Chemical: Drug

Available Guidelines

  1. CPIC Guideline for fluorouracil and DPYD
  2. DPWG Guideline for fluorouracil and DPYD

last updated 07/30/2014

1. CPIC Guideline for fluorouracil and DPYD


The CPIC Dosing Guidelines for fluoropyrimidines (i.e. 5-fluorouracil, capecitabine or tegafur) recommends an alternative drug for patients who are homozygous for DPYD non-functional variants - *2A (rs3918290), *13 (rs55886062), and rs67376798 A (on the positive chromosomal strand) - as these patients are typically DPD deficient. Consider a 50% reduction in starting dose for heterozygous patients (intermediate activity).


May 2014 Update on PharmGKB

December 2013 Publication

Accepted article preview online August 2013; Advance online publication October 2013.

  • Guidelines regarding the use of pharmacogenomic tests in dosing for fluoropyrimidines have been published in Clinical Pharmacology and Therapeutics by the Clinical Pharmacogenetics Implementation Consortium (CPIC).
  • These guidelines are applicable to:
    • at the time of this writing, there are no data available on the possible role of DPYD*2A, *13, or rs67376798 in 5-fluorouracil toxicities in pediatric patient populations; however, there is no reason to suspect that DPYD variant alleles would affect 5-fluorouracil metabolism differently in children compared to adults.
  • Excerpt from the fluoropyrimidine dosing guideline based on DPYD genotype:
    • "The strength of the dosing recommendations is based on the fact that some variants (DPYD*2A, *13, and rs67376798) clearly affect DPD activity, and DPD activity is clearly related to 5-fluorouracil clearance, and 5-fluorouracil exposure is associated with its toxic effects. Therefore, reduction of fluoropyrimidine dosage in patients with these variants may prevent severe and possibly life-threatening toxicities. However, available evidence does not clearly indicate a degree of dose reduction needed to prevent fluoropyrimidine related toxicities...[Based on literature review (see full manuscript),] our recommendation is to start with at least a 50% reduction of the starting dose followed by an increase in dose in patients experiencing no or clinically tolerable toxicity to maintain efficacy, a decrease in dose in patients who do not tolerate the starting dose to minimize toxicities or pharmacokinetic guided dose adjustments (if available). Patients who are homozygous for DPYD*2A, *13, or rs67376798 may demonstrate complete DPD deficiency and the use of 5-fluorouracil or capecitabine is not recommended in these patients."
  • Download and read:

Table 1: Recommended dosing of fluoropyrimidines by genotype/phenotype.

Adapted from Tables 1 and 2 of the 2013 guideline manuscript.

Phenotype (genotype)Examples of diplotypesImplications for phenotypic measuresDosing recommendationsClassification of recommendationsa
Homozygous wild-type or normal, high DPD activity (two or more functional *1 alleles)*1/*1Normal DPD activity and "normal" risk for fluoropyrimidine toxicityUse label-recommended dosage and administrationModerate
Heterozygous or intermediate activity (~3-5% of patients), may have partial DPD deficiency, at risk for toxicity with drug exposure (one functional allele *1, plus one nonfunctional allele - *2A, *13 or rs67376798Ac)*1/*2A; *1/*13; *1/ rs67376798Ac)Decreased DPD activity (leukocyte DPD activity at 30% to 70% that of the normal population) and increased risk for severe or even fatal drug toxicity when treated with fluoropyrimidine drugsStart with at least a 50% reduction in starting dose followed by titration of dose based on toxicity b or pharmacokinetic test (if available)Moderate
Homozygous variant, DPD deficiency (~0.2% of patients), at risk for toxicity with drug exposure (2 nonfunctional alleles - *2A, *13 or rs67376798A c)*2A/*2A; *13/*13; rs67376798Ac / rs67376798AcComplete DPD deficiency and increased risk for severe or even fatal drug toxicity when treated with fluoropyrimidine drugsSelect alternate drugStrong

a Rating scheme described in 2013 supplement.

b Increase the dose in patients experiencing no or clinically tolerable toxicity to maintain efficacy; decrease the dose in patients who do not tolerate the starting dose to minimize toxicities.

c Note that the rs67376798A allele refers to the allele on the positive chromosomal strand. This is important because DPYD is on the minus chromosomal strand and rs67376798 is a T/A snp. Therefore, the T allele on the gene confers the deficiency, while the complement on the positive chromosomal strand (A allele) is indicative of deficiency.

last updated 02/07/2014

2. DPWG Guideline for fluorouracil and DPYD


An alternative drug rather than fluorouracil is recommended for DPYD poor metabolizer patients, and a reduced dose (by 50%) of fluorouracil or use of an alternative drug is recommended for intermediate metabolizer patients.


The Royal Dutch Pharmacists Association - Pharmacogenetics Working Group has evaluated therapeutic dose recommendations for fluorouracil based on DPYD genotype [Article:21412232]. They recommend that an alternate drug be used for poor metabolizer patients, and a reduced dose or alternate drug for intermediate metabolizer patients.

Phenotype (Genotype)Therapeutic Dose RecommendationLevel of EvidenceClinical Relevance
PM (2 inactive alleles, 2 decreased activity alleles, or one inactive and one decreased activity alleles)Select alterantive drug. Tegafur is not a suitable alternative because this drug is also metabolized by DPD.Published controlled studies of moderate quality* relating to phenotyped and/or genotyped patients or healthy volunteers, and having relevant pharmacokinetic or clinical endpoints.Clinical effect (S): death; arrhythmia; unanticipated myelosuppression.
IM (1 active allele and 1 inactive or decreased activity allele)Reduce dose by 50% or select alternative drug. Tegafur is not a suitable alternative because this drug is also a substrate for DPD. Increase dose in response to toxicity and efficacy.Published controlled studies of moderate quality* relating to phenotyped and/or genotyped patients or healthy volunteers, and having relevant pharmacokinetic or clinical endpoints.Clinical effect (S): death; arrhythmia; unanticipated myelosuppression.
Allele TypeAlleles
active*1, *4, *5, *6, *9A
decreased activity*9B, *10
inactive*2A, *3, *7, *8, *11, *12, *13, 496A>G, IVS10-15T>C, 1156G>T, 1845G>T
  • *See Methods or PMID: 18253145 for definition of "moderate" quality.
  • S: statistically significant difference.

PharmGKB annotates drug labels containing pharmacogenetic information approved by the US Food and Drug Administration (FDA), European Medicines Agency (EMA), the Pharmaceuticals and Medical Devices Agency, Japan (PMDA), and Health Canada (Santé Canada) (HCSC). PharmGKB annotations provide a brief summary of the PGx in the label, an excerpt from the label and a downloadable highlighted label PDF file. A list of genes and phenotypes found within the label is mapped to label section headers and listed at the end of each annotation. PharmGKB also attempts to interpret the level of action implied in each label with the "PGx Level" tag.

See the legend for more information about drug label sources and PGx Levels.

We welcome any information regarding drug labels containing PGx information approved by the FDA, EMA, PMDA, HCSC or other Medicine Agencies around the world - please contact feedback.

Annotated Labels

  1. FDA Label for fluorouracil and DPYD
  2. PMDA Label for fluorouracil and DPYD
  3. HCSC Label for fluorouracil and DPYD

last updated 10/25/2013

1. FDA Label for fluorouracil and DPYD

Actionable PGx


Fluorouracil is available in both a topical cream and as an injection. These two formulations have different indications. Both FDA-approved labels contain information about the potential for severe toxicity in patients with dipyrimidine dehydrogenase (DPD) deficiency. However, neither label mentions testing for genetic variants or activity of DPD.

There's more of this label. Read more.

last updated 01/26/2015

2. PMDA Label for fluorouracil and DPYD

Actionable PGx


The PMDA package insert for fluorouracil states that severe adverse events have occurred in patients receiving the drug who are dihydropyrimidine dehydrogenase (DPD)-deficient. DPD is the enzyme responsible for the degradation of fluorouracil and other fluoropyrimidines.

There's more of this label. Read more.

last updated 06/08/2015

3. HCSC Label for fluorouracil and DPYD

Actionable PGx


The product monograph for fluorouracil states that it should be used with care in patients who have a dihydropyrimidine dehydrogenase (DYPD) deficiency, due to the risk for experiencing toxicity.

There's more of this label. Read more.

Clinical Variants that meet the highest level of criteria, manually curated by PharmGKB, are shown below.

To see more Clinical Variants with lower levels of criteria, click the button at the bottom of the page.

Disclaimer: The PharmGKB's clinical annotations reflect expert consensus based on clinical evidence and peer-reviewed literature available at the time they are written and are intended only to assist clinicians in decision-making and to identify questions for further research. New evidence may have emerged since the time an annotation was submitted to the PharmGKB. The annotations are limited in scope and are not applicable to interventions or diseases that are not specifically identified.

The annotations do not account for individual variations among patients, and cannot be considered inclusive of all proper methods of care or exclusive of other treatments. It remains the responsibility of the health-care provider to determine the best course of treatment for a patient. Adherence to any guideline is voluntary, with the ultimate determination regarding its application to be made solely by the clinician and the patient. PharmGKB assumes no responsibility for any injury or damage to persons or property arising out of or related to any use of the PharmGKB clinical annotations, or for any errors or omissions.

? = Mouse-over for quick help

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Links in the "Gene" column lead to PharmGKB Gene Pages.

List of all variant annotations for fluorouracil

Gene ? Variant?
Alternate Names ? Chemicals ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
VIP No VIP available No VIP available CYP2A6 *1B1 N/A N/A N/A
No VIP available CA VA DPYD *1 N/A N/A N/A
No VIP available No VIP available VA DPYD *2A N/A N/A N/A
No VIP available No VIP available VA DPYD *4 N/A N/A N/A
No VIP available No VIP available VA DPYD *5 N/A N/A N/A
No VIP available No VIP available VA DPYD *6 N/A N/A N/A
No VIP available No VIP available VA DPYD *9A N/A N/A N/A
No VIP available CA No VIP available DPYD *9B N/A N/A N/A
No VIP available No VIP available VA DPYD *11 N/A N/A N/A
No VIP available CA VA DPYD *12 N/A N/A N/A
No VIP available No VIP available VA DPYD *13 N/A N/A N/A
No VIP available No VIP available VA UGT1A1 *1 N/A N/A N/A
No VIP available No VIP available VA UGT1A1 *6 N/A N/A N/A
No VIP available No VIP available VA UGT1A1 *28 N/A N/A N/A
No VIP available No Clinical Annotations available DPYD poor metabolizer
DPYD poor metabolizer N/A N/A N/A
No VIP available No Clinical Annotations available DPYD deficiency
DPYD deficiency N/A N/A N/A
No VIP available No Clinical Annotations available VA
rs10049380 124487443T>C, 124768596T>C, 2017+417A>G
T > C
No VIP available No Clinical Annotations available VA
rs10209881 130-30376A>G, 31023383T>C, 31246249T>C, 315-57081A>G, 70-30376A>G, 903-30376A>G
T > C
No VIP available CA VA
rs1042522 -1020C=, -1020C>A, -1020C>G, -939C=, -939C>A, -939C>G, 16397C=, 16397C>A, 16397C>G, 215C=, 215C>A, 215C>G, 7579472G=, 7579472G>C, 7579472G>T, 7676154G=, 7676154G>C, 7676154G>T, 98C=, 98C>A, 98C>G, P53:Arg72Pro, Pro33=, Pro33Arg, Pro33His, Pro72=, Pro72Arg, Pro72His, R72P, TP53 Arg72Pro, mRNA 412C>G, p.Pro72Arg, p52 codon 72
G > C
5' Flanking
No VIP available No Clinical Annotations available VA
rs10434 *847A>G, *913A>G, *929A>G, 20260A>G, 43753212A>G, 43785475A>G
A > G
3' UTR
No VIP available CA VA
rs1045642 208920T>C, 3435T>C, 87138645A>G, 87509329A>G, ABCB1*6, ABCB1: 3435C>T, ABCB1: C3435T, ABCB1: c.3435C>T, ABCB1:3435C>T, Ile1145=, Ile1145Ile, MDR1 3435C>T, MDR1 C3435T, PGP C3435T, c.3435C>T, mRNA 3853C>T
A > T
A > G
No VIP available CA VA
rs1047840 1762G>A, 1765G>A, 241878999G>A, 242042301G>A, 35809G>A, Glu588Lys, Glu589Lys
G > A
No VIP available No Clinical Annotations available VA
rs1051266 45537880T>C, 46957794T>C, 80A>G, 9592A>G, : 80A>G, His27Arg, RFC-1, SCL19A1:80G>A, SLC19A1:Arg27His, SLC19A1:G80A, mRNA 199A>G
T > C
No VIP available No Clinical Annotations available VA
rs10517 *1119T>C, 21774T>C, 69709857A>G, 69743760A>G
A > G
3' UTR
No VIP available CA VA
rs1056515 *3872C>A, 163113260G>T, 163143470G>T, 183322C>A
G > T
3' UTR
No VIP available CA VA
rs1056836 10042C=, 10042C>G, 1294C=, 1294C>G, 38071060G=, 38298203C>G, CYP1B1*3, CYP1B1: L432V, CYP1B1:4326 C>G, CYP1B1:L432V, Leu432=, Leu432Val
G > C
No VIP available No Clinical Annotations available VA
rs1059829 *1103C>T, *987C>T, 151042029G>A, 151662468G>A, 29587C>T
G > A
3' UTR
No VIP available No Clinical Annotations available VA
rs1063320 *233C=, *233C>G, 1093443C=, 1093443C>G, 1093458C=, 1093458C>G, 1093752G=, 1093752G>C, 1093785C=, 1093785C>G, 1096598G=, 1096598G>C, 1099028C=, 1099028C>G, 1099078C=, 1099078C>G, 1099370C=, 1099370C>G, 1137017G=, 1137017G>C, 1314548G=, 1314548G>C, 29798749C=, 29798749C>G, 29830972C=, 29830972C>G, 8994C=, 8994C>G
C > G
3' UTR
No VIP available No Clinical Annotations available VA
rs10784749 69028249C>G, 69422029C>G
C > G
Not Available
No VIP available No Clinical Annotations available VA
rs10876844 55656922C>A, 56050706C>A
C > A
Not Available
No VIP available CA VA
rs10937158 -1402-1268A>G, 130-1268A>G, 183708439T>C, 183990651T>C, 316-1268A>G
T > C
No VIP available No Clinical Annotations available VA
rs111858276 1484A>G, 376460A>G, 97549600T>C, 98015156T>C, Asp495Gly
T > C
No VIP available No Clinical Annotations available VA
rs112445441 10574G>A, 10574G>C, 10574G>T, 25245347C>A, 25245347C>G, 25245347C>T, 25398281C>A, 25398281C>G, 25398281C>T, 38G>A, 38G>C, 38G>T, Gly13Ala, Gly13Asp, Gly13Val, g.25398281C>G, g.25398281C>T
G > A
G > T
G > C
No VIP available No Clinical Annotations available VA
rs112723255 -14+175G>A, -14+420G>A, -368G>A, -398G>A, 1393G>A, 1408G>A, 22611C>T, 50525826C>T, 50964255C>T, 5614G>A, 9260G>A, Ala465Thr, Ala470Thr
G > T
G > C
5' Flanking
No VIP available No Clinical Annotations available VA
rs1127648 *796T>C, 75674754A>G, 75967095A>G
A > G
3' UTR
No VIP available No Clinical Annotations available VA
rs112766203 129-910G>A, 129-910G>C, 2279C>G, 2279C>T, 620781C>G, 620781C>T, 97305279G>A, 97305279G>C, 97770835G>A, 97770835G>C, Thr760Ile, Thr760Ser
G > A
G > C
No VIP available No Clinical Annotations available VA
rs1128503 1236T>C, 167964T>C, 87179601A>G, 87550285A>G, ABCB1 1236C>T, ABCB1*8, ABCB1: c.1236T>C, ABCB1:1236C>T, ABCB1:1236T>C, Gly412=, Gly412Gly, mRNA 1654T>C, p.Gly412Gly
A > G
No VIP available No Clinical Annotations available VA
rs1138272 341C>T, 67353579C>T, 67586108C>T, 7514C>T, A114V, Ala114Val, GSTP1: A114V, GSTP1: C341T
C > T
No VIP available No Clinical Annotations available VA
rs114096998 3067C>A, 3067C>G, 3067C>T, 847073C>A, 847073C>G, 847073C>T, 97078987G>A, 97078987G>C, 97078987G>T, 97544543G>A, 97544543G>C, 97544543G>T, Pro1023Ala, Pro1023Ser, Pro1023Thr
G > T
No VIP available CA VA
rs11479 -14+194C>T, -14+439C>T, -349C>T, -379C>T, 1412C>T, 1427C>T, 22592G>A, 50525807G>A, 50964236G>A, 5633C>T, 9279C>T, Ser471Leu, Ser476Leu
G > A
G > T
G > C
5' Flanking
No VIP available CA VA
rs115232898 226586A>G, 557A>G, 97699474T>C, 98165030T>C, Tyr186Cys, Y186C, c.557A>G
T > C
No VIP available CA VA
rs115632870 151-69G>A, 97795G>A, 97828265C>T, 98293821C>T, IVS2-69, c.151-69G>A
C > T
No VIP available CA VA
rs11615 354T>C, 45420395A>G, 45923653A>G, 63434T>C, Asn118=, ERCC1:19007T>C, ERCC1:Asn118Asn
A > G
No VIP available No Clinical Annotations available VA
rs12613732 130-33554A>C, 31026561T>G, 31249427T>G, 315-60259A>C, 70-33554A>C, 903-33554A>C
T > G
No VIP available CA VA
rs12659 15830T>C, 45531642A>G, 46951556A>G, 576T>C, 696T>C, Pro192=, Pro232=
A > G
No VIP available No Clinical Annotations available VA
rs12999804 130-29777T>A, 31022784A>T, 31245650A>T, 315-56482T>A, 70-29777T>A, 903-29777T>A
A > T
No VIP available CA VA
rs13181 *304T>G, 2251A>C, 23927A>C, 45351661T>G, 45854919T>G, ERCC2 Lys751Gln, ERCC2:2251A>C, ERCC2:Lys751Gln, Lys751Gln, rs13181:T>G
T > G
No VIP available No Clinical Annotations available VA
rs137999090 2021G>A, 552462G>A, 97373598C>T, 97839154C>T, Gly674Asp
C > T
No VIP available No Clinical Annotations available VA
rs138616379 1775G>A, 475871G>A, 97450189C>T, 97915745C>T, Arg592Gln
C > T
No VIP available No Clinical Annotations available VA
rs141044036 2872A>G, 843695A>G, 97082365T>C, 97547921T>C, Lys958Glu
T > C
No VIP available No Clinical Annotations available VA
rs143154602 1057C>T, 332771C>T, 97593289G>A, 98058845G>A, Arg353Cys
G > A
No VIP available No Clinical Annotations available VA
rs143986398 185621C>G, 274C>G, 97740439G>C, 98205995G>C, Pro92Ala
G > C
No VIP available No Clinical Annotations available VA
rs145773863 1777G>A, 475873G>A, 97450187C>T, 97915743C>T, Gly593Arg
C > T
No VIP available No Clinical Annotations available VA
rs146356975 330911A>G, 868A>G, 97595149T>C, 98060705T>C, Lys290Glu
T > C
No VIP available No Clinical Annotations available VA
rs147601618 1796T>C, 475892T>C, 97450168A>G, 97915724A>G, Met599Thr
A > G
No VIP available No Clinical Annotations available VA
rs1610696 *287C=, *287C>G, 1093497C=, 1093497C>G, 1093512C=, 1093512C>G, 1093806G=, 1093806G>C, 1093839C=, 1093839C>G, 1096652G=, 1096652G>C, 1099082C=, 1099082C>G, 1099132C=, 1099132C>G, 1099424C=, 1099424C>G, 1137071G=, 1137071G>C, 1314602G=, 1314602G>C, 29798803C=, 29798803C>G, 29831026C=, 29831026C>G, 9048C=, 9048C>G
C > G
3' UTR
No VIP available No Clinical Annotations available VA
rs163182 1414-24781G>C, 1688-24781G>C, 1795-24781G>C, 2822986G>C, 2844216G>C, 382996G>C, 55173G>C
G > C
No VIP available No Clinical Annotations available VA
rs16857540 173900575C>G, 174182785C>G, 647-92530C>G
C > G
No VIP available CA VA
rs1695 313A>G, 6624A>G, 67352689A>G, 67585218A>G, GSTP1*2, GSTP1*B, GSTP1: I105V, GSTP1:A313G, GSTP1:I105V, GSTP1:Ile105Val, Ile105Val, Part of haplotypes GSTP1*B and GSTP1*C, rs1695:A>G
A > G
No VIP available No Clinical Annotations available VA
rs1707 *94C=, *94C>T, 1093304T=, 1093304T>C, 1093319T=, 1093319T>C, 1093613T=, 1093613T>C, 1093646T=, 1093646T>C, 1096459T=, 1096459T>C, 1098889T=, 1098889T>C, 1098939T=, 1098939T>C, 1099231T=, 1099231T>C, 1136878T=, 1136878T>C, 1314409T=, 1314409T>C, 29798610C=, 29798610C>T, 29830833C=, 29830833C>T, 8855C=, 8855C>T
C > T
3' UTR
No VIP available No Clinical Annotations available VA
rs1710 *101G=, *101G>C, 1093311G=, 1093311G>C, 1093326G=, 1093326G>C, 1093620C=, 1093620C>G, 1093653G=, 1093653G>C, 1096466C=, 1096466C>G, 1098896G=, 1098896G>C, 1098946G=, 1098946G>C, 1099238G=, 1099238G>C, 1136885C=, 1136885C>G, 1314416C=, 1314416C>G, 29798617G=, 29798617G>C, 29830840G=, 29830840G>C, 8862G=, 8862G>C
G > C
3' UTR
No VIP available CA VA
rs17109924 1781T>C, 1925T>C, 1997T>C, 2497+95T>C, 71584007T>C, 71977787T>C, Val594Ala, Val642Ala, Val666Ala
T > C
No VIP available No Clinical Annotations available VA
rs17116806 1740+8030G>T, 418364G>T, 97507696C>A, 97973252C>A
C > A
No VIP available CA VA
rs17160359 458+6848G>T, 509+6848G>T, 746C>A, 87346819G>T, 87717503G>T
G > T
No VIP available No Clinical Annotations available VA
rs17179101 *118C>A, 1093328C>A, 1093343C>A, 1093637C>A, 1093670C>A, 1096483C>A, 1098913C>A, 1098963C>A, 1099255C>A, 1136902C>A, 1314433C>A, 29798634C>A, 29830857C>A, 8879C>A
C > A
3' UTR
No VIP available CA VA
rs17179108 *126C>T, 1093336C>T, 1093351C>T, 1093645C>T, 1093678C>T, 1096491C>T, 1098921C>T, 1098971C>T, 1099263C>T, 1136910C>T, 1314441C>T, 29798642C>T, 29830865C>T, 8887C>T
C > T
3' UTR
No VIP available No Clinical Annotations available VA
rs1734787 -421-1429T>G, 1493974A>C, 153325446A>C, 154059995A>C, 27-27438T>G, 63-27438T>G, 82133T>G
A > C
No VIP available No Clinical Annotations available VA
rs1734791 -421-6903T>A, 1499448A>T, 153330920A>T, 154065469A>T, 26+26722T>A, 62+32141T>A, 76659T>A
A > T
No VIP available CA VA
rs17376848 1896T>C, 475992T>C, 97450068A>G, 97915624A>G, Phe632=, Phe632Phe
A > G
No VIP available CA VA
rs17431184 102056T>C, 1321-400T>C, 211-400T>C, 802-400T>C, 87960494T>C, 89720251T>C
T > C
No VIP available No Clinical Annotations available VA
rs17435 -254+11870A>T, 1480508T>A, 153311980T>A, 154046529T>A, 27-13972A>T, 63-13972A>T, 95599A>T
T > A
No VIP available CA VA
rs17626122 205609288T>C, 206474012T>C, 2958-6168T>C, 3054-6168T>C, 3075-6168T>C, 3261-6168T>C
T > C
No VIP available No Clinical Annotations available VA
rs17822471 1637C>T, 31710C>T, 48208468G>A, 48242379G>A, Thr546Met
G > A
No VIP available No Clinical Annotations available VA
rs17822931 15891G>A, 48224287C>T, 48258198C>T, 538G>A, Gly180Arg
G > T
G > C
No VIP available No Clinical Annotations available VA
rs1799793 11587G>A, 45364001C>T, 45867259C>T, 862G>A, 934G>A, Asp288Asn, Asp312Asn, XPD Asp312Asn, XPD:Asp312Asn
C > T
No VIP available No Clinical Annotations available VA
rs1799794 -260-1363A>G, -316A>G, 103712930T>C, 104179267T>C, 7557A>G
T > C
5' UTR
No VIP available No Clinical Annotations available VA
rs1799895 24800212C>G, 24801834C>G, 691C>G, 9750C>G, Arg231Gly
C > G
No VIP available CA VA
rs1799983 12965T>G, 150696111T>G, 150999023T>G, 894T>G, Asp298Glu, NOS3:894G>T
T > G
No VIP available CA VA
rs1800566 20389C>T, 343C>T, 445C>T, 457C>T, 559C>T, 69711242G>A, 69745145G>A, NQO1*2, NQO1:C609T, NQO1:P187S, NQO1:c.558C>T, Pro115Ser, Pro149Ser, Pro153Ser, Pro187Ser, rs1800566 C>T
G > A
No VIP available CA VA
rs1801019 124456742G>C, 124737895G>C, 12530G>C, 590G>C, 638G>C, 843G>C, Gly213Ala, OPRT: Gly213Ala
G > C
Not Available
No VIP available CA VA
rs1801131 11794419T>G, 11854476T>G, 1286A>C, 16685A>C, A1298C, Glu429Ala, MTHFR:1298A>C
T > G
Not Available
rs1801133 11796321G>A, 11856378G>A, 14783C>T, 665C>T, 677C>T, A222V, Ala222Val, C677T, MTHFR: c.677C>T, MTHFR:667C>T, p.A222V
G > A
Not Available
No VIP available CA VA
rs1801158 1601G>A, 410195G>A, 97515865C>T, 97981421C>T, Ser534Asn
C > T
Not Available
No VIP available CA VA
rs1801159 1627A>G, 410221A>G, 97515839T>C, 97981395T>C, DPYD*5, DPYD:A1627G, DPYD:I543V, Ile543Val
T > C
No VIP available CA VA
rs1801160 129-825C>T, 2194G>A, 620696G>A, 97305364C>T, 97770920C>T, Val732Ile
C > T
No VIP available CA VA
rs1801265 42731T=, 42731T>C, 85T=, 85T>C, 97883329A=, 97883329A>G, 98348885G=, 98348885G>A, Cys29=, Cys29Arg, DPYD*9A, DPYD:C29R, DYPD:T85C
A > G
No VIP available CA VA
rs1801266 234284C>T, 703C>T, 97691776G>A, 98157332G>A, Arg235Trp
G > A
No VIP available CA VA
rs1801268 2983G>T, 846989G>T, 97079071C>A, 97544627C>A, Val995Phe
C > A
No VIP available No Clinical Annotations available VA
rs183105782 330953T>C, 910T>C, 97595107A>G, 98060663A>G, Tyr304His
A > G
No VIP available CA VA
rs183205964 *34+185C>G, -86G>C, 5054G>C, 657657G>C
G > C
5' UTR
No VIP available No Clinical Annotations available VA
rs183385770 1024G>A, 332738G>A, 97593322C>T, 98058878C>T, Asp342Asn
C > T
No VIP available No Clinical Annotations available VA
rs186169810 1314T>G, 352275T>G, 97573785A>C, 98039341A>C, Phe438Leu
A > C
No VIP available No Clinical Annotations available VA
rs1870377 1416A>T, 23789A>T, 55106807T>A, 55972974T>A, Gln472His, VEGFR-2 1718T/A
T > A
No VIP available No Clinical Annotations available VA
rs188052243 2678A>G, 64+2591T>C, 827483A>G, 97098577T>C, 97564133T>C, Asn893Ser
T > C
No VIP available No Clinical Annotations available VA
rs1885301 -1549A>G, -1549G>A, 101541053A>G, 3591A>G, 99781296A>G
A > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs190577302 1054C>G, 332768C>G, 97593292G>C, 98058848G>C, Leu352Val
G > C
No VIP available CA VA
rs1979277 1006C>T, 1303C>T, 1420C>T, 18232096G>A, 18328782G>A, 39761C>T, Leu336Phe, Leu435Phe, Leu474Phe, SHMT1 L435F
G > A
No VIP available No Clinical Annotations available VA
rs200687447 2482G>A, 2482G>C, 65-72205C>G, 65-72205C>T, 732851G>A, 732851G>C, 97193209C>G, 97193209C>T, 97658765C>G, 97658765C>T, Glu828Gln, Glu828Lys
C > G
C > T
No VIP available CA VA
rs201045130 39659467A>G, 40125139A>G, 761T>C, Leu254Pro
A > G
No VIP available No Clinical Annotations available VA
rs2010851 *1224C>A, 1647476C>A, 1756642C>A
C > A
3' Flanking
No VIP available No Clinical Annotations available VA
rs2010963 -1507C>G, -634C>G, -94C>G, 43738350C>G, 43770613C>G, 5398C>G, VEGF-A 405 G/C, VEGFA:405G>C, VEGFA:C405G
C > G
5' UTR
No VIP available No Clinical Annotations available VA
rs2032582 186947T>A, 186947T>G, 2677A, 2677G, 2677T, 2677T>A, 2677T>G, 3095G>T/A, 87160618A>C, 87160618A>T, 87531302A>C, 87531302A>T, 893 Ala, 893 Ser, 893 Thr, ABCB1*7, ABCB1: 2677G>T/A, ABCB1: 2677T/A>G, ABCB1: A893S, ABCB1: G2677T/A, ABCB1: c.2677G>T/A, ABCB1:2677G>A/T, ABCB1:2677G>T/A, ABCB1:A893T, Ala893Ser/Thr, MDR1, MDR1 G2677T/A, Ser893Ala, Ser893Thr, mRNA 3095G>T/A, p.Ala893Ser/Thr
A > T
A > C
No VIP available No Clinical Annotations available VA
rs2070474 -250G>C, -80C>G, 24495324C>G, 24891292C>G, 5042C>G
C > G
5' UTR
No VIP available CA No Variant Annotations available
rs2070744 -51-762C=, -51-762C>T, -786, -813C=, -813C>T, 150690079C=, 150690079C>T, 150992991C=, 150992991C>T, 6933C=, 6933C>T, NOS3 -786T>C, NOS3:, T>C, eNOS -786T>C
C > T
5' Flanking
No VIP available No Clinical Annotations available VA
rs2071559 -906T>C, 4397T>C, 55126199A>G, 55992366A>G
A > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs2072671 20589208A>C, 20915701A>C, 79A>C, CDA: c.79A>C, CDA:79A>C, K27Q, Lys27Gln, p.Lys27Gln
A > C
No VIP available No Clinical Annotations available VA
rs2074087 145799C=, 145799C>G, 16090375C=, 16090375C>G, 16184232C>G, 1748233G=, 1748233G>C, 2461-30C>G, 2461-30G>C
C > G
No VIP available CA No Variant Annotations available
rs2231142 105152C>A, 421C>A, 88131171G>T, 89052323G>T, ABCG2: Q141K, ABCG2:421C>A, ABCG2:Q141K, ABCG2:c.421C>A, Gln141Lys, rs2231142
G > T
No VIP available No Clinical Annotations available VA
rs2236225 1958G>A, 59087G>A, 64442127G>A, 64908845G>A, Arg653Gln, MTHFD1:1958G>A, MTHFD1:Arg653Gln, R653Q
G > A
No VIP available CA VA
rs2236722 100801T>C, 115T>C, 51242798A>G, 51534995A>G, Trp39Arg
A > G
No VIP available CA VA
rs225440 220+7029C>T, 277+7029C>T, 286+7029C>T, 292+7029C>T, 319+7029C>T, 42232943C>T, 43653053C>T
C > T
No VIP available No Clinical Annotations available VA
rs2266637 113-228G>A, 151G>A, 201-228G>A, 24376845C>T, 271020C>T, 463G>A, 505G>A, GSTT1:Val169Ile, Val155Ile, Val169Ile, Val51Ile
G > T
G > C
No VIP available No Clinical Annotations available VA
rs2286455 16018539C>T, 16020162C>T, 70462G>A, 759G>A, 786G>A, Ala253=, Ala262=
C > T
No VIP available CA VA
rs2289310 120476C>A, 4442C>A, 49807G>T, 77811115G>T, 79570873G>T, Pro1481Gln
G > T
No VIP available CA VA
rs2291078 1002T>A, 1050T>A, 124458938T>A, 124740091T>A, 1255T>A, 14726T>A, Val350=
T > A
Not Available
No VIP available CA VA
rs2292997 -1403+7980C>T, -54G>A, 129+7980C>T, 183724072G>A, 184006284G>A, 315+7980C>T
G > A
5' Flanking
No VIP available CA VA
rs2293347 187192C>T, 2982C>T, 55201223C>T, 55268916C>T, Asp994=
C > T
No VIP available CA VA
rs2297595 226525A>G, 496A>G, 97699535T>C, 98165091T>C, DPYD:496A>G, DPYD:Met166Val, Met166Val
T > C
No VIP available No Clinical Annotations available VA
rs2302273 -302C>T, 149535255G>A, 150155692G>A, 5168C>T
G > A
5' UTR
No VIP available No Clinical Annotations available VA
rs2305948 17205G>A, 55113391C>T, 55979558C>T, 889G>A, Val297Ile
C > T
No VIP available No Clinical Annotations available VA
rs2306283 21176804A>G, 21329738A>G, 388A>G, 50611A>G, Asn130Asp, SLCO1B1*1B
A > G
No VIP available No Clinical Annotations available VA
rs2465403 119078588G>A, 120090827G>A, 149-11092G>A
G > A
No VIP available CA VA
rs25487 1196A>G, 29005A>G, 43551574T>C, 44055726T>C, Gln399Arg, XRCC1 Arg399Gln, XRCC1:Arg399Gln
T > C
No VIP available CA VA
rs25648 -7C>T, -880C>T, 43738977C>T, 43771240C>T, 534C>T, 6025C>T, Ser178=
C > T
No VIP available No Clinical Annotations available VA
rs2661280 *3757C>G, 163113375G>C, 163143585G>C, 183207C>G
G > C
3' UTR
No VIP available No Clinical Annotations available VA
rs2669429 104451462A>G, 105463690A>G, 20588T>C, 265-58T>C
A > G
No VIP available No Clinical Annotations available VA
rs2740574 -392G>A, 4713G>A, 5'-flanking region -392A>G, 99382096C>T, 99784473C>T, CYP3A4*1B, CYP3A4-V, CYP3A4:-392A>G
C > T
5' Flanking
No VIP available CA VA
rs2847153 280-499G>A, 661647G>A, 9044G>A
G > A
No VIP available CA VA
rs2854744 -336C>A, 45921476G>T, 45961075G>T, 4797C>A
G > T
5' Flanking
No VIP available No Clinical Annotations available VA
rs2854746 45921046G>C, 45960645G>C, 5227C>G, 95C>G, Ala32Gly
G > C
No VIP available No Clinical Annotations available VA
rs2959023 -1T>C, 104466921A>G, 105479149A>G, 5129T>C
A > G
5' UTR
No VIP available CA VA
rs2960436 45937683G>A, 45977282G>A
G > A
Not Available
No VIP available CA VA
rs3025039 *171C>T, *237C>T, *253C>T, 19584C>T, 43752536C>T, 43784799C>T, VEGFA:C936T
C > T
3' UTR
No VIP available No Clinical Annotations available VA
rs307805 -942A>G, 180077487T>C, 180650487T>C, 4138A>G
T > C
5' Flanking
No VIP available No Clinical Annotations available VA
rs307822 *1475A>G, 180028717T>C, 180601717T>C, 52908A>G
T > C
3' UTR
No VIP available No Clinical Annotations available VA
rs3110697 10843T>C, 45915430A>G, 45955029A>G, 751-485T>C, 769-485T>C
A > G
No VIP available No Clinical Annotations available VA
rs3130 *1078A>G, 120686A>G, 15968315T>C, 15969938T>C
T > C
3' UTR
No VIP available No Clinical Annotations available VA
rs3136228 -1293T>G, -2071T>G, -557T>G, 4531T>G, 47782677T>G, 48009816T>G
T > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs3212948 321+74C>G, 45421104G>C, 45924362G>C, 62725C>G
G > C
No VIP available No Clinical Annotations available VA
rs3212986 *197G>T, 1510C>A, 1516C>A, 45409478C>A, 45912736C>A, 74351G>T, ERCC1 C8092A, ERCC1:8090C>A, ERCC1:8092C>A, Gln504Lys, Gln506Lys
C > A
3' UTR
No VIP available CA VA
rs3218592 111322635C>T, 111643838C>T, 8051G>A, 8285G>A, Arg2684Gln, Arg2762Gln
C > T
No VIP available No Clinical Annotations available VA
rs329007 1053+99G>A, 9522606G>A, 9522608G>A
G > A
No VIP available No Clinical Annotations available VA
rs34116584 240868897C>A, 240868897C>G, 240868897C>T, 241808314C>A, 241808314C>G, 241808314C>T, 32C>A, 32C>G, 32C>T, 5153C>A, 5153C>G, 5153C>T, Pro11Arg, Pro11His, Pro11Leu
C > G
C > T
C > A
rs34489327 *145-370delT, *145-370delTinsCTTTAA, *449delA, *449delAinsTTAAAG, *859delT, *859delTinsCTTTAA, 20843delA, 20843delAinsTTAAAG, 6-basepair 3'UTR repeat, 663446delA, 663446delAinsTTAAAG, 673446delA, 673446delAinsTTAAAG, TYMS:-TTAAAG, TYMS:1494del, TYMS:1494del TTAAAG, ttaaag
T > -
3' UTR
rs34743033 28-bp tandem repeats, CCGCGCCACTTGGCCTGCCTCCGTCCCG, TSER*2, TSER*3, TYMS: 28 bp tandem repeat, TYMS: 2R, TYMS: TSER *2/*3, TYMS:TSER 28-basepair 5'UTR enhancer region repeat
Not Available
No VIP available CA VA
rs351855 1058-90G>A, 1097+65G>A, 11323G>A, 1162G>A, 176520243G>A, 177093242G>A, FGFR4:Arg388, FGFR4:GLY388ARG, Gly388Arg
G > A
No VIP available CA VA
rs370457585 39661180C>G, 39661180C>T, 40126852C>G, 40126852C>T, 640G>A, 640G>C, Ala214Pro, Ala214Thr
C > T
No VIP available CA VA
rs371194629 *65_*66insATTTGT, *65_*66insATTTGTTCATGCCT, 1093275_1093276insATTTGT, 1093275_1093276insATTTGTTCATGCCT, 1093290_1093291insATTTGT, 1093290_1093291insATTTGTTCATGCCT, 1093570_1093585insATTTGT, 1093570_1093585insATTTGTTCATGCCT, 1093617_1093618insATTTGT, 1093617_1093618insATTTGTTCATGCCT, 1096416_1096431insATTTGT, 1096416_1096431insATTTGTTCATGCCT, 1098860_1098861insATTTGT, 1098860_1098861insATTTGTTCATGCCT, 1098910_1098911insATTTGT, 1098910_1098911insATTTGTTCATGCCT, 1099202_1099203insATTTGT, 1099202_1099203insATTTGTTCATGCCT, 1136835_1136850insATTTGT, 1136835_1136850insATTTGTTCATGCCT, 1314366_1314381insATTTGT, 1314366_1314381insATTTGTTCATGCCT, 29798581_29798582insATTTGT, 29798581_29798582insATTTGTTCATGCCT, 29830804_29830805insATTTGT, 29830804_29830805insATTTGTTCATGCCT, 8826_8827insATTTGT, 8826_8827insATTTGTTCATGCCT
3' UTR
No VIP available No Clinical Annotations available VA
rs3740066 101604207C>T, 3972C>T, 66745C>T, 99844450C>T, ABCC2:3972C>T, I1324I, Ile1324=
C > T
No VIP available CA VA
rs374150125 39663330G>A, 40129002G>A, 538C>T, Arg180Ter
G > A
Stop Codon
No VIP available CA VA
rs3749438 -941+374C>T, 183705184G>A, 183987396G>A, 591+374C>T, 777+374C>T
G > A
No VIP available CA VA
rs3772809 124462824A>G, 124743977A>G, 1288A>G, 1336A>G, 1541A>G, 18612A>G, Ile446Val
A > G
Not Available
No VIP available CA VA
rs3772810 *28A>G, 124462959A>G, 124744112A>G, 1423A>G, 1676A>G, 18747A>G
A > G
Not Available
No VIP available No Clinical Annotations available VA
rs3812718 166053034C>T, 166909544C>T, 25606G>A, 603-91G>A
C > T
No VIP available CA VA
rs3917412 169700502T>C, 169731361T>C, 529+474A>G, 7719A>G
T > C
rs3918290 1905+1G>A, 476002G>A, 97450058C>T, 97915614C>T, DPYD*2A, DPYD:67887533 G>A, DPYD:IVS14 + 1G>A
C > T
No VIP available No Clinical Annotations available VA
rs4073 -352A>T, 4802A>T, 73740307A>T, 74606024A>T, IL8 -251A/T
A > T
5' Flanking
No VIP available No Clinical Annotations available VA
rs4149056 21178615T>C, 21331549T>C, 521T>C, 52422T>C, SLCO1B1*5, Val174Ala
T > C
No VIP available No Clinical Annotations available VA
rs4243761 26037644G>T, 26282791G>T, 896-11481G>T
G > T
No VIP available No Clinical Annotations available VA
rs4402960 -106+27113C>A, 185511687G>T, 185793899G>T, 239+29254C>A, 36141C>A, 50+27113C>A
G > T
No VIP available No Clinical Annotations available VA
rs4426527 1020A>G, 14355A>G, 240878099A>G, 241817516A>G, Ile340Met
A > G
No VIP available No Clinical Annotations available VA
rs45445694 *34+169_*34+196CGGGACGGAGGCAGGCCAAGTGGCGCGG[2][3][4][7][8][9], -97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], 2, 28-bp tandem repeats located in the TS enhancer region of 5'UTR, 5043_5070CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], 657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], TYMS:*2
5' UTR
No VIP available No Clinical Annotations available VA
rs45589337 246890A>G, 775A>G, 97679170T>C, 98144726T>C, Lys259Glu
T > C
No VIP available CA VA
rs4646 *161T>G, 132952T>G, 51210647A>C, 51502844A>C
A > C
3' UTR
No VIP available No Clinical Annotations available VA
rs470119 2955A>G, 50528485T>C, 50966914T>C, 516+27A>G, 6601A>G
T > C
No VIP available No Clinical Annotations available VA
rs4880 159692840A>G, 160113872A>G, 47C-T, 47T>C, 5482T>C, Ala16Val, SOD1:Val16Ala, SOD2: Val16Ala, T47C, V16A, Val16Ala
A > G
No VIP available No Clinical Annotations available VA
rs4932551 91528728G>C, 92071958G>C
G > C
Not Available
No VIP available No Clinical Annotations available VA
rs4970722 39563T>A, 40-3123T>A, 97886497A>T, 98352053A>T
A > T
No VIP available No Clinical Annotations available VA
rs5009910 130-33141A>G, 31026148T>C, 31249014T>C, 315-59846A>G, 70-33141A>G, 903-33141A>G
T > C
No VIP available No Clinical Annotations available VA
rs501415 -20+35A>G, 54318842A>G, 56651611A>G
A > G
No VIP available No Clinical Annotations available VA
rs55674432 2639G>T, 64+2630C>A, 827444G>T, 97098616C>A, 97564172C>A, Gly880Val
C > A
No VIP available CA VA
rs55886062 1679T>G, 410273T>G, 97515787A>C, 97981343A>C, Ile560Ser
A > T
A > C
No VIP available CA VA
rs56038477 1236G>A, 352197G>A, 97573863C>T, 98039419C>T, Glu412=
C > T
No VIP available No Clinical Annotations available VA
rs56160474 *274T>C, 847358T>C, 97078702A>G, 97544258A>G
A > G
3' UTR
No VIP available No Clinical Annotations available VA
rs5906072 105769T>C, 45640507T>C, 45781104T>C
T > C
Not Available
No VIP available No Clinical Annotations available VA
rs59086055 1774C>T, 475870C>T, 97450190G>A, 97915746G>A, Arg592Trp
G > A
No VIP available No Clinical Annotations available VA
rs5934731 447C>T, 9935844C>T, 9967804C>T, Tyr149=
C > T
No VIP available No Clinical Annotations available VA
rs60139309 2582A>G, 65-72305T>C, 732951A>G, 97193109T>C, 97658665T>C, Lys861Arg
T > C
No VIP available No Clinical Annotations available VA
rs61757362 2948C>T, 846954C>T, 97079106G>A, 97544662G>A, Thr983Ile
G > A
No VIP available No Clinical Annotations available VA
rs61764370 *2505T>G, *2626T>G, 25207290A>C, 25360224A>C, 48631T>G, LCS6 (let-7 complementary sites 6)
A > C
3' UTR
No VIP available No Clinical Annotations available VA
rs6458232 41629726C>A, 41661988C>A
C > A
Not Available
No VIP available CA VA
rs662 21439A>G, 575A>G, 94937446T>C, 95308134T>C, Gln192Arg
T > C
No VIP available No Clinical Annotations available VA
rs664393 -2021A>G, 28496864T>C, 29071001T>C, 3265A>G
T > C
5' Flanking
No VIP available CA VA
rs67376798 2846A>T, 843669A>T, 97082391T>A, 97547947T>A, Asp949Val
T > A
No VIP available No Clinical Annotations available VA
rs6752303 130-31612A>G, 31024619T>C, 31247485T>C, 315-58317A>G, 70-31612A>G, 903-31612A>G
T > C
No VIP available No Clinical Annotations available VA
rs6769511 -106+8510A>G, 17538A>G, 185530290T>C, 185812502T>C, 239+10651A>G, 50+8510A>G
T > C
No VIP available No Clinical Annotations available VA
rs6877011 *721G>C, 180029471C>G, 180602471C>G, 52154G>C
C > G
3' UTR
No VIP available CA VA
rs699947 -2055A>C, -2578, -2595A>C, 3437A>C, 43736389A>C, 43768652A>C, VEGF-A -2578 C/A, VEGFA:, VEGFA:C-2578A
A > C
5' Flanking
No VIP available No Clinical Annotations available VA
rs7121 *254C>T, *299C>T, 216C>T, 2322C>T, 348C>T, 351C>T, 393C>T, 396C>T, 483C>T, 57478807C>T, 58903752C>T, 69013C>T, Ile116=, Ile117=, Ile131=, Ile132=, Ile72=, Ile774=
C > T
No VIP available No Clinical Annotations available VA
rs715171 9341848C>T, 9373808C>T
C > T
Not Available
No VIP available No Clinical Annotations available VA
rs7170769 91526975C>T, 92070205C>T
C > T
Not Available
No VIP available CA VA
rs717620 -24C>T, 101542578C>T, 5116C>T, 99782821C>T, ABCC2: 5'UTR, ABCC2:(-24)C>T, mRNA 118C>T
C > T
5' UTR
No VIP available CA VA
rs7194667 1609-491A>C, 31191A>C, 48208987T>G, 48242898T>G
T > G
No VIP available No Clinical Annotations available VA
rs72547601 2933A>G, 846939A>G, 97079121T>C, 97544677T>C, His978Arg
T > C
No VIP available CA No Variant Annotations available
rs72549303 1898delC, 475994delC, 97450066delG, 97915622delG, Pro633Glnfs
G > -
No VIP available No Clinical Annotations available VA
rs72549304 1475C>T, 376451C>T, 97549609G>A, 98015165G>A, Ser492Leu
G > A
No VIP available CA No Variant Annotations available
rs72549306 1003G>T, 332717G>T, 97593343C>A, 98058899C>A, Val335Leu
C > A
No VIP available No Clinical Annotations available VA
rs72549307 226661A>G, 632A>G, 97699399T>C, 98164955T>C, Tyr211Cys
T > C
No VIP available No Clinical Annotations available VA
rs72549308 226630A>C, 601A>C, 97699430T>G, 98164986T>G, Ser201Arg
T > G
No VIP available CA No Variant Annotations available
rs72549309 185642_185645delTCAT, 295_298delTCAT, 97740415_97740418delATGA, 98205971_98205974delATGA, Phe100Serfs
ATGA > -
No VIP available CA VA
rs72728438 1974+75A>G, 543742A>G, 97382318T>C, 97847874T>C, IVS15+75, c.1974+75A>G
T > C
No VIP available CA VA
rs7325568 40244147C>T, 40818284C>T
C > T
Not Available
No VIP available CA VA
rs75017182 1129-5923C>G, 346167C>G, 97579893G>C, 98045449G>C
G > C
No VIP available No Clinical Annotations available VA
rs7608731 130-34101A>G, 31027108T>C, 31249974T>C, 315-60806A>G, 70-34101A>G, 903-34101A>G
T > C
No VIP available No Clinical Annotations available VA
rs7664413 110193G>A, 176687553C>T, 177608707C>T, 812-33G>A
C > T
Not Available
No VIP available No Clinical Annotations available VA
rs7667298 -271A>G, 5032A>G, 55125564T>C, 55991731T>C
T > C
5' UTR
No VIP available CA VA
rs7699188 -19-34895C>T, 61414C>T, 88174909G>A, 89096061G>A
G > A
No VIP available No Clinical Annotations available VA
rs770063251 104424265C>T, 105436493C>T, 1217G>A, 47785G>A, Trp406Ter
C > T
Stop Codon
No VIP available No Clinical Annotations available VA
rs780093 1572+799T>C, 27519736T>C, 27742603T>C, 27898T>C
T > C
No VIP available No Clinical Annotations available VA
rs780094 1423-418T>C, 26532T>C, 27518370T>C, 27741237T>C
T > C
No VIP available No Clinical Annotations available VA
rs78060119 1156G>T, 352117G>T, 97573943C>A, 98039499C>A, Glu386Ter
C > A
Stop Codon
No VIP available No Clinical Annotations available VA
rs7952081 67324933G>A, 67557462G>A
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs7993418 191205C>T, 28308924G>A, 28883061G>A, 3639C>T, Tyr1213=
G > A
No VIP available No Clinical Annotations available VA
rs8056100 13459C>T, 395+1087C>T, 48226719G>A, 48260630G>A
G > A
No VIP available No Clinical Annotations available VA
rs8071253 -1392C>T, 117+953G>A, 63+953G>A, 76184467G>A, 78188386G>A
G > A
No VIP available No Clinical Annotations available VA
rs8175347 233760235_233760236TA[5][6][7][8], 5-TA insertion in promoter, 7-TA insertion in promoter, 8-TA insertion in promoter, UGT1A1*28, UGT1A1*36, UGT1A1*37, microsatellite, short tandem repeat
(TA)6 > (TA)8
(TA)6 > (TA)5
(TA)6 > (TA)7
Not Available
No VIP available No Clinical Annotations available VA
rs833061 -1498C>T, -460, -958C>T, 43737486C>T, 43769749C>T, 4534C>T, VEGF-A -460 C/T, VEGFA:C-460T, VEGFA:T-1498C
C > T
5' Flanking
No VIP available No Clinical Annotations available VA
rs854560 12801T>A, 163T>A, 94946084A>T, 95316772A>T, Leu55Met
A > T
A > C
A > G
A > N
No VIP available CA VA
rs861539 103699416G>A, 104165753G>A, 1651-1239G>A, 1782-1239G>A, 21071C>T, 722C>T, 75229G>A, Thr241Met
G > A
No VIP available CA VA
rs9344 12038G>A, 69462910G>A, 69648142G>A, 723G>A, CCND1 (A870G), CCND1:870G>A, Pro241=, rs603965
G > A
No VIP available CA VA
rs9380142 *278A=, *278A>G, 1093488G=, 1093488G>A, 1093503A=, 1093503A>G, 1093797A=, 1093797A>G, 1093830G=, 1093830G>A, 1096643A=, 1096643A>G, 1099073G=, 1099073G>A, 1099123A=, 1099123A>G, 1099415G=, 1099415G>A, 1137062A=, 1137062A>G, 1314593A=, 1314593A>G, 29798794A=, 29798794A>G, 29831017A=, 29831017A>G, 9039A=, 9039A>G
A > G
3' UTR
No VIP available CA VA
rs9561778 3225+1243C>A, 3366+1243C>A, 95061461G>T, 95713715G>T, NM_005845.3:c.3366+1243G>T
G > A
G > T
No VIP available CA VA
rs9679162 130-31641C>A, 31024648G>T, 31247514G>T, 315-58346C>A, 70-31641C>A, 903-31641C>A
G > T
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 147


Generic Names
Trade Names
  • 5 Fluorouracil
  • Adrucil
  • Arumel
  • Carac
  • Carzonal
  • Effluderm
  • Efudex
  • Efudix
  • Efurix
  • FU
  • Fluoroblastin
  • Fluoroplex
  • Fluracil
  • Fluracilum
  • Fluri
  • Fluril
  • Fluro Uracil
  • Flurouracil
  • Ftoruracil
  • Kecimeton
  • Phthoruracil
  • Phtoruracil
  • Queroplex
  • Timazin
  • URF
  • Ulup
Brand Mixture Names

PharmGKB Accession Id





A pyrimidine analog that is an antineoplastic antimetabolite. It interferes with DNA synthesis by blocking the thymidylate synthetase conversion of deoxyuridylic acid to thymidylic acid.

Source: Drug Bank


For the topical treatment of multiple actinic or solar keratoses. In the 5% strength it is also useful in the treatment of superficial basal cell carcinomas when conventional methods are impractical, such as with multiple lesions or difficult treatment sites. Fluorouracil injection is indicated in the palliative management of some types of cancer, including colon, esophageal, gastric, rectum, breast, biliary tract, stomach, head and neck, cervical, pancreas, renal cell, and carcinoid.

Source: Drug Bank

Other Vocabularies

Information pulled from DrugBank has not been reviewed by PharmGKB.

Pharmacology, Interactions, and Contraindications

Mechanism of Action

The precise mechanism of action has not been fully determined, but the main mechanism of fluorouracil is thought to be the binding of the deoxyribonucleotide of the drug (FdUMP) and the folate cofactor, N5-10-methylenetetrahydrofolate, to thymidylate synthase (TS) to form a covalently bound ternary complex. This results in the inhibition of the formation of thymidylate from uracil, which leads to the inhibition of DNA and RNA synthesis and cell death. Fluorouracil can also be incorporated into RNA in place of uridine triphosphate (UTP), producing a fraudulent RNA and interfering with RNA processing and protein synthesis.

Source: Drug Bank


Fluorouracil is an antineoplastic anti-metabolite. Anti-metabolites masquerade as purine or pyrimidine - which become the building blocks of DNA. They prevent these substances from becoming incorporated into DNA during the "S" phase (of the cell cycle), stopping normal development and division. Fluorouracil blocks an enzyme which converts the cytosine nucleotide into the deoxy derivative. In addition, DNA synthesis is further inhibited because Fluorouracil blocks the incorporation of the thymidine nucleotide into the DNA strand.

Source: Drug Bank

Food Interaction

Vitamin B1 needs increased with long term use.

Source: Drug Bank

Absorption, Distribution, Metabolism, Elimination & Toxicity



Source: Drug Bank

Protein Binding


Source: Drug Bank



Source: Drug Bank


10-20 minutes

Source: Drug Bank


LD 50=230mg/kg (orally in mice)

Source: Drug Bank

Route of Elimination

Seven percent to 20% of the parent drug is excreted unchanged in the urine in 6 hours; of this over 90% is excreted in the first hour.
The remaining percentage of the administered dose is metabolized, primarily in the liver.

Source: Drug Bank

Chemical Properties

Chemical Formula


Source: Drug Bank

Isomeric SMILES


Source: OpenEye

Canonical SMILES


Source: Drug Bank

Average Molecular Weight


Source: Drug Bank

Monoisotopic Molecular Weight


Source: Drug Bank



Source: Drug Bank

InChI String


Source: Drug Bank

PharmGKB Curated Pathways

Pathways created internally by PharmGKB based primarily on literature evidence.

  1. Fluoropyrimidine Pathway, Pharmacodynamics
    Model non-tissue-specific cancer cell displaying genes which may be involved in the pharmacodynamics of the fluoropyrimidines, 5-fluorouracil (5-FU), capecitabine and tegafur.
  1. Fluoropyrimidine Pathway, Pharmacokinetics
    Representation of the metabolic pathways for fluoropyrimidines.

External Pathways

Links to non-PharmGKB pathways.

PharmGKB contains no links to external pathways for this drug. To report a pathway, click here.

Genes that are associated with this drug in PharmGKB's database based on (1) variant annotations, (2) literature review, (3) pathways or (4) information automatically retrieved from DrugBank, depending on the "evidence" and "source" listed below.

Curated Information ?

No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available PW
No Dosing Guideline available No Drug Label available CA VA No VIP available PW
No Dosing Guideline available No Drug Label available CA VA No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available PW
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available

Drug Targets

Gene Description
TYMS (source: Drug Bank)

Curated Information ?

No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available PW

Drug Interactions

Interaction Description
cimetidine - fluorouracil Increases the effect of and toxicity of fluorouacil (source: Drug Bank)
cimetidine - fluorouracil Increases the effect of and toxicity of fluorouacil (source: Drug Bank)
fluorouracil - acenocoumarol The antineoplasic agent increases the anticoagulant effect (source: Drug Bank)
fluorouracil - acenocoumarol The antineoplasic agent, fluorouracil, may increase the anticoagulant effect of acenocoumarol. (source: Drug Bank)
fluorouracil - anisindione The antineoplasic agent, fluorouracil, may increase the anticoagulant effect of anisindione. (source: Drug Bank)
fluorouracil - cimetidine Cimetidine increases the effect and toxicity of fluorouracil (source: Drug Bank)
fluorouracil - cimetidine Cimetidine increases the effect and toxicity of fluorouracil (source: Drug Bank)
fluorouracil - dicumarol The antineoplasic agent increases the anticoagulant effect (source: Drug Bank)
fluorouracil - dicumarol The antineoplasic agent, fluorouracil, may increase the anticoagulant effect of dicumarol. (source: Drug Bank)
fluorouracil - ethotoin Fluorouracil increases the effect of hydantoin (source: Drug Bank)
fluorouracil - fosphenytoin Fluorouracil increases the effect of hydantoin (source: Drug Bank)
fluorouracil - mephenytoin Fluorouracil increases the effect of hydantoin (source: Drug Bank)
fluorouracil - mephenytoin Fluorouracil increases the effect of hydantoin (source: Drug Bank)
fluorouracil - metronidazole Risk of 5-FU toxicity when associated with metronidazole (source: Drug Bank)
fluorouracil - metronidazole Risk of 5-FU toxicity when associated with metronidazole (source: Drug Bank)
fluorouracil - phenytoin Fluorouracil increases the effect of hydantoin (source: Drug Bank)
fluorouracil - phenytoin Fluorouracil increases the effect of hydantoin (source: Drug Bank)
fluorouracil - warfarin The antineoplasic agent increases the anticoagulant effect (source: Drug Bank)
fluorouracil - warfarin The antineoplasic agent, fluorouracil, may increase the anticoagulant effect of warfarin. (source: Drug Bank)
fosphenytoin - fluorouracil Fluorouracil increases the effect of hydantoin (source: Drug Bank)
metronidazole - fluorouracil Risk of 5-FU toxicity when associated with metronidazole (source: Drug Bank)
metronidazole - fluorouracil Risk of 5-FU toxicity when associated with metronidazole (source: Drug Bank)
phenytoin - fluorouracil Fluorouracil increases the effect of hydantoin (source: Drug Bank)
phenytoin - fluorouracil Fluorouracil increases the effect of hydantoin (source: Drug Bank)
tamoxifen - fluorouracil Fluorouracil may reduce clearance rate of Tamoxifen. Monitor for changes in therapeutic/adverse effects of Tamoxifen if Fluorouracil is initiated, discontinued or dose changed. (source: Drug Bank)
tamoxifen - fluorouracil Fluorouracil may reduce clearance rate of Tamoxifen. Monitor for changes in therapeutic/adverse effects of Tamoxifen if Fluorouracil is initiated, discontinued or dose changed. (source: Drug Bank)
tolbutamide - fluorouracil Fluorouracil, a strong CYP2C9 inhibitor, may decrease the metabolism and clearance of Tolbutamide, a CYP2C9 substrate. Consider alternate therapy or monitor for changes in Tolbutamide therapeutic and adverse effects if Fluorouracil is initiated, discontinued or dose changed. (source: Drug Bank)
tolbutamide - fluorouracil Fluorouracil, a strong CYP2C9 inhibitor, may decrease the metabolism and clearance of Tolbutamide, a CYP2C9 substrate. Consider alternate therapy or monitor for changes in Tolbutamide therapeutic and adverse effects if Fluorouracil is initiated, discontinued or dose changed. (source: Drug Bank)
torasemide - fluorouracil Fluorouracil, a strong CYP2C9 inhibitor, may increase the serum concentration of Torasemide, a CYP2C9 substrate, by decreasing Torasemide metabolism and clearance. Consider alternate therapy or monitor for changes in the therapeutic and adverse effects of Torasemide if Fluorouracil is initiated, discontinued or dose changed. (source: Drug Bank)
trastuzumab - fluorouracil Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank)
trimethoprim - fluorouracil The strong CYP2C9 inhibitor, Fluorouracil, may decrease the metabolism and clearance of Trimethoprim, a CYP2C9 substrate. Consider alternate therapy or monitor for changes in therapeutic and adverse effects of Trimethoprim if Fluorouracil is initiated, discontinued or dose changed. (source: Drug Bank)
voriconazole - fluorouracil Fluorouracil, a strong CYP2C9 inhibitor, may increase the serum concentration of voriconazole by decreasing its metabolism. Monitor for changes in the therapeutic and adverse effects of voriconazole if fluorouracil is initiated, discontinued or dose changed. (source: Drug Bank)
warfarin - fluorouracil Fluorouracil, a strong CYP2C9 inhibitor, may decrease the metabolism of warfarin. Consider alternate therapy or monitor for changes in the therapeutic and adverse effects of warfarin if fluorouracil is initiated, discontinued or dose changed. (source: Drug Bank)
zafirlukast - fluorouracil Fluorouracil, a strong CYP2C9 inhibitor, may decrease the metabolism and clearance of zafirlukast. Consider alternate therapy or monitor for changes in zafirlukast therapeutic and adverse effects if fluorouracil is initiated, discontinued or dose changed. (source: Drug Bank)

Curated Information ?

No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
5-fluorouracil associated toxicity
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Alzheimer Disease
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Arrhythmias, Cardiac
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Arthritis, Rheumatoid
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Atrial Fibrillation
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Attention Deficit Disorder with Hyperactivity
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Bipolar Disorder
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Breast Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
cancer or viral infections
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Carcinoma, Hepatocellular
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Carcinoma, Non-Small-Cell Lung
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Carcinoma, Renal Cell
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Colonic Neoplasms
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Colorectal Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
contralateral breast cancer
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Crohn Disease
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Diabetes Mellitus, Type 2
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Disease Progression
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Drug Resistance
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Drug Toxicity
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
epithelial cancers
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Esophageal Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Esophogeal Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
event-free survival
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
gastroesophageal cancer
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Gastrointestinal Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gastrointestinal Stromal Tumors
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
hand-foot syndrome
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Head and Neck Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Heart Failure
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HIV Infections
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Hypereosinophilic Syndrome
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Hyperlipoproteinemia Type II
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Inflammatory Bowel Diseases
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Kidney Neoplasms
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukemia, Lymphocytic, Chronic, B-Cell
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukemia, Myelogenous, Chronic, BCR-ABL Positive
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukemia, Myeloid, Acute
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukemia, Nonlymphocytic, Acute
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leukemia, Promyelocytic, Acute
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Lung Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Lymphoma, Non-Hodgkin
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
No Dosing Guideline available DL No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Mental Retardation
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Metabolic Diseases
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Metabolism, Inborn Errors
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Myelodysplastic Syndromes
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Neoplasm Metastasis
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Neurotoxicity Syndromes
No Dosing Guideline available DL CA VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
neutropenic sepsis
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Ocular Hypertension
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Ovarian Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
overall survival
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pancreatic Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Peripheral Nervous System Diseases
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Precursor Cell Lymphoblastic Leukemia-Lymphoma
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
progression-free survival
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pulmonary Disease, Chronic Obstructive
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pulmonary Fibrosis
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Purine-Pyrimidine Metabolism, Inborn Errors
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Rectal Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Sjogren's Syndrome
No Dosing Guideline available DL CA VA No VIP available No VIP available
Stomach Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Toxic liver disease
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Tuberculosis, Pulmonary
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Tumor Lysis Syndrome
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Unspecified conjunctivitis
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Urinary Incontinence
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Uterine Cervical Neoplasms
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available

Relationships from National Drug File - Reference Terminology (NDF-RT)

May Treat
Contraindicated With

Publications related to fluorouracil: 320

No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The impact of ABCC11 polymorphisms on the risk of early-onset fluoropyrimidine toxicity. The pharmacogenomics journal. 2016. Hamzic S, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic characterization of naturally occurring germline NT5C1A variants to chemotherapeutic nucleoside analogs. Pharmacogenetics and genomics. 2016. Saliba Jason, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Fluoropyrimidine and platinum toxicity pharmacogenetics: an umbrella review of systematic reviews and meta-analyses. Pharmacogenomics. 2016. Campbell Jared M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
DPYD gene polymorphisms are associated with risk and chemotherapy prognosis in pediatric patients with acute lymphoblastic leukemia. Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine. 2016. Zhao Xiao-Qiang, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Phenotypic and clinical implications of variants in the dihydropyrimidine dehydrogenase gene. Biochimica et biophysica acta. 2016. Kuilenburg André B P van, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Increased risk of severe fluoropyrimidine-associated toxicity in patients carrying a G to C substitution in the first 28-bp tandem repeat of the thymidylate synthase 2R allele. International journal of cancer. Journal international du cancer. 2016. Meulendijks Didier, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
DPYD Genotyping to Predict Adverse Events Following Treatment With Flourouracil-Based Adjuvant Chemotherapy in Patients With Stage III Colon Cancer: A Secondary Analysis of the PETACC-8 Randomized Clinical Trial. JAMA oncology. 2016. Boige Valérie, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Clinical validity of a DPYD-based pharmacogenetic test to predict severe toxicity to fluoropyrimidines. International journal of cancer. Journal international du cancer. 2015. Toffoli Giuseppe, et al.