Chemical: Drug

Available Prescribing Info

Dosing Guidelines
  1. CPIC Guideline for azathioprine and TPMT
  2. DPWG Guideline for azathioprine and TPMT
last updated 05/10/2016

1. CPIC Guideline for azathioprine and TPMT


Consider an alternate agent or extreme dose reduction of azathioprine for patients with low or deficient TPMT activity. Start at 30-70% of target dose for patients with intermediate enzyme activity.


May 2016 Update on PharmGKB

Several studies have reported that individuals who carry low-function alleles for NUDT15 are unable to tolerate usual doses of thiopurines. [Articles:25108385, 25624441, 26033531, 26076924, 26405151, 26503813, 26590936, 26735160, 26878724] These alleles are more common among those of Asian ancestry and Hispanic ethnicity than others. [Articles:25624441, 26878724] The dose tolerated by those with two low-function alleles is only ~ 10% that tolerated by those with no low-function NUDT15 or TPMT alleles. [Articles:25624441, 26878724] CPIC is planning a guideline to address NUDT15 variants and possible dosing recommendations for thiopurines.

April 2013 Update

Advance online publication January 2013.

March 2011

Advance online publication January 2011.

  • Guidelines regarding the use of pharmacogenomic tests in dosing for azathioprine, thioguanine and mercaptopurine were published in Clinical Pharmacology and Therapeutics by the Clinical Pharmacogenetics Implementation Consortium (CPIC).
  • Excerpt from the 2011 thiopurine dosing guidelines:
    • "Thiopurines are most commonly used to treat nonmalignant conditions but are also critical anticancer agents. The approach to dosing adjustments based on TPMT status may differ depending on the clinical indication and the propensity to initiate therapy at higher vs. lower starting doses. We and others advocate testing for TPMT status prior to initiating thiopurine therapy, so that starting dosages can be adjusted accordingly."
  • Download and read:

Adapted from Tables 1 and 2 of the 2011 guideline manuscript.

Phenotype (Genotype)Examples of diplotypesImplications for azathioprine pharmacologic measuresDosing recommendations for azathioprineClassification of recommendations
Homozygous wild-type or normal, high activity (two functional *1 alleles)*1/*1Lower concentrations of TGN metabolites, higher methylTIMP, this is the "normal" patternStart with normal starting dose (e.g., 2-3 mg/kg/d) and adjust doses of azathioprine based on disease-specific guidelines. Allow 2 weeks to reach steady state after each dose adjustment.Strong
Heterozygote or intermediate activity (one functional allele - *1, plus one nonfunctional allele - *2, *3A, *3B, *3C, or *4)*1/*2, *1/*3A, *1/*3B, *1/*3C, *1/*4Moderate to high concentrations of TGN metabolites; low concentrations of methylTIMPIf disease treatment normally starts at the "full dose", consider starting at 30-70% of target dose (e.g., 1-1.5 mg/kg/d), and titrate based on tolerance. Allow 2-4 weeks to reach steady state after each dose adjustment.Strong
Homozygous variant, mutant, low, or deficient activity (two nonfunctional alleles - *2, *3A, *3B, *3C, or *4)*3A/*3A, *2/*3A, *3C/*3A, *3C/*4, *3C/*2, *3A/*4Extremely high concentrations of TGN metabolites; fatal toxicity possible without dose decrease; no methylTIMP metabolitesConsider alternative agents. If using azathioprine start with drastically reduced doses (reduce daily dose by 10-fold and dose thrice weekly instead of daily) and adjust doses of azathioprine based on degree of myelosuppression and disease-specific guidelines. Allow 4-6 weeks to reach steady state after each dose adjustment. Azathioprine is the likely cause of myelosuppression.Strong

last updated 08/10/2011

2. DPWG Guideline for azathioprine and TPMT


Select an alternative drug or reduce the initial dose of azathioprine for patients carrying one or two inactive TPMT alleles.


The Royal Dutch Pharmacists Association - Pharmacogenetics Working Group has evaluated therapeutic dose recommendations for azathioprine based on TPMT genotype [Article:21412232]. They recommend selecting an alternative drug or reducing the initial dose for patients carrying inactive alleles.

Phenotype (Genotype)Therapeutic Dose RecommendationLevel of EvidenceClinical Relevance
IM (one inactive allele: *2, *3, *4-*18)Select alternative drug or reduce dose by 50%. Increase dose in response of hematologic monitoring and efficacy.Published controlled studies of good quality* relating to phenotyped and/or genotyped patients or healthy volunteers, and having relevant pharmacokinetic or clinical endpoints.Clinical effect (S): Failure of lifesaving therapy e.g. anticipated myelosuppression; prevention of breast cancer relapse; arrhythmia; neutropenia < 0.5x109/l; leucopenia < 1.0x109/l; thrombocytopenia < 25x109/l; life-threatening complications from diarrhea.
PM (two inactive alleles: *2, *3, *4-*18)Select alternative drug or reduce dose by 90%. Increase dose in response of hematologic monitoring and efficacy.Published controlled studies of good quality* relating to phenotyped and/or genotyped patients or healthy volunteers, and having relevant pharmacokinetic or clinical endpoints.Clinical effect (S): death; arrhythmia; unanticipated myelosuppression.
  • *See Methods or [Article:18253145] for definition of "good quality."
  • S: statistically significant difference.

Annotated Labels

  1. FDA Label for azathioprine and TPMT
  2. PMDA Label for azathioprine and TPMT
  3. HCSC Label for azathioprine and TPMT

last updated 10/25/2013

1. FDA Label for azathioprine and TPMT

Genetic testing recommended


The azathioprine (Imuran) FDA-approved drug label recommends testing for TPMT genotype or phenotype to identify patients who are at increased risk of myelotoxicity: those with low or absent TPMT activity. Dosage reduction is recommended in those with reduced activity. The label also recommends a further reduced dosage or alternative therapies in patients with low or absent TPMT activity treated with azathioprine and allopurinol concomitantly.

There's more of this label. Read more.

2. PMDA Label for azathioprine and TPMT

Actionable PGx


The PMDA package insert for azathioprine notes that individuals with certain TPMT genetic variations may be at increased risk of developing myelotoxicity. The insert also notes that this myelotoxicity could be exacerbated by co-administration of drugs that inhibit TPMT, such as aminosalicylic acid derivatives.

There's more of this label. Read more.

3. HCSC Label for azathioprine and TPMT

Actionable PGx


The product monograph for azathioprine notes that individuals with an inherited deficiency of the thiopurine methyltransferase (TPMT) enzyme may be at risk for developing myelosuppression when treated with the drug.

There's more of this label. Read more.

Clinical Variants that meet the highest level of criteria, manually curated by PharmGKB, are shown below.

To see more Clinical Variants with lower levels of criteria, click the button at the bottom of the page.

Disclaimer: The PharmGKB's clinical annotations reflect expert consensus based on clinical evidence and peer-reviewed literature available at the time they are written and are intended only to assist clinicians in decision-making and to identify questions for further research. New evidence may have emerged since the time an annotation was submitted to the PharmGKB. The annotations are limited in scope and are not applicable to interventions or diseases that are not specifically identified.

The annotations do not account for individual variations among patients, and cannot be considered inclusive of all proper methods of care or exclusive of other treatments. It remains the responsibility of the health-care provider to determine the best course of treatment for a patient. Adherence to any guideline is voluntary, with the ultimate determination regarding its application to be made solely by the clinician and the patient. PharmGKB assumes no responsibility for any injury or damage to persons or property arising out of or related to any use of the PharmGKB clinical annotations, or for any errors or omissions.

? = Mouse-over for quick help

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Links in the "Gene" column lead to PharmGKB Gene Pages.

List of all variant annotations for azathioprine

Gene ? Variant?
Alternate Names ? Chemicals ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
No VIP available No VIP available VA GSTM1 non-null N/A N/A N/A
No VIP available No VIP available VA GSTM1 null N/A N/A N/A
No VIP available CA VA HLA-DQA1 *02:01 N/A N/A N/A
No VIP available CA VA HLA-DRB1 *07:01:01:01 N/A N/A N/A
No VIP available No VIP available VA NUDT15 *1 N/A N/A N/A
No VIP available No VIP available VA NUDT15 *2 N/A N/A N/A
No VIP available No VIP available VA NUDT15 *3 N/A N/A N/A
No VIP available No VIP available VA NUDT15 *5 N/A N/A N/A
No VIP available No VIP available VA NUDT15 *6 N/A N/A N/A
No VIP available CA VA TPMT *1 N/A N/A N/A
No VIP available CA VA TPMT *1S N/A N/A N/A
No VIP available CA VA TPMT *2 N/A N/A N/A
No VIP available CA VA TPMT *3A N/A N/A N/A
No VIP available CA VA TPMT *3B N/A N/A N/A
No VIP available CA VA TPMT *3C N/A N/A N/A
No VIP available No VIP available VA TPMT *3D N/A N/A N/A
No VIP available No VIP available VA TPMT *3E N/A N/A N/A
No VIP available CA No VIP available TPMT *4 N/A N/A N/A
No VIP available CA VA TPMT *6 N/A N/A N/A
No VIP available CA No VIP available TPMT *7 N/A N/A N/A
No VIP available CA No VIP available TPMT *8 N/A N/A N/A
No VIP available CA No VIP available TPMT *9 N/A N/A N/A
No VIP available CA No VIP available TPMT *11 N/A N/A N/A
No VIP available CA No VIP available TPMT *12 N/A N/A N/A
No VIP available CA No VIP available TPMT *14 N/A N/A N/A
No VIP available CA No VIP available TPMT *16 N/A N/A N/A
No VIP available CA No VIP available TPMT *17 N/A N/A N/A
No VIP available CA No VIP available TPMT *18 N/A N/A N/A
No VIP available CA No VIP available TPMT *20 N/A N/A N/A
No VIP available CA No VIP available TPMT *21 N/A N/A N/A
No VIP available CA No VIP available TPMT *22 N/A N/A N/A
No VIP available CA No VIP available TPMT *23 N/A N/A N/A
No VIP available No Clinical Annotations available VA
C > T
No VIP available CA VA
rs1127354 NC_000020.10:g.3193842C>A, NC_000020.11:g.3213196C>A, NG_012093.1:g.8787C>A, NM_001267623.1:c.67-789C>A, NM_033453.3:c.94C>A, NM_181493.2:c.43C>A, NP_258412.1:p.Pro32Thr, NP_852470.1:p.Pro15Thr, NR_052000.1:n.194C>A, NR_052001.1:n.49-62C>A, NR_052002.1:n.286C>A, XM_006723564.2:c.94C>A, XM_006723565.2:c.67-789C>A, XM_011529234.1:c.94C>A, XM_011529235.1:c.94C>A, XP_006723627.1:p.Pro32Thr, XP_011527536.1:p.Pro32Thr, XP_011527537.1:p.Pro32Thr, rs111069069, rs11565932, rs117814751, rs16988347, rs3177087, rs3183216, rs41320251, rs52834049
C > A
rs1142345 NC_000006.11:g.18130918T>C, NC_000006.12:g.18130687T>C, NG_012137.2:g.29457A>G, NM_000367.3:c.719A>G, NP_000358.1:p.Tyr240Cys, XM_011514839.1:c.674A>G, XM_011514840.1:c.650A>G, XP_011513141.1:p.Tyr225Cys, XP_011513142.1:p.Tyr217Cys, rs16880254, rs1801205, rs29001646, rs52798150, rs61510596
T > C
No VIP available CA VA
rs116855232 NC_000013.10:g.48619855C>T, NC_000013.11:g.48045719C>T, NM_018283.2:c.415C>T, NP_060753.1:p.Arg139Cys
C > T
No VIP available No Clinical Annotations available VA
rs11706052 NC_000003.11:g.49064110A>G, NC_000003.12:g.49026677A>G, NG_012091.1:g.7766T>C, NM_000884.2:c.819+10T>C, XM_006713128.2:c.1029+10T>C
A > G
No VIP available No Clinical Annotations available VA
T > C
VIP No Clinical Annotations available No Variant Annotations available
rs1800460 NC_000006.11:g.18139228C>T, NC_000006.12:g.18138997C>T, NG_012137.2:g.21147G>A, NM_000367.3:c.460G>A, NP_000358.1:p.Ala154Thr, XM_011514839.1:c.460G>A, XM_011514840.1:c.391G>A, XP_011513141.1:p.Ala154Thr, XP_011513142.1:p.Ala131Thr, rs11568060, rs16880273, rs386545583, rs57650974
C > T
VIP No Clinical Annotations available No Variant Annotations available
rs1800462 NC_000006.11:g.18143955C>G, NC_000006.12:g.18143724C>G, NG_012137.2:g.16420G>C, NM_000367.3:c.238G>C, NP_000358.1:p.Ala80Pro, XM_011514839.1:c.238G>C, XM_011514840.1:c.169G>C, XP_011513141.1:p.Ala80Pro, XP_011513142.1:p.Ala57Pro
C > G
VIP No Clinical Annotations available No Variant Annotations available
rs1800584 NC_000006.11:g.18131012C>T, NC_000006.12:g.18130781C>T, NG_012137.2:g.29363G>A, NM_000367.3:c.626-1G>A, XM_011514839.1:c.581-1G>A, XM_011514840.1:c.557-1G>A, rs386545588
C > T
No VIP available No Clinical Annotations available VA
rs1801131 NC_000001.10:g.11854476T>G, NC_000001.11:g.11794419T>G, NG_013351.1:g.16685A>C, NM_005957.4:c.1286A>C, NP_005948.3:p.Glu429Ala, XM_005263458.1:c.1409A>C, XM_005263458.2:c.1409A>C, XM_005263459.1:c.1355A>C, XM_005263460.1:c.1286A>C, XM_005263460.3:c.1286A>C, XM_005263461.1:c.1286A>C, XM_005263461.3:c.1286A>C, XM_005263462.1:c.1286A>C, XM_005263462.3:c.1286A>C, XM_005263463.1:c.1040A>C, XM_005263463.2:c.1040A>C, XM_011541495.1:c.1406A>C, XM_011541496.1:c.1409A>C, XP_005263515.1:p.Glu470Ala, XP_005263516.1:p.Glu452Ala, XP_005263517.1:p.Glu429Ala, XP_005263518.1:p.Glu429Ala, XP_005263519.1:p.Glu429Ala, XP_005263520.1:p.Glu347Ala, XP_011539797.1:p.Glu469Ala, XP_011539798.1:p.Glu470Ala, rs17367365, rs17857426, rs4134712
T > G
No VIP available No Clinical Annotations available VA
rs1801133 NC_000001.10:g.11856378G>A, NC_000001.11:g.11796321G>A, NG_013351.1:g.14783C>T, NM_005957.4:c.665C>T, NP_005948.3:p.Ala222Val, XM_005263458.1:c.788C>T, XM_005263458.2:c.788C>T, XM_005263459.1:c.734C>T, XM_005263460.1:c.665C>T, XM_005263460.3:c.665C>T, XM_005263461.1:c.665C>T, XM_005263461.3:c.665C>T, XM_005263462.1:c.665C>T, XM_005263462.3:c.665C>T, XM_005263463.1:c.419C>T, XM_005263463.2:c.419C>T, XM_011541495.1:c.785C>T, XM_011541496.1:c.788C>T, XP_005263515.1:p.Ala263Val, XP_005263516.1:p.Ala245Val, XP_005263517.1:p.Ala222Val, XP_005263518.1:p.Ala222Val, XP_005263519.1:p.Ala222Val, XP_005263520.1:p.Ala140Val, XP_011539797.1:p.Ala262Val, XP_011539798.1:p.Ala263Val, rs386545618, rs4134713, rs59514310
G > A
No VIP available No Clinical Annotations available VA
rs2074087 NC_000016.10:g.16090375C=, NC_000016.10:g.16090375C>G, NC_000016.9:g.16184232C>G, NG_028268.1:g.145799C=, NG_028268.1:g.145799C>G, NM_004996.3:c.2461-30C>G, NM_004996.3:c.2461-30G>C, NT_187607.1:g.1748233G=, NT_187607.1:g.1748233G>C, XM_005255326.1:c.2461-30C>G, XM_005255327.1:c.2335-30C>G, XM_005255328.1:c.2323-30C>G, XM_005255329.1:c.2284-30C>G, XM_011522497.1:c.2437-30C>G, XM_011522497.1:c.2437-30G>C, XM_011522498.1:c.2368-30C>G, XM_011522498.1:c.2368-30G>C, rs57718684
C > G
No VIP available No Clinical Annotations available VA
rs2278294 NC_000007.13:g.128040699C>T, NC_000007.14:g.128400645C>T, NG_009194.1:g.14338G>A, NM_000883.3:c.580-106G>A, NM_001102605.1:c.550-106G>A, NM_001142573.1:c.325-106G>A, NM_001142574.1:c.310-106G>A, NM_001142575.1:c.250-106G>A, NM_001142576.1:c.481-106G>A, NM_001304521.1:c.373-106G>A, NM_183243.2:c.472-106G>A, XM_005250313.1:c.373-106G>A, XM_005250314.1:c.349-106G>A, XM_005250315.1:c.325-106G>A, XM_005250316.1:c.-61-106G>A, XM_006715967.1:c.580-106G>A, XM_006715968.1:c.550-106G>A, XM_006715969.1:c.472-106G>A, XM_006715970.2:c.373-106G>A, XM_006715971.1:c.349-106G>A, XM_011516156.1:c.-167G>A, XM_011516157.1:c.-167G>A, rs386563394, rs58322800
C > T
No VIP available CA VA
rs2647087 NC_000006.11:g.32681049A=, NC_000006.11:g.32681049A>C, NC_000006.12:g.32713272A=, NC_000006.12:g.32713272A>C, NT_113891.2:g.4126664A=, NT_113891.2:g.4126664A>C, NT_113891.3:g.4126558A=, NT_113891.3:g.4126558A>C, NT_167245.1:g.3962959C=, NT_167245.1:g.3962959C>A, NT_167245.2:g.3957374C=, NT_167245.2:g.3957374C>A, NT_167246.1:g.4138195C=, NT_167246.1:g.4138195C>A, NT_167246.2:g.4132575C=, NT_167246.2:g.4132575C>A, NT_167247.1:g.4017591A=, NT_167247.1:g.4017591A>C, NT_167247.2:g.4012006A=, NT_167247.2:g.4012006A>C, NT_167248.1:g.3913118A=, NT_167248.1:g.3913118A>C, NT_167248.2:g.3907522A=, NT_167248.2:g.3907522A>C, NT_167249.1:g.4112694A=, NT_167249.1:g.4112694A>C, NT_167249.2:g.4113396A=, NT_167249.2:g.4113396A>C, rs112058546, rs116333078, rs118168432, rs17219323, rs7745306
A > C
No VIP available No Clinical Annotations available VA
C > T
No VIP available CA VA
rs3765534 NC_000013.10:g.95815415C>T, NC_000013.11:g.95163161C>T, NM_001105515.2:c.2269G>A, NM_001301829.1:c.2128G>A, NM_001301830.1:c.2044G>A, NM_005845.4:c.2269G>A, NP_001098985.1:p.Glu757Lys, NP_001288758.1:p.Glu710Lys, NP_001288759.1:p.Glu682Lys, NP_005836.2:p.Glu757Lys, XM_005254025.1:c.2140G>A, XM_005254025.2:c.2140G>A, XM_005254026.1:c.2128G>A, XM_005254027.1:c.2044G>A, XM_005254028.1:c.2044G>A, XM_006719914.1:c.2179G>A, XM_011521047.1:c.1720G>A, XP_005254082.1:p.Glu714Lys, XP_005254083.1:p.Glu710Lys, XP_005254084.1:p.Glu682Lys, XP_005254085.1:p.Glu682Lys, XP_006719977.1:p.Glu727Lys, XP_011519349.1:p.Glu574Lys, rs17235040, rs52814620, rs57150501
C > T
No VIP available No Clinical Annotations available VA
rs4407290 NC_000002.11:g.31606670G>A, NC_000002.12:g.31383804G>A, NG_008871.1:g.35942C>T, NM_000379.3:c.837C>T, NP_000370.2:p.Val279=, XM_011533095.1:c.837C>T, XM_011533096.1:c.837C>T, XP_011531397.1:p.Val279=, XP_011531398.1:p.Val279=, rs17544440, rs57766493
G > A
No VIP available No Clinical Annotations available VA
rs45445694 NC_000018.10:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NC_000018.9:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NG_028255.1:g.5043_5070CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NM_001012716.2:c.*34+169_*34+196CGGGACGGAGGCAGGCCAAGTGGCGCGG[2][3][4][7][8][9], NM_001071.2:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258137.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258138.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], rs34743033 (retired)
No VIP available CA VA
rs55754655 NC_000002.11:g.201526330A>G, NC_000002.12:g.200661607A>G, NM_001159.3:c.3404A>G, NP_001150.3:p.Asn1135Ser, XM_005246506.1:c.2072A>G, XM_011511062.1:c.3404A>G, XP_005246563.1:p.Asn691Ser, XP_011509364.1:p.Asn1135Ser, XR_922913.1:n.3561A>G, rs60972007, rs61737010
A > G
No VIP available No Clinical Annotations available VA
rs594445 NC_000018.10:g.36251226C>A, NC_000018.9:g.33831189C>A, NM_017947.2:c.2107C>A, NP_060417.2:p.His703Asn, rs17790830, rs3737372, rs56434535, rs57829177
C > A
No VIP available No Clinical Annotations available VA
rs7270101 NC_000020.10:g.3193893A>C, NC_000020.11:g.3213247A>C, NG_012093.1:g.8838A>C, NM_001267623.1:c.67-738A>C, NM_033453.3:c.124+21A>C, NM_181493.2:c.73+21A>C, NR_052000.1:n.224+21A>C, NR_052001.1:n.49-11A>C, NR_052002.1:n.316+21A>C, XM_006723564.2:c.124+21A>C, XM_006723565.2:c.67-738A>C, XM_011529234.1:c.124+21A>C, XM_011529235.1:c.124+21A>C
A > C
No VIP available No Clinical Annotations available VA
rs747199 NC_000006.11:g.44194345G>C, NC_000006.12:g.44226608G>C, NG_042893.1:g.12104G>C, NM_001078174.1:c.-54-652G>C, NM_001078175.2:c.-52+441G>C, NM_001078176.2:c.-51-655G>C, NM_001078177.1:c.-55+441G>C, NM_001304462.1:c.187-655G>C, NM_001304463.1:c.76-655G>C, NM_001304465.1:c.25-652G>C, NM_001304466.1:c.25-655G>C, NM_004955.2:c.-51-655G>C, XM_005248875.1:c.187-655G>C, XM_005248876.1:c.76-652G>C, XM_005248876.3:c.76-652G>C, XM_005248877.1:c.76-655G>C, XM_005248878.1:c.-52+441G>C, XM_005248878.3:c.-52+441G>C, XM_005248879.1:c.-52+441G>C, XM_005248879.3:c.-52+441G>C, XM_005248880.1:c.-55+441G>C, XM_005248880.3:c.-55+441G>C, XM_005248881.1:c.-483G>C, XM_005248881.3:c.-483G>C, XM_005248882.1:c.-486G>C, XM_005248882.3:c.-486G>C, XM_011514341.1:c.187-652G>C, rs3799961
G > C
No VIP available CA VA
G > A
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 147


Generic Names
  • Azathioprin
  • Azathioprine Sodium
  • Azatioprin
  • Azothioprine
Trade Names
  • Azamun
  • Azanin
  • Azasan
  • Ccucol
  • Imuran
  • Imurek
  • Imurel
  • Muran
Brand Mixture Names

PharmGKB Accession Id






An immunosuppressive pro-drug. It is converted into 6-mercaptopurine in the body where it blocks purine metabolism and DNA synthesis.

Source: Drug Bank


For use in rheumatoid arthritis, preventing renal transplant rejection, Crohn's disease, and colitis.

Source: Drug Bank

Other Vocabularies

Information pulled from DrugBank has not been reviewed by PharmGKB.

Pharmacology, Interactions, and Contraindications

Mechanism of Action

Azathioprine antagonizes purine metabolism and may inhibit synthesis of DNA, RNA, and proteins. It may also interfere with cellular metabolism and inhibit mitosis. Its mechanism of action is likely due to incorporation of thiopurine analogues into the DNA structure, causing chain termination and cytotoxicity.

Source: Drug Bank


Azathioprine is a chemotherapy drug, now rarely used for chemotherapy but more for immunosuppression in organ transplantation and autoimmune disease such as rheumatoid arthritis or inflammatory bowel disease or Crohn's disease. It is a pro-drug, converted in the body to the active metabolite 6-mercaptopurine. Azathioprine acts to inhibit purine synthesis necessary for the proliferation of cells, especially leukocytes and lymphocytes. It is a safe and effective drug used alone in certain autoimmune diseases, or in combination with other immunosuppressants in organ transplantation. Its most severe side effect is bone marrow suppression, and it should not be given in conjunction with purine analogues such as allopurinol. The enzyme thiopurine S-methyltransferase (TPMT) deactivates 6-mercaptopurine. Genetic polymorphisms of TPMT can lead to excessive drug toxicity, thus assay of serum TPMT may be useful to prevent this complication.

Source: Drug Bank

Food Interaction

Take with food to reduce irritation.

Source: Drug Bank

Absorption, Distribution, Metabolism, Elimination & Toxicity


Primarily converted to the active metabolites 6-mercaptopurine and 6-thioinosinic acid via a non-enzymatica process. 6-mercaptopurine is subsequently metabolized primarily by xanthine oxidase.

Source: Drug Bank

Protein Binding

Azathioprine and the metabolite mercaptopurine are moderately bound to serum proteins (30%).

Source: Drug Bank


Well absorbed following oral administration.

Source: Drug Bank


Approximately 5 hours for the unchanged drug and its metabolites.

Source: Drug Bank


The oral LD ~50~ for single doses of azathioprine in mice and rats are 2500 mg/kg and 400 mg/kg, respectively. Very large doses of this antimetabolite may lead to marrow hypoplasia, bleeding, infection, and death.

Source: Drug Bank

Chemical Properties

Chemical Formula


Source: Drug Bank

Average Molecular Weight


Source: PharmGKB

Monoisotopic Molecular Weight


Source: Drug Bank



Source: Drug Bank

InChI String


Source: Drug Bank

PharmGKB Curated Pathways

Pathways created internally by PharmGKB based primarily on literature evidence.

  1. Thiopurine Pathway, Pharmacokinetics/Pharmacodynamics
    Diagrammatic representation of a non-tissue specific cancer cell displaying candidate genes involved in the metabolism and action of thiopurines.

Genes that are associated with this drug in PharmGKB's database based on (1) variant annotations, (2) literature review, (3) pathways or (4) information automatically retrieved from DrugBank, depending on the "evidence" and "source" listed below.

Curated Information ?

Drug Targets

Gene Description
ADSL (source: Drug Bank )
AMPD1 (source: Drug Bank )
AMPD2 (source: Drug Bank )
AMPD3 (source: Drug Bank )
GMPR (source: Drug Bank )
GMPR2 (source: Drug Bank )
GMPS (source: Drug Bank )
HPRT1 (source: Drug Bank )
IMPDH1 (source: Drug Bank )
IMPDH2 (source: Drug Bank )
PPAT (source: Drug Bank )

Curated Information ?

No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available

Drug Interactions

Interaction Description
allopurinol - azathioprine Allopurinol increases the effect of thiopurine (source: Drug Bank )
allopurinol - azathioprine Allopurinol increases the effect of thiopurine (source: Drug Bank )
aminosalicylic acid - azathioprine The 5-ASA derivative increases the toxicity of thiopurine (source: Drug Bank )
aminosalicylic acid - azathioprine The 5-ASA derivative increases the toxicity of thiopurine (source: Drug Bank )
mesalazine - azathioprine The 5-ASA derivative increases the toxicity of thiopurine (source: Drug Bank )
mesalazine - azathioprine The 5-ASA derivative increases the toxicity of thiopurine (source: Drug Bank )
trandolapril - azathioprine Trandolapril may increase the risk of neutropenia. Monitor for increased toxic effects of Azathioprine if Trandolapril is initiated or dose increased. (source: Drug Bank )
trastuzumab - azathioprine Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )

Curated Information ?

No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Arrhythmias, Cardiac
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Arthritis, Juvenile Rheumatoid
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Arthritis, Rheumatoid
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Atrial Fibrillation
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Attention Deficit Disorder with Hyperactivity
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Bipolar Disorder
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Breast Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Carcinoma, Hepatocellular
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Carcinoma, Non-Small-Cell Lung
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Carcinoma, Renal Cell
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cardiovascular Abnormalities
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cardiovascular Diseases
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
Colitis, Ulcerative
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Colonic Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Colorectal Neoplasms
No Dosing Guideline available DL No Clinical Annotation available VA No VIP available No VIP available
Crohn Disease
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Dermatitis, Atopic
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Drug Hypersensitivity
No Dosing Guideline available DL CA VA No VIP available No VIP available
Drug Toxicity
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Epilepsy, Absence
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Epilepsy, Generalized
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gastrointestinal Stromal Tumors
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Graft vs Host Disease
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Heart Failure
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
heart transplantation
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Hepatitis, Autoimmune
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HIV Infections
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Hypereosinophilic Syndrome
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Hyperlipoproteinemia Type II
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available DL CA VA No VIP available No VIP available
Inflammatory Bowel Diseases
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Irritable Bowel Syndrome
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Kidney Transplantation
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukemia, Lymphocytic, Chronic, B-Cell
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukemia, Myelogenous, Chronic, BCR-ABL Positive
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukemia, Myeloid
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Leukemia, Myeloid, Acute
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukemia, Nonlymphocytic, Acute
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukemia, Promyelocytic, Acute
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Liver Cirrhosis, Biliary
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Liver Diseases
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
liver transplantation
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Lupus Erythematosus, Systemic
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Migraine without Aura
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Muscular Diseases
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Myasthenia Gravis
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Myelodysplastic Syndromes
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Myocardial Infarction
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Myoclonic Epilepsy, Juvenile
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Neoplasm Metastasis
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Ocular Hypertension
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Precursor Cell Lymphoblastic Leukemia-Lymphoma
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pulmonary Disease, Chronic Obstructive
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pulmonary Fibrosis
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Rheumatic Diseases
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Sjogren's Syndrome
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Skin Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Sleep Disorders
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Toxic liver disease
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
transplant rejection
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Tuberculosis, Pulmonary
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Tumor Lysis Syndrome
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Urinary Incontinence

Relationships from National Drug File - Reference Terminology (NDF-RT)

May Treat
May Prevent
Contraindicated With

Publications related to azathioprine: 222

No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
NUDT15 polymorphisms are better than thiopurine S-methyltransferase as predictor of risk for thiopurine-induced leukopenia in Chinese patients with Crohn's disease. Alimentary pharmacology & therapeutics. 2016. Zhu X, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A coding variant in FTO confers susceptibility to thiopurine-induced leukopenia in East Asian patients with IBD. Gut. 2016. Kim Han Sang, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
NUDT15 and TPMT genetic polymorphisms are related to 6-mercaptopurine intolerance in children treated for acute lymphoblastic leukemia at the Children's Cancer Center of Lebanon. Pediatric blood & cancer. 2016. Zgheib Nathalie K, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Further evidence that a variant of the gene NUDT15 may be an important predictor of azathioprine-induced toxicity in Chinese subjects: a case report. Journal of clinical pharmacy and therapeutics. 2016. Ailing Z, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Nudt15 C415t Variant as a Predictor For Thiopurine Induced Toxicity in Indian Patients. Journal of gastroenterology and hepatology. 2016. Shah Swarup A V, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genotyping NUDT15 can predict the dose reduction of 6-MP for children with acute lymphoblastic leukemia especially at a preschool age. Journal of human genetics. 2016. Suzuki Hisato, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
NUDT15 variant and thiopurine-induced leukopenia in Hong Kong. Hong Kong medical journal = Xianggang yi xue za zhi / Hong Kong Academy of Medicine. 2016. Wong F Ck, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Prospective Evaluation of Pharmacogenomics and Metabolite Measurements upon Azathioprine Therapy in Inflammatory Bowel Disease: An Observational Study. Medicine. 2016. Fangbin Zhang, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
TPMT and ITPA genetic variants in Lithuanian inflammatory bowel disease patients: Prevalence and azathioprine-related side effects. Advances in medical sciences. 2016. Steponaitiene Ruta, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
NUDT15 polymorphisms alter thiopurine metabolism and hematopoietic toxicity. Nature genetics. 2016. Moriyama Takaya, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
NUDT15 variant is the most common variant associated with thiopurine-induced early leukopenia and alopecia in Korean pediatric patients with Crohn's disease. European journal of gastroenterology & hepatology. 2016. Lee Yeoun Joo, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
NUDT15 c.415C>T increases risk of 6-mercaptopurine induced myelosuppression during maintenance therapy in children with acute lymphoblastic leukemia. Haematologica. 2016. Chiengthong Kanhatai, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
NUDT15 R139C-related thiopurine leukocytopenia is mediated by 6-thioguanine nucleotide-independent mechanism in Japanese patients with inflammatory bowel disease. Journal of gastroenterology. 2016. Asada Ayumi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Impact of Genetic Polymorphisms on 6-Thioguanine Nucleotide Levels and Toxicity in Pediatric Patients with IBD Treated with Azathioprine. Inflammatory bowel diseases. 2015. Lee Mi-Na, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomically actionable medications in a safety net health care system. SAGE open medicine. 2016. Carpenter Janet S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Integrated Patient and Tumor Genetic Testing for Individualized Cancer Therapy. Clinical pharmacology and therapeutics. 2015. Hertz Daniel L, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Susceptibility to 6-MP toxicity conferred by a NUDT15 variant in Japanese children with acute lymphoblastic leukaemia. British journal of haematology. 2015. Tanaka Yoichi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Identification of Patients With Variants in TPMT and Dose Reduction Reduces Hematologic Events During Thiopurine Treatment of Inflammatory Bowel Disease. Gastroenterology. 2015. Coenen Marieke J H, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
NUDT15 gene polymorphism related to mercaptopurine intolerance in Taiwan Chinese children with acute lymphoblastic leukemia. The pharmacogenomics journal. 2015. Liang D-C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Personalized medicine in sarcoidosis: predict responders and nonresponders. Current opinion in pulmonary medicine. 2015. Petrek Martin. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Update on thiopurine pharmacogenetics in inflammatory bowel disease. Pharmacogenomics. 2015. Roberts Rebecca L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Inherited genetic variation in childhood acute lymphoblastic leukemia. Blood. 2015. Moriyama Takaya, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
NUDT15 R139C causes thiopurine-induced early severe hair loss and leukopenia in Japanese patients with IBD. The pharmacogenomics journal. 2015. Kakuta Y, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Inherited NUDT15 Variant Is a Genetic Determinant of Mercaptopurine Intolerance in Children With Acute Lymphoblastic Leukemia. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2015. Yang Jun J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Physiologically based pharmacokinetic model for 6-mercpatopurine: exploring the role of genetic polymorphism in TPMT enzyme activity. British journal of clinical pharmacology. 2015. Ogungbenro Kayode, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Myelotoxicity after high-dose methotrexate in childhood acute leukemia is influenced by 6-mercaptopurine dosing but not by intermediate thiopurine methyltransferase activity. Cancer chemotherapy and pharmacology. 2015. Levinsen Mette, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Crystal structure, biochemical and cellular activities demonstrate separate functions of MTH1 and MTH2. Nature communications. 2015. Carter Megan, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
A Prospective Study Evaluating Metabolic Capacity of Thiopurine and Associated Adverse Reactions in Japanese Patients with Inflammatory Bowel Disease (IBD). PloS one. 2015. Odahara Shunichi, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine dose intensity and treatment outcome in childhood lymphoblastic leukaemia: the influence of thiopurine methyltransferase pharmacogenetics. British journal of haematology. 2014. Lennard Lynne, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Surgeons and their tools: a history of surgical instruments and their innovators--part I: place the scissors on the Mayo stand. The American surgeon. 2014. El-Sedfy Abraham, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
HLA-DQA1-HLA-DRB1 variants confer susceptibility to pancreatitis induced by thiopurine immunosuppressants. Nature genetics. 2014. Heap Graham A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine monitoring in children with inflammatory bowel disease: a systematic review. British journal of clinical pharmacology. 2014. Konidari Anastasia, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A common missense variant in NUDT15 confers susceptibility to thiopurine-induced leukopenia. Nature genetics. 2014. Yang Suk-Kyun, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Implementation of TPMT testing. British journal of clinical pharmacology. 2014. Lennard Lynne. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Deletion of glutathione-s-transferase m1 reduces azathioprine metabolite concentrations in young patients with inflammatory bowel disease. Journal of clinical gastroenterology. 2014. Stocco Gabriele, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinically actionable genotypes among 10,000 patients with preemptive pharmacogenomic testing. Clinical pharmacology and therapeutics. 2013. Van Driest Sara L, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
TPMT genetic variants are associated with increased rejection with azathioprine use in heart transplantation. Pharmacogenetics and genomics. 2013. Liang Jackson J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine methyltransferase genotype-phenotype discordance and thiopurine active metabolite formation in childhood acute lymphoblastic leukaemia. British journal of clinical pharmacology. 2013. Lennard Lynne, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of disease-modifying antirheumatic drugs in rheumatoid arthritis: towards personalized medicine. Pharmacogenomics. 2013. Umićević Mirkov Maša, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Nomenclature for alleles of the thiopurine methyltransferase gene. Pharmacogenetics and genomics. 2013. Appell Malin L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinical Pharmacogenetics Implementation Consortium Guidelines for Thiopurine Methyltransferase Genotype and Thiopurine Dosing: 2013 Update. Clinical pharmacology and therapeutics. 2013. Relling M V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
A new thiopurine s-methyltransferase haplotype associated with intolerance to azathioprine. Journal of clinical pharmacology. 2013. Colleoni Lara, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Optimising outcome on thiopurines in inflammatory bowel disease by co-prescription of allopurinol. Journal of Crohn's & colitis. 2012. Smith Melissa A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A Clinician-Driven Automated System for Integration of Pharmacogenetic Interpretations Into an Electronic Medical Record. Clinical pharmacology and therapeutics. 2012. Hicks J K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Gene polymorphisms involved in manifestation of leucopenia, digestive intolerance, and pancreatitis in azathioprine-treated patients. Digestive diseases and sciences. 2012. Wroblova Katerina, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic variants of thiopurine and folate metabolic pathways determine 6-MP-mediated hematological toxicity in childhood ALL. Pharmacogenomics. 2012. Dorababu Patchva, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Polymorphism of genes involved in purine metabolism (XDH, AOX1, MOCOS) in kidney transplant recipients receiving azathioprine. Therapeutic drug monitoring. 2012. Kurzawski Mateusz, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pan-pathway based interaction profiling of FDA-approved nucleoside and nucleobase analogs with enzymes of the human nucleotide metabolism. PloS one. 2012. Egeblad Louise, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic analysis of pediatric patients with acute lymphoblastic leukemia: a possible association between survival rate and ITPA polymorphism. PloS one. 2012. Kim Hyery, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase (TPMT) polymorphisms in children with acute lymphoblastic leukemia, and the need for reduction or cessation of 6-mercaptopurine doses during maintenance therapy: the Polish multicenter analysis. Pediatric blood & cancer. 2011. Peregud-Pogorzelski Jarosław, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine methyl-transferase activity and azathioprine metabolite concentrations do not predict clinical outcome in thiopurine-treated inflammatory bowel disease patients. Alimentary pharmacology & therapeutics. 2011. González-Lama Y, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A pharmacogenetics study of TPMT and ITPA genes detects a relationship with side effects and clinical response in patients with inflammatory bowel disease receiving Azathioprine. Journal of gastrointestinal and liver diseases : JGLD. 2011. Zabala-Fernández William, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase polymorphism in Iranian kidney transplant recipients. Experimental and clinical transplantation : official journal of the Middle East Society for Organ Transplantation. 2011. Aghdaie Mahdokht Hossein, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Azathioprine-related myelosuppression in a patient homozygous for TPMT*3A. Nature reviews. Nephrology. 2011. Budhiraja Pooja, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Prospective-retrospective biomarker analysis for regulatory consideration: white paper from the industry pharmacogenomics working group. Pharmacogenomics. 2011. Patterson Scott D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Nodular regenerative liver hyperplasia as a complication of azathioprine-containing immunosuppressive treatment for Crohn's disease. Immunopharmacology and immunotoxicology. 2011. Błogowski Wojciech, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Novel thiopurine methyltransferase variant TPMT*28 results in a misdiagnosis of TPMT deficiency. Inflammatory bowel diseases. 2011. Landy J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
A pragmatic randomized controlled trial of thiopurine methyltransferase genotyping prior to azathioprine treatment: the TARGET study. Pharmacogenomics. 2011. Newman William G, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Determinants of mercaptopurine toxicity in paediatric acute lymphoblastic leukemia maintenance therapy. British journal of clinical pharmacology. 2011. Adam de Beaumais Tiphaine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinical pharmacogenetics implementation consortium guidelines for thiopurine methyltransferase genotype and thiopurine dosing. Clinical pharmacology and therapeutics. 2011. Relling M V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics: From Bench to Byte- An Update of Guidelines. Clinical pharmacology and therapeutics. 2011. Swen J J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Practical recommendations for pharmacogenomics-based prescription: 2010 ESF-UB Conference on Pharmacogenetics and Pharmacogenomics. Pharmacogenomics. 2011. Becquemont Laurent, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine methyltransferase predicts the extent of cytotoxicty and DNA damage in astroglial cells after thioguanine exposure. PloS one. 2011. Hosni-Ahmed Amira, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Identifying genomic and developmental causes of adverse drug reactions in children. Pharmacogenomics. 2010. Becker Mara L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Systematic review of pharmacoeconomic studies of pharmacogenomic tests. Pharmacogenomics. 2010. Beaulieu Mathieu, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The multidrug-resistance protein 4 polymorphism is a new factor accounting for thiopurine sensitivity in Japanese patients with inflammatory bowel disease. Journal of gastroenterology. 2010. Ban Hiromistu, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine pathway. Pharmacogenetics and genomics. 2010. Zaza Gianluigi, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase gene polymorphism and 6-mercaptopurine dose intensity in Indian children with acute lymphoblastic leukemia. Leukemia research. 2010. Kapoor Gauri, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Influence of 5-aminosalicylic acid on 6-thioguanosine phosphate metabolite levels: a prospective study in patients under steady thiopurine therapy. British journal of pharmacology. 2010. de Graaf P, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase polymorphisms and thiopurine toxicity in treatment of inflammatory bowel disease. World journal of gastroenterology : WJG. 2010. Dong Xian-Wen, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Azathioprine versus mesalazine for prevention of postoperative clinical recurrence in patients with Crohn's disease with endoscopic recurrence: efficacy and safety results of a randomised, double-blind, double-dummy, multicentre trial. Gut. 2010. Reinisch Walter, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Very important pharmacogene summary: thiopurine S-methyltransferase. Pharmacogenetics and genomics. 2010. Wang Liewei, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Drug transporter pharmacogenetics in nucleoside-based therapies. Pharmacogenomics. 2010. Errasti-Murugarren Ekaitz, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase pharmacogenetics: functional characterization of a novel rapidly degraded variant allozyme. Biochemical pharmacology. 2010. Feng Qiping, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Determination of 6-thioguanosine diphosphate and triphosphate and nucleoside diphosphate kinase activity in erythrocytes: novel targets for thiopurine therapy?. Therapeutic drug monitoring. 2010. Karner Susanne, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Low-dose azathioprine or mercaptopurine in combination with allopurinol can bypass many adverse drug reactions in patients with inflammatory bowel disease. Alimentary pharmacology & therapeutics. 2010. Ansari A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Human lymphoblastoid cell line panels: novel tools for assessing shared drug pathways. Pharmacogenomics. 2010. Morag Ayelet, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics in the treatment of inflammatory bowel disease. Pharmacogenomics. 2010. Smith Melissa A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase genotype and the use of thiopurines in paediatric inflammatory bowel disease Greek patients. Journal of clinical pharmacy and therapeutics. 2010. Gazouli M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Are patients with intermediate TPMT activity at increased risk of myelosuppression when taking thiopurine medications?. Pharmacogenomics. 2010. Higgs Jenny E, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Influences of thiopurine methyltransferase genotype and activity on thiopurine-induced leukopenia in Korean patients with inflammatory bowel disease: a retrospective cohort study. Journal of clinical gastroenterology. 2010. Kim Jae Hak, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase pharmacogenetics in a large-scale healthy Italian-Caucasian population: differences in enzyme activity. Pharmacogenomics. 2009. Serpe Loredana, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Warfarin interactions with substances listed in drug information compendia and in the FDA-approved label for warfarin sodium. Clinical pharmacology and therapeutics. 2009. Anthony M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Novel pharmacogenetic markers for treatment outcome in azathioprine-treated inflammatory bowel disease. Alimentary pharmacology & therapeutics. 2009. Smith M A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine methyltransferase genetics is not a major risk factor for secondary malignant neoplasms after treatment of childhood acute lymphoblastic leukemia on Berlin-Frankfurt-Münster protocols. Blood. 2009. Stanulla Martin, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Improving pharmacovigilance in Europe: TPMT genotyping and phenotyping in the UK and Spain. European journal of human genetics : EJHG. 2009. Gurwitz David, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Impact of the heterozygous TPMT*1/*3C genotype on azathioprine-induced myelosuppression in kidney transplant recipients in Thailand. Clinical therapeutics. 2009. Vannaprasaht Suda, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Adverse reactions to azathioprine cannot be predicted by thiopurine S-methyltransferase genotype in Japanese patients with inflammatory bowel disease. Journal of gastroenterology and hepatology. 2009. Takatsu Noritaka, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pro32Thr polymorphism of inosine triphosphate pyrophosphatase gene predicts efficacy of low-dose azathioprine for patients with systemic lupus erythematosus. Clinical pharmacology and therapeutics. 2009. Okada Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ADME pharmacogenetics: current practices and future outlook. Expert opinion on drug metabolism & toxicology. 2009. Grossman Iris. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Heterozygosity at the TPMT gene locus, augmented by mutated MTHFR gene, predisposes to 6-MP related toxicities in childhood ALL patients. Leukemia. 2009. Karas-Kuzelicki N, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Application of SNaPshot for analysis of thiopurine methyltransferase gene polymorphism. The Indian journal of medical research. 2009. Kapoor Gauri, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Relationships between thiopurine S-methyltransferase polymorphism and azathioprine-related adverse drug reactions in Chinese renal transplant recipients. European journal of clinical pharmacology. 2009. Xin Hua-Wen, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine methyltransferase activity is related to the risk of relapse of childhood acute lymphoblastic leukemia: results from the NOPHO ALL-92 study. Leukemia : official journal of the Leukemia Society of America, Leukemia Research Fund, U.K. 2009. Schmiegelow K, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
TPMT genetic variations in populations of the Russian Federation. Pediatric blood & cancer. 2009. Samochatova Elena V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Use of pharmacogenetics, enzymatic phenotyping, and metabolite monitoring to guide treatment with azathioprine in patients with systemic lupus erythematosus. The Journal of rheumatology. 2009. Askanase Anca D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Thiopurine methyltransferase gene polymorphisms in Chinese patients with inflammatory bowel disease. Digestion. 2009. Cao Qian, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Initial clinical experience with allopurinol-thiopurine combination therapy in pediatric inflammatory bowel disease. Inflammatory bowel diseases. 2008. Rahhal Riad M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Importance of thiopurine S-Methyltransferase gene polymorphisms for prediction of azathioprine toxicity. Neuro endocrinology letters. 2009. Kolorz Michal, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase (TPMT) gene polymorphism in Brazilian children with acute lymphoblastic leukemia: association with clinical and laboratory data. Therapeutic drug monitoring. 2008. Silva Marcilene Rezende, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Prospective evaluation of the pharmacogenetics of azathioprine in the treatment of inflammatory bowel disease. Alimentary pharmacology & therapeutics. 2008. Ansari A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacogenomic studies of the anticancer and immunosuppressive thiopurines mercaptopurine and azathioprine. British journal of clinical pharmacology. 2008. Hawwa Ahmed F, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Functional characterization of 23 allelic variants of thiopurine S-methyltransferase gene (TPMT*2 - *24). Pharmacogenetics and genomics. 2008. Ujiie Shuta, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Long-term outcome of using allopurinol co-therapy as a strategy for overcoming thiopurine hepatotoxicity in treating inflammatory bowel disease. Alimentary pharmacology & therapeutics. 2008. Ansari A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Characterisation of novel defective thiopurine S-methyltransferase allelic variants. Biochemical pharmacology. 2008. Garat A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Transporter-mediated protection against thiopurine-induced hematopoietic toxicity. Cancer research. 2008. Krishnamurthy Partha, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine dose in intermediate and normal metabolizers of thiopurine methyltransferase may differ three-fold. Clinical gastroenterology and hepatology : the official clinical practice journal of the American Gastroenterological Association. 2008. Gardiner Sharon J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Trinucleotide repeat variants in the promoter of the thiopurine S-methyltransferase gene of patients exhibiting ultra-high enzyme activity. Pharmacogenetics and genomics. 2008. Roberts Rebecca L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Azathioprine-associated acute myeloid leukemia in a patient with Crohn's disease and thiopurine S-methyltransferase deficiency. American journal of hematology. 2008. Yenson Paul R, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine-methyltransferase and inosine triphosphate pyrophosphatase polymorphism in a liver transplant recipient developing nodular regenerative hyperplasia on low-dose azathioprine. European journal of gastroenterology & hepatology. 2008. Buster Erik H C J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase (TPMT) pharmacogenetics: three new mutations and haplotype analysis in the Estonian population. Clinical chemistry and laboratory medicine : CCLM / FESCC. 2008. Tamm Riin, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Analysis of thiopurine S-methyltransferase genotypes in Japanese patients with inflammatory bowel disease. Internal medicine (Tokyo, Japan). 2008. Ban Hiromitsu, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase gene (TMPT) polymorphisms in a Mexican population of healthy individuals and leukemic patients. Medical oncology (Northwood, London, England). 2008. Taja-Chayeb Lucia, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The low frequency of defective TPMT alleles in Turkish population: a study on pediatric patients with acute lymphoblastic leukemia. American journal of hematology. 2007. Tumer Tugba Boyunegmez, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Explaining TPMT genotype/phenotype discrepancy by haplotyping of TPMT*3A and identification of a novel sequence variant, TPMT*23. Pharmacogenetics and genomics. 2007. Lindqvist Malin, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
IMPDH1 promoter mutations in a patient exhibiting azathioprine resistance. The pharmacogenomics journal. 2007. Roberts R L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic significance of inosine triphosphatase. Pharmacogenomics. 2007. Bierau Jörgen, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Assessment of thiopurine methyltransferase enzyme activity is superior to genotype in predicting myelosuppression following azathioprine therapy in patients with inflammatory bowel disease. Alimentary pharmacology & therapeutics. 2007. Winter J W, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
MDR1 polymorphisms and response to azathioprine therapy in patients with Crohn's disease. Inflammatory bowel diseases. 2007. Mendoza Juan L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Current use of pharmacogenetic testing: a national survey of thiopurine methyltransferase testing prior to azathioprine prescription. Journal of clinical pharmacy and therapeutics. 2007. Fargher E A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Efficient screening method of the thiopurine methyltransferase polymorphisms for patients considering taking thiopurine drugs in a Chinese Han population in Henan Province (central China). Clinica chimica acta; international journal of clinical chemistry. 2007. Zhang Li-Rong, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase gene polymorphism in Japanese patients with autoimmune liver diseases. Liver international : official journal of the International Association for the Study of the Liver. 2007. Tamori Akihiro, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Monitoring of thiopurine methyltransferase activity in postsurgical patients with Crohn's disease during 1 year of treatment with azathioprine or mesalazine. Therapeutic drug monitoring. 2007. Dilger Karin, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
TPMT genotype and its clinical implication in renal transplant recipients with azathioprine treatment. Journal of clinical pharmacy and therapeutics. 2006. Song D-K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Overview of the pharmacoeconomics of pharmacogenetics. Pharmacogenomics. 2006. Dervieux Thierry, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Analysis of thiopurine S-methyltransferase polymorphism in the population of Serbia and Montenegro and mercaptopurine therapy tolerance in childhood acute lymphoblastic leukemia. Therapeutic drug monitoring. 2006. Dokmanovic Lidija, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The thiopurine methyltransferase genetic polymorphism is associated with thioguanine-related veno-occlusive disease of the liver in children with acute lymphoblastic leukemia. Clinical pharmacology and therapeutics. 2006. Lennard Lynne, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetics during standardised initiation of thiopurine treatment in inflammatory bowel disease. Gut. 2006. Hindorf U, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Three novel thiopurine S-methyltransferase allelic variants (TPMT*20, *21, *22) - association with decreased enzyme function. Human mutation. 2006. Schaeffeler Elke, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Divergent activities of human glutathione transferases in the bioactivation of azathioprine. Molecular pharmacology. 2006. Eklund Birgitta I, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Adverse events leading to modification of therapy in a large cohort of patients with inflammatory bowel disease. Alimentary pharmacology & therapeutics. 2006. Hindorf U, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The frequency and significance of thiopurine S-methyltransferase gene polymorphisms in azathioprine-treated renal transplant recipients. The British journal of dermatology. 2006. Moloney F J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetics of thiopurine therapy in paediatric IBD patients. Alimentary pharmacology & therapeutics. 2006. De Ridder L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Azathioprine dosed by thiopurine methyltransferase activity for moderate-to-severe atopic eczema: a double-blind, randomised controlled trial. Lancet. 2006. Meggitt Simon J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase pharmacogenetics: insights, challenges and future directions. Oncogene. 2006. Wang L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Predictors of immunomodulator use as early therapy in pediatric Crohn's disease. Journal of clinical gastroenterology. 2006. Jacobstein Douglas A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Inosine triphosphate pyrophosphatase and thiopurine s-methyltransferase genotypes relationship to azathioprine-induced myelosuppression. Clinical gastroenterology and hepatology : the official clinical practice journal of the American Gastroenterological Association. 2006. Zelinkova Zuzana, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Azathioprine suppresses ezrin-radixin-moesin-dependent T cell-APC conjugation through inhibition of Vav guanosine exchange activity on Rac proteins. Journal of immunology (Baltimore, Md. : 1950). 2006. Poppe Daniela, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics and individualized drug therapy. Annual review of medicine. 2006. Eichelbaum Michel, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
TPMT genotype and the use of thiopurines in paediatric inflammatory bowel disease. Digestive and liver disease : official journal of the Italian Society of Gastroenterology and the Italian Association for the Study of the Liver. 2005. Stocco G, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase phenotype-genotype correlation in hemodialyzed patients. Pharmacological reports : PR. 2006. Chrzanowska Maria, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase pharmacogenetics: genotype to phenotype correlation in the Slovenian population. Pharmacology. 2006. Milek M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine methyltransferase genotype and phenotype status in Japanese patients with systemic lupus erythematosus. Biological & pharmaceutical bulletin. 2005. Okada Yuko, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase pharmacogenetics: variant allele functional and comparative genomics. Pharmacogenetics and genomics. 2005. Salavaggione Oreste E, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine methyltransferase and 6-thioguanine nucleotide measurement: early experience of use in clinical practice. Internal medicine journal. 2005. Gearry R B, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A cost-effectiveness analysis of alternative disease management strategies in patients with Crohn's disease treated with azathioprine or 6-mercaptopurine. The American journal of gastroenterology. 2005. Dubinsky Marla C, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The impact of thiopurine s-methyltransferase polymorphism on azathioprine-induced myelotoxicity in renal transplant recipients. Therapeutic drug monitoring. 2005. Kurzawski Mateusz, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic association with adverse drug reactions to azathioprine immunosuppressive therapy following liver transplantation. Liver transplantation : official publication of the American Association for the Study of Liver Diseases and the International Liver Transplantation Society. 2005. Breen David P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Azathioprine induced nodular regenerative hyperplasia in IBD patients. Gastroentérologie clinique et biologique. 2005. Daniel Fady, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine methyltransferase (TPMT) heterozygosity and enzyme activity as predictive tests for the development of azathioprine-related adverse events. Journal of the neurological sciences. 2005. Heckmann Jeannine M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine methyltransferase (TPMT) genotype and early treatment response to mercaptopurine in childhood acute lymphoblastic leukemia. JAMA : the journal of the American Medical Association. 2005. Stanulla Martin, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Identification and functional analysis of two rare allelic variants of the thiopurine S-methyltransferase gene, TPMT*16 and TPMT*19. Biochemical pharmacology. 2005. Hamdan-Khalil Rima, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase polymorphisms and the relationship between the mutant alleles and the adverse effects in systemic lupus erythematosus patients taking azathioprine. Clinical and experimental rheumatology. 2005. Jun J B, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Guidelines for prescribing azathioprine in dermatology. The British journal of dermatology. 2004. Anstey A V, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Assessment of thiopurine methyltransferase and metabolite formation during thiopurine therapy: results from a large Swedish patient population. Therapeutic drug monitoring. 2004. Hindorf Ulf, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase genotype predicts azathioprine-induced myelotoxicity in kidney transplant recipients. American journal of transplantation : official journal of the American Society of Transplantation and the American Society of Transplant Surgeons. 2004. Formea Christine M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Lack of association between the ITPA 94C>A polymorphism and adverse effects from azathioprine. Pharmacogenetics. 2004. Gearry Richard B, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Monitoring of long-term thiopurine therapy among adults with inflammatory bowel disease. Scandinavian journal of gastroenterology. 2004. Hindorf U, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Allele frequency of inosine triphosphate pyrophosphatase gene polymorphisms in a Japanese population. Nucleosides, nucleotides & nucleic acids. 2004. Marinaki A M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The impact of thiopurine S-methyltransferase polymorphisms on azathioprine dose 1 year after renal transplantation. Transplant international : official journal of the European Society for Organ Transplantation. 2004. Fabre Margarete A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Comprehensive analysis of thiopurine S-methyltransferase phenotype-genotype correlation in a large population of German-Caucasians and identification of novel TPMT variants. Pharmacogenetics. 2004. Schaeffeler Elke, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Phenotype and genotype for thiopurine methyltransferase activity in the French Caucasian population: impact of age. European journal of clinical pharmacology. 2004. Ganiere-Monteil Catherine, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Identification of two novel sequence variants affecting thiopurine methyltransferase enzyme activity. Pharmacogenetics. 2004. Lindqvist Malin, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of thiopurine S-methyltransferase and thiopurine therapy. Therapeutic drug monitoring. 2004. Evans William E. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Adverse drug reactions to azathioprine therapy are associated with polymorphism in the gene encoding inosine triphosphate pyrophosphatase (ITPase). Pharmacogenetics. 2004. Marinaki Anthony M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pyrosequencing of TPMT alleles in a general Swedish population and in patients with inflammatory bowel disease. Clinical chemistry. 2004. Haglund Sofie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Relevance of thiopurine methyltransferase status in rheumatology patients receiving azathioprine. Rheumatology (Oxford, England). 2004. Clunie G P R, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Distribution of ITPA P32T alleles in multiple world populations. Journal of human genetics. 2004. Marsh Sharon, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Mistaken identity: misclassification of TPMT phenotype following blood transfusion. European journal of gastroenterology & hepatology. 2003. Cheung Seau-Tak, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
In vitro characterization of four novel non-functional variants of the thiopurine S-methyltransferase. Biochemical and biophysical research communications. 2003. Hamdan-Khalil Rima, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Drug methylation in cancer therapy: lessons from the TPMT polymorphism. Oncogene. 2003. Krynetski Eugene, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Phenotypic and genotypic analysis of thiopurine s-methyltransferase polymorphism in the bulgarian population. Therapeutic drug monitoring. 2003. Indjova Dessislava, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphism of thiopurine S-methyltransferase in Argentina. Annals of clinical biochemistry. 2003. Laróvere L E, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A novel TPMT missense mutation associated with TPMT deficiency in a 5-year-old boy with ALL. Leukemia : official journal of the Leukemia Society of America, Leukemia Research Fund, U.K. 2003. Schaeffeler E, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine methyltransferase phenotypes and genotypes in Brazilians. Pharmacogenetics. 2003. Reis Marcelo, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CD28-dependent Rac1 activation is the molecular target of azathioprine in primary human CD4+ T lymphocytes. The Journal of clinical investigation. 2003. Tiede Imke, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine methyltransferase genotype distribution in patients with Crohn's disease. Alimentary pharmacology & therapeutics. 2003. Reuther L O, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Safe treatment of thiopurine S-methyltransferase deficient Crohn's disease patients with azathioprine. Gut. 2003. Kaskas B A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Is thiopurine methyltransferase genetic polymorphism a major factor for withdrawal of azathioprine in rheumatoid arthritis patients?. Rheumatology (Oxford, England). 2003. Corominas H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Practical pharmacogenetics: the cost effectiveness of screening for thiopurine s-methyltransferase polymorphisms in patients with rheumatological conditions treated with azathioprine. The Journal of rheumatology. 2002. Marra Carlo A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine methyltransferase activity and the use of azathioprine in inflammatory bowel disease. Alimentary pharmacology & therapeutics. 2002. Ansari A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Determination of thiopurine methyltransferase genotype or phenotype optimizes initial dosing of azathioprine for the treatment of Crohn's disease. Journal of clinical gastroenterology. 2002. Regueiro Miguel, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Azathioprine therapy and adverse drug reactions in patients with inflammatory bowel disease: impact of thiopurine S-methyltransferase polymorphism. Pharmacogenetics. 2002. Schwab Matthias, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Interaction between azathioprine and aminosalicylates: an in vivo study in patients with Crohn's disease. Alimentary pharmacology & therapeutics. 2002. Dewit O, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The thiopurine S-methyltransferase gene locus -- implications for clinical pharmacogenomics. Pharmacogenomics. 2002. McLeod Howard L, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine methyltransferase polymorphisms in a multiracial asian population and children with acute lymphoblastic leukemia. Journal of pediatric hematology/oncology. 2002. Kham S K Y, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Influence of the variable number of tandem repeats located in the promoter region of the thiopurine methyltransferase gene on enzymatic activity. Clinical pharmacology and therapeutics. 2001. Alves S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Rational dosing of azathioprine and 6-mercaptopurine. Gut. 2001. Sandborn W J. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genotype-phenotype correlation for thiopurine S-methyltransferase in healthy Italian subjects. European journal of clinical pharmacology. 2001. Rossi A M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Preponderance of thiopurine S-methyltransferase deficiency and heterozygosity among patients intolerant to mercaptopurine or azathioprine. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2001. Evans W E, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms of thiopurine S-methyltransferase and 6-mercaptopurine toxicity in Japanese children with acute lymphoblastic leukaemia. Pharmacogenetics. 2001. Ando M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Veno-occlusive disease, nodular regenerative hyperplasia and hepatocellular carcinoma after azathioprine treatment in a patient with ulcerative colitis. European journal of gastroenterology & hepatology. 2001. Russmann S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genotypic analysis of thiopurine S-methyltransferase in patients with Crohn's disease and severe myelosuppression during azathioprine therapy. Gastroenterology. 2000. Colombel J F, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenomics and metabolite measurement for 6-mercaptopurine therapy in inflammatory bowel disease. Gastroenterology. 2000. Dubinsky M C, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase gene polymorphism is predictive of azathioprine-induced myelosuppression in heart transplant recipients. Transplantation. 2000. Sebbag L, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Severe 6-thioguanine-induced marrow aplasia in a child with acute lymphoblastic leukemia and inherited thiopurine methyltransferase deficiency. Journal of pediatric hematology/oncology. 2000. McBride K L, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Mercaptopurine therapy intolerance and heterozygosity at the thiopurine S-methyltransferase gene locus. Journal of the National Cancer Institute. 1999. Relling M V, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Enhanced proteasomal degradation of mutant human thiopurine S-methyltransferase (TPMT) in mammalian cells: mechanism for TPMT protein deficiency inherited by TPMT*2, TPMT*3A, TPMT*3B or TPMT*3C. Pharmacogenetics. 1999. Tai H L, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Analysis of thiopurine methyltransferase variant alleles in childhood acute lymphoblastic leukaemia. British journal of haematology. 1999. McLeod H L, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine methyltransferase pharmacogenetics: alternative molecular diagnosis and preliminary data from Northern Portugal. Pharmacogenetics. 1999. Alves S, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Polymorphism of the thiopurine S-methyltransferase gene in African-Americans. Human molecular genetics. 1999. Hon Y Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The frequency and distribution of thiopurine methyltransferase alleles in Caucasian and Asian populations. Pharmacogenetics. 1999. Collie-Duguid E S, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine methyltransferase genotype predicts therapy-limiting severe toxicity from azathioprine. Annals of internal medicine. 1998. Black A J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinical implications of thiopurine methyltransferase--optimization of drug dosage and potential drug interactions. Therapeutic drug monitoring. 1998. Lennard L. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Isolation of a human thiopurine S-methyltransferase (TPMT) complementary DNA with a single nucleotide transition A719G (TPMT*3C) and its association with loss of TPMT protein and catalytic activity in humans. Clinical pharmacology and therapeutics. 1998. Loennechen T, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Human thiopurine methyltransferase pharmacogenetics. Kindred with a terminal exon splice junction mutation that results in loss of activity. The Journal of clinical investigation. 1998. Otterness D M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacokinetics, dose adjustments, and 6-mercaptopurine/methotrexate drug interactions in two patients with thiopurine methyltransferase deficiency. Acta paediatrica (Oslo, Norway : 1992). 1998. Andersen J B, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Detection of known and new mutations in the thiopurine S-methyltransferase gene by single-strand conformation polymorphism analysis. Human mutation. 1998. Spire-Vayron de la Moureyre C, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Human thiopurine methyltransferase pharmacogenetics: gene sequence polymorphisms. Clinical pharmacology and therapeutics. 1997. Otterness D, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Enhanced proteolysis of thiopurine S-methyltransferase (TPMT) encoded by mutant alleles in humans (TPMT*3A, TPMT*2): mechanisms for the genetic polymorphism of TPMT activity. Proceedings of the National Academy of Sciences of the United States of America. 1997. Tai H L, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Molecular diagnosis of thiopurine S-methyltransferase deficiency: genetic basis for azathioprine and mercaptopurine intolerance. Annals of internal medicine. 1997. Yates C R, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Individualizing therapy with 6-mercaptopurine and 6-thioguanine related to the thiopurine methyltransferase genetic polymorphism. Therapeutic drug monitoring. 1996. Lennard L, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase deficiency: two nucleotide transitions define the most prevalent mutant allele associated with loss of catalytic activity in Caucasians. American journal of human genetics. 1996. Tai H L, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A single point mutation leading to loss of catalytic activity in human thiopurine S-methyltransferase. Proceedings of the National Academy of Sciences of the United States of America. 1995. Krynetski E Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Azathioprine-related bone marrow toxicity and low activities of purine enzymes in patients with rheumatoid arthritis. Arthritis and rheumatism. 1995. Kerstens P J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Congenital thiopurine methyltransferase deficiency and 6-mercaptopurine toxicity during treatment for acute lymphoblastic leukaemia. Archives of disease in childhood. 1993. Lennard L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Azathioprine-induced myelosuppression in thiopurine methyltransferase deficient heart transplant recipient. Lancet. 1993. McLeod H L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Azathioprine-induced myelosuppression in thiopurine methyltransferase deficient heart transplant recipient. Lancet. 1993. Schütz E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
The clinical pharmacology of 6-mercaptopurine. European journal of clinical pharmacology. 1992. Lennard L. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Altered mercaptopurine metabolism, toxic effects, and dosage requirement in a thiopurine methyltransferase-deficient child with acute lymphocytic leukemia. The Journal of pediatrics. 1991. Evans W E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of acute azathioprine toxicity: relationship to thiopurine methyltransferase genetic polymorphism. Clinical pharmacology and therapeutics. 1989. Lennard L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine pharmacogenetics in leukemia: correlation of erythrocyte thiopurine methyltransferase activity and 6-thioguanine nucleotide concentrations. Clinical pharmacology and therapeutics. 1987. Lennard L, et al. PubMed


Web Resource:
National Drug Code Directory:
KEGG Drug:
PubChem Compound:
PubChem Substance:
Drugs Product Database (DPD):
Therapeutic Targets Database:
FDA Drug Label at DailyMed:

Clinical Trials

These are trials that mention azathioprine and are related to either pharmacogenetics or pharmacogenomics.

No trials loaded.

NURSA Datasets

provided by

No NURSA datasets available.

Common Searches

Search PubMed
Search Medline Plus
Search PubChem
Search CTD

Sources for PharmGKB drug information: DrugBank, PubChem.