Chemical: Drug
platinum

PharmGKB contains no dosing guidelines for this . To report known genotype-based dosing guidelines, or if you are interested in developing guidelines, click here.

PharmGKB has no annotated drug labels with pharmacogenomic information for this . If you know of a drug label with PGx, send us a message.

PharmGKB contains no Clinical Variants that meet the highest level of criteria.

To see more Clinical Variants with lower levels of criteria, click the button at the bottom of the page.

Disclaimer: The PharmGKB's clinical annotations reflect expert consensus based on clinical evidence and peer-reviewed literature available at the time they are written and are intended only to assist clinicians in decision-making and to identify questions for further research. New evidence may have emerged since the time an annotation was submitted to the PharmGKB. The annotations are limited in scope and are not applicable to interventions or diseases that are not specifically identified.

The annotations do not account for individual variations among patients, and cannot be considered inclusive of all proper methods of care or exclusive of other treatments. It remains the responsibility of the health-care provider to determine the best course of treatment for a patient. Adherence to any guideline is voluntary, with the ultimate determination regarding its application to be made solely by the clinician and the patient. PharmGKB assumes no responsibility for any injury or damage to persons or property arising out of or related to any use of the PharmGKB clinical annotations, or for any errors or omissions.

? = Mouse-over for quick help

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Links in the "Gene" column lead to PharmGKB Gene Pages.

List of all variant annotations for platinum

Gene ? Variant?
(147)
Alternate Names ? Chemicals ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
Translation
No VIP available No Clinical Annotations available VA
rs1051685 NC_000002.11:g.217070376A>G, NC_000002.12:g.216205653A>G, NG_029780.1:g.101357A>G, NM_021141.3:c.*451A>G, XM_005246836.1:c.*451A>G, rs3192081, rs59137106
A > G
SNP
No VIP available No Clinical Annotations available VA
rs1057451 NC_000016.10:g.29822167G>T, NC_000016.9:g.29833488G>T, NM_005115.4:c.-36+1657G>T, NM_017458.3:c.-77+1657G>T, NM_024516.3:c.*2413G>T, XM_005255730.1:c.-77+1657G>T, rs3169550, rs386514440, rs59001958, rs74249938
G > T
SNP
No VIP available No Clinical Annotations available VA
rs10875989 NC_000012.11:g.50351075T>C, NC_000012.12:g.49957292T>C, NG_008913.1:g.11552T>C, NG_033883.1:g.797T>C, NM_000486.5:c.*1684T>C, NR_110590.1:n.257-2944A>G, NR_110591.1:n.118-5204A>G, rs59141834
T > C
SNP
No VIP available CA VA
rs11615 NC_000019.10:g.45420395A>G, NC_000019.9:g.45923653A>G, NG_015839.2:g.63434T>C, NM_001166049.1:c.354T>C, NM_001983.3:c.354T>C, NM_202001.2:c.354T>C, NP_001159521.1:p.Asn118=, NP_001974.1:p.Asn118=, NP_973730.1:p.Asn118=, XM_005258634.1:c.354T>C, XM_005258635.1:c.354T>C, XM_005258635.2:c.354T>C, XM_005258636.1:c.354T>C, XM_005258636.3:c.354T>C, XM_005258637.1:c.354T>C, XM_005258638.1:c.138T>C, XM_011526610.1:c.354T>C, XP_005258691.1:p.Asn118=, XP_005258692.1:p.Asn118=, XP_005258693.1:p.Asn118=, XP_005258694.1:p.Asn118=, XP_005258695.1:p.Asn46=, XP_011524912.1:p.Asn118=, rs1130005, rs17285882, rs17359303, rs17845191, rs17858003, rs17859564, rs2228629, rs3177700, rs3188446, rs3752251, rs59923575
A > G
SNP
N118N
No VIP available CA No Variant Annotations available
rs13181 NC_000019.10:g.45351661T>G, NC_000019.9:g.45854919T>G, NG_007067.2:g.23927A>C, NM_000400.3:c.2251A>C, NM_177417.2:c.*304T>G, NP_000391.1:p.Lys751Gln, XM_005258536.1:c.*128T>G, XM_005258536.3:c.*128T>G, XM_005258537.1:c.*128T>G, XM_005258538.1:c.*304T>G, XM_005258539.1:c.*304T>G, XM_005258639.1:c.2179A>C, XM_005258640.1:c.2017A>C, XM_005258641.1:c.1513A>C, XM_011526611.1:c.2173A>C, XP_005258696.1:p.Lys727Gln, XP_005258697.1:p.Lys673Gln, XP_005258698.1:p.Lys505Gln, XP_011524913.1:p.Lys725Gln, rs1052559, rs17285142, rs17355147, rs17359310, rs3170171, rs3859422, rs60606175
T > G
SNP
K751Q
No VIP available No Clinical Annotations available VA
rs1516400 NC_000015.10:g.58137065G>A, NC_000015.9:g.58429264G>A, NG_011975.1:g.3857G>A, NM_020980.3:c.-1501G>A, XM_005254347.1:c.-1301G>A, rs58441942
G > A
SNP
No VIP available No Clinical Annotations available VA
rs1554203 NC_000015.10:g.58137348A>G, NC_000015.9:g.58429547A>G, NG_011975.1:g.4140A>G, NM_020980.3:c.-1218A>G, XM_005254347.1:c.-1018A>G, rs3809533, rs386537472, rs61074455
A > G
SNP
No VIP available No Clinical Annotations available VA
rs1560661 NC_000005.10:g.150413894C>T, NC_000005.9:g.149793457C>T, NG_029730.1:g.4043G>A, NM_001025158.2:c.-1145G>A, NM_001025159.2:c.-1145G>A, NM_004355.3:c.-1145G>A, XM_005268545.1:c.-914G>A, XM_005268546.1:c.-914G>A, rs56832097
C > T
SNP
No VIP available No Clinical Annotations available VA
rs1695 NC_000011.10:g.67585218A>G, NC_000011.9:g.67352689A>G, NG_012075.1:g.6624A>G, NM_000852.3:c.313A>G, NP_000843.1:p.Ile105Val, XM_005273958.1:c.313A>G, XP_005274015.1:p.Ile105Val, rs1138257, rs11553891, rs17353321, rs17856342, rs2230827, rs4609, rs56971933, rs947894
A > G
SNP
I105V
No VIP available No Clinical Annotations available VA
rs172731 NC_000019.10:g.11336275T>C, NC_000019.9:g.11446951T>C, NM_004283.3:c.229-492A>G, rs1268847, rs172749, rs477329, rs809544
T > C
SNP
No VIP available CA VA
rs17655 NC_000013.10:g.103528002G>C, NC_000013.11:g.102875652G>C, NG_007146.1:g.34829G>C, NM_000123.3:c.3310G>C, NM_001204425.1:c.4672G>C, NP_000114.2:p.Asp1104His, NP_001191354.1:p.Asp1558His, rs16960665, rs3188002, rs3825521, rs52825398
G > C
SNP
D1104H
No VIP available No Clinical Annotations available VA
rs182455 NC_000001.10:g.26234983A>G, NC_000001.11:g.25908492A>G, NM_001145454.2:c.-2166T>C, NM_005563.3:c.-2166T>C, NM_203399.1:c.-1767T>C, XR_947102.1:n.1554A>G, rs35049280, rs56876055, rs58153054
A > G
SNP
No VIP available No Clinical Annotations available VA
rs1867380 NC_000015.10:g.58184082A>G, NC_000015.9:g.58476281A>G, NG_011975.1:g.50874A>G, NM_020980.3:c.835A>G, NP_066190.2:p.Thr279Ala, XM_005254347.1:c.640A>G, XP_005254404.1:p.Thr214Ala, rs17848107, rs17855515, rs52835083, rs58016439
A > G
SNP
T279A
No VIP available No Clinical Annotations available VA
rs1869641 NC_000006.11:g.99277867C>T, NC_000006.12:g.98829991C>T, rs386547226, rs60385622
C > T
SNP
No VIP available No Clinical Annotations available VA
rs1883306 NC_000006.11:g.99279449A>C, NC_000006.12:g.98831573A>C, rs386547868, rs60441657
A > C
SNP
No VIP available No Clinical Annotations available VA
rs195854 NC_000006.11:g.99289475T>A, NC_000006.12:g.98841599T>A, rs58954307
T > A
SNP
No VIP available No Clinical Annotations available VA
rs195862 NC_000006.11:g.99281809C>A, NC_000006.12:g.98833933C>A, NM_005604.3:c.-941C>A
C > A
SNP
No VIP available No Clinical Annotations available VA
rs2032582 NC_000007.13:g.87160618A>C, NC_000007.13:g.87160618A>T, NC_000007.14:g.87531302A>C, NC_000007.14:g.87531302A>T, NG_011513.1:g.186947T>A, NG_011513.1:g.186947T>G, NM_000927.4:c.2677T>A, NM_000927.4:c.2677T>G, NP_000918.2:p.Ser893Ala, NP_000918.2:p.Ser893Thr, rs10228331, rs2229106, rs386553610, rs57135550, rs9641018
A > C
SNP
S893A
No VIP available No Clinical Annotations available VA
rs2077737 NC_000015.10:g.58186751T>C, NC_000015.9:g.58478950T>C, NG_011975.1:g.53543T>C, rs386556660, rs57816743
T > C
SNP
No VIP available No Clinical Annotations available VA
rs2444933 NC_000006.11:g.99278428T>C, NC_000006.12:g.98830552T>C
T > C
SNP
No VIP available CA VA
rs25487 NC_000019.10:g.43551574T>C, NC_000019.9:g.44055726T>C, NG_033799.1:g.29005A>G, NM_006297.2:c.1196A>G, NP_006288.2:p.Gln399Arg, rs11553658, rs17435395, rs3817410, rs386493716, rs57378728
T > C
SNP
Q399R
No VIP available No Clinical Annotations available VA
rs2748249 NC_000005.10:g.150413037C>A, NC_000005.9:g.149792600C>A, NG_029730.1:g.4900G>T, NM_001025158.2:c.-288G>T, NM_001025159.2:c.-288G>T, NM_004355.3:c.-288G>T, XM_005268545.1:c.-57G>T, XM_005268546.1:c.-57G>T, rs386573235
C > A
SNP
No VIP available No Clinical Annotations available VA
rs296766 NC_000012.11:g.50350953T>C, NC_000012.12:g.49957170T>C, NG_008913.1:g.11430T>C, NG_033883.1:g.675T>C, NM_000486.5:c.*1562T>C, NR_110590.1:n.257-2822A>G, NR_110591.1:n.118-5082A>G, rs59390283
T > C
SNP
No VIP available CA VA
rs3212986 NC_000019.10:g.45409478C>A, NC_000019.9:g.45912736C>A, NG_015839.2:g.74351G>T, NM_001166049.1:c.*197G>T, NM_001297590.1:c.1516C>A, NM_001983.3:c.*197G>T, NM_012099.1:c.1510C>A, NP_001284519.1:p.Gln506Lys, NP_036231.1:p.Gln504Lys, XM_005258425.1:c.1516C>A, XM_005258638.1:c.*197G>T, XP_005258482.1:p.Gln506Lys, rs386580934, rs60333438
C > A
C > T
SNP
Q506K
No VIP available No Clinical Annotations available VA
rs3738514 NC_000001.10:g.43426591C>T, NC_000001.11:g.42960920C>T, NG_008232.1:g.3257G>A, NM_006516.2:c.-2269G>A, NR_033967.1:n.529+1343C>T, rs58038963, rs60110630
C > T
SNP
No VIP available No Clinical Annotations available VA
rs3759125 NC_000012.11:g.50343608A>C, NC_000012.12:g.49949825A>C, NG_008913.1:g.4085A>C, NM_000486.5:c.-1006A>C, rs386585625, rs57211551, rs59771778
A > C
SNP
No VIP available No Clinical Annotations available VA
rs3759126 NC_000012.11:g.50343862A>G, NC_000012.12:g.49950079A>G, NG_008913.1:g.4339A>G, NM_000486.5:c.-752A>G, rs17551101, rs386585626
A > G
SNP
No VIP available No Clinical Annotations available VA
rs3823036 NC_000006.11:g.99284532T>C, NC_000006.12:g.98836656T>C, NM_005604.3:c.*451T>C, rs57778231
T > C
SNP
No VIP available No Clinical Annotations available VA
rs45445694 NC_000018.10:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NC_000018.9:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NG_028255.1:g.5043_5070CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NM_001012716.2:c.*34+169_*34+196CGGGACGGAGGCAGGCCAAGTGGCGCGG[2][3][4][7][8][9], NM_001071.2:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258137.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258138.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9]
CCGCGC(CACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2
CCGCGC(CACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)4
CCGCGC(CACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)7
CCGCGC(CACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)8
CCGCGC(CACTTGGCCTGCCTCCGTCCCG)3 > (CCGCGCCACTTGGCCTGCCTCCGTCCCG)9
microsatellite
No VIP available No Clinical Annotations available VA
rs461872 NC_000012.11:g.50345206G>A, NC_000012.12:g.49951423G>A, NG_008913.1:g.5683G>A, NM_000486.5:c.360+233G>A, NR_110591.1:n.534C>T, rs3782321, rs56469367, rs59534325
G > A
SNP
No VIP available No Clinical Annotations available VA
rs4658 NC_000001.10:g.43392250C>G, NC_000001.11:g.42926579C>G, NG_008232.1:g.37598G>C, NM_006516.2:c.*462G>C, XM_005271135.1:c.*125G>C, rs16830055, rs3198989, rs3768028, rs56807926
C > G
SNP
No VIP available No Clinical Annotations available VA
rs4788184 NC_000016.10:g.29819105T>C, NC_000016.9:g.29830426T>C, NM_005115.4:c.-1441T>C, NM_017458.3:c.-1482T>C, NM_024516.3:c.566-450T>C, XM_005255730.1:c.-1482T>C, rs57220831
T > C
SNP
No VIP available No Clinical Annotations available VA
rs4788186 NC_000016.10:g.29829904A>G, NC_000016.9:g.29841225A>G, NM_001293204.1:c.-646A>G, NM_001293205.1:c.-646A>G, NM_005115.4:c.-35-611A>G, NM_017458.3:c.-76-570A>G, XM_005255730.1:c.-76-570A>G, rs386595434, rs60884933
A > G
SNP
No VIP available No Clinical Annotations available VA
rs6941 NC_000002.11:g.217070652C>A, NC_000002.12:g.216205929C>A, NG_029780.1:g.101633C>A, NM_021141.3:c.*727C>A, XM_005246836.1:c.*727C>A, rs3192168, rs58334615
C > A
SNP
No VIP available No Clinical Annotations available VA
rs7204252 NC_000016.10:g.29852848C>T, NC_000016.9:g.29864169C>T, rs57823063
C > T
SNP
No VIP available No Clinical Annotations available VA
rs7251786 NC_000019.10:g.11354453C>T, NC_000019.9:g.11465129C>T, NM_001080503.2:c.773-127C>T, NM_001170635.1:c.-1309C>T, NM_022737.2:c.-1309C>T, XM_005259732.1:c.1010-127C>T, XM_005259733.1:c.1010-127C>T, XM_005259734.1:c.773-127C>T, XM_005259735.1:c.770-127C>T, XM_005259736.1:c.770-127C>T, XM_005259737.1:c.704-127C>T, XM_005260017.1:c.-1309C>T, XM_005260018.1:c.-1350C>T, XM_005260019.1:c.-1350C>T, XM_006722643.1:c.881-127C>T, XR_936156.1:n.1082-127C>T, rs17775684, rs52803261, rs58952587
C > T
SNP
No VIP available No Clinical Annotations available VA
rs7305534 NC_000012.11:g.50341610T>C, NC_000012.12:g.49947827T>C, NG_008913.1:g.2087T>C, rs57602581
T > C
SNP
No VIP available No Clinical Annotations available VA
rs7314734 NC_000012.11:g.50340041C>T, NC_000012.12:g.49946258C>T, NG_008913.1:g.518C>T, XR_944942.1:n.3037C>T, XR_944943.1:n.2831C>T, XR_944944.1:n.2873C>T, XR_944945.1:n.2288C>T, XR_944946.1:n.2912C>T, XR_944947.1:n.2861C>T, XR_944948.1:n.2555C>T, XR_944949.1:n.2222C>T, XR_944950.1:n.1555C>T, XR_944951.1:n.3037C>T, XR_944952.1:n.3037C>T
C > T
SNP
No VIP available No Clinical Annotations available VA
rs8023369 NC_000015.10:g.58189995T>G, NC_000015.9:g.58482194T>G, rs52802624, rs60715544
T > G
SNP
No VIP available No Clinical Annotations available VA
rs896412 NC_000019.10:g.11333455C>G, NC_000019.9:g.11444131C>G, NM_004283.3:c.472+1992G>C, rs17446930
C > G
SNP
No VIP available No Clinical Annotations available VA
rs9920375 NC_000015.10:g.58190874T>C, NC_000015.9:g.58483073T>C, rs17240664, rs61659407
T > C
SNP
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 147

Overview

Generic Names
Trade Names
Brand Mixture Names

PharmGKB Accession Id

PA150595617

Type(s):

Drug

Other Vocabularies

Information pulled from DrugBank has not been reviewed by PharmGKB.

Chemical Properties

Isomeric SMILES

[Pt]

Source: Drug Bank

Genes that are associated with this drug in PharmGKB's database based on (1) variant annotations, (2) literature review, (3) pathways or (4) information automatically retrieved from DrugBank, depending on the "evidence" and "source" listed below.

Curated Information ?

No related drugs are available.

Curated Information ?

Publications related to platinum: 36

No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic predictors of toxicity to platinum based chemotherapy in non-small cell lung cancer patients. Pharmacological research. 2016. Pérez-Ramírez Cristina, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Improvement of a predictive model in ovarian cancer patients submitted to platinum-based chemotherapy: implications of a GST activity profile. European journal of clinical pharmacology. 2016. Pereira Deolinda, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Molecular determinants of chemotherapy resistance in ovarian cancer. Pharmacogenomics. 2015. Cooley Megan, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Predictive value of STMN1 gene promoter polymorphism (-2166T>C) in patients with advanced NSCLC treated with the combination of platinum compounds and vinorelbine. Cancer chemotherapy and pharmacology. 2015. Mlak Radosław, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Effect of transporter and DNA repair gene polymorphisms to lung cancer chemotherapy toxicity. Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine. 2015. Chen Juan, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Germline TYMS genotype is highly predictive in patients with metastatic gastrointestinal malignancies receiving capecitabine-based chemotherapy. Cancer chemotherapy and pharmacology. 2015. Joerger M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of the DNA repair pathways in advanced non-small cell lung cancer patients treated with platinum-based chemotherapy. Cancer letters. 2014. Sullivan Ivana, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Novel association between CD74 polymorphisms and hematologic toxicity in patients with NSCLC after platinum-based chemotherapy. Clinical lung cancer. 2014. Tan Xiaoming, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of DNA repair gene polymorphisms in non-small-cell lung carcinoma patients on platinum-based chemotherapy. Genetics and molecular research : GMR. 2014. Zhang L, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
ERCC1 Cys8092Ala and XRCC1 Arg399Gln polymorphisms predict progression-free survival after curative radiotherapy for nasopharyngeal carcinoma. PloS one. 2014. Jin Hekun, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The association of transporter genes polymorphisms and lung cancer chemotherapy response. PloS one. 2014. Wang Ying, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DNA repair and cytotoxic drugs: the potential role of RAD51 in clinical outcome of non-small-cell lung cancer patients. Pharmacogenomics. 2013. Nogueira Augusto, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association between polymorphisms of ERCC1 and survival in epithelial ovarian cancer patients with chemotherapy. Pharmacogenomics. 2012. Yan Li, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genomic approach towards personalized anticancer drug therapy. Pharmacogenomics. 2012. Midorikawa Yutaka, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenomics of cisplatin-based chemotherapy in ovarian cancer patients of different ethnic origins. Pharmacogenomics. 2012. Khrunin Andrey, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association between DNA-repair polymorphisms and survival in pancreatic cancer patients treated with combination chemotherapy. Pharmacogenomics. 2011. Giovannetti Elisa, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Meta-analysis on pharmacogenetics of platinum-based chemotherapy in non small cell lung cancer (NSCLC) patients. PloS one. 2012. Yin Ji-Ye, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
DNA-damage response gene polymorphisms and therapeutic outcomes in ovarian cancer. The pharmacogenomics journal. 2011. Caiola E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Prospective molecular marker analyses of EGFR and KRAS from a randomized, placebo-controlled study of erlotinib maintenance therapy in advanced non-small-cell lung cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2011. Brugger Wolfram, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic analyses of cisplatin-induced nephrotoxicity indicate a renoprotective effect of ERCC1 polymorphisms. Pharmacogenomics. 2011. Tzvetkov Mladen V, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Nucleotide excision repair gene variants and association with survival in osteosarcoma patients treated with neoadjuvant chemotherapy. The pharmacogenomics journal. 2011. Biason P, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Use of a comprehensive panel of biomarkers to predict response to a fluorouracil-oxaliplatin regimen in patients with metastatic colorectal cancer. Pharmacogenomics. 2011. Lamas Maria J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
THYMIDYLATE SYNTHASE AND EXCISION REPAIR-CROSS-COMPLEMENTING GROUP-1 AS PREDICTORS OF RESPONSIVENESS IN MESOTHELIOMA PATIENTS TREATED WITH PEMETREXED-CARBOPLATIN. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Zucali Paolo Andrea, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Multiple genetic polymorphisms in the prediction of clinical outcome of metastatic colorectal cancer patients treated with first-line FOLFOX-4 chemotherapy. Pharmacogenetics and genomics. 2011. Huang Ming-Yii, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gemcitabine and platinum pathway pharmacogenetics in Asian breast cancer patients. Cancer genomics & proteomics. 2011. Wong Andrea Li-Ann, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms and the efficacy and toxicity of cisplatin-based chemotherapy in ovarian cancer patients. The pharmacogenomics journal. 2010. Khrunin A V, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Methylenetetrahydrofolate reductase (MTHFR) gene polymorphisms and FOLFOX response in colorectal cancer patients. British journal of clinical pharmacology. 2010. Etienne-Grimaldi Marie-Christine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics of taxane/platinum therapy in ovarian cancer. International journal of gynecological cancer : official journal of the International Gynecological Cancer Society. 2009. Marsh Sharon. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Common variations in ERCC2 are associated with response to cisplatin chemotherapy and clinical outcome in osteosarcoma patients. The pharmacogenomics journal. 2009. Caronia D, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Cisplatin pharmacogenetics, DNA repair polymorphisms, and esophageal cancer outcomes. Pharmacogenetics and genomics. 2009. Bradbury Penelope A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genetic polymorphisms affecting clinical outcomes in epithelial ovarian cancer patients treated with taxanes and platinum compounds: a Korean population-based study. Gynecologic oncology. 2009. Kim Hee Seung, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
DNA repair gene polymorphisms predict favorable clinical outcome in advanced non-small-cell lung cancer. Clinical lung cancer. 2009. Kalikaki Aristea, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms of copper- and platinum drug-efflux transporters ATP7A and ATP7B in Japanese cancer patients. Drug metabolism and pharmacokinetics. 2009. Fukushima-Uesaka Hiromi, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Correlation of CDA, ERCC1, and XPD polymorphisms with response and survival in gemcitabine/cisplatin-treated advanced non-small cell lung cancer patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2008. Tibaldi Carmelo, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
XRCC1 R399Q polymorphism is associated with response to platinum-based neoadjuvant chemotherapy in bulky cervical cancer. Gynecologic oncology. 2006. Chung Hyun Hoon, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A multivariate analysis of genomic polymorphisms: prediction of clinical outcome to 5-FU/oxaliplatin combination chemotherapy in refractory colorectal cancer. British journal of cancer. 2004. Stoehlmacher J, et al. PubMed

Clinical Trials

These are trials that mention platinum and are related to either pharmacogenetics or pharmacogenomics.

No trials loaded.

NURSA Datasets

provided by nursa.org

No NURSA datasets available.

Common Searches

Search PubMed
Search Medline Plus
Search PubChem
Search CTD

Sources for PharmGKB drug information: DrugBank, PubChem.