>T, rs17847072, rs57792040
G > A
No VIP available CA VA
rs2228001 NC_000003.11:g.14187449G>T, NC_000003.12:g.14145949G>T, NG_011763.1:g.37724C>A, NM_001145769.1:c.2704C>A, NM_004628.4:c.2815C>A, NP_001139241.1:p.Gln902Lys, NP_004619.3:p.Gln939Lys, NR_027299.1:n.2795C>A, rs17620623, rs17856505, rs3729583, rs60736379
G > T
No VIP available CA VA
rs2228171 NC_000002.11:g.170053505C>T, NC_000002.12:g.169196995C>T, NG_012634.1:g.170618G>A, NM_004525.2:c.8614G>A, NP_004516.2:p.Ala2872Thr, XM_005246551.1:c.6325G>A, XM_005246552.1:c.8614G>A, XM_011511183.1:c.8614G>A, XM_011511184.1:c.6325G>A, XM_011511185.1:c.8614G>A, XP_005246608.1:p.Ala2109Thr, XP_005246609.1:p.Ala2872Thr, XP_011509485.1:p.Ala2872Thr, XP_011509486.1:p.Ala2109Thr, XP_011509487.1:p.Ala2872Thr, rs117432666, rs17848174, rs2302697, rs4668123, rs52816657, rs57579868
C > T
No VIP available No Clinical Annotations available VA
rs2236225 NC_000014.8:g.64908845G>A, NC_000014.9:g.64442127G>A, NG_012450.1:g.59087G>A, NM_005956.3:c.1958G>A, NP_005947.3:p.Arg653Gln, XM_005267693.1:c.2126G>A, XP_005267750.1:p.Arg709Gln, rs117048039, rs17751608, rs17850560, rs52810262, rs56503831, rs58065500
G > A
No VIP available No Clinical Annotations available VA
rs2273697 NC_000010.10:g.101563815G>A, NC_000010.11:g.99804058G>A, NG_011798.1:g.26353G>A, NM_000392.4:c.1249G>A, NP_000383.1:p.Val417Ile, XM_005269536.1:c.1249G>A, XM_006717630.2:c.553G>A, XM_006717631.2:c.1249G>A, XM_011539291.1:c.1249G>A, XP_005269593.1:p.Val417Ile, XP_006717693.1:p.Val185Ile, XP_006717694.1:p.Val417Ile, XP_011537593.1:p.Val417Ile, XR_945604.1:n.1438G>A, XR_945605.1:n.1440G>A, rs17216184, rs60620335
G > A
No VIP available CA VA
rs2284449 NC_000011.10:g.4099619T>C, NC_000011.9:g.4120849T>C, NG_027992.2:g.9926T>C, NM_001033.3:c.20-2374T>C, NM_001033.4:c.20-2374T>C, NM_001318064.1:c.-94-2374T>C, XM_005253058.1:c.20-2374T>C, XM_005253059.1:c.-94-2374T>C, XM_011520277.1:c.-94-2374T>C, rs52806873
T > C
No VIP available CA VA
rs2291767 NC_000002.11:g.241080132T>C, NC_000002.12:g.240140715T>C, NM_148961.3:c.-214A>G
T > C
No VIP available CA VA
rs2299939 NC_000010.10:g.89657150C>A, NC_000010.11:g.87897393C>A, NG_007466.2:g.38955C>A, NM_000314.4:c.164+3284C>A, NM_000314.6:c.164+3284C>A, NM_001304717.2:c.683+3284C>A, NM_001304718.1:c.-542+3284C>A, XM_006717926.2:c.164+3284C>A, XM_011539981.1:c.164+3284C>A, XM_011539982.1:c.68+16955C>A, XR_945789.1:n.876+3284C>A, XR_945790.1:n.876+3284C>A, XR_945791.1:n.876+3284C>A, rs17561756, rs52816835, rs60036687
C > A
C > T
No VIP available No Clinical Annotations available VA
rs2305948 NC_000004.11:g.55979558C>T, NC_000004.12:g.55113391C>T, NG_012004.1:g.17205G>A, NM_002253.2:c.889G>A, NP_002244.1:p.Val297Ile, rs386564519, rs52830740, rs56532927, rs56973163
C > T
No VIP available CA VA
rs232043 NC_000011.10:g.4117895G>A, NC_000011.9:g.4139125G>A, NG_027992.2:g.28202G>A, NM_001033.3:c.651-425G>A, NM_001033.4:c.651-425G>A, NM_001318064.1:c.360-425G>A, NM_001318065.1:c.-406-425G>A, XM_005253058.1:c.408-425G>A, XM_005253059.1:c.360-425G>A, XM_011520277.1:c.360-425G>A, XM_011520278.1:c.-16-425G>A, XM_011520279.1:c.-406-425G>A, rs1662167
G > A
No VIP available CA VA
T > C
No VIP available No Clinical Annotations available VA
rs2494750 NC_000014.8:g.105262912G>C, NC_000014.9:g.104796575G>C, NG_012188.1:g.4169C>G, NG_042073.1:g.395G>C, NM_001014431.1:c.-1172C>G, NM_001014432.1:c.-1256C>G, rs57563070
G > C
No VIP available CA VA
rs2494752 NC_000014.8:g.105263608A>G, NC_000014.9:g.104797271A>G, NG_012188.1:g.3473T>C, NG_042073.1:g.1091A>G, NM_001014431.1:c.-1868T>C, NM_001014432.1:c.-1952T>C
A > G
No VIP available No Clinical Annotations available VA
rs2498786 NC_000014.8:g.105262368C>G, NC_000014.9:g.104796031C>G, NG_012188.1:g.4713G>C, NM_001014431.1:c.-628G>C, NM_001014432.1:c.-712G>C, XM_005267401.1:c.-1992G>C, XM_011536543.1:c.-2170G>C, XM_011536544.1:c.-2984G>C
C > G
No VIP available CA VA
rs2498804 NC_000014.8:g.105233095C>A, NC_000014.9:g.104766758C>A, XR_429419.2:n.-1209C>A, rs386568280, rs56890536
C > A
No VIP available CA VA
rs25487 NC_000019.10:g.43551574T>C, NC_000019.9:g.44055726T>C, NG_033799.1:g.29005A>G, NM_006297.2:c.1196A>G, NP_006288.2:p.Gln399Arg, rs11553658, rs17435395, rs3817410, rs386493716, rs57378728
T > C
No VIP available No Clinical Annotations available VA
rs25489 NC_000019.10:g.43552260C>T, NC_000019.9:g.44056412C>T, NG_033799.1:g.28319G>A, NM_006297.2:c.839G>A, NP_006288.2:p.Arg280His, rs17435388, rs2229675, rs2307183
C > T
No VIP available CA VA
rs25648 NC_000006.11:g.43738977C>T, NC_000006.12:g.43771240C>T, NG_008732.1:g.6025C>T, NM_001025366.2:c.534C>T, NM_001025367.2:c.534C>T, NM_001025368.2:c.534C>T, NM_001025369.2:c.534C>T, NM_001025370.2:c.534C>T, NM_001033756.2:c.534C>T, NM_001171622.1:c.534C>T, NM_001171623.1:c.-7C>T, NM_001171624.1:c.-7C>T, NM_001171625.1:c.-7C>T, NM_001171626.1:c.-7C>T, NM_001171627.1:c.-7C>T, NM_001171628.1:c.-7C>T, NM_001171629.1:c.-7C>T, NM_001171630.1:c.-7C>T, NM_001204384.1:c.-7C>T, NM_001204385.1:c.534C>T, NM_001287044.1:c.-880C>T, NM_001317010.1:c.-7C>T, NM_003376.5:c.534C>T, NP_001020537.2:p.Ser178=, NP_001020538.2:p.Ser178=, NP_001020539.2:p.Ser178=, NP_001020540.2:p.Ser178=, NP_001020541.2:p.Ser178=, NP_001028928.1:p.Ser178=, NP_001165093.1:p.Ser178=, NP_001191314.1:p.Ser178=, NP_003367.4:p.Ser178=, XM_005249363.1:c.-880C>T
C > T
No VIP available No Clinical Annotations available VA
rs2612091 NC_000018.10:g.683607C>T, NC_000018.9:g.683607C>T, NM_001126123.3:c.496-227G>A, NM_001318759.1:c.742-227G>A, NM_001318760.1:c.199-227G>A, NM_017512.5:c.742-227G>A, NM_202758.3:c.805-227G>A, XM_005258111.1:c.886-227G>A, XM_005258112.1:c.661-227G>A, XM_005258113.1:c.658-227G>A, XM_005258114.1:c.514-227G>A, XM_005258115.1:c.496-227G>A, XM_005258116.1:c.496-227G>A, XM_005258117.1:c.310-227G>A, XM_005258118.1:c.199-227G>A, XM_005258118.2:c.199-227G>A, XM_005258120.1:c.157-227G>A, XM_011525677.1:c.769-212G>A, XM_011525678.1:c.760-212G>A, XM_011525679.1:c.769-227G>A, XM_011525680.1:c.742-212G>A, XM_011525681.1:c.730-212G>A, XM_011525682.1:c.703-212G>A, XM_011525683.1:c.580-212G>A, XM_011525684.1:c.553-212G>A, XM_011525685.1:c.541-212G>A, XM_011525686.1:c.517-212G>A, XM_011525687.1:c.514-227G>A, XM_011525688.1:c.496-212G>A, XM_011525689.1:c.364-212G>A, XM_011525690.1:c.364-212G>A, XM_011525691.1:c.310-212G>A, XM_011525692.1:c.310-212G>A, XM_011525693.1:c.310-212G>A, XM_011525694.1:c.310-227G>A, XM_011525695.1:c.271-212G>A, XM_011525696.1:c.199-212G>A, XM_011525697.1:c.157-212G>A, XM_011525698.1:c.157-212G>A, XM_011525699.1:c.157-212G>A, XR_243810.1:n.937-227G>A, XR_243810.3:n.778-227G>A, XR_243811.1:n.803-227G>A, XR_243811.2:n.803-227G>A, XR_243812.1:n.938-227G>A, XR_430041.2:n.940-227G>A, XR_935066.1:n.778-212G>A, XR_935067.1:n.778-212G>A, rs61671949
C > T
No VIP available CA VA
rs2699887 NC_000003.11:g.178866408C>T, NC_000003.12:g.179148620C>T, NG_012113.2:g.5098C>T, NM_006218.2:c.-77+17C>T, NR_125401.1:n.-647G>A, XM_006713658.2:c.-77+401C>T, XM_011512894.1:c.-1173C>T, XR_241620.1:n.-643G>A
C > T
No VIP available No Clinical Annotations available VA
rs2720376 NC_000004.11:g.185554300C>T, NC_000004.12:g.184633146C>T, NM_004346.3:c.179-750G>A, NM_032991.2:c.179-750G>A, XM_005263266.1:c.179-750G>A, XM_011532301.1:c.179-750G>A, rs17586243, rs58845854
C > T
No VIP available No Clinical Annotations available VA
rs2762939 NC_000020.10:g.52781251G>C, NC_000020.11:g.54164712G>C, NG_008334.1:g.14266C>G, NM_000782.4:c.733-149C>G, NM_001128915.1:c.733-149C>G, XM_005260304.1:c.733-149C>G, XM_005260304.3:c.733-149C>G, XM_005260305.1:c.733-149C>G, rs57991016
G > C
No VIP available No Clinical Annotations available VA
rs2804402 NC_000010.10:g.101541583A>G, NC_000010.11:g.99781826A>G, NG_011798.1:g.4121A>G, NM_000392.4:c.-1019A>G, XM_005269536.1:c.-1019A>G, XM_006717631.2:c.-1019A>G, XM_011539291.1:c.-1019A>G, XR_945604.1:n.-830A>G, XR_945605.1:n.-828A>G, rs17222526, rs60149027
A > G
No VIP available No Clinical Annotations available VA
rs3025039 NC_000006.11:g.43752536C>T, NC_000006.12:g.43784799C>T, NG_008732.1:g.19584C>T, NM_001025366.2:c.*237C>T, NM_001025367.2:c.*237C>T, NM_001025368.2:c.*237C>T, NM_001025369.2:c.*253C>T, NM_001025370.2:c.*237C>T, NM_001033756.2:c.*171C>T, NM_001171622.1:c.*237C>T, NM_001171623.1:c.*237C>T, NM_001171624.1:c.*237C>T, NM_001171625.1:c.*237C>T, NM_001171626.1:c.*237C>T, NM_001171627.1:c.*253C>T, NM_001171628.1:c.*237C>T, NM_001171629.1:c.*171C>T, NM_001171630.1:c.*237C>T, NM_001204384.1:c.*237C>T, NM_001204385.1:c.*237C>T, NM_001287044.1:c.*237C>T, NM_001317010.1:c.*171C>T, NM_003376.5:c.*237C>T, XM_005249363.1:c.*237C>T, rs11575898
C > T
No VIP available No Clinical Annotations available VA
rs307805 NC_000005.10:g.180650487T>C, NC_000005.9:g.180077487T>C, NG_011536.1:g.4138A>G, NM_002020.4:c.-942A>G, NM_182925.4:c.-942A>G, XM_011534482.1:c.-942A>G, XM_011534483.1:c.-289A>G, rs1309960, rs57113127
T > C
No VIP available No Clinical Annotations available VA
rs307822 NC_000005.10:g.180601717T>C, NC_000005.9:g.180028717T>C, NG_011536.1:g.52908A>G, NM_182925.4:c.*1475A>G, XM_011534477.1:c.*1475A>G, XM_011534478.1:c.*1475A>G, XM_011534482.1:c.*1475A>G, XM_011534483.1:c.*1475A>G, XM_011534484.1:c.*1475A>G, rs1309977
T > C
No VIP available No Clinical Annotations available VA
rs3087386 NC_000002.11:g.100055506A>G, NC_000002.12:g.99439044A>G, NM_001037872.1:c.770T>C, NM_016316.2:c.770T>C, NP_001032961.1:p.Phe257Ser, NP_057400.1:p.Phe257Ser, XM_005263967.1:c.770T>C, XM_005263968.1:c.560T>C, XM_005263969.1:c.-825T>C, XM_011511336.1:c.770T>C, XM_011511337.1:c.770T>C, XM_011511338.1:c.560T>C, XM_011511339.1:c.-825T>C, XP_005264024.1:p.Phe257Ser, XP_005264025.1:p.Phe187Ser, XP_011509638.1:p.Phe257Ser, XP_011509639.1:p.Phe257Ser, XP_011509640.1:p.Phe187Ser, XR_244891.1:n.931T>C, XR_427092.1:n.1151T>C, XR_922941.1:n.780T>C, rs3749086, rs58019413
A > G
No VIP available No Clinical Annotations available VA
rs3087399 NC_000002.11:g.100055158T>C, NC_000002.12:g.99438696T>C, NM_001037872.1:c.1118A>G, NM_016316.2:c.1118A>G, NP_001032961.1:p.Asn373Ser, NP_057400.1:p.Asn373Ser, XM_005263967.1:c.1118A>G, XM_005263968.1:c.908A>G, XM_005263969.1:c.-477A>G, XM_011511336.1:c.1118A>G, XM_011511337.1:c.1118A>G, XM_011511338.1:c.908A>G, XM_011511339.1:c.-477A>G, XP_005264024.1:p.Asn373Ser, XP_005264025.1:p.Asn303Ser, XP_011509638.1:p.Asn373Ser, XP_011509639.1:p.Asn373Ser, XP_011509640.1:p.Asn303Ser, XR_244891.1:n.1279A>G, XR_427092.1:n.1499A>G, XR_922941.1:n.1128A>G, rs52791165, rs57440453
T > C
No VIP available CA VA
rs3087403 NC_000002.11:g.100058870C>T, NC_000002.12:g.99442408C>T, NM_001037872.1:c.412G>A, NM_016316.2:c.412G>A, NP_001032961.1:p.Val138Met, NP_057400.1:p.Val138Met, XM_005263967.1:c.412G>A, XM_005263968.1:c.202G>A, XM_011511336.1:c.412G>A, XM_011511337.1:c.412G>A, XM_011511338.1:c.202G>A, XP_005264024.1:p.Val138Met, XP_005264025.1:p.Val68Met, XP_011509638.1:p.Val138Met, XP_011509639.1:p.Val138Met, XP_011509640.1:p.Val68Met, XR_244891.1:n.573G>A, XR_427092.1:n.793G>A, XR_922941.1:n.422G>A, rs17713429, rs52807598, rs58647355
C > T
No VIP available CA VA
rs316019 NC_000006.11:g.160670282A>C, NC_000006.12:g.160249250A>C, NM_003058.3:c.808T>G, NP_003049.2:p.Ser270Ala, rs1755917, rs17846267, rs17859289, rs386580336, rs52803175, rs60007366, rs666224
A > C
No VIP available No Clinical Annotations available VA
rs3204953 NC_000006.11:g.111628626C>T, NC_000006.12:g.111307423C>T, NM_001286431.1:c.8956G>A, NM_001286432.1:c.8956G>A, NM_002912.4:c.9190G>A, NP_001273360.1:p.Val2986Ile, NP_001273361.1:p.Val2986Ile, NP_002903.3:p.Val3064Ile, XM_005267088.1:c.8956G>A, XM_005267089.1:c.8824G>A, XM_006715543.2:c.9190G>A, XM_006715544.2:c.8956G>A, XM_011536028.1:c.9271G>A, XM_011536029.1:c.9268G>A, XM_011536030.1:c.9193G>A, XM_011536031.1:c.9037G>A, XM_011536032.1:c.9037G>A, XP_005267145.1:p.Val2986Ile, XP_005267146.1:p.Val2942Ile, XP_006715606.1:p.Val3064Ile, XP_006715607.1:p.Val2986Ile, XP_011534330.1:p.Val3091Ile, XP_011534331.1:p.Val3090Ile, XP_011534332.1:p.Val3065Ile, XP_011534333.1:p.Val3013Ile, XP_011534334.1:p.Val3013Ile, XR_942871.1:n.2045+29265C>T, rs17511539, rs386580771, rs52817805
C > T
No VIP available CA VA
rs3212986 NC_000019.10:g.45409478C>A, NC_000019.9:g.45912736C>A, NG_015839.2:g.74351G>T, NM_001166049.1:c.*197G>T, NM_001297590.1:c.1516C>A, NM_001983.3:c.*197G>T, NM_012099.1:c.1510C>A, NP_001284519.1:p.Gln506Lys, NP_036231.1:p.Gln504Lys, XM_005258425.1:c.1516C>A, XM_005258638.1:c.*197G>T, XP_005258482.1:p.Gln506Lys, rs386580934, rs60333438
C > A
C > T
No VIP available CA VA
rs3219484 NC_000001.10:g.45800156C>T, NC_000001.11:g.45334484C>T, NG_008189.1:g.10987G>A, NM_001048171.1:c.64G>A, NM_001048172.1:c.22G>A, NM_001048173.1:c.22G>A, NM_001048174.1:c.22G>A, NM_001128425.1:c.64G>A, NM_001293190.1:c.64G>A, NM_001293191.1:c.22G>A, NM_001293192.1:c.-191G>A, NM_001293195.1:c.22G>A, NM_001293196.1:c.-191G>A, NM_012222.2:c.64G>A, NP_001041636.1:p.Val22Met, NP_001041637.1:p.Val8Met, NP_001041638.1:p.Val8Met, NP_001041639.1:p.Val8Met, NP_001121897.1:p.Val22Met, NP_001280119.1:p.Val22Met, NP_001280120.1:p.Val8Met, NP_001280124.1:p.Val8Met, NP_036354.1:p.Val22Met, XM_005270880.1:c.64G>A, XM_005270881.1:c.22G>A, XM_005270882.1:c.22G>A, XM_005270883.1:c.-135G>A, XM_005270884.1:c.-191G>A, XM_005270885.1:c.-191G>A, XM_005270886.1:c.-52G>A, XM_011541497.1:c.40G>A, XM_011541498.1:c.22G>A, XM_011541499.1:c.22G>A, XM_011541500.1:c.22G>A, XM_011541501.1:c.22G>A, XM_011541502.1:c.22G>A, XM_011541503.1:c.64G>A, XM_011541504.1:c.22G>A, XM_011541505.1:c.-52G>A, XM_011541506.1:c.-52G>A, XM_011541507.1:c.-1167G>A, XM_011541508.1:c.-1194G>A, XP_005270937.1:p.Val22Met, XP_005270938.1:p.Val8Met, XP_005270939.1:p.Val8Met, XP_011539799.1:p.Val14Met, XP_011539800.1:p.Val8Met, XP_011539801.1:p.Val8Met, XP_011539802.1:p.Val8Met, XP_011539803.1:p.Val8Met, XP_011539804.1:p.Val8Met, XP_011539805.1:p.Val22Met, XP_011539806.1:p.Val8Met, XR_946658.1:n.111G>A, rs17784895, rs52809192, rs61197742
C > T
No VIP available No Clinical Annotations available VA
rs34716810 NC_000019.10:g.40286682G>A, NC_000019.9:g.40792589G>A, NG_012038.2:g.3677C>T, NM_001243027.2:c.-1735C>T, NM_001243028.2:c.-1642C>T, NM_001626.5:c.-1586C>T, XM_005258648.1:c.-1319C>T, XM_005258650.1:c.-1586C>T, XM_011526617.1:c.-2299C>T, XM_011526618.1:c.-2002C>T, XM_011526620.1:c.-1319C>T, XM_011526621.1:c.-1718C>T, XM_011526622.1:c.-1586C>T, XR_935967.1:n.169+83G>A, rs62107592
G > A
No VIP available No Clinical Annotations available VA
rs3740066 NC_000010.10:g.101604207C>T, NC_000010.11:g.99844450C>T, NG_011798.1:g.66745C>T, NM_000392.4:c.3972C>T, NP_000383.1:p.Ile1324=, XM_005269536.1:c.3693C>T, XM_006717630.2:c.3276C>T, XP_005269593.1:p.Ile1231=, XP_006717693.1:p.Ile1092=, XR_945604.1:n.4161C>T, XR_945605.1:n.4036C>T, rs12780340, rs17216303, rs59292214
C > T
No VIP available CA VA
rs3740556 NC_000010.10:g.120840195G>A, NC_000010.11:g.119080683G>A, NM_003750.2:c.-7C>T, XM_005270259.1:c.-7C>T, XM_005270260.1:c.-357C>T
G > A
No VIP available No Clinical Annotations available VA
rs3787554 NC_000020.10:g.52782680G>A, NC_000020.11:g.54166141G>A, NG_008334.1:g.12837C>T, NM_000782.4:c.641-308C>T, NM_001128915.1:c.641-308C>T, XM_005260304.1:c.641-308C>T, XM_005260304.3:c.641-308C>T, XM_005260305.1:c.641-308C>T
G > A
No VIP available No Clinical Annotations available VA
rs3803304 NC_000014.8:g.105239146C>G, NC_000014.9:g.104772809C>G, NG_012188.1:g.27936G>C, NM_001014431.1:c.1172+69G>C, NM_001014432.1:c.1172+69G>C, NM_005163.2:c.1172+69G>C, XM_005267401.1:c.1172+69G>C, XM_005267402.1:c.1169+69G>C, XM_011536543.1:c.1172+69G>C, XM_011536544.1:c.1172+69G>C
C > G
No VIP available No Clinical Annotations available VA
rs3817657 NC_000011.10:g.4121362T>C, NC_000011.9:g.4142592T>C, NG_027992.2:g.31669T>C, NM_001033.3:c.877-242T>C, NM_001033.4:c.877-242T>C, NM_001318064.1:c.586-242T>C, NM_001318065.1:c.-138-242T>C, XM_005253058.1:c.634-242T>C, XM_005253059.1:c.586-242T>C, XM_011520277.1:c.586-242T>C, XM_011520278.1:c.211-242T>C, XM_011520279.1:c.-138-242T>C, rs57325561
T > C
No VIP available No Clinical Annotations available VA
rs3832043 NC_000002.11:g.234580454delT, NC_000002.12:g.233671808delT, NG_002601.2:g.87065delT, NM_019075.2:c.855+34431del, NM_019075.2:c.855+34431delT, NM_019076.4:c.855+53246del, NM_019076.4:c.855+53246delT, NM_021027.2:c.-127del, NM_021027.2:c.-127delT, XR_241241.1:n.-41delT, rs150487502, rs35426722, rs371526135, rs57111427, rs67695772, rs67695773
T > -
No VIP available CA VA
rs3957357 NC_000006.11:g.52668687A>G, NC_000006.12:g.52803889A>G, NM_001319059.1:c.-281T>C, NM_145740.4:c.-135T>C, XM_005249034.1:c.-135T>C, XM_005249034.2:c.-135T>C, rs58145964
A > G
No VIP available No Clinical Annotations available VA
rs4124874 NC_000002.11:g.234665659T>G, NC_000002.12:g.233757013T>G, NG_002601.2:g.172270T>G, NG_033238.1:g.1741T>G, NM_001072.3:c.862-10021T>G, NM_007120.2:c.868-10021T>G, NM_019075.2:c.856-10021T>G, NM_019076.4:c.856-10021T>G, NM_019077.2:c.856-10021T>G, NM_019078.1:c.868-10021T>G, NM_019093.2:c.868-10021T>G, NM_021027.2:c.856-10021T>G, NM_205862.1:c.61-10021T>G, NR_037694.1:n.-1668A>C, NR_037695.1:n.-1668A>C, NR_037696.1:n.-1668A>C, XR_241238.1:n.924-10021T>G, XR_241240.1:n.1023-10021T>G, XR_241241.1:n.942-10021T>G, rs57409706
T > G
No VIP available No Clinical Annotations available VA
rs4148323 NC_000002.11:g.234669144G>A, NC_000002.12:g.233760498G>A, NG_002601.2:g.175755G>A, NG_033238.1:g.5226G>A, NM_000463.2:c.211G>A, NM_001072.3:c.862-6536G>A, NM_007120.2:c.868-6536G>A, NM_019075.2:c.856-6536G>A, NM_019076.4:c.856-6536G>A, NM_019077.2:c.856-6536G>A, NM_019078.1:c.868-6536G>A, NM_019093.2:c.868-6536G>A, NM_021027.2:c.856-6536G>A, NM_205862.1:c.61-6536G>A, NP_000454.1:p.Gly71Arg, XR_241238.1:n.924-6536G>A, XR_241239.1:n.233G>A, XR_241240.1:n.1023-6536G>A, XR_241241.1:n.942-6536G>A, rs113525835, rs34360183, rs58105808, rs58585123
G > A
No VIP available CA VA
rs4148416 NC_000017.10:g.48753423C>T, NC_000017.11:g.50676062C>T, NM_003786.3:c.3039C>T, NP_003777.2:p.Gly1013=, XM_005257763.1:c.2847C>T, XM_005257763.2:c.2847C>T, XM_011525422.1:c.2952C>T, XM_011525423.1:c.3144C>T, XM_011525424.1:c.2364C>T, XM_011525425.1:c.2313C>T, XP_005257820.1:p.Gly949=, XP_011523724.1:p.Gly984=, XP_011523725.1:p.Gly1048=, XP_011523726.1:p.Gly788=, XP_011523727.1:p.Gly771=, XR_934586.1:n.3237C>T
C > T
No VIP available CA VA
rs4148737 NC_000007.13:g.87171152T>C, NC_000007.14:g.87541836T>C, NG_011513.1:g.176413A>G, NM_000927.4:c.2212-372A>G, rs386591482, rs60838665
T > C
No VIP available CA VA
rs4492666 NC_000001.10:g.47800845A>C, NC_000001.11:g.47335173A>C, NM_001136140.1:c.171+1057A>C, NM_016308.2:c.171+1057A>C, NR_046394.1:n.320+1057A>C, NR_046395.1:n.320+1057A>C, rs61400292
A > C
A > T
No VIP available CA VA
rs451774 NC_000006.11:g.28502550A>G, NC_000006.12:g.28534773A>G, NM_001509.2:c.*606A>G, NM_003996.3:c.*851A>G, NT_113891.2:g.24754A>G, NT_113891.3:g.24654A>G, XM_011514527.1:c.*606A>G, XM_011514528.1:c.*606A>G, XM_011514529.1:c.*606A>G, XM_011514530.1:c.*606A>G, XM_011547233.1:c.*606A>G, XM_011547234.1:c.*606A>G, XM_011547235.1:c.*606A>G, XM_011547236.1:c.*606A>G, rs115878751, rs118080793, rs60258350
A > G
No VIP available No Clinical Annotations available VA
rs45445694 NC_000018.10:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NC_000018.9:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NG_028255.1:g.5043_5070CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NM_001012716.2:c.*34+169_*34+196CGGGACGGAGGCAGGCCAAGTGGCGCGG[2][3][4][7][8][9], NM_001071.2:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258137.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258138.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], rs34743033 (retired)
No VIP available CA VA
rs462779 NC_000006.11:g.111695887G>A, NC_000006.12:g.111374684G>A, NM_001286431.1:c.3437C>T, NM_001286432.1:c.3437C>T, NM_002912.4:c.3671C>T, NP_001273360.1:p.Thr1146Ile, NP_001273361.1:p.Thr1146Ile, NP_002903.3:p.Thr1224Ile, XM_005267088.1:c.3437C>T, XM_005267089.1:c.3305C>T, XM_005267090.1:c.3671C>T, XM_005267091.1:c.3671C>T, XM_006715543.2:c.3671C>T, XM_006715544.2:c.3437C>T, XM_011536028.1:c.3674C>T, XM_011536029.1:c.3671C>T, XM_011536030.1:c.3674C>T, XM_011536031.1:c.3440C>T, XM_011536032.1:c.3440C>T, XM_011536033.1:c.3674C>T, XM_011536034.1:c.3674C>T, XM_011536035.1:c.3674C>T, XM_011536036.1:c.3674C>T, XP_005267145.1:p.Thr1146Ile, XP_005267146.1:p.Thr1102Ile, XP_005267147.1:p.Thr1224Ile, XP_005267148.1:p.Thr1224Ile, XP_006715606.1:p.Thr1224Ile, XP_006715607.1:p.Thr1146Ile, XP_011534330.1:p.Thr1225Ile, XP_011534331.1:p.Thr1224Ile, XP_011534332.1:p.Thr1225Ile, XP_011534333.1:p.Thr1147Ile, XP_011534334.1:p.Thr1147Ile, XP_011534335.1:p.Thr1225Ile, XP_011534336.1:p.Thr1225Ile, XP_011534337.1:p.Thr1225Ile, XP_011534338.1:p.Thr1225Ile, XR_942545.1:n.4223C>T, XR_942546.1:n.4223C>T, rs17510886, rs386594115, rs52812261, rs56811779
G > A
No VIP available No Clinical Annotations available VA
rs4638843 NC_000002.11:g.47704027G>C, NC_000002.12:g.47476888G>C, NG_007110.2:g.78765G>C, NM_000251.2:c.2210+317G>C, NM_001258281.1:c.2012+317G>C, XM_005264332.1:c.2210+317G>C, XM_005264332.2:c.2210+317G>C, XM_005264333.1:c.2060+317G>C, XM_011532867.1:c.2210+317G>C, XR_939685.1:n.2282+317G>C, rs17224885, rs5023612, rs61203271
G > C
No VIP available CA VA
rs4646316 NC_000022.10:g.19952132C>T, NC_000022.11:g.19964609C>T, NG_011526.1:g.27870C>T, NM_000754.3:c.615+310C>T, NM_001135161.1:c.615+310C>T, NM_001135162.1:c.615+310C>T, NM_007310.2:c.465+310C>T, XM_005261229.1:c.615+310C>T, XM_011529885.1:c.729+310C>T, XM_011529886.1:c.729+310C>T, XM_011529887.1:c.615+310C>T, XM_011529888.1:c.615+310C>T, XM_011529889.1:c.615+310C>T, XM_011529890.1:c.615+310C>T, XM_011529891.1:c.615+310C>T, rs58510682
C > T
No VIP available No Clinical Annotations available VA
rs4646437 NC_000007.13:g.99365083G>A, NC_000007.14:g.99767460G>A, NG_008421.1:g.21726C>T, NM_001202855.2:c.671-205C>T, NM_017460.5:c.671-202C>T, XM_011515841.1:c.671-202C>T, XM_011515842.1:c.671-205C>T, rs386594232, rs57997883
G > A
No VIP available No Clinical Annotations available VA
rs4655567 NC_000001.10:g.68101640G>C, NC_000001.11:g.67635957G>C, rs57378090, rs57576059
G > C
No VIP available No Clinical Annotations available VA
rs465646 NC_000006.11:g.111620758G>A, NC_000006.12:g.111299555G>A, NM_001286431.1:c.*461C>T, NM_001286432.1:c.*461C>T, NM_002912.4:c.*461C>T, XM_005267088.1:c.*461C>T, XM_005267089.1:c.*461C>T, XM_006715543.2:c.*461C>T, XM_006715544.2:c.*461C>T, XM_011536028.1:c.*461C>T, XM_011536029.1:c.*461C>T, XM_011536030.1:c.*461C>T, XM_011536031.1:c.*461C>T, XM_011536032.1:c.*461C>T, XR_942871.1:n.2045+21397G>A, rs17511609, rs3805825, rs59824672
G > A
No VIP available CA VA
T > C
No VIP available No Clinical Annotations available VA
rs4834232 NC_000004.11:g.129024273C>T, NC_000004.12:g.128103118C>T, NM_001278604.1:c.814-4021C>T, NM_018078.3:c.814-4021C>T, NM_032239.3:c.814-4021C>T, NM_178043.2:c.814-4021C>T, XM_005263086.1:c.1417-4021C>T, XM_005263087.1:c.1417-4021C>T, XM_005263088.1:c.1417-4021C>T, XM_005263089.1:c.1273-4021C>T, XM_005263090.1:c.1417-4021C>T, XM_005263091.1:c.1417-4021C>T, XM_005263092.1:c.1417-4021C>T, XM_005263093.1:c.1417-4021C>T, XM_005263094.1:c.1417-4021C>T, XM_005263095.1:c.1417-4021C>T, XM_005263096.1:c.1417-4021C>T, XM_005263097.1:c.1417-4021C>T, XM_005263098.1:c.1417-4021C>T, XM_005263099.1:c.91-4021C>T, XM_005263100.1:c.91-4021C>T, XM_005263101.1:c.1417-4021C>T, XM_011532057.1:c.814-4021C>T, XM_011532058.1:c.814-4021C>T, XM_011532059.1:c.814-4021C>T, XM_011532060.1:c.814-4021C>T, XM_011532061.1:c.1276-4021C>T, XM_011532062.1:c.814-4021C>T, XM_011532063.1:c.814-4021C>T, XM_011532064.1:c.814-4021C>T, XM_011532065.1:c.1276-4021C>T, XM_011532066.1:c.814-4021C>T, XM_011532067.1:c.814-4021C>T, XM_011532068.1:c.673-4021C>T, XM_011532069.1:c.673-4021C>T, XM_011532070.1:c.814-4021C>T, XM_011532071.1:c.814-4021C>T, XM_011532072.1:c.814-4021C>T, XM_011532073.1:c.814-4021C>T, XM_011532074.1:c.814-4021C>T, XM_011532075.1:c.91-4021C>T, XM_011532076.1:c.91-4021C>T, XM_011532077.1:c.91-4021C>T, XM_011532078.1:c.814-4021C>T, XR_938753.1:n.891-4021C>T, XR_938754.1:n.891-4021C>T, XR_938755.1:n.891-4021C>T, XR_938756.1:n.891-4021C>T, XR_938757.1:n.891-4021C>T, XR_938758.1:n.891-4021C>T, XR_938759.1:n.891-4021C>T, XR_938760.1:n.891-4021C>T, XR_938761.1:n.891-4021C>T, XR_938762.1:n.891-4021C>T, rs17394472, rs59780448
C > T
No VIP available No Clinical Annotations available VA
rs4932551 NC_000015.10:g.91528728G>C, NC_000015.9:g.92071958G>C, rs17772730, rs56529178, rs57899076, rs58182249
G > C
No VIP available No Clinical Annotations available VA
rs5009910 NC_000002.11:g.31249014T>C, NC_000002.12:g.31026148T>C, NM_001253826.1:c.315-59846A>G, NM_001253827.1:c.70-33141A>G, NM_024572.3:c.130-33141A>G, NR_045602.1:n.903-33141A>G, XM_005264559.1:c.25-33141A>G, XM_011533104.1:c.448-33141A>G, XM_011533105.1:c.70-33141A>G, XM_011533106.1:c.43-33141A>G, rs56597185, rs59566663, rs60531112
T > C
No VIP available No Clinical Annotations available VA
rs560018 NC_000001.10:g.110200360T>C, NC_000001.11:g.109657738T>C, NM_000850.4:c.260-34T>C, NM_147148.2:c.260-34T>C, NR_024538.1:n.492-34T>C, XM_011541297.1:c.260-34T>C, XM_011541298.1:c.-53-34T>C, rs17531990, rs1800657, rs58086519
T > C
No VIP available No Clinical Annotations available VA
rs56038477 NC_000001.10:g.98039419C>T, NC_000001.11:g.97573863C>T, NG_008807.2:g.352197G>A, NM_000110.3:c.1236G>A, NP_000101.2:p.Glu412=, XM_005270561.1:c.1125G>A, XM_005270562.1:c.1236G>A, XM_005270562.3:c.1236G>A, XM_005270563.1:c.1236G>A, XM_005270564.1:c.1236G>A, XM_006710397.2:c.1236G>A, XP_005270618.1:p.Glu375=, XP_005270619.1:p.Glu412=, XP_005270619.2:p.Glu412=, XP_005270620.1:p.Glu412=, XP_005270621.1:p.Glu412=, XP_006710460.1:p.Glu412=, rs199469533, rs61730901
C > T
No VIP available No Clinical Annotations available VA
rs5906072 NC_000023.10:g.45640507T>C, NC_000023.11:g.45781104T>C, NW_004070879.1:g.105769T>C, rs59017433, rs59105359, rs6609373
T > C
No VIP available No Clinical Annotations available VA
rs5934731 NC_000023.10:g.9935844C>T, NC_000023.11:g.9967804C>T, NM_001195081.1:c.447C>T, NP_001182010.1:p.Tyr149=, XM_006724448.2:c.579C>T, XP_006724511.2:p.Tyr193=, rs56455686, rs57784312, rs6640581
C > T
No VIP available No Clinical Annotations available VA
rs60369023 NC_000001.10:g.20931474G>A, NC_000001.11:g.20604981G>A, NM_001785.2:c.208G>A, NP_001776.1:p.Ala70Thr
G > A
No VIP available No Clinical Annotations available VA
rs62107593 NC_000019.10:g.40287019C>G, NC_000019.9:g.40792926C>G, NG_012038.2:g.3340G>C, NM_001243027.2:c.-2072G>C, NM_001243028.2:c.-1979G>C, NM_001626.5:c.-1923G>C, XM_005258648.1:c.-1656G>C, XM_005258650.1:c.-1923G>C, XM_011526620.1:c.-1656G>C, XM_011526621.1:c.-2055G>C, XM_011526622.1:c.-1923G>C, XR_935967.1:n.169+420C>G
C > G
No VIP available CA VA
rs6413432 NC_000010.10:g.135348544T>A, NC_000010.11:g.133535040T>A, NG_008383.1:g.12678T>A, NM_000773.3:c.967+1143T>A, XM_005252665.1:c.1027+1143T>A
T > A
No VIP available No Clinical Annotations available VA
rs6458232 NC_000006.11:g.41629726C>A, NC_000006.12:g.41661988C>A, rs59690886
C > A
No VIP available No Clinical Annotations available VA
rs664393 NC_000013.10:g.29071001T>C, NC_000013.11:g.28496864T>C, NG_012003.1:g.3265A>G, NM_001159920.1:c.-2021A>G, NM_001160030.1:c.-2021A>G, NM_001160031.1:c.-2021A>G, NM_002019.4:c.-2021A>G, XM_011535014.1:c.-2021A>G, rs59180014
T > C
No VIP available No Clinical Annotations available VA
rs6721961 NC_000002.11:g.178130037T>G, NC_000002.12:g.177265309T>G, NM_001145412.3:c.-1910A>C, NM_001145413.3:c.-1910A>C, NM_001313900.1:c.-1784A>C, NM_001313901.1:c.-1876A>C, NM_001313902.1:c.-733A>C, NM_001313903.1:c.-733A>C, NM_001313904.1:c.-2091A>C, NM_006164.4:c.-733A>C, rs117801448
T > C
T > G
No VIP available No Clinical Annotations available VA
rs67376798 NC_000001.10:g.97547947T>A, NC_000001.11:g.97082391T>A, NG_008807.2:g.843669A>T, NM_000110.3:c.2846A>T, NP_000101.2:p.Asp949Val, XM_005270561.1:c.2735A>T, XM_005270562.1:c.2630A>T, XM_005270562.3:c.2630A>T, XP_005270618.1:p.Asp912Val, XP_005270619.1:p.Asp877Val, XP_005270619.2:p.Asp877Val, rs199469564, rs386467430, rs67376799
T > A
No VIP available No Clinical Annotations available VA
rs6752303 NC_000002.11:g.31247485T>C, NC_000002.12:g.31024619T>C, NM_001253826.1:c.315-58317A>G, NM_001253827.1:c.70-31612A>G, NM_024572.3:c.130-31612A>G, NR_045602.1:n.903-31612A>G, XM_005264559.1:c.25-31612A>G, XM_011533104.1:c.448-31612A>G, XM_011533105.1:c.70-31612A>G, XM_011533106.1:c.43-31612A>G, rs111184598, rs56566923, rs56952366, rs61068192
T > C
No VIP available No Clinical Annotations available VA
rs6848982 NC_000004.11:g.128959213G>A, NC_000004.12:g.128038058G>A, NM_001319305.1:c.*2245G>A, NM_001319306.1:c.*2245G>A, NM_001319307.1:c.*2245G>A
G > A
No VIP available No Clinical Annotations available VA
rs6877011 NC_000005.10:g.180602471C>G, NC_000005.9:g.180029471C>G, NG_011536.1:g.52154G>C, NM_182925.4:c.*721G>C, XM_011534477.1:c.*721G>C, XM_011534478.1:c.*721G>C, XM_011534482.1:c.*721G>C, XM_011534483.1:c.*721G>C, XM_011534484.1:c.*721G>C, rs59862001
C > G
No VIP available CA VA
rs698 NC_000004.11:g.100260789T>C, NC_000004.12:g.99339632T>C, NG_011718.1:g.18129A>G, NM_000669.4:c.1048A>G, NP_000660.1:p.Ile350Val, NR_133005.1:n.1374A>G, XM_011531588.1:c.946A>G, XM_011531589.1:c.928A>G, XP_011529890.1:p.Ile316Val, XP_011529891.1:p.Ile310Val, rs1042758, rs117472071, rs1693473, rs17399447, rs17855753, rs3182222, rs4134508, rs56906178
T > -
T > C
No VIP available No Clinical Annotations available VA
rs7121 NC_000020.10:g.57478807C>T, NC_000020.11:g.58903752C>T, NG_016194.1:g.69013C>T, NM_000516.5:c.393C>T, NM_001077488.3:c.396C>T, NM_001077489.3:c.348C>T, NM_001077490.2:c.*254C>T, NM_001309840.1:c.216C>T, NM_001309861.1:c.216C>T, NM_016592.3:c.*299C>T, NM_080425.3:c.2322C>T, NM_080426.3:c.351C>T, NP_000507.1:p.Ile131=, NP_001070956.1:p.Ile132=, NP_001070957.1:p.Ile116=, NP_001296769.1:p.Ile72=, NP_001296790.1:p.Ile72=, NP_536350.2:p.Ile774=, NP_536351.1:p.Ile117=, NR_003259.1:n.483C>T, XM_005260396.1:c.336C>T, XM_005260397.1:c.297C>T, XM_005260398.1:c.252C>T, XM_005260399.1:c.171C>T, XM_005260400.1:c.171C>T, XM_005260401.1:c.171C>T, XM_005260402.1:c.219C>T, XP_005260453.1:p.Ile112=, XP_005260454.1:p.Ile99=, XP_005260455.1:p.Ile84=, XP_005260456.1:p.Ile57=, XP_005260457.1:p.Ile57=, XP_005260458.1:p.Ile57=, XP_005260459.1:p.Ile73=, XR_244140.1:n.1443C>T, rs1053389, rs17829840, rs3171206, rs3730167, rs61041002
C > -
C > T
No VIP available No Clinical Annotations available VA
rs7131224 NC_000011.10:g.24225985T>C, NC_000011.9:g.24247531T>C, rs111186995, rs58002303, rs58056067
T > C
No VIP available No Clinical Annotations available VA
rs715171 NC_000023.10:g.9341848C>T, NC_000023.11:g.9373808C>T, rs61410664
C > T
No VIP available No Clinical Annotations available VA
rs7170769 NC_000015.10:g.91526975C>T, NC_000015.9:g.92070205C>T, rs58543442
C > T
No VIP available No Clinical Annotations available VA
rs717620 NC_000010.10:g.101542578C>T, NC_000010.11:g.99782821C>T, NG_011798.1:g.5116C>T, NM_000392.4:c.-24C>T, XM_005269536.1:c.-24C>T, XM_006717631.2:c.-24C>T, XM_011539291.1:c.-24C>T, XR_945604.1:n.166C>T, XR_945605.1:n.168C>T, rs17216163, rs386485129, rs58371376
C > T
No VIP available CA VA
rs7186128 NC_000016.10:g.16864058G=, NC_000016.10:g.16864058G>A, NC_000016.9:g.16957915G>A, NT_187607.1:g.2524971A=, NT_187607.1:g.2524971A>G, rs56576370, rs57245322, rs58011988
G > A
No VIP available CA VA
rs720106 NC_000011.10:g.4118748T>C, NC_000011.9:g.4139978T>C, NG_027992.2:g.29055T>C, NM_001033.3:c.792+287T>C, NM_001033.4:c.792+287T>C, NM_001318064.1:c.501+287T>C, NM_001318065.1:c.-265+287T>C, XM_005253058.1:c.549+287T>C, XM_005253059.1:c.501+287T>C, XM_011520277.1:c.501+287T>C, XM_011520278.1:c.126+287T>C, XM_011520279.1:c.-265+287T>C
T > C
No VIP available No Clinical Annotations available VA
rs725518 NC_000011.10:g.4107615G>A, NC_000011.9:g.4128845G>A, NG_027992.2:g.17922G>A, NM_001033.3:c.387+80G>A, NM_001033.4:c.387+80G>A, NM_001318064.1:c.96+80G>A, XM_005253058.1:c.202+1476G>A, XM_005253059.1:c.96+80G>A, XM_011520277.1:c.96+80G>A, rs17423023, rs386608733, rs61333041
G > A
No VIP available CA VA
rs726501 NC_000005.10:g.56832039G>A, NC_000005.9:g.56127866G>A, NG_031884.1:g.21967G>A, NM_005921.1:c.482+15984G>A, XM_005248519.1:c.71+11223G>A, XM_005248519.3:c.104+11223G>A, XM_005248520.1:c.-8+14923G>A, XM_011543406.1:c.227+15704G>A, XM_011543407.1:c.482+15984G>A, XM_011543408.1:c.482+15984G>A, rs57031684
G > A
No VIP available No Clinical Annotations available VA
rs74090038 NC_000014.8:g.105262781C>T, NC_000014.9:g.104796444C>T, NG_012188.1:g.4300G>A, NG_042073.1:g.264C>T, NM_001014431.1:c.-1041G>A, NM_001014432.1:c.-1125G>A, XM_005267401.1:c.-2405G>A, XM_011536543.1:c.-2583G>A, XM_011536544.1:c.-3397G>A
C > T
No VIP available No Clinical Annotations available VA
rs7483 NC_000001.10:g.110279701C>T, NC_000001.11:g.109737079C>T, NM_000849.4:c.670G>A, NP_000840.2:p.Val224Ile, NR_024537.1:n.904G>A, XM_011541296.1:c.889G>A, XP_011539598.1:p.Val297Ile, rs17845187, rs17857997, rs3167664, rs386610559, rs52802282, rs58618587
C > -
C > T
No VIP available No Clinical Annotations available VA
rs7608731 NC_000002.11:g.31249974T>C, NC_000002.12:g.31027108T>C, NM_001253826.1:c.315-60806A>G, NM_001253827.1:c.70-34101A>G, NM_024572.3:c.130-34101A>G, NR_045602.1:n.903-34101A>G, XM_005264559.1:c.25-34101A>G, XM_011533104.1:c.448-34101A>G, XM_011533105.1:c.70-34101A>G, XM_011533106.1:c.43-34101A>G, rs56452495, rs57143999
T > C
No VIP available No Clinical Annotations available VA
rs763110 NC_000001.10:g.172627498C=, NC_000001.10:g.172627498C>T, NC_000001.11:g.172658358C=, NC_000001.11:g.172658358C>T, NG_007269.1:g.4314C=, NG_007269.1:g.4314C>T, NM_000639.2:c.-157-687C>T, NM_000639.2:c.-844C=, NM_001302746.1:c.-844C=, NM_001302746.1:c.-844C>T, rs59042607
C > T
No VIP available No Clinical Annotations available VA
rs7664413 NC_000004.11:g.177608707C>T, NC_000004.12:g.176687553C>T, NG_034216.1:g.110193G>A, NM_005429.4:c.812-33G>A, XR_939498.1:n.260+7803C>T, XR_939499.1:n.209+17844C>T, rs58304891
C > T
No VIP available No Clinical Annotations available VA
rs7667298 NC_000004.11:g.55991731T>C, NC_000004.12:g.55125564T>C, NG_012004.1:g.5032A>G, NM_002253.2:c.-271A>G, rs386485376, rs60563091
T > C
No VIP available CA VA
rs7851395 NC_000009.11:g.116002464A>G, NC_000009.12:g.113240184A>G, NM_001859.3:c.-35-15930A>G
A > G
No VIP available CA VA
G > A
No VIP available No Clinical Annotations available VA
rs7940013 NC_000011.10:g.4117074C>T, NC_000011.9:g.4138304C>T, NG_027992.2:g.27381C>T, NM_001033.3:c.651-1246C>T, NM_001033.4:c.651-1246C>T, NM_001318064.1:c.360-1246C>T, NM_001318065.1:c.-407+714C>T, XM_005253058.1:c.408-1246C>T, XM_005253059.1:c.360-1246C>T, XM_011520277.1:c.360-1246C>T, XM_011520278.1:c.-17+714C>T, XM_011520279.1:c.-407+714C>T, rs59381386, rs61670155
C > T
No VIP available No Clinical Annotations available VA
rs7993418 NC_000013.10:g.28883061G>A, NC_000013.11:g.28308924G>A, NG_012003.1:g.191205C>T, NM_002019.4:c.3639C>T, NP_002010.2:p.Tyr1213=, rs117224149, rs57281829
G > A
No VIP available No Clinical Annotations available VA
rs8020368 NC_000014.8:g.95943548T>C, NC_000014.9:g.95477211T>C, NM_152592.3:c.-1390A>G, XM_005267376.1:c.-14-1376A>G, XM_005267376.3:c.176-1376A>G, XM_005267377.1:c.-14-1376A>G, XM_005267377.2:c.-14-1376A>G, XM_005267378.1:c.-14-1376A>G, XM_005267379.1:c.-14-1376A>G, XM_005267380.1:c.-14-1376A>G, XM_006720063.2:c.-14-1376A>G, XM_011536513.1:c.176-1376A>G, XM_011536514.1:c.176-1376A>G, XM_011536515.1:c.11-1376A>G, XM_011536516.1:c.176-1376A>G, rs56427699, rs58836477, rs59378010
T > C
No VIP available No Clinical Annotations available VA
(TA)6 > (TA)5
(TA)6 > (TA)7
(TA)6 > (TA)8
No VIP available No Clinical Annotations available VA
rs8187710 NC_000010.10:g.101611294G>A, NC_000010.11:g.99851537G>A, NG_011798.1:g.73832G>A, NM_000392.4:c.4544G>A, NP_000383.1:p.Cys1515Tyr, XM_005269536.1:c.4265G>A, XM_006717630.2:c.3848G>A, XP_005269593.1:p.Cys1422Tyr, XP_006717693.1:p.Cys1283Tyr, XR_945605.1:n.4608G>A, rs17222568, rs52804507, rs58135906
G > A
No VIP available No Clinical Annotations available VA
rs833061 NC_000006.11:g.43737486C>T, NC_000006.12:g.43769749C>T, NG_008732.1:g.4534C>T, NM_001025366.2:c.-958C>T, NM_001025367.2:c.-958C>T, NM_001025368.2:c.-958C>T, NM_001025369.2:c.-958C>T, NM_001025370.2:c.-958C>T, NM_001033756.2:c.-958C>T, NM_001171622.1:c.-958C>T, NM_001171623.1:c.-1498C>T, NM_001171624.1:c.-1498C>T, NM_001171625.1:c.-1498C>T, NM_001171626.1:c.-1498C>T, NM_001171627.1:c.-1498C>T, NM_001171628.1:c.-1498C>T, NM_001171629.1:c.-1498C>T, NM_001171630.1:c.-1498C>T, NM_001204384.1:c.-1498C>T, NM_001204385.1:c.-958C>T, NM_001317010.1:c.-1498C>T, NM_003376.5:c.-958C>T, rs36208046, rs60746584
C > T
No VIP available No Clinical Annotations available VA
rs861539 NC_000014.8:g.104165753G>A, NC_000014.9:g.103699416G>A, NG_011516.1:g.21071C>T, NG_012307.1:g.75229G>A, NM_001100118.1:c.722C>T, NM_001100119.1:c.722C>T, NM_001130107.1:c.1782-1239G>A, NM_005432.3:c.722C>T, NM_182923.3:c.1651-1239G>A, NP_001093588.1:p.Thr241Met, NP_001093589.1:p.Thr241Met, NP_005423.1:p.Thr241Met, XM_005267599.1:c.1924-1239G>A, XM_005267600.1:c.*17-1239G>A, XM_005267602.1:c.1897-1239G>A, XM_005267603.1:c.*17-1239G>A, XM_005267604.1:c.1857-1239G>A, XM_005267605.1:c.1849-1239G>A, XM_005267606.1:c.*17-1239G>A, XM_005267607.1:c.1830-1239G>A, XM_005267608.1:c.1825-1239G>A, XM_005267609.1:c.1822-1239G>A, XM_005267610.1:c.*46-1239G>A, XM_005267612.1:c.*17-1239G>A, XM_005267613.1:c.1758-1239G>A, XM_005267614.1:c.1755-1239G>A, XM_005267615.1:c.1726-1239G>A, XM_005267616.1:c.*17-1239G>A, XM_005267617.1:c.1699-1239G>A, XM_005267618.1:c.*17-1239G>A, XM_005267624.1:c.1624-1239G>A, XM_005268045.1:c.722C>T, XM_005268046.1:c.722C>T, XM_005268047.1:c.722C>T, XM_011537138.1:c.722C>T, XP_005268102.1:p.Thr241Met, XP_005268103.1:p.Thr241Met, XP_005268104.1:p.Thr241Met, XP_011535440.1:p.Thr241Met, rs1734804, rs17435402, rs17850783, rs3212111, rs56934996
G > A
No VIP available CA VA
rs9332377 NC_000022.10:g.19955692C>T, NC_000022.11:g.19968169C>T, NG_011526.1:g.31430C>T, NG_023326.1:g.53618G>A, NM_000754.3:c.616-367C>T, NM_001135161.1:c.616-367C>T, NM_001135162.1:c.616-367C>T, NM_007310.2:c.466-367C>T, XM_005261229.1:c.616-367C>T, XM_005261242.1:c.2764-960G>A, XM_006724243.1:c.2782-960G>A, XM_006724246.2:c.2536-960G>A, XM_011529885.1:c.*742C>T, XM_011529886.1:c.730-367C>T, XM_011529887.1:c.*742C>T, XM_011529888.1:c.*742C>T, XM_011529889.1:c.*742C>T, XM_011529890.1:c.*742C>T, XM_011529891.1:c.*742C>T, XM_011530179.1:c.2749-960G>A, XM_011530182.1:c.1348-960G>A, rs60676269
C > T
No VIP available No Clinical Annotations available VA
rs939338 NC_000003.11:g.183704068G>A, NC_000003.12:g.183986280G>A, NM_001023587.2:c.592-902C>T, NM_001320032.1:c.-941+1490C>T, NM_005688.3:c.591+1490C>T, NR_135125.1:n.778-825C>T, XM_005247058.1:c.591+1490C>T, XM_005247058.3:c.591+1490C>T, XM_005247059.1:c.591+1490C>T, XM_005247059.3:c.591+1490C>T, XM_005247060.1:c.591+1490C>T, XM_005247061.1:c.591+1490C>T, XM_005247062.1:c.-941+1490C>T, XM_011512314.1:c.591+1490C>T, XM_011512315.1:c.591+1490C>T, XM_011512316.1:c.-941+1490C>T, rs17218204, rs3749439, rs56440939, rs59349069
G > A
No VIP available CA VA
rs9597 NC_000016.10:g.1324950C>G, NC_000016.9:g.1374951C>G, NM_003345.4:c.*157C>G, NM_194259.2:c.*157C>G, NM_194260.2:c.*157C>G, NM_194261.2:c.*157C>G, XM_005255544.1:c.*157C>G, rs74248366
C > G
No VIP available CA VA
rs9679162 NC_000002.11:g.31247514G>T, NC_000002.12:g.31024648G>T, NM_001253826.1:c.315-58346C>A, NM_001253827.1:c.70-31641C>A, NM_024572.3:c.130-31641C>A, NR_045602.1:n.903-31641C>A, XM_005264559.1:c.25-31641C>A, XM_011533104.1:c.448-31641C>A, XM_011533105.1:c.70-31641C>A, XM_011533106.1:c.43-31641C>A, rs56573917, rs57478659, rs60984987
G > T
No VIP available No Clinical Annotations available VA
rs9937 NC_000011.10:g.4138227A>G, NC_000011.9:g.4159457A>G, NG_027992.2:g.48534A>G, NM_001033.3:c.2223A>G, NM_001033.4:c.2223A>G, NM_001318064.1:c.1932A>G, NM_001318065.1:c.1209A>G, NP_001024.1:p.Thr741=, NP_001304993.1:p.Thr644=, NP_001304994.1:p.Thr403=, XM_005253058.1:c.1980A>G, XM_005253059.1:c.1932A>G, XM_011520277.1:c.1932A>G, XM_011520278.1:c.1557A>G, XM_011520279.1:c.1209A>G, XP_005253115.1:p.Thr660=, XP_005253116.1:p.Thr644=, XP_011518579.1:p.Thr644=, XP_011518580.1:p.Thr519=, XP_011518581.1:p.Thr403=, rs1042857, rs17295553, rs17349998, rs17398272, rs17850106, rs2228120, rs3177016, rs59628733
A > G
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 147


Generic Names
  • CACP
  • CPDC
  • CPDD
  • Cis-DDP
  • Cis-Diaminedichloroplatinum
  • Cis-Diamminedichloroplatinum
  • DDP
  • DDPT
  • Diamminedichloroplatinum
  • Platinum Ammine Chloride
  • Platinum Ammonium Chloride
  • Platinum Diamine Dichloride
  • Trans-DDP
  • Trans-Diaminedichloroplatinum
  • Trans-Diamminedichloroplatinum
  • Trans-Dichlorodiammine Platinum
  • Trans-Platinumdiammine Dichloride
Trade Names
  • Abiplatin
  • Biocisplatinum
  • Briplatin
  • Carboquone
  • Cis Pt II
  • Cismaplat
  • Cisplatine
  • Cisplatyl
  • Citoplationo
  • Lederplatin
  • Neoplatin
  • Plastin
  • Platamine
  • Platiblastin
  • Platidiam
  • Platinex
  • Platinol
  • Platinol-AQ
  • Platinoxan
  • Randa
Brand Mixture Names

PharmGKB Accession Id





Cisplatin, cisplatinum or cis-diamminedichloroplatinum(II) (CDDP) is a platinum-based chemotherapy drug used to treat various types of cancers, including sarcomas, some carcinomas (e.g. small cell lung cancer, and ovarian cancer), lymphomas and germ cell tumors. It was the first member of its class, which now also includes carboplatin and oxaliplatin.

Source: Drug Bank


Cisplatin is one of the most widely used platinum-based antineoplastic agents for treatment of various forms of cancer, including solid tumour and haematological malignancies, cancers of the Testicular Neoplasms, Ovarian Neoplasms, Urinary Bladder Neoplasms, Head and Neck Neoplasms, Esophageal Neoplasms, Stomach Neoplasms and Lung Neoplasms in addition to Lymphoma and Osteosarcoma. Cisplatin is an alkylating agent which destroys cancerous cells through DNA crosslinking, thereby preventing cell division and growth [Article:19525887]. The efficacy of cisplatin is often compromised because of the substantial risk for severe toxicities due to non-specific targeting and intrinsic and/or acquired resistance. Cisplatin has a narrow therapeutic index, and patients may experience toxicities affecting hearing (Ototoxicity) or affecting renal, gastrointestinal, neurological or haematological systems even when administered at standard doses [Articles:19139108, 3538860, 19243296, 19851045].


Cellular detoxification of cisplatin is regulated by the glutathione-S-transferase (GST) enzymes (GSTP1, GSTM1, GSTM3). Genetic changes influencing the activity of these enzymes may result in variations in cisplatin-induced toxicity or resistance. Association studies have revealed that cisplatin-induced toxicity is associated with genetic variations in GSTP1 [Articles:18855538, 18162130, 17228018, 19638079, 16317430], GSTM1 [Article:18162130], GSTM3 [Article:11081456], LRP2 (megalin) [Article:17457342], TPMT (rs12201199, [Article:19898482]), COMT (rs9332377, [Article:19898482]), TYMS [Article:16317430] and XPC [Article:19434073]. Variants associated with cisplatin-based treatment response are listed on the PGx tab attached to this page.


The influx of carboplatin into the cell can occur via SLC31A1 (CTR1) [Articles:12391279, 19509135] and SLC31A2 [Article:19509135]. The efflux of cisplatin is mediated by two copper efflux transporters ATP7A and ATP7B [Articles:17318448, 20045993, 18998134]. ATP7A and ATP7B are thought to be involved in resistance to cisplatin, either by sequestering drug away from its targets (ATP7A) or by exporting the drug from the cell (ATP7B). Drug transporters ABCC1 [Articles:17318448, 20045993, 18998134], ABCC2 [Articles:8797578, 19568750], ABCB1 [Article:20189873] and ABCG2 [Articles:20082278, 19900859, 15014021] may also play a role in cisplatin transport and response.


Cisplatin acts by forming platinum-DNA adducts, and this leads to cell-cycle arrest and apoptosis [Article:19525887]. Candidate genes for cisplatin pharmacodynamics include those involved in excision repair, mismatch repair and double strand break repair. Variants in ERCC1 [Articles:19638079, 19955911, 19620936, 16957145, 19620936, 20189873], ERCC2 [Articles:19434073, 19786980, 19620936], MLH1, MSH2 [Article:20458443], and XRCC1 (Arg399Gln, [Articles:18400332, 20331623]) are associated with cisplatin response. Other candidate genes include BRCA1 [Articles:19638079, 20331623, 19403936, 19249193] and TP53 [Article:19620936].

Genes involved in transport, detoxification and action of the platinum-based drugs including cisplatin are depicted in the Platinum Pathway, Pharmacokinetics/Pharmacodynamics.

An extensive list of candidate SNPs obtained by treatment of Coriell cell lines with cisplatin is available at PACdb [Article:20216476].

Source: PharmGKB [Article:20458443] [Article:20331623] [Article:20216476] [Article:20189873] [Article:19568750] [Article:19786980] [Article:19955911] [Article:19898482] [Article:19900859] [Article:19851045] [Article:19434073] [Article:19249193] [Article:19620936] [Article:19509135] [Article:19525887] [Article:18998134] [Article:19638079] [Article:19403936] [Article:19243296] [Article:19139108] [Article:20045993] [Article:20082278] [Article:18400332] [Article:18855538] [Article:17457342] [Article:17318448] [Article:17228018] [Article:18162130] [Article:16957145] [Article:16317430] [Article:15014021] [Article:12391279] [Article:11081456] [Article:8797578] [Article:3538860]


For the treatment of metastatic testicular tumors, metastatic ovarian tumors and advanced bladder cancer.

Source: Drug Bank

Other Vocabularies

Information pulled from DrugBank has not been reviewed by PharmGKB.

Pharmacology, Interactions, and Contraindications

Mechanism of Action

Alkylating agents work by three different mechanisms: 1) attachment of alkyl groups to DNA bases, resulting in the DNA being fragmented by repair enzymes in their attempts to replace the alkylated bases, preventing DNA synthesis and RNA transcription from the affected DNA, 2) DNA damage via the formation of cross-links (bonds between atoms in the DNA) which prevents DNA from being separated for synthesis or transcription, and 3) the induction of mispairing of the nucleotides leading to mutations.

Source: Drug Bank


Cisplatin is an antineoplastic in the class of alkylating agents and is used to treat various forms of cancer. Alkylating agents are so named because of their ability to add alkyl groups to many electronegative groups under conditions present in cells. They stop tumor growth by cross-linking guanine bases in DNA double-helix strands - directly attacking DNA. This makes the strands unable to uncoil and separate. As this is necessary in DNA replication, the cells can no longer divide. In addition, these drugs add methyl or other alkyl groups onto molecules where they do not belong which in turn inhibits their correct utilization by base pairing and causes a miscoding of DNA. Alkylating agents are cell cycle-nonspecific. Alkylating agents work by three different mechanisms all of which achieve the same end result - disruption of DNA function and cell death.

Source: Drug Bank

Food Interaction

Echinacea should be used with caution, if at all, in patients receiving therapeutic immunosuppressants. Monitor for reduced efficacy of the immunosuppressant during concomitant use.

Source: Drug Bank

Absorption, Distribution, Metabolism, Elimination & Toxicity

Protein Binding

Greater than 90%.

Source: Drug Bank


20-30 minutes

Source: Drug Bank


* 15 - 16 L/h/m2 [After infusions of 100 mg/m2.]

Source: Drug Bank

Route of Elimination

The parent compound, cisplatin, is excreted in the urine. Although small amounts of platinum are present in the bile and large intestine after administration of cisplatin, the fecal excretion of platinum appears to be insignificant.

Source: Drug Bank

Chemical Properties

Chemical Formula


Source: Drug Bank

Isomeric SMILES


Source: OpenEye

Canonical SMILES


Source: Drug Bank

Average Molecular Weight


Source: Drug Bank

Monoisotopic Molecular Weight


Source: Drug Bank



Source: Drug Bank

InChI String


Source: Drug Bank

Genes that are associated with this drug in PharmGKB's database based on (1) variant annotations, (2) literature review, (3) pathways or (4) information automatically retrieved from DrugBank, depending on the "evidence" and "source" listed below.

Curated Information ?

No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available

Drug Interactions

Interaction Description
amikacin - cisplatin Increased risk of nephrotoxicity (source: Drug Bank )
bumetanide - cisplatin Increased ototoxicity (source: Drug Bank )
bumetanide - cisplatin Increased ototoxicity (source: Drug Bank )
ethacrynic acid - cisplatin Increased ototoxicity (source: Drug Bank )
ethacrynic acid - cisplatin Increased ototoxicity (source: Drug Bank )
fosphenytoin - cisplatin The antineoplasic agent decreases the effect of hydantoin (source: Drug Bank )
furosemide - cisplatin Increased ototoxicity (source: Drug Bank )
furosemide - cisplatin Increased ototoxicity (source: Drug Bank )
gentamicin - cisplatin Increased risk of nephrotoxicity (source: Drug Bank )
gentamicin - cisplatin Increased risk of nephrotoxicity (source: Drug Bank )
methotrexate - cisplatin Cisplatin increases methotrexate toxicity (source: Drug Bank )
methotrexate - cisplatin Cisplatin increases methotrexate toxicity (source: Drug Bank )
netilmicin - cisplatin Increased risk of nephrotoxicity (source: Drug Bank )
paclitaxel - cisplatin Cisplatin increases the effect and toxicity of paclitaxel (source: Drug Bank )
paclitaxel - cisplatin Cisplatin increases the effect and toxicity of paclitaxel (source: Drug Bank )
phenytoin - cisplatin The antineoplasic agent decreases the effect of hydantoin (source: Drug Bank )
phenytoin - cisplatin The antineoplasic agent decreases the effect of hydantoin (source: Drug Bank )
topotecan - cisplatin Administration of Topotecan after Cisplatin therapy may increase the risk of hematologic toxicity, such as neutropenia and/or thrombocytopenia. A dose adjustment may be required or the sequence of administration reversed. (source: Drug Bank )
trastuzumab - cisplatin Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )

Curated Information ?

No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Acquired Immunodeficiency Syndrome
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Brain Neoplasms
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Breast Neoplasms
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Carcinoma, Hepatocellular
No Dosing Guideline available DL CA VA No VIP available No VIP available
Carcinoma, Non-Small-Cell Lung
No Dosing Guideline available DL CA VA No VIP available No VIP available
Carcinoma, Small Cell
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Colitis, Ulcerative
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Colonic Neoplasms
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Colorectal Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
creatinine clearance
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Crohn Disease
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Disease Progression
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Drug Resistance
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Drug Toxicity
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
drug-induced liver injury
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Esophageal Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Esophogeal Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
event-free survival
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gallbladder Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gastrointestinal Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gastrointestinal Stromal Tumors
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genital Neoplasms, Female
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
hand-foot syndrome
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Head and Neck Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Kidney Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Lung Diseases
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Lung Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Lupus Erythematosus, Systemic
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Lymphoma, Non-Hodgkin
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Muscular Diseases
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Myalgia unspecified
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Myopathy, Central Core
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Nasopharyngeal Neoplasms
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Neoplasms, Germ Cell and Embryonal
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Neurotoxicity Syndromes
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available DL CA VA No VIP available No VIP available
Ovarian Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
overall survival
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pancreatic Neoplasms
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
Peripheral Nervous System Diseases
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
progression-free survival
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Rectal Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Stevens-Johnson Syndrome
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Stomach Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Testicular Neoplasms
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Tobacco Use Disorder
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Toxic liver disease
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Urinary Bladder Neoplasms
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Uterine Cervical Neoplasms

Relationships from National Drug File - Reference Terminology (NDF-RT)

May Treat
Contraindicated With

Publications related to cisplatin: 208

No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic variants associated with outcome in patients with advanced gastric cancer treated with fluoropyrimidine and platinum-based triplet combinations: a pooled analysis of three prospective studies. The pharmacogenomics journal. 2016. Meulendijks D, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic predictors of toxicity to platinum based chemotherapy in non-small cell lung cancer patients. Pharmacological research. 2016. Pérez-Ramírez Cristina, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Promoter region variation in NFE2L2 influences susceptibility to ototoxicity in patients exposed to high cumulative doses of cisplatin. The pharmacogenomics journal. 2016. Spracklen T F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacokinetics and pharmacogenetics of Gemcitabine as a mainstay in adult and pediatric oncology: an EORTC-PAMM perspective. Cancer chemotherapy and pharmacology. 2016. Ciccolini Joseph, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Clinical Evaluation of Cisplatin Sensitivity of Germline Polymorphisms in Neoadjuvant Chemotherapy for Urothelial Cancer. Clinical genitourinary cancer. 2016. O'Donnell Peter H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacokinetic interaction between pazopanib and cisplatin regimen. Cancer chemotherapy and pharmacology. 2016. Imbs Diane-Charlotte, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Replication of a genetic variant in ACYP2 associated with cisplatin-induced hearing loss in patients with osteosarcoma. Pharmacogenetics and genomics. 2016. Vos Hanneke I, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
GALNT14 genotype effectively predicts the therapeutic response in unresectable hepatocellular carcinoma treated with transcatheter arterial chemoembolization. Pharmacogenomics. 2016. Liang Kung-Hao, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MicroRNA-509-3p increases the sensitivity of epithelial ovarian cancer cells to cisplatin-induced apoptosis. Pharmacogenomics. 2016. Chen Wei, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Targeting therapeutic liabilities engendered by PIK3R1 mutations for cancer treatment. Pharmacogenomics. 2016. Cheung Lydia Wt, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
TP53 Codon 72 Polymorphism Predicts Efficacy of Paclitaxel Plus Capecitabine Chemotherapy in Advanced Gastric Cancer Patients. Archives of medical research. 2016. Zha Yong, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Improvement of a predictive model in ovarian cancer patients submitted to platinum-based chemotherapy: implications of a GST activity profile. European journal of clinical pharmacology. 2016. Pereira Deolinda, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Molecular determinants of chemotherapy resistance in ovarian cancer. Pharmacogenomics. 2015. Cooley Megan, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics in the treatment of lung cancer: an update. Pharmacogenomics. 2015. Morales-Espinosa Daniela, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
A First Step toward Personalized Medicine in Osteosarcoma: Pharmacogenetics as Predictive Marker of Outcome after Chemotherapy-Based Treatment. Clinical cancer research : an official journal of the American Association for Cancer Research. 2015. Hagleitner Melanie M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Carboplatin/taxane-induced gastrointestinal toxicity: a pharmacogenomics study on the SCOTROC1 trial. The pharmacogenomics journal. 2015. He Y J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Translesion polymerase genes polymorphisms and haplotypes influence survival of osteosarcoma patients. Omics : a journal of integrative biology. 2015. Goričar Katja, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Human OCT2 variant c.808G>T confers protection effect against cisplatin-induced ototoxicity. Pharmacogenomics. 2015. Lanvers-Kaminsky Claudia, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Report of New Haplotype for ABCC2 Gene: rs17222723 and rs8187718 in cis. The Journal of molecular diagnostics : JMD. 2015. Pratt Victoria M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Common variants in ACYP2 influence susceptibility to cisplatin-induced hearing loss. Nature genetics. 2015. Xu Heng, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variability of DNA repair mechanisms and glutathione-S-transferase genes influences treatment outcome in osteosarcoma. Cancer epidemiology. 2015. Goričar Katja, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Correlation of UGT1A1 and ERCC1 gene polymorphisms with the outcome of combined irinotecan plus cisplatin treatment in recurrent ovarian cancer. Genetics and molecular research : GMR. 2015. Xu Q, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CD24 and APC Genetic Polymorphisms in Pancreatic Cancers as Potential Biomarkers for Clinical Outcome. PloS one. 2015. Shamai Sivan, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Glutathione S-Transferase Gene Polymorphisms and Treatment Outcome in Cervical Cancer Patients under Concomitant Chemoradiation. PloS one. 2015. Abbas Mohammad, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of the DNA repair pathways in advanced non-small cell lung cancer patients treated with platinum-based chemotherapy. Cancer letters. 2014. Sullivan Ivana, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic markers of cisplatin-induced hearing loss in children. Clinical pharmacology and therapeutics. 2014. Carleton B C, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variation in Otos is associated with cisplatin-induced ototoxicity. Pharmacogenomics. 2014. Spracklen Timothy F, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Evaluation of pharmacogenetic markers to predict the risk of Cisplatin-induced ototoxicity. Clinical pharmacology and therapeutics. 2014. Lanvers-Kaminsky C, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic variants in the glutathione S-transferase genes and survival in colorectal cancer patients after chemotherapy and differences according to treatment with oxaliplatin. Pharmacogenetics and genomics. 2014. Kap Elisabeth J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Application of next generation sequencing to CEPH cell lines to discover variants associated with FDA approved chemotherapeutics. BMC research notes. 2014. Hariani Gunjan D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PharmGKB summary: very important pharmacogene information for N-acetyltransferase 2. Pharmacogenetics and genomics. 2014. McDonagh Ellen M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Epigenetic perspectives on cancer chemotherapy response. Pharmacogenomics. 2014. Liu Mou-Ze, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenomic assessment of cisplatin-based chemotherapy outcomes in ovarian cancer. Pharmacogenomics. 2014. Khrunin Andrey V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Challenges in interpreting the evidence for genetic predictors of ototoxicity. Clinical pharmacology and therapeutics. 2013. Ratain M J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of DNA repair gene polymorphisms in non-small-cell lung carcinoma patients on platinum-based chemotherapy. Genetics and molecular research : GMR. 2014. Zhang L, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Tumor angiogenesis genotyping and efficacy of first-line chemotherapy in metastatic gastric cancer patients. Pharmacogenomics. 2013. Scartozzi Mario, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ERCC1 Cys8092Ala and XRCC1 Arg399Gln polymorphisms predict progression-free survival after curative radiotherapy for nasopharyngeal carcinoma. PloS one. 2014. Jin Hekun, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Influence of genetic variants in TPMT and COMT associated with cisplatin induced hearing loss in patients with cancer: two new cohorts and a meta-analysis reveal significant heterogeneity between cohorts. PloS one. 2014. Hagleitner Melanie M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Replication of TPMT and ABCC3 Genetic Variants Highly Associated With Cisplatin-Induced Hearing Loss in Children. Clinical pharmacology and therapeutics. 2013. Pussegoda K, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The Role of Inherited TPMT and COMT Genetic Variation in Cisplatin-Induced Ototoxicity in Children With Cancer. Clinical pharmacology and therapeutics. 2013. Yang J J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ERCC1 C8092A (rs3212986) polymorphism as a predictive marker in esophageal cancer patients treated with cisplatin/5-FU-based neoadjuvant therapy. Pharmacogenetics and genomics. 2013. Rumiato Enrica, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Understanding platinum-induced ototoxicity. Trends in pharmacological sciences. 2013. Langer Thorsten, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of ABCB1 genetic polymorphisms with susceptibility to colorectal cancer and therapeutic prognosis. Pharmacogenomics. 2013. Wu Huizhe, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
A phase I/II pharmacokinetic and pharmacogenomic study of calcitriol in combination with cisplatin and docetaxel in advanced non-small-cell lung cancer. Cancer chemotherapy and pharmacology. 2013. Ramnath N, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Cisplatin-induced ototoxicity in pediatric solid tumors: the role of glutathione S-transferases and megalin genetic polymorphisms. Journal of pediatric hematology/oncology. 2013. Choeyprasert Worawut, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Glutathione S-transferase P1 single nucleotide polymorphism predicts permanent ototoxicity in children with medulloblastoma. Pediatric blood & cancer. 2013. Rednam Surya, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DNA repair and cytotoxic drugs: the potential role of RAD51 in clinical outcome of non-small-cell lung cancer patients. Pharmacogenomics. 2013. Nogueira Augusto, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A genome-wide association study of survival in small-cell lung cancer patients treated with irinotecan plus cisplatin chemotherapy. The pharmacogenomics journal. 2013. Han J-Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Association between eIF3alpha polymorphism and severe toxicity caused by platinum-based chemotherapy in non-small cell lung cancer patients. British journal of clinical pharmacology. 2013. Xu Xiaojing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Excision repair cross-complementing gene-1, ribonucleotide reductase subunit M1, ribonucleotide reductase subunit M2, and human equilibrative nucleoside transporter-1 expression and prognostic value in biliary tract malignancy. Cancer. 2013. Fisher Sarah B, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The A/G allele of eIF3a rs3740556 predicts platinum-based chemotherapy resistance in lung cancer patients. Lung cancer (Amsterdam, Netherlands). 2013. Xu Xiaojing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The TRPM6/EGF Pathway Is Downregulated in a Rat Model of Cisplatin Nephrotoxicity. PloS one. 2013. Ledeganck Kristien J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Epigenomics and Interindividual Differences in Drug Response. Clinical pharmacology and therapeutics. 2012. Ivanov M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
PharmGKB summary: very important pharmacogene information for GSTT1. Pharmacogenetics and genomics. 2012. Thorn Caroline F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
siRNA-mediated knock-down of NOX3: therapy for hearing loss?. Cellular and molecular life sciences : CMLS. 2012. Rybak Leonard P, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic polymorphism of copper transporter protein 1 is related to platinum resistance in Chinese non-small cell lung carcinoma patients. Clinical and experimental pharmacology & physiology. 2012. Xu Xiaojing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Associations Between ABCC2 Polymorphisms and Cisplatin Disposition and Efficacy. Clinical pharmacology and therapeutics. 2012. Sprowl J A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
First-SIGNAL: first-line single-agent iressa versus gemcitabine and cisplatin trial in never-smokers with adenocarcinoma of the lung. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2012. Han Ji-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Prediction of copper transport protein 1 (CTR1) genotype on severe cisplatin induced toxicity in non-small cell lung cancer (NSCLC) patients. Lung cancer (Amsterdam, Netherlands). 2012. Xu Xiaojing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gene therapy for cisplatin-induced ototoxicity: a systematic review of in vitro and experimental animal studies. Otology & neurotology : official publication of the American Otological Society, American Neurotology Society [and] European Academy of Otology and Neurotology. 2012. Waissbluth Sofia, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association between polymorphisms of ERCC1 and survival in epithelial ovarian cancer patients with chemotherapy. Pharmacogenomics. 2012. Yan Li, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Proximal Tubular Secretion of Creatinine by Organic Cation Transporter OCT2 in Cancer Patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2012. Ciarimboli Giuliano, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genomic approach towards personalized anticancer drug therapy. Pharmacogenomics. 2012. Midorikawa Yutaka, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenomics of cisplatin-based chemotherapy in ovarian cancer patients of different ethnic origins. Pharmacogenomics. 2012. Khrunin Andrey, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Arylamine N-acetyltransferase 1: a novel drug target in cancer development. Pharmacological reviews. 2012. Butcher Neville J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variants in the PI3K/PTEN/AKT/mTOR pathway predict platinum-based chemotherapy response of advanced non-small cell lung cancers in a Chinese population. Asian Pacific journal of cancer prevention : APJCP. 2012. Xu Jia-Li, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ERCC1 as a biomarker for bladder cancer patients likely to benefit from adjuvant chemotherapy. BMC cancer. 2012. Sun Jong-Mu, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association between DNA-repair polymorphisms and survival in pancreatic cancer patients treated with combination chemotherapy. Pharmacogenomics. 2011. Giovannetti Elisa, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available