Chemical: Drug

Available Prescribing Info

Dosing Guidelines
  1. Annotation of CPIC Guideline for fluorouracil and DPYD
  2. Annotation of DPWG Guideline for fluorouracil and DPYD
last updated 03/16/2017

1. Annotation of CPIC Guideline for fluorouracil and DPYD


The CPIC Dosing Guidelines for fluoropyrimidines (i.e. 5-fluorouracil, capecitabine or tegafur) recommends an alternative drug for patients who are homozygous for DPYD non-functional variants - *2A (rs3918290), *13 (rs55886062), and rs67376798 A (on the positive chromosomal strand) - as these patients are typically DPD deficient. Consider a 50% reduction in starting dose for heterozygous patients (intermediate activity).


This annotation is based on the CPIC® guideline for fluoropyrimidines and DPYD.

May 2014 Update on PharmGKB

December 2013 Publication

Accepted article preview online August 2013; Advance online publication October 2013.

  • Guidelines regarding the use of pharmacogenomic tests in dosing for fluoropyrimidines have been published in Clinical Pharmacology and Therapeutics by the Clinical Pharmacogenetics Implementation Consortium (CPIC).
  • These guidelines are applicable to:
    • at the time of this writing, there are no data available on the possible role of DPYD*2A, *13, or rs67376798 in 5-fluorouracil toxicities in pediatric patient populations; however, there is no reason to suspect that DPYD variant alleles would affect 5-fluorouracil metabolism differently in children compared to adults.
  • Excerpt from the fluoropyrimidine dosing guideline based on DPYD genotype:
    • "The strength of the dosing recommendations is based on the fact that some variants (DPYD*2A, *13, and rs67376798) clearly affect DPD activity, and DPD activity is clearly related to 5-fluorouracil clearance, and 5-fluorouracil exposure is associated with its toxic effects. Therefore, reduction of fluoropyrimidine dosage in patients with these variants may prevent severe and possibly life-threatening toxicities. However, available evidence does not clearly indicate a degree of dose reduction needed to prevent fluoropyrimidine related toxicities...[Based on literature review (see full manuscript),] our recommendation is to start with at least a 50% reduction of the starting dose followed by an increase in dose in patients experiencing no or clinically tolerable toxicity to maintain efficacy, a decrease in dose in patients who do not tolerate the starting dose to minimize toxicities or pharmacokinetic guided dose adjustments (if available). Patients who are homozygous for DPYD*2A, *13, or rs67376798 may demonstrate complete DPD deficiency and the use of 5-fluorouracil or capecitabine is not recommended in these patients."
  • Download and read:

Adapted from Tables 1 and 2 of the 2013 guideline manuscript.

Phenotype (genotype)Examples of diplotypesImplications for phenotypic measuresDosing recommendationsClassification of recommendationsa
Homozygous wild-type or normal, high DPD activity (two or more functional *1 alleles)*1/*1Normal DPD activity and "normal" risk for fluoropyrimidine toxicityUse label-recommended dosage and administrationModerate
Heterozygous or intermediate activity (~3-5% of patients), may have partial DPD deficiency, at risk for toxicity with drug exposure (one functional allele *1, plus one nonfunctional allele - *2A, *13 or rs67376798Ac)*1/*2A; *1/*13; *1/ rs67376798Ac)Decreased DPD activity (leukocyte DPD activity at 30% to 70% that of the normal population) and increased risk for severe or even fatal drug toxicity when treated with fluoropyrimidine drugsStart with at least a 50% reduction in starting dose followed by titration of dose based on toxicity b or pharmacokinetic test (if available)Moderate
Homozygous variant, DPD deficiency (~0.2% of patients), at risk for toxicity with drug exposure (2 nonfunctional alleles - *2A, *13 or rs67376798A c)*2A/*2A; *13/*13; rs67376798Ac / rs67376798AcComplete DPD deficiency and increased risk for severe or even fatal drug toxicity when treated with fluoropyrimidine drugsSelect alternate drugStrong

a Rating scheme described in 2013 supplement.

b Increase the dose in patients experiencing no or clinically tolerable toxicity to maintain efficacy; decrease the dose in patients who do not tolerate the starting dose to minimize toxicities.

c Note that the rs67376798A allele refers to the allele on the positive chromosomal strand. This is important because DPYD is on the minus chromosomal strand and rs67376798 is a T/A snp. Therefore, the T allele on the gene confers the deficiency, while the complement on the positive chromosomal strand (A allele) is indicative of deficiency.

last updated 08/10/2011

2. Annotation of DPWG Guideline for fluorouracil and DPYD


An alternative drug rather than fluorouracil is recommended for DPYD poor metabolizer patients, and a reduced dose (by 50%) of fluorouracil or use of an alternative drug is recommended for intermediate metabolizer patients.


The Royal Dutch Pharmacists Association - Pharmacogenetics Working Group has evaluated therapeutic dose recommendations for fluorouracil based on DPYD genotype [Article:21412232]. They recommend that an alternate drug be used for poor metabolizer patients, and a reduced dose or alternate drug for intermediate metabolizer patients.

Phenotype (Genotype)Therapeutic Dose RecommendationLevel of EvidenceClinical Relevance
PM (2 inactive alleles, 2 decreased activity alleles, or one inactive and one decreased activity alleles)Select alterantive drug. Tegafur is not a suitable alternative because this drug is also metabolized by DPD.Published controlled studies of moderate quality* relating to phenotyped and/or genotyped patients or healthy volunteers, and having relevant pharmacokinetic or clinical endpoints.Clinical effect (S): death; arrhythmia; unanticipated myelosuppression.
IM (1 active allele and 1 inactive or decreased activity allele)Reduce dose by 50% or select alternative drug. Tegafur is not a suitable alternative because this drug is also a substrate for DPD. Increase dose in response to toxicity and efficacy.Published controlled studies of moderate quality* relating to phenotyped and/or genotyped patients or healthy volunteers, and having relevant pharmacokinetic or clinical endpoints.Clinical effect (S): death; arrhythmia; unanticipated myelosuppression.
Allele TypeAlleles
active*1, *4, *5, *6, *9A
decreased activity*9B, *10
inactive*2A, *3, *7, *8, *11, *12, *13, 496A>G, IVS10-15T>C, 1156G>T, 1845G>T
  • *See Methods or [Article:18253145] for definition of "moderate" quality.
  • S: statistically significant difference.

Annotated Labels

  1. Annotation of FDA Label for fluorouracil and DPYD
  2. Annotation of PMDA Label for fluorouracil and DPYD
  3. Annotation of HCSC Label for fluorouracil and DPYD

last updated 05/04/2017

1. Annotation of FDA Label for fluorouracil and DPYD

Actionable PGx


Fluorouracil is available in both a topical cream and as an injection. These two formulations have different indications. Both FDA-approved labels contain information about the potential for severe toxicity in patients with dipyrimidine dehydrogenase (DPD) deficiency. However, neither label mentions testing for genetic variants or activity of DPD.

There's more of this label. Read more.

2. Annotation of PMDA Label for fluorouracil and DPYD

Actionable PGx


The PMDA package insert for fluorouracil states that severe adverse events have occurred in patients receiving the drug who are dihydropyrimidine dehydrogenase (DPD)-deficient. DPD is the enzyme responsible for the degradation of fluorouracil and other fluoropyrimidines.

There's more of this label. Read more.

3. Annotation of HCSC Label for fluorouracil and DPYD

Actionable PGx


The product monograph for fluorouracil states that it should be used with care in patients who have a dihydropyrimidine dehydrogenase (DYPD) deficiency, due to the risk for experiencing toxicity.

There's more of this label. Read more.

Clinical Variants that meet the highest level of criteria, manually curated by PharmGKB, are shown below.

To see more Clinical Variants with lower levels of criteria, click the button at the bottom of the page.

Clinical Annotation for rs45445694 (TYMS), capecitabine, fluorouracil, Pyrimidine analogues, tegafur, Colorectal Neoplasms, Neoplasms, Pancreatic Neoplasms and Rectal Neoplasms (level 3 Efficacy, Toxicity/ADR)

Level of Evidence
Level 3
Efficacy, Toxicity/ADR
Colorectal Neoplasms, Neoplasms, Pancreatic Neoplasms, Rectal Neoplasms
OMB Race
Mixed Population
Race Notes
White, Asian, Mixed, unknown

To see the rest of this clinical annotation please register or sign in.

Disclaimer: The PharmGKB's clinical annotations reflect expert consensus based on clinical evidence and peer-reviewed literature available at the time they are written and are intended only to assist clinicians in decision-making and to identify questions for further research. New evidence may have emerged since the time an annotation was submitted to the PharmGKB. The annotations are limited in scope and are not applicable to interventions or diseases that are not specifically identified.

The annotations do not account for individual variations among patients, and cannot be considered inclusive of all proper methods of care or exclusive of other treatments. It remains the responsibility of the health-care provider to determine the best course of treatment for a patient. Adherence to any guideline is voluntary, with the ultimate determination regarding its application to be made solely by the clinician and the patient. PharmGKB assumes no responsibility for any injury or damage to persons or property arising out of or related to any use of the PharmGKB clinical annotations, or for any errors or omissions.

? = Mouse-over for quick help

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Links in the "Gene" column lead to PharmGKB Gene Pages.

List of all variant annotations for fluorouracil

Gene ? Variant?
Alternate Names ? Chemicals ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
VIP No VIP available No VIP available CYP2A6 *1B1 N/A N/A N/A
No VIP available No VIP available VA CYP3A4 *1B N/A N/A N/A
No VIP available No VIP available VA CYP3A4 *3 N/A N/A N/A
No VIP available CA VA DPYD *1 N/A N/A N/A
No VIP available No VIP available VA DPYD *2A N/A N/A N/A
No VIP available No VIP available VA DPYD *2B N/A N/A N/A
No VIP available No VIP available VA DPYD *4 N/A N/A N/A
No VIP available No VIP available VA DPYD *5 N/A N/A N/A
No VIP available No VIP available VA DPYD *6 N/A N/A N/A
No VIP available No VIP available VA DPYD *9A N/A N/A N/A
No VIP available CA No VIP available DPYD *9B N/A N/A N/A
No VIP available No VIP available VA DPYD *11 N/A N/A N/A
No VIP available CA VA DPYD *12 N/A N/A N/A
No VIP available No VIP available VA DPYD *13 N/A N/A N/A
No VIP available No VIP available VA GSTM1 non-null N/A N/A N/A
No VIP available No VIP available VA GSTM1 null N/A N/A N/A
No VIP available CA No VIP available TPMT *1 N/A N/A N/A
No VIP available No VIP available VA TPMT *2 N/A N/A N/A
No VIP available CA VA TPMT *3B N/A N/A N/A
No VIP available CA VA TPMT *3C N/A N/A N/A
No VIP available No VIP available VA UGT1A1 *1 N/A N/A N/A
No VIP available No VIP available VA UGT1A1 *6 N/A N/A N/A
No VIP available No VIP available VA UGT1A1 *28 N/A N/A N/A
No VIP available No VIP available VA UGT1A1 *93 N/A N/A N/A
No VIP available No Clinical Annotations available VA
rs10049380 NC_000003.11:g.124487443T>C, NC_000003.12:g.124768596T>C, NM_002213.4:c.2017+417A>G, XM_005247436.1:c.1927+417A>G, XM_005247436.2:c.1927+417A>G, XM_006713630.2:c.1882+417A>G, rs59662485
T > C
No VIP available No Clinical Annotations available VA
C > A
No VIP available No Clinical Annotations available VA
rs10209881 NC_000002.11:g.31246249T>C, NC_000002.12:g.31023383T>C, NM_001253826.1:c.315-57081A>G, NM_001253827.1:c.70-30376A>G, NM_024572.3:c.130-30376A>G, NR_045602.1:n.903-30376A>G, XM_005264559.1:c.25-30376A>G, XM_011533104.1:c.448-30376A>G, XM_011533105.1:c.70-30376A>G, XM_011533106.1:c.43-30376A>G, rs56517291, rs57849618, rs59539437
T > C
No VIP available CA VA
rs1042522 NC_000017.10:g.7579472G=, NC_000017.10:g.7579472G>C, NC_000017.10:g.7579472G>T, NC_000017.11:g.7676154G=, NC_000017.11:g.7676154G>C, NC_000017.11:g.7676154G>T, NG_017013.2:g.16397C=, NG_017013.2:g.16397C>A, NG_017013.2:g.16397C>G, NM_000546.5:c.215C=, NM_000546.5:c.215C>A, NM_000546.5:c.215C>G, NM_001126112.2:c.215C=, NM_001126112.2:c.215C>A, NM_001126112.2:c.215C>G, NM_001126113.2:c.215C=, NM_001126113.2:c.215C>A, NM_001126113.2:c.215C>G, NM_001126114.2:c.215C=, NM_001126114.2:c.215C>A, NM_001126114.2:c.215C>G, NM_001126115.1:c.-939C=, NM_001126115.1:c.-939C>A, NM_001126115.1:c.-939C>G, NM_001126116.1:c.-939C=, NM_001126116.1:c.-939C>A, NM_001126116.1:c.-939C>G, NM_001126117.1:c.-939C=, NM_001126117.1:c.-939C>A, NM_001126117.1:c.-939C>G, NM_001126118.1:c.98C=, NM_001126118.1:c.98C>A, NM_001126118.1:c.98C>G, NM_001276695.1:c.98C=, NM_001276695.1:c.98C>A, NM_001276695.1:c.98C>G, NM_001276696.1:c.98C=, NM_001276696.1:c.98C>A, NM_001276696.1:c.98C>G, NM_001276697.1:c.-1020C=, NM_001276697.1:c.-1020C>A, NM_001276697.1:c.-1020C>G, NM_001276698.1:c.-1020C=, NM_001276698.1:c.-1020C>A, NM_001276698.1:c.-1020C>G, NM_001276699.1:c.-1020C=, NM_001276699.1:c.-1020C>A, NM_001276699.1:c.-1020C>G, NM_001276760.1:c.98C=, NM_001276760.1:c.98C>A, NM_001276760.1:c.98C>G, NM_001276761.1:c.98C=, NM_001276761.1:c.98C>A, NM_001276761.1:c.98C>G, NP_000537.3:p.Pro72=, NP_000537.3:p.Pro72Arg, NP_000537.3:p.Pro72His, NP_001119584.1:p.Pro72=, NP_001119584.1:p.Pro72Arg, NP_001119584.1:p.Pro72His, NP_001119585.1:p.Pro72=, NP_001119585.1:p.Pro72Arg, NP_001119585.1:p.Pro72His, NP_001119586.1:p.Pro72=, NP_001119586.1:p.Pro72Arg, NP_001119586.1:p.Pro72His, NP_001119590.1:p.Pro33=, NP_001119590.1:p.Pro33Arg, NP_001119590.1:p.Pro33His, NP_001263624.1:p.Pro33=, NP_001263624.1:p.Pro33Arg, NP_001263624.1:p.Pro33His, NP_001263625.1:p.Pro33=, NP_001263625.1:p.Pro33Arg, NP_001263625.1:p.Pro33His, NP_001263689.1:p.Pro33=, NP_001263689.1:p.Pro33Arg, NP_001263689.1:p.Pro33His, NP_001263690.1:p.Pro33=, NP_001263690.1:p.Pro33Arg, NP_001263690.1:p.Pro33His, XM_005256778.1:c.176-21C=, XM_005256778.1:c.176-21C>A, XM_005256778.1:c.176-21C>G, XR_243565.1:n.354C=, XR_243565.1:n.354C>A, XR_243565.1:n.354C>G, XR_243566.1:n.354C=, XR_243566.1:n.354C>A, XR_243566.1:n.354C>G, rs17844988, rs17857747, rs17882155, rs2229076, rs3174747, rs4134781, rs60388830
G > C
No VIP available No Clinical Annotations available VA
rs10434 NC_000006.11:g.43753212A>G, NC_000006.12:g.43785475A>G, NG_008732.1:g.20260A>G, NM_001025366.2:c.*913A>G, NM_001025367.2:c.*913A>G, NM_001025368.2:c.*913A>G, NM_001025369.2:c.*929A>G, NM_001025370.2:c.*913A>G, NM_001033756.2:c.*847A>G, NM_001171622.1:c.*913A>G, NM_001171623.1:c.*913A>G, NM_001171624.1:c.*913A>G, NM_001171625.1:c.*913A>G, NM_001171626.1:c.*913A>G, NM_001171627.1:c.*929A>G, NM_001171628.1:c.*913A>G, NM_001171629.1:c.*847A>G, NM_001171630.1:c.*913A>G, NM_001204384.1:c.*913A>G, NM_001204385.1:c.*913A>G, NM_001287044.1:c.*913A>G, NM_001317010.1:c.*847A>G, NM_003376.5:c.*913A>G, XM_005249363.1:c.*913A>G, rs3173233, rs60316096
A > G
No VIP available CA VA
rs1045642 NC_000007.13:g.87138645A>G, NC_000007.14:g.87509329A>G, NG_011513.1:g.208920T>C, NM_000927.4:c.3435T>C, NP_000918.2:p.Ile1145=, rs10239679, rs11568726, rs117328163, rs17210003, rs2229108, rs386513066, rs60023214, rs9690664
A > G
No VIP available CA VA
rs1047840 NC_000001.10:g.242042301G>A, NC_000001.11:g.241878999G>A, NG_029100.1:g.35809G>A, NM_001319224.1:c.1762G>A, NM_003686.4:c.1765G>A, NM_006027.4:c.1765G>A, NM_130398.3:c.1765G>A, NP_001306153.1:p.Glu588Lys, NP_003677.4:p.Glu589Lys, NP_006018.4:p.Glu589Lys, NP_569082.2:p.Glu589Lys, XM_005273350.1:c.1762G>A, XM_005273350.2:c.1762G>A, XM_006711840.1:c.1765G>A, XM_011544321.1:c.1765G>A, XM_011544322.1:c.1765G>A, XM_011544323.1:c.1762G>A, XM_011544324.1:c.1645G>A, XM_011544325.1:c.802G>A, XM_011544326.1:c.*224G>A, XP_005273407.1:p.Glu588Lys, XP_006711903.1:p.Glu589Lys, XP_011542623.1:p.Glu589Lys, XP_011542624.1:p.Glu589Lys, XP_011542625.1:p.Glu588Lys, XP_011542626.1:p.Glu549Lys, XP_011542627.1:p.Glu268Lys, XR_949162.1:n.2350G>A, rs12734501, rs16842258, rs3187846, rs52829990, rs56561721, rs59734256
G > A
No VIP available No Clinical Annotations available VA
rs1051266 NC_000021.8:g.46957794T>C, NC_000021.9:g.45537880T>C, NG_028278.1:g.9592A>G, NM_001205206.1:c.80A>G, NM_194255.2:c.80A>G, NP_001192135.1:p.His27Arg, NP_919231.1:p.His27Arg, XM_005261163.1:c.80A>G, XM_005261164.1:c.-279A>G, XM_005261164.2:c.-279A>G, XM_011529696.1:c.371A>G, XM_011529697.1:c.371A>G, XM_011529698.1:c.146A>G, XM_011529699.1:c.-1639A>G, XM_011529700.1:c.80A>G, XM_011529701.1:c.80A>G, XM_011529702.1:c.80A>G, XM_011529703.1:c.80A>G, XM_011529704.1:c.80A>G, XM_011529705.1:c.371A>G, XM_011529707.1:c.371A>G, XM_011529708.1:c.80A>G, XM_011529709.1:c.-279A>G, XM_011529710.1:c.-165-5732A>G, XP_005261220.1:p.His27Arg, XP_011527998.1:p.His124Arg, XP_011527999.1:p.His124Arg, XP_011528000.1:p.His49Arg, XP_011528002.1:p.His27Arg, XP_011528003.1:p.His27Arg, XP_011528004.1:p.His27Arg, XP_011528005.1:p.His27Arg, XP_011528006.1:p.His27Arg, XP_011528007.1:p.His124Arg, XP_011528009.1:p.His124Arg, XP_011528010.1:p.His27Arg, rs17844977, rs17857726, rs3171496, rs386514057, rs61510559
T > C
No VIP available No Clinical Annotations available VA
rs10517 NC_000016.10:g.69709857A>G, NC_000016.9:g.69743760A>G, NG_011504.1:g.21774T>C, NM_000903.2:c.*1119T>C, NM_001025433.1:c.*1119T>C, NM_001025434.1:c.*1119T>C, NM_001286137.1:c.*1119T>C, XM_005255830.1:c.*1119T>C, rs1131357, rs3191227, rs386514164, rs60683463
A > G
No VIP available CA VA
rs1056515 NC_000001.10:g.163113260G>T, NC_000001.11:g.163143470G>T, NG_027731.2:g.183322C>A, NM_001195303.2:c.*3872C>A, NM_001254748.1:c.*3872C>A, NM_001254749.1:c.*3872C>A, NM_003617.3:c.*3872C>A, rs111183181, rs386514407, rs58775087, rs59069797
G > T
No VIP available CA VA
rs1056836 NC_000002.11:g.38298203C>G, NC_000002.12:g.38071060G=, NG_008386.2:g.10042C=, NG_008386.2:g.10042C>G, NM_000104.3:c.1294C=, NM_000104.3:c.1294C>G, NP_000095.2:p.Leu432=, NP_000095.2:p.Leu432Val, rs17405323, rs3731848, rs52802961, rs59494749
C > G
No VIP available No Clinical Annotations available VA
rs1059829 NC_000005.10:g.151662468G>A, NC_000005.9:g.151042029G>A, NG_042174.1:g.29587C>T, NM_001309443.1:c.*1103C>T, NM_001309444.1:c.*987C>T, NM_003118.3:c.*1103C>T, rs17718221, rs1804457, rs3210713, rs3822701, rs59831535
G > A
No VIP available No Clinical Annotations available VA
rs1063320 NC_000006.11:g.29798749C=, NC_000006.11:g.29798749C>G, NC_000006.12:g.29830972C=, NC_000006.12:g.29830972C>G, NG_029039.1:g.8994C=, NG_029039.1:g.8994C>G, NM_002127.5:c.*233C=, NM_002127.5:c.*233C>G, NT_113891.3:g.1314548G=, NT_113891.3:g.1314548G>C, NT_167244.2:g.1096598G=, NT_167244.2:g.1096598G>C, NT_167245.1:g.1099370C=, NT_167245.1:g.1099370C>G, NT_167245.2:g.1093785C=, NT_167245.2:g.1093785C>G, NT_167246.1:g.1099078C=, NT_167246.1:g.1099078C>G, NT_167246.2:g.1093458C=, NT_167246.2:g.1093458C>G, NT_167247.1:g.1099028C=, NT_167247.1:g.1099028C>G, NT_167247.2:g.1093443C=, NT_167247.2:g.1093443C>G, NT_167248.2:g.1093752G=, NT_167248.2:g.1093752G>C, NT_167249.2:g.1137017G=, NT_167249.2:g.1137017G>C, XM_005249055.1:c.*233C=, XM_005249055.1:c.*233C>G, XM_005249056.1:c.*233C>G, XM_005249056.1:c.*233G>C, XM_005249057.1:c.*448C>G, XM_005249057.1:c.*448G>C, XM_005249058.1:c.*233C=, XM_005249058.1:c.*233C>G, XM_005272810.1:c.*247G=, XM_005272810.1:c.*247G>C, XM_005274964.1:c.*233C=, XM_005274964.1:c.*233C>G, XM_005274965.1:c.*233C=, XM_005274965.1:c.*233C>G, XM_005274966.1:c.*448C>G, XM_005274966.1:c.*448G>C, XM_005274967.1:c.*233C=, XM_005274967.1:c.*233C>G, XM_005275119.1:c.*233C=, XM_005275119.1:c.*233C>G, XM_005275120.1:c.*233C>G, XM_005275120.1:c.*233G>C, XM_005275121.1:c.*448C>G, XM_005275121.1:c.*448G>C, XM_005275122.1:c.*233C>G, XM_005275122.1:c.*233G>C, XM_005275246.1:c.*233C=, XM_005275246.1:c.*233C>G, XM_005275247.1:c.*233C=, XM_005275247.1:c.*233C>G, XM_005275248.1:c.*448C>G, XM_005275248.1:c.*448G>C, XM_005275249.1:c.*233C=, XM_005275249.1:c.*233C>G, XM_005275394.1:c.*247G=, XM_005275394.1:c.*247G>C, XM_005275549.1:c.*247G=, XM_005275549.1:c.*247G>C, XM_005275550.1:c.*247C>G, XM_005275550.1:c.*247G>C, XM_005275551.1:c.*462C>G, XM_005275551.1:c.*462G>C, XM_005275552.1:c.*247G=, XM_005275552.1:c.*247G>C, XM_011547651.1:c.*233C=, XM_011547651.1:c.*233C>G, XM_011547882.1:c.*233C=, XM_011547882.1:c.*233C>G, XM_011548048.1:c.*233C=, XM_011548048.1:c.*233C>G, XM_011548236.1:c.*247G=, XM_011548236.1:c.*247G>C, XM_011548237.1:c.*247G=, XM_011548237.1:c.*247G>C, XM_011548430.1:c.*247G=, XM_011548430.1:c.*247G>C, XM_011548431.1:c.*247G=, XM_011548431.1:c.*247G>C, XR_241896.1:n.1859C=, XR_241896.1:n.1859C>G, XR_246963.1:n.1793G=, XR_246963.1:n.1793G>C, XR_247353.1:n.1859C=, XR_247353.1:n.1859C>G, XR_247370.1:n.1859C=, XR_247370.1:n.1859C>G, XR_247389.1:n.1859C=, XR_247389.1:n.1859C>G, XR_247402.1:n.1793G=, XR_247402.1:n.1793G>C, XR_247423.1:n.1851G=, XR_247423.1:n.1851G>C, rs115928989, rs117512550, rs1632929, rs16867727, rs17185496, rs3204385, rs386485817, rs58677621, rs9258500
C > C
C > G
No VIP available No Clinical Annotations available VA
rs10784749 NC_000012.11:g.69422029C>G, NC_000012.12:g.69028249C>G, rs58473609
C > G
No VIP available No Clinical Annotations available VA
rs10876844 NC_000012.11:g.56050706C>A, NC_000012.12:g.55656922C>A, XM_011538339.1:c.-700+2791G>T, rs61345690
C > A
No VIP available CA VA
rs10937158 NC_000003.11:g.183708439T>C, NC_000003.12:g.183990651T>C, NM_001023587.2:c.130-1268A>G, NM_001320032.1:c.-1402-1268A>G, NM_005688.3:c.130-1268A>G, NR_135125.1:n.316-1268A>G, XM_005247058.1:c.130-1268A>G, XM_005247058.3:c.130-1268A>G, XM_005247059.1:c.130-1268A>G, XM_005247059.3:c.130-1268A>G, XM_005247060.1:c.130-1268A>G, XM_005247061.1:c.130-1268A>G, XM_005247062.1:c.-1402-1268A>G, XM_011512314.1:c.130-1268A>G, XM_011512315.1:c.130-1268A>G, XM_011512316.1:c.-1402-1268A>G
T > C
No VIP available No Clinical Annotations available VA
rs111858276 NC_000001.10:g.98015156T>C, NC_000001.11:g.97549600T>C, NG_008807.2:g.376460A>G, NM_000110.3:c.1484A>G, NP_000101.2:p.Asp495Gly, XM_005270561.1:c.1373A>G, XM_005270562.1:c.1484A>G, XM_005270562.3:c.1484A>G, XM_005270563.1:c.1484A>G, XM_005270564.1:c.1484A>G, XM_006710397.2:c.1484A>G, XP_005270618.1:p.Asp458Gly, XP_005270619.1:p.Asp495Gly, XP_005270619.2:p.Asp495Gly, XP_005270620.1:p.Asp495Gly, XP_005270621.1:p.Asp495Gly, XP_006710460.1:p.Asp495Gly
T > C
No VIP available No Clinical Annotations available VA
rs112445441 NC_000012.11:g.25398281C>A, NC_000012.11:g.25398281C>G, NC_000012.11:g.25398281C>T, NC_000012.12:g.25245347C>A, NC_000012.12:g.25245347C>G, NC_000012.12:g.25245347C>T, NG_007524.1:g.10574G>A, NG_007524.1:g.10574G>C, NG_007524.1:g.10574G>T, NM_004985.4:c.38G>A, NM_004985.4:c.38G>C, NM_004985.4:c.38G>T, NM_033360.3:c.38G>A, NM_033360.3:c.38G>C, NM_033360.3:c.38G>T, NP_004976.2:p.Gly13Ala, NP_004976.2:p.Gly13Asp, NP_004976.2:p.Gly13Val, NP_203524.1:p.Gly13Ala, NP_203524.1:p.Gly13Asp, NP_203524.1:p.Gly13Val, XM_005253365.1:c.38G>A, XM_005253365.1:c.38G>C, XM_005253365.1:c.38G>T, XM_006719069.2:c.38G>A, XM_006719069.2:c.38G>C, XM_006719069.2:c.38G>T, XM_011520653.1:c.38G>A, XM_011520653.1:c.38G>C, XM_011520653.1:c.38G>T, XP_005253422.1:p.Gly13Ala, XP_005253422.1:p.Gly13Asp, XP_005253422.1:p.Gly13Val, XP_006719132.1:p.Gly13Ala, XP_006719132.1:p.Gly13Asp, XP_006719132.1:p.Gly13Val, XP_011518955.1:p.Gly13Ala, XP_011518955.1:p.Gly13Asp, XP_011518955.1:p.Gly13Val
C > A
C > G
C > T
No VIP available No Clinical Annotations available VA
rs112723255 NC_000022.10:g.50964255C>T, NC_000022.11:g.50525826C>T, NG_011860.1:g.9260G>A, NG_016235.1:g.5614G>A, NG_021419.1:g.22611C>T, NM_001113755.2:c.1393G>A, NM_001113756.2:c.1393G>A, NM_001169109.1:c.-14+420G>A, NM_001169110.1:c.-14+175G>A, NM_001169111.1:c.-398G>A, NM_001257988.1:c.1393G>A, NM_001257989.1:c.1408G>A, NM_001953.4:c.1393G>A, NM_005138.2:c.-368G>A, NP_001107227.1:p.Ala465Thr, NP_001107228.1:p.Ala465Thr, NP_001244917.1:p.Ala465Thr, NP_001244918.1:p.Ala470Thr, NP_001944.1:p.Ala465Thr
C > T
No VIP available No Clinical Annotations available VA
rs1127648 NC_000015.10:g.75674754A>G, NC_000015.9:g.75967095A>G, NM_001897.4:c.*796T>C, rs17591523, rs3183827, rs59364090
A > G
No VIP available No Clinical Annotations available VA
rs112766203 NC_000001.10:g.97770835G>A, NC_000001.10:g.97770835G>C, NC_000001.11:g.97305279G>A, NC_000001.11:g.97305279G>C, NG_008807.2:g.620781C>G, NG_008807.2:g.620781C>T, NM_000110.3:c.2279C>G, NM_000110.3:c.2279C>T, NP_000101.2:p.Thr760Ile, NP_000101.2:p.Thr760Ser, NR_046590.1:n.129-910G>A, NR_046590.1:n.129-910G>C, XM_005270561.1:c.2168C>G, XM_005270561.1:c.2168C>T, XM_005270562.1:c.2063C>G, XM_005270562.1:c.2063C>T, XM_005270562.3:c.2063C>G, XM_005270562.3:c.2063C>T, XM_005270563.1:c.2279C>G, XM_005270563.1:c.2279C>T, XM_006710397.2:c.2279C>G, XM_006710397.2:c.2279C>T, XP_005270618.1:p.Thr723Ile, XP_005270618.1:p.Thr723Ser, XP_005270619.1:p.Thr688Ile, XP_005270619.1:p.Thr688Ser, XP_005270619.2:p.Thr688Ile, XP_005270619.2:p.Thr688Ser, XP_005270620.1:p.Thr760Ile, XP_005270620.1:p.Thr760Ser, XP_006710460.1:p.Thr760Ile, XP_006710460.1:p.Thr760Ser
G > A
G > C
No VIP available No Clinical Annotations available VA
rs1128503 NC_000007.13:g.87179601A>G, NC_000007.14:g.87550285A>G, NG_011513.1:g.167964T>C, NM_000927.4:c.1236T>C, NP_000918.2:p.Gly412=, rs116989428, rs17276907, rs2032587, rs2229105, rs28365046, rs386518005, rs58257317
A > G
No VIP available No Clinical Annotations available VA
rs1138272 NC_000011.10:g.67586108C>T, NC_000011.9:g.67353579C>T, NG_012075.1:g.7514C>T, NM_000852.3:c.341C>T, NP_000843.1:p.Ala114Val, XM_005273958.1:c.338C>T, XP_005274015.1:p.Ala113Val, rs11553894, rs17434783, rs1799811, rs1804665, rs3202011, rs4134657, rs52800258, rs61323549
C > T
No VIP available No Clinical Annotations available VA
rs114096998 NC_000001.10:g.97544543G>A, NC_000001.10:g.97544543G>C, NC_000001.10:g.97544543G>T, NC_000001.11:g.97078987G>A, NC_000001.11:g.97078987G>C, NC_000001.11:g.97078987G>T, NG_008807.2:g.847073C>A, NG_008807.2:g.847073C>G, NG_008807.2:g.847073C>T, NM_000110.3:c.3067C>A, NM_000110.3:c.3067C>G, NM_000110.3:c.3067C>T, NP_000101.2:p.Pro1023Ala, NP_000101.2:p.Pro1023Ser, NP_000101.2:p.Pro1023Thr, XM_005270561.1:c.2956C>A, XM_005270561.1:c.2956C>G, XM_005270561.1:c.2956C>T, XM_005270562.1:c.2851C>A, XM_005270562.1:c.2851C>G, XM_005270562.1:c.2851C>T, XM_005270562.3:c.2851C>A, XM_005270562.3:c.2851C>G, XM_005270562.3:c.2851C>T, XP_005270618.1:p.Pro986Ala, XP_005270618.1:p.Pro986Ser, XP_005270618.1:p.Pro986Thr, XP_005270619.1:p.Pro951Ala, XP_005270619.1:p.Pro951Ser, XP_005270619.1:p.Pro951Thr, XP_005270619.2:p.Pro951Ala, XP_005270619.2:p.Pro951Ser, XP_005270619.2:p.Pro951Thr, rs199469566
G > A
G > C
G > T
No VIP available CA VA
rs11479 NC_000022.10:g.50964236G>A, NC_000022.11:g.50525807G>A, NG_011860.1:g.9279C>T, NG_016235.1:g.5633C>T, NG_021419.1:g.22592G>A, NM_001113755.2:c.1412C>T, NM_001113756.2:c.1412C>T, NM_001169109.1:c.-14+439C>T, NM_001169110.1:c.-14+194C>T, NM_001169111.1:c.-379C>T, NM_001257988.1:c.1412C>T, NM_001257989.1:c.1427C>T, NM_001953.4:c.1412C>T, NM_005138.2:c.-349C>T, NP_001107227.1:p.Ser471Leu, NP_001107228.1:p.Ser471Leu, NP_001244917.1:p.Ser471Leu, NP_001244918.1:p.Ser476Leu, NP_001944.1:p.Ser471Leu, rs17846490, rs17859554, rs3202233, rs3829983
G > A
No VIP available CA VA
rs115232898 NC_000001.10:g.98165030T>C, NC_000001.11:g.97699474T>C, NG_008807.2:g.226586A>G, NM_000110.3:c.557A>G, NP_000101.2:p.Tyr186Cys, XM_005270561.1:c.446A>G, XM_005270562.1:c.557A>G, XM_005270562.3:c.557A>G, XM_005270563.1:c.557A>G, XM_005270564.1:c.557A>G, XM_006710397.2:c.557A>G, XP_005270618.1:p.Tyr149Cys, XP_005270619.1:p.Tyr186Cys, XP_005270619.2:p.Tyr186Cys, XP_005270620.1:p.Tyr186Cys, XP_005270621.1:p.Tyr186Cys, XP_006710460.1:p.Tyr186Cys, rs199469520
T > C
No VIP available No Clinical Annotations available VA
A > C
A > G
No VIP available CA VA
rs115632870 NC_000001.10:g.98293821C>T, NC_000001.11:g.97828265C>T, NG_008807.2:g.97795G>A, NM_000110.3:c.151-69G>A, NM_001160301.1:c.151-69G>A, XM_005270561.1:c.40-69G>A, XM_005270562.1:c.151-69G>A, XM_005270562.3:c.151-69G>A, XM_005270563.1:c.151-69G>A, XM_005270564.1:c.151-69G>A, XM_006710397.2:c.151-69G>A, rs199469511
C > T
No VIP available CA VA
rs11615 NC_000019.10:g.45420395A>G, NC_000019.9:g.45923653A>G, NG_015839.2:g.63434T>C, NM_001166049.1:c.354T>C, NM_001983.3:c.354T>C, NM_202001.2:c.354T>C, NP_001159521.1:p.Asn118=, NP_001974.1:p.Asn118=, NP_973730.1:p.Asn118=, XM_005258634.1:c.354T>C, XM_005258635.1:c.354T>C, XM_005258635.2:c.354T>C, XM_005258636.1:c.354T>C, XM_005258636.3:c.354T>C, XM_005258637.1:c.354T>C, XM_005258638.1:c.138T>C, XM_011526610.1:c.354T>C, XP_005258691.1:p.Asn118=, XP_005258692.1:p.Asn118=, XP_005258693.1:p.Asn118=, XP_005258694.1:p.Asn118=, XP_005258695.1:p.Asn46=, XP_011524912.1:p.Asn118=, rs1130005, rs17285882, rs17359303, rs17845191, rs17858003, rs17859564, rs2228629, rs3177700, rs3188446, rs3752251, rs59923575
A > G
No VIP available CA VA
T > C
No VIP available No Clinical Annotations available VA
rs11671784 NC_000019.10:g.13836482G>A, NC_000019.9:g.13947296G>A, NR_029495.1:n.178C>T, NR_029497.1:n.-123C>T, NR_029501.1:n.36C>T, NR_036515.1:n.-193C>T
G > A
No VIP available CA VA
A > G
No VIP available No Clinical Annotations available VA
T > G
No VIP available No Clinical Annotations available VA
T > A
T > C
No VIP available CA VA
rs12613732 NC_000002.11:g.31249427T>G, NC_000002.12:g.31026561T>G, NM_001253826.1:c.315-60259A>C, NM_001253827.1:c.70-33554A>C, NM_024572.3:c.130-33554A>C, NR_045602.1:n.903-33554A>C, XM_005264559.1:c.25-33554A>C, XM_011533104.1:c.448-33554A>C, XM_011533105.1:c.70-33554A>C, XM_011533106.1:c.43-33554A>C, rs17393634, rs56739826, rs58514179
T > G
No VIP available CA VA
rs12659 NC_000021.8:g.46951556A>G, NC_000021.9:g.45531642A>G, NG_028278.1:g.15830T>C, NM_001205206.1:c.696T>C, NM_001205207.1:c.576T>C, NM_194255.2:c.696T>C, NP_001192135.1:p.Pro232=, NP_001192136.1:p.Pro192=, NP_919231.1:p.Pro232=, XM_005261163.1:c.696T>C, XM_005261164.1:c.342T>C, XM_005261164.2:c.342T>C, XM_011529696.1:c.987T>C, XM_011529697.1:c.987T>C, XM_011529698.1:c.762T>C, XM_011529699.1:c.723T>C, XM_011529700.1:c.696T>C, XM_011529701.1:c.696T>C, XM_011529702.1:c.696T>C, XM_011529703.1:c.696T>C, XM_011529704.1:c.696T>C, XM_011529705.1:c.987T>C, XM_011529706.1:c.558T>C, XM_011529707.1:c.987T>C, XM_011529708.1:c.696T>C, XM_011529709.1:c.342T>C, XM_011529710.1:c.342T>C, XP_005261220.1:p.Pro232=, XP_005261221.1:p.Pro114=, XP_011527998.1:p.Pro329=, XP_011527999.1:p.Pro329=, XP_011528000.1:p.Pro254=, XP_011528001.1:p.Pro241=, XP_011528002.1:p.Pro232=, XP_011528003.1:p.Pro232=, XP_011528004.1:p.Pro232=, XP_011528005.1:p.Pro232=, XP_011528006.1:p.Pro232=, XP_011528007.1:p.Pro329=, XP_011528008.1:p.Pro186=, XP_011528009.1:p.Pro329=, XP_011528010.1:p.Pro232=, XP_011528011.1:p.Pro114=, XP_011528012.1:p.Pro114=, rs17844976, rs17857725, rs3171495
A > G
No VIP available No Clinical Annotations available VA
rs12999804 NC_000002.11:g.31245650A>T, NC_000002.12:g.31022784A>T, NM_001253826.1:c.315-56482T>A, NM_001253827.1:c.70-29777T>A, NM_024572.3:c.130-29777T>A, NR_045602.1:n.903-29777T>A, XM_005264559.1:c.25-29777T>A, XM_011533104.1:c.448-29777T>A, XM_011533105.1:c.70-29777T>A, XM_011533106.1:c.43-29777T>A, rs58546060, rs59591816
A > T
No VIP available CA VA
rs13181 NC_000019.10:g.45351661T>G, NC_000019.9:g.45854919T>G, NG_007067.2:g.23927A>C, NM_000400.3:c.2251A>C, NM_177417.2:c.*304T>G, NP_000391.1:p.Lys751Gln, XM_005258536.1:c.*128T>G, XM_005258536.3:c.*128T>G, XM_005258537.1:c.*128T>G, XM_005258538.1:c.*304T>G, XM_005258539.1:c.*304T>G, XM_005258639.1:c.2179A>C, XM_005258640.1:c.2017A>C, XM_005258641.1:c.1513A>C, XM_011526611.1:c.2173A>C, XP_005258696.1:p.Lys727Gln, XP_005258697.1:p.Lys673Gln, XP_005258698.1:p.Lys505Gln, XP_011524913.1:p.Lys725Gln, rs1052559, rs17285142, rs17355147, rs17359310, rs3170171, rs3859422, rs60606175
T > G
No VIP available No Clinical Annotations available VA
rs137999090 NC_000001.10:g.97839154C>T, NC_000001.11:g.97373598C>T, NG_008807.2:g.552462G>A, NM_000110.3:c.2021G>A, NP_000101.2:p.Gly674Asp, XM_005270561.1:c.1910G>A, XM_005270562.1:c.1805G>A, XM_005270562.3:c.1805G>A, XM_005270563.1:c.2021G>A, XM_006710397.2:c.2021G>A, XP_005270618.1:p.Gly637Asp, XP_005270619.1:p.Gly602Asp, XP_005270619.2:p.Gly602Asp, XP_005270620.1:p.Gly674Asp, XP_006710460.1:p.Gly674Asp, XR_947619.1:n.1125-1930C>T, XR_947620.1:n.1124+6397C>T, XR_947621.1:n.1125-1930C>T
C > T
No VIP available No Clinical Annotations available VA
C > T
No VIP available No Clinical Annotations available VA
C > A
No VIP available No Clinical Annotations available VA
rs138616379 NC_000001.10:g.97915745C>T, NC_000001.11:g.97450189C>T, NG_008807.2:g.475871G>A, NM_000110.3:c.1775G>A, NP_000101.2:p.Arg592Gln, XM_005270561.1:c.1664G>A, XM_005270562.1:c.1559G>A, XM_005270562.3:c.1559G>A, XM_005270563.1:c.1775G>A, XM_006710397.2:c.1775G>A, XP_005270618.1:p.Arg555Gln, XP_005270619.1:p.Arg520Gln, XP_005270619.2:p.Arg520Gln, XP_005270620.1:p.Arg592Gln, XP_006710460.1:p.Arg592Gln
C > T
No VIP available No Clinical Annotations available VA
A > C
No VIP available No Clinical Annotations available VA
C > T
No VIP available No Clinical Annotations available VA
C > T
No VIP available No Clinical Annotations available VA
G > A
G > T
No VIP available No Clinical Annotations available VA
rs141044036 NC_000001.10:g.97547921T>C, NC_000001.11:g.97082365T>C, NG_008807.2:g.843695A>G, NM_000110.3:c.2872A>G, NP_000101.2:p.Lys958Glu, XM_005270561.1:c.2761A>G, XM_005270562.1:c.2656A>G, XM_005270562.3:c.2656A>G, XP_005270618.1:p.Lys921Glu, XP_005270619.1:p.Lys886Glu, XP_005270619.2:p.Lys886Glu
T > C
No VIP available No Clinical Annotations available VA
T > C
No VIP available No Clinical Annotations available VA
C > T
No VIP available No Clinical Annotations available VA
C > G
C > T
No VIP available No Clinical Annotations available VA
rs143154602 NC_000001.10:g.98058845G>A, NC_000001.11:g.97593289G>A, NG_008807.2:g.332771C>T, NM_000110.3:c.1057C>T, NP_000101.2:p.Arg353Cys, XM_005270561.1:c.946C>T, XM_005270562.1:c.1057C>T, XM_005270562.3:c.1057C>T, XM_005270563.1:c.1057C>T, XM_005270564.1:c.1057C>T, XM_006710397.2:c.1057C>T, XP_005270618.1:p.Arg316Cys, XP_005270619.1:p.Arg353Cys, XP_005270619.2:p.Arg353Cys, XP_005270620.1:p.Arg353Cys, XP_005270621.1:p.Arg353Cys, XP_006710460.1:p.Arg353Cys
G > A
No VIP available No Clinical Annotations available VA
C > A
C > T
No VIP available No Clinical Annotations available VA
rs143986398 NC_000001.10:g.98205995G>C, NC_000001.11:g.97740439G>C, NG_008807.2:g.185621C>G, NM_000110.3:c.274C>G, NM_001160301.1:c.274C>G, NP_000101.2:p.Pro92Ala, NP_001153773.1:p.Pro92Ala, XM_005270561.1:c.163C>G, XM_005270562.1:c.274C>G, XM_005270562.3:c.274C>G, XM_005270563.1:c.274C>G, XM_005270564.1:c.274C>G, XM_006710397.2:c.274C>G, XP_005270618.1:p.Pro55Ala, XP_005270619.1:p.Pro92Ala, XP_005270619.2:p.Pro92Ala, XP_005270620.1:p.Pro92Ala, XP_005270621.1:p.Pro92Ala, XP_006710460.1:p.Pro92Ala
G > C
No VIP available No Clinical Annotations available VA
G > C
G > T
No VIP available No Clinical Annotations available VA
G > A
No VIP available No Clinical Annotations available VA
T > C
No VIP available No Clinical Annotations available VA
C > T
No VIP available No Clinical Annotations available VA
rs145773863 NC_000001.10:g.97915743C>T, NC_000001.11:g.97450187C>T, NG_008807.2:g.475873G>A, NM_000110.3:c.1777G>A, NP_000101.2:p.Gly593Arg, XM_005270561.1:c.1666G>A, XM_005270562.1:c.1561G>A, XM_005270562.3:c.1561G>A, XM_005270563.1:c.1777G>A, XM_006710397.2:c.1777G>A, XP_005270618.1:p.Gly556Arg, XP_005270619.1:p.Gly521Arg, XP_005270619.2:p.Gly521Arg, XP_005270620.1:p.Gly593Arg, XP_006710460.1:p.Gly593Arg
C > T
No VIP available No Clinical Annotations available VA
rs146356975 NC_000001.10:g.98060705T>C, NC_000001.11:g.97595149T>C, NG_008807.2:g.330911A>G, NM_000110.3:c.868A>G, NP_000101.2:p.Lys290Glu, XM_005270561.1:c.757A>G, XM_005270562.1:c.868A>G, XM_005270562.3:c.868A>G, XM_005270563.1:c.868A>G, XM_005270564.1:c.868A>G, XM_006710397.2:c.868A>G, XP_005270618.1:p.Lys253Glu, XP_005270619.1:p.Lys290Glu, XP_005270619.2:p.Lys290Glu, XP_005270620.1:p.Lys290Glu, XP_005270621.1:p.Lys290Glu, XP_006710460.1:p.Lys290Glu
T > C
No VIP available No Clinical Annotations available VA
G > A
No VIP available No Clinical Annotations available VA
rs147545709 NC_000001.10:g.97564155G>A, NC_000001.11:g.97098599G>A, NG_008807.2:g.827461C>T, NM_000110.3:c.2656C>T, NP_000101.2:p.Arg886Cys, NR_046590.1:n.64+2613G>A, XM_005270561.1:c.2545C>T, XM_005270562.1:c.2440C>T, XM_005270562.3:c.2440C>T, XP_005270618.1:p.Arg849Cys, XP_005270619.1:p.Arg814Cys, XP_005270619.2:p.Arg814Cys
G > A
No VIP available No Clinical Annotations available VA
rs147601618 NC_000001.10:g.97915724A>G, NC_000001.11:g.97450168A>G, NG_008807.2:g.475892T>C, NM_000110.3:c.1796T>C, NP_000101.2:p.Met599Thr, XM_005270561.1:c.1685T>C, XM_005270562.1:c.1580T>C, XM_005270562.3:c.1580T>C, XM_005270563.1:c.1796T>C, XM_006710397.2:c.1796T>C, XP_005270618.1:p.Met562Thr, XP_005270619.1:p.Met527Thr, XP_005270619.2:p.Met527Thr, XP_005270620.1:p.Met599Thr, XP_006710460.1:p.Met599Thr
A > G
No VIP available No Clinical Annotations available VA
C > G
No VIP available No Clinical Annotations available VA
C > T
No VIP available No Clinical Annotations available VA
G > C
No VIP available No Clinical Annotations available VA
C > A
C > T
No VIP available No Clinical Annotations available VA
A > G
rs151264360 NC_000018.10:g.673444_673449delTTAAAG, NC_000018.9:g.673444_673449delTTAAAG, NG_028255.1:g.20841_20846delTTAAAG, NM_001071.2:c.*447_*452delTTAAAG, NM_001126123.3:c.*145-373_*145-368del, NM_001126123.3:c.*145-373_*145-368delCTTTAA, NM_001318759.1:c.*145-373_*145-368del, NM_001318759.1:c.*145-373_*145-368delCTTTAA, NM_001318760.1:c.*446+410_*446+415delCTTTAA, NM_001318760.1:c.*856_*861del, NM_017512.5:c.*856_*861delCTTTAA, NM_202758.3:c.*856_*861delCTTTAA, XM_005258111.1:c.*856_*861delCTTTAA, XM_005258112.1:c.*856_*861delCTTTAA, XM_005258113.1:c.*856_*861delCTTTAA, XM_005258114.1:c.*856_*861delCTTTAA, XM_005258115.1:c.*856_*861delCTTTAA, XM_005258116.1:c.*856_*861delCTTTAA, XM_005258117.1:c.*856_*861delCTTTAA, XM_005258118.1:c.*856_*861delCTTTAA, XM_005258118.2:c.*856_*861del, XM_005258120.1:c.*856_*861delCTTTAA, XM_005258137.1:c.*447_*452delTTAAAG, XM_005258138.1:c.*447_*452delTTAAAG, XM_011525677.1:c.*856_*861del, XM_011525678.1:c.*856_*861del, XM_011525679.1:c.*856_*861del, XM_011525680.1:c.*856_*861del, XM_011525681.1:c.*856_*861del, XM_011525682.1:c.*856_*861del, XM_011525683.1:c.*856_*861del, XM_011525684.1:c.*856_*861del, XM_011525685.1:c.*856_*861del, XM_011525686.1:c.*856_*861del, XM_011525687.1:c.*856_*861del, XM_011525688.1:c.*856_*861del, XM_011525689.1:c.*856_*861del, XM_011525690.1:c.*856_*861del, XM_011525691.1:c.*856_*861del, XM_011525692.1:c.*856_*861del, XM_011525693.1:c.*856_*861del, XM_011525694.1:c.*856_*861del, XM_011525695.1:c.*856_*861del, XM_011525696.1:c.*856_*861del, XM_011525697.1:c.*856_*861del, XM_011525698.1:c.*856_*861del, XM_011525699.1:c.*856_*861del, XR_243810.1:n.1672-373_1672-368delCTTTAA, XR_243810.3:n.1513-373_1513-368del, XR_243811.1:n.1538-373_1538-368delCTTTAA, XR_243811.2:n.1538-373_1538-368del, XR_243812.1:n.2112_2117delCTTTAA, XR_430041.2:n.1633-373_1633-368del, XR_935066.1:n.2109_2114del, XR_935067.1:n.1967_1972del
No VIP available No Clinical Annotations available VA
rs1610696 NC_000006.11:g.29798803C=, NC_000006.11:g.29798803C>G, NC_000006.12:g.29831026C=, NC_000006.12:g.29831026C>G, NG_029039.1:g.9048C=, NG_029039.1:g.9048C>G, NM_002127.5:c.*287C=, NM_002127.5:c.*287C>G, NT_113891.3:g.1314602G=, NT_113891.3:g.1314602G>C, NT_167244.2:g.1096652G=, NT_167244.2:g.1096652G>C, NT_167245.1:g.1099424C=, NT_167245.1:g.1099424C>G, NT_167245.2:g.1093839C=, NT_167245.2:g.1093839C>G, NT_167246.1:g.1099132C=, NT_167246.1:g.1099132C>G, NT_167246.2:g.1093512C=, NT_167246.2:g.1093512C>G, NT_167247.1:g.1099082C=, NT_167247.1:g.1099082C>G, NT_167247.2:g.1093497C=, NT_167247.2:g.1093497C>G, NT_167248.2:g.1093806G=, NT_167248.2:g.1093806G>C, NT_167249.2:g.1137071G=, NT_167249.2:g.1137071G>C, XM_005249055.1:c.*287C>G, XM_005249055.1:c.*287G>C, XM_005249056.1:c.*287C>G, XM_005249056.1:c.*287G>C, XM_005249057.1:c.*502C>G, XM_005249057.1:c.*502G>C, XM_005249058.1:c.*287C>G, XM_005249058.1:c.*287G>C, XM_005272810.1:c.*301C>G, XM_005272810.1:c.*301G>C, XM_005274964.1:c.*287C>G, XM_005274964.1:c.*287G>C, XM_005274965.1:c.*287C>G, XM_005274965.1:c.*287G>C, XM_005274966.1:c.*502C>G, XM_005274966.1:c.*502G>C, XM_005274967.1:c.*287C>G, XM_005274967.1:c.*287G>C, XM_005275119.1:c.*287C>G, XM_005275119.1:c.*287G>C, XM_005275120.1:c.*287C>G, XM_005275120.1:c.*287G>C, XM_005275121.1:c.*502C>G, XM_005275121.1:c.*502G>C, XM_005275122.1:c.*287C>G, XM_005275122.1:c.*287G>C, XM_005275246.1:c.*287C>G, XM_005275246.1:c.*287G>C, XM_005275247.1:c.*287C>G, XM_005275247.1:c.*287G>C, XM_005275248.1:c.*502C>G, XM_005275248.1:c.*502G>C, XM_005275249.1:c.*287C>G, XM_005275249.1:c.*287G>C, XM_005275394.1:c.*301C>G, XM_005275394.1:c.*301G>C, XM_005275549.1:c.*301C>G, XM_005275549.1:c.*301G>C, XM_005275550.1:c.*301C>G, XM_005275550.1:c.*301G>C, XM_005275551.1:c.*516C>G, XM_005275551.1:c.*516G>C, XM_005275552.1:c.*301G=, XM_005275552.1:c.*301G>C, XM_011547651.1:c.*287C>G, XM_011547651.1:c.*287G>C, XM_011547882.1:c.*287C=, XM_011547882.1:c.*287C>G, XM_011548048.1:c.*287C>G, XM_011548048.1:c.*287G>C, XM_011548236.1:c.*301C>G, XM_011548236.1:c.*301G>C, XM_011548237.1:c.*301C>G, XM_011548237.1:c.*301G>C, XM_011548430.1:c.*301C>G, XM_011548430.1:c.*301G>C, XM_011548431.1:c.*301C>G, XM_011548431.1:c.*301G>C, XR_241896.1:n.1913C>G, XR_241896.1:n.1913G>C, XR_246963.1:n.1847C>G, XR_246963.1:n.1847G>C, XR_247353.1:n.1913C>G, XR_247353.1:n.1913G>C, XR_247370.1:n.1913C>G, XR_247370.1:n.1913G>C, XR_247389.1:n.1913C>G, XR_247389.1:n.1913G>C, XR_247402.1:n.1847C>G, XR_247402.1:n.1847G>C, XR_247423.1:n.1905C>G, XR_247423.1:n.1905G>C, rs115045214, rs117220578, rs17185510
C > C
C > G
No VIP available No Clinical Annotations available VA
rs163182 NC_000011.10:g.2822986G>C, NC_000011.9:g.2844216G>C, NG_008935.1:g.382996G>C, NM_000218.2:c.1795-24781G>C, NM_181798.1:c.1414-24781G>C, NR_040711.2:n.1688-24781G>C, NT_187585.1:g.55173G>C, rs1176403, rs1182258, rs1182263, rs776659, rs800638
G > C
No VIP available No Clinical Annotations available VA
rs16857540 NC_000003.11:g.173900575C>G, NC_000003.12:g.174182785C>G, NM_014932.3:c.647-92530C>G, XM_005247231.1:c.767-92530C>G, XM_005247232.1:c.707-92530C>G, XM_005247233.1:c.707-92530C>G, XM_005247234.1:c.647-92530C>G, XM_005247235.1:c.647-92530C>G, XM_005247235.2:c.647-92530C>G, XM_005247236.1:c.647-92530C>G, XM_005247237.1:c.191-92530C>G, XM_005247237.2:c.191-92530C>G, XM_006713540.2:c.707-92530C>G, XM_011512551.1:c.707-92530C>G, XM_011512552.1:c.707-92530C>G, XM_011512553.1:c.-297+46205C>G, XM_011512554.1:c.-270+46205C>G, rs56587723, rs59949065, rs61398694
C > G
No VIP available CA VA
rs1695 NC_000011.10:g.67585218A>G, NC_000011.9:g.67352689A>G, NG_012075.1:g.6624A>G, NM_000852.3:c.313A>G, NP_000843.1:p.Ile105Val, XM_005273958.1:c.313A>G, XP_005274015.1:p.Ile105Val, rs1138257, rs11553891, rs17353321, rs17856342, rs2230827, rs4609, rs56971933, rs947894
A > G
No VIP available No Clinical Annotations available VA
rs1707 NC_000006.11:g.29798610C=, NC_000006.11:g.29798610C>T, NC_000006.12:g.29830833C=, NC_000006.12:g.29830833C>T, NG_029039.1:g.8855C=, NG_029039.1:g.8855C>T, NM_002127.5:c.*94C=, NM_002127.5:c.*94C>T, NT_113891.3:g.1314409T=, NT_113891.3:g.1314409T>C, NT_167244.2:g.1096459T=, NT_167244.2:g.1096459T>C, NT_167245.1:g.1099231T=, NT_167245.1:g.1099231T>C, NT_167245.2:g.1093646T=, NT_167245.2:g.1093646T>C, NT_167246.1:g.1098939T=, NT_167246.1:g.1098939T>C, NT_167246.2:g.1093319T=, NT_167246.2:g.1093319T>C, NT_167247.1:g.1098889T=, NT_167247.1:g.1098889T>C, NT_167247.2:g.1093304T=, NT_167247.2:g.1093304T>C, NT_167248.2:g.1093613T=, NT_167248.2:g.1093613T>C, NT_167249.2:g.1136878T=, NT_167249.2:g.1136878T>C, XM_005249055.1:c.*94C=, XM_005249055.1:c.*94C>T, XM_005249056.1:c.*94C=, XM_005249056.1:c.*94C>T, XM_005249057.1:c.*309C>T, XM_005249057.1:c.*309T>C, XM_005249058.1:c.*94C=, XM_005249058.1:c.*94C>T, XM_005272810.1:c.*108T=, XM_005272810.1:c.*108T>C, XM_005274964.1:c.*94T=, XM_005274964.1:c.*94T>C, XM_005274965.1:c.*94T=, XM_005274965.1:c.*94T>C, XM_005274966.1:c.*309C>T, XM_005274966.1:c.*309T>C, XM_005274967.1:c.*94T=, XM_005274967.1:c.*94T>C, XM_005275119.1:c.*94T=, XM_005275119.1:c.*94T>C, XM_005275120.1:c.*94T=, XM_005275120.1:c.*94T>C, XM_005275121.1:c.*309C>T, XM_005275121.1:c.*309T>C, XM_005275122.1:c.*94T=, XM_005275122.1:c.*94T>C, XM_005275246.1:c.*94T=, XM_005275246.1:c.*94T>C, XM_005275247.1:c.*94T=, XM_005275247.1:c.*94T>C, XM_005275248.1:c.*309C>T, XM_005275248.1:c.*309T>C, XM_005275249.1:c.*94T=, XM_005275249.1:c.*94T>C, XM_005275394.1:c.*108T=, XM_005275394.1:c.*108T>C, XM_005275549.1:c.*108T=, XM_005275549.1:c.*108T>C, XM_005275550.1:c.*108T=, XM_005275550.1:c.*108T>C, XM_005275551.1:c.*323C>T, XM_005275551.1:c.*323T>C, XM_005275552.1:c.*108T=, XM_005275552.1:c.*108T>C, XM_011547651.1:c.*94T=, XM_011547651.1:c.*94T>C, XM_011547882.1:c.*94T=, XM_011547882.1:c.*94T>C, XM_011548048.1:c.*94T=, XM_011548048.1:c.*94T>C, XM_011548236.1:c.*108T=, XM_011548236.1:c.*108T>C, XM_011548237.1:c.*108T=, XM_011548237.1:c.*108T>C, XM_011548430.1:c.*108T=, XM_011548430.1:c.*108T>C, XM_011548431.1:c.*108T=, XM_011548431.1:c.*108T>C, XR_241896.1:n.1720C=, XR_241896.1:n.1720C>T, XR_246963.1:n.1654T=, XR_246963.1:n.1654T>C, XR_247353.1:n.1720T=, XR_247353.1:n.1720T>C, XR_247370.1:n.1720T=, XR_247370.1:n.1720T>C, XR_247389.1:n.1720T=, XR_247389.1:n.1720T>C, XR_247402.1:n.1654T=, XR_247402.1:n.1654T>C, XR_247423.1:n.1712T=, XR_247423.1:n.1712T>C, rs113572485, rs115689421, rs117926242, rs1233332, rs1632931, rs17179087, rs17375406, rs57754052, rs75256208
C > C
C > T
No VIP available No Clinical Annotations available VA
rs1710 NC_000006.11:g.29798617G=, NC_000006.11:g.29798617G>C, NC_000006.12:g.29830840G=, NC_000006.12:g.29830840G>C, NG_029039.1:g.8862G=, NG_029039.1:g.8862G>C, NM_002127.5:c.*101G=, NM_002127.5:c.*101G>C, NT_113891.3:g.1314416C=, NT_113891.3:g.1314416C>G, NT_167244.2:g.1096466C=, NT_167244.2:g.1096466C>G, NT_167245.1:g.1099238G=, NT_167245.1:g.1099238G>C, NT_167245.2:g.1093653G=, NT_167245.2:g.1093653G>C, NT_167246.1:g.1098946G=, NT_167246.1:g.1098946G>C, NT_167246.2:g.1093326G=, NT_167246.2:g.1093326G>C, NT_167247.1:g.1098896G=, NT_167247.1:g.1098896G>C, NT_167247.2:g.1093311G=, NT_167247.2:g.1093311G>C, NT_167248.2:g.1093620C=, NT_167248.2:g.1093620C>G, NT_167249.2:g.1136885C=, NT_167249.2:g.1136885C>G, XM_005249055.1:c.*101G=, XM_005249055.1:c.*101G>C, XM_005249056.1:c.*101G=, XM_005249056.1:c.*101G>C, XM_005249057.1:c.*316C>G, XM_005249057.1:c.*316G>C, XM_005249058.1:c.*101G=, XM_005249058.1:c.*101G>C, XM_005272810.1:c.*115C=, XM_005272810.1:c.*115C>G, XM_005274964.1:c.*101G=, XM_005274964.1:c.*101G>C, XM_005274965.1:c.*101G=, XM_005274965.1:c.*101G>C, XM_005274966.1:c.*316C>G, XM_005274966.1:c.*316G>C, XM_005274967.1:c.*101G=, XM_005274967.1:c.*101G>C, XM_005275119.1:c.*101G=, XM_005275119.1:c.*101G>C, XM_005275120.1:c.*101G=, XM_005275120.1:c.*101G>C, XM_005275121.1:c.*316C>G, XM_005275121.1:c.*316G>C, XM_005275122.1:c.*101G=, XM_005275122.1:c.*101G>C, XM_005275246.1:c.*101G=, XM_005275246.1:c.*101G>C, XM_005275247.1:c.*101G=, XM_005275247.1:c.*101G>C, XM_005275248.1:c.*316C>G, XM_005275248.1:c.*316G>C, XM_005275249.1:c.*101G=, XM_005275249.1:c.*101G>C, XM_005275394.1:c.*115C=, XM_005275394.1:c.*115C>G, XM_005275549.1:c.*115C=, XM_005275549.1:c.*115C>G, XM_005275550.1:c.*115C=, XM_005275550.1:c.*115C>G, XM_005275551.1:c.*330C>G, XM_005275551.1:c.*330G>C, XM_005275552.1:c.*115C=, XM_005275552.1:c.*115C>G, XM_011547651.1:c.*101G=, XM_011547651.1:c.*101G>C, XM_011547882.1:c.*101G=, XM_011547882.1:c.*101G>C, XM_011548048.1:c.*101G=, XM_011548048.1:c.*101G>C, XM_011548236.1:c.*115C=, XM_011548236.1:c.*115C>G, XM_011548237.1:c.*115C=, XM_011548237.1:c.*115C>G, XM_011548430.1:c.*115C=, XM_011548430.1:c.*115C>G, XM_011548431.1:c.*115C=, XM_011548431.1:c.*115C>G, XR_241896.1:n.1727G=, XR_241896.1:n.1727G>C, XR_246963.1:n.1661C=, XR_246963.1:n.1661C>G, XR_247353.1:n.1727G=, XR_247353.1:n.1727G>C, XR_247370.1:n.1727G=, XR_247370.1:n.1727G>C, XR_247389.1:n.1727G=, XR_247389.1:n.1727G>C, XR_247402.1:n.1661C=, XR_247402.1:n.1661C>G, XR_247423.1:n.1719C=, XR_247423.1:n.1719C>G, rs1049037, rs111577111, rs116152775, rs117391931, rs1632930, rs17179094, rs3189113, rs77969756
G > C
G > G
No VIP available CA VA
rs17109924 NC_000012.11:g.71977787T>C, NC_000012.12:g.71584007T>C, NM_001277226.1:c.1925T>C, NM_001277227.1:c.1781T>C, NM_003667.3:c.1997T>C, NP_001264155.1:p.Val642Ala, NP_001264156.1:p.Val594Ala, NP_003658.1:p.Val666Ala, NR_110596.1:n.2497+95T>C, XM_005269204.1:c.1775T>C, XM_005269204.3:c.1775T>C, XP_005269261.1:p.Val592Ala, rs56488504, rs58792571, rs61507334
T > C
No VIP available No Clinical Annotations available VA
rs17116806 NC_000001.10:g.97973252C>A, NC_000001.11:g.97507696C>A, NG_008807.2:g.418364G>T, NM_000110.3:c.1740+8030G>T, XM_005270561.1:c.1629+8030G>T, XM_005270562.1:c.1524+41864G>T, XM_005270562.3:c.1524+41864G>T, XM_005270563.1:c.1740+8030G>T, XM_006710397.2:c.1740+8030G>T, rs59151739
C > A
No VIP available CA VA
rs17160359 NC_000007.13:g.87346819G>T, NC_000007.14:g.87717503G>T, NG_011513.1:g.746C>A, NM_001134405.1:c.458+6848G>T, NM_001134406.1:c.458+6848G>T, NM_138290.2:c.509+6848G>T, XM_005250156.1:c.458+6848G>T, XM_005250156.2:c.458+6848G>T, XM_005250157.1:c.116+6848G>T, XM_005250158.1:c.98+6848G>T, XM_005250158.2:c.98+6848G>T, XM_011515826.1:c.509+6848G>T, XM_011515827.1:c.509+6848G>T, XM_011515828.1:c.116+6848G>T, XM_011515829.1:c.116+6848G>T
G > T
No VIP available No Clinical Annotations available VA
rs17179101 NC_000006.11:g.29798634C>A, NC_000006.12:g.29830857C>A, NG_029039.1:g.8879C>A, NM_002127.5:c.*118C>A, NT_113891.3:g.1314433C>A, NT_167244.2:g.1096483C>A, NT_167245.1:g.1099255C>A, NT_167245.2:g.1093670C>A, NT_167246.1:g.1098963C>A, NT_167246.2:g.1093343C>A, NT_167247.1:g.1098913C>A, NT_167247.2:g.1093328C>A, NT_167248.2:g.1093637C>A, NT_167249.2:g.1136902C>A, XM_005249055.1:c.*118C>A, XM_005249056.1:c.*118C>A, XM_005249057.1:c.*333C>A, XM_005249058.1:c.*118C>A, XM_005272810.1:c.*132C>A, XM_005274964.1:c.*118C>A, XM_005274965.1:c.*118C>A, XM_005274966.1:c.*333C>A, XM_005274967.1:c.*118C>A, XM_005275119.1:c.*118C>A, XM_005275120.1:c.*118C>A, XM_005275121.1:c.*333C>A, XM_005275122.1:c.*118C>A, XM_005275246.1:c.*118C>A, XM_005275247.1:c.*118C>A, XM_005275248.1:c.*333C>A, XM_005275249.1:c.*118C>A, XM_005275394.1:c.*132C>A, XM_005275549.1:c.*132C>A, XM_005275550.1:c.*132C>A, XM_005275551.1:c.*347C>A, XM_005275552.1:c.*132C>A, XM_011547651.1:c.*118C>A, XM_011547882.1:c.*118C>A, XM_011548048.1:c.*118C>A, XM_011548236.1:c.*132C>A, XM_011548237.1:c.*132C>A, XM_011548430.1:c.*132C>A, XM_011548431.1:c.*132C>A, XR_241896.1:n.1744C>A, XR_246963.1:n.1678C>A, XR_247353.1:n.1744C>A, XR_247370.1:n.1744C>A, XR_247389.1:n.1744C>A, XR_247402.1:n.1678C>A, XR_247423.1:n.1736C>A, rs115810666, rs118174970
C > A
No VIP available CA VA
rs17179108 NC_000006.11:g.29798642C>T, NC_000006.12:g.29830865C>T, NG_029039.1:g.8887C>T, NM_002127.5:c.*126C>T, NT_113891.3:g.1314441C>T, NT_167244.2:g.1096491C>T, NT_167245.1:g.1099263C>T, NT_167245.2:g.1093678C>T, NT_167246.1:g.1098971C>T, NT_167246.2:g.1093351C>T, NT_167247.1:g.1098921C>T, NT_167247.2:g.1093336C>T, NT_167248.2:g.1093645C>T, NT_167249.2:g.1136910C>T, XM_005249055.1:c.*126C>T, XM_005249056.1:c.*126C>T, XM_005249057.1:c.*341C>T, XM_005249058.1:c.*126C>T, XM_005272810.1:c.*140C>T, XM_005274964.1:c.*126C>T, XM_005274965.1:c.*126C>T, XM_005274966.1:c.*341C>T, XM_005274967.1:c.*126C>T, XM_005275119.1:c.*126C>T, XM_005275120.1:c.*126C>T, XM_005275121.1:c.*341C>T, XM_005275122.1:c.*126C>T, XM_005275246.1:c.*126C>T, XM_005275247.1:c.*126C>T, XM_005275248.1:c.*341C>T, XM_005275249.1:c.*126C>T, XM_005275394.1:c.*140C>T, XM_005275549.1:c.*140C>T, XM_005275550.1:c.*140C>T, XM_005275551.1:c.*355C>T, XM_005275552.1:c.*140C>T, XM_011547651.1:c.*126C>T, XM_011547882.1:c.*126C>T, XM_011548048.1:c.*126C>T, XM_011548236.1:c.*140C>T, XM_011548237.1:c.*140C>T, XM_011548430.1:c.*140C>T, XM_011548431.1:c.*140C>T, XR_241896.1:n.1752C>T, XR_246963.1:n.1686C>T, XR_247353.1:n.1752C>T, XR_247370.1:n.1752C>T, XR_247389.1:n.1752C>T, XR_247402.1:n.1686C>T, XR_247423.1:n.1744C>T, rs115100128, rs117118691, rs17875407
C > T
No VIP available No Clinical Annotations available VA
rs1734787 AJ132917.1:c.27-27438T>G, NC_000023.10:g.153325446A>C, NC_000023.11:g.154059995A>C, NG_007107.2:g.82133T>G, NM_001110792.1:c.63-27438T>G, NM_001316337.1:c.-421-1429T>G, NM_004992.3:c.27-27438T>G, NW_003871103.3:g.1493974A>C, XM_005274681.1:c.27-27438T>G, XM_005274681.3:c.27-27438T>G, XM_005274682.1:c.-365-20092T>G, XM_005274682.3:c.-365-20092T>G, XM_005274683.1:c.-2264T>G, XM_005274683.3:c.-2264T>G, XM_005277851.1:c.27-27438T>G, XM_005277852.1:c.-365-20092T>G, XM_005277853.1:c.-2264T>G, XM_011531165.1:c.-421-1429T>G, rs17332596, rs56534075, rs58354099, rs61248129
A > C
No VIP available No Clinical Annotations available VA
rs1734791 AJ132917.1:c.26+26722T>A, NC_000023.10:g.153330920A>T, NC_000023.11:g.154065469A>T, NG_007107.2:g.76659T>A, NM_001110792.1:c.62+32141T>A, NM_001316337.1:c.-421-6903T>A, NM_004992.3:c.26+26722T>A, NW_003871103.3:g.1499448A>T, XM_005274681.1:c.26+26722T>A, XM_005274681.3:c.26+26715T>A, XM_005274682.1:c.-365-25566T>A, XM_005274682.3:c.-365-25566T>A, XM_005277851.1:c.26+26715T>A, XM_005277852.1:c.-365-25566T>A, XM_011531165.1:c.-421-6903T>A, rs111178553, rs60889458
A > T
No VIP available CA VA
rs17376848 NC_000001.10:g.97915624A>G, NC_000001.11:g.97450068A>G, NG_008807.2:g.475992T>C, NM_000110.3:c.1896T>C, NP_000101.2:p.Phe632=, XM_005270561.1:c.1785T>C, XM_005270562.1:c.1680T>C, XM_005270562.3:c.1680T>C, XM_005270563.1:c.1896T>C, XM_006710397.2:c.1896T>C, XP_005270618.1:p.Phe595=, XP_005270619.1:p.Phe560=, XP_005270619.2:p.Phe560=, XP_005270620.1:p.Phe632=, XP_006710460.1:p.Phe632=, rs117467766, rs52815410, rs58485702
A > G
No VIP available CA VA
rs17431184 NC_000010.10:g.89720251T>C, NC_000010.11:g.87960494T>C, NG_007466.2:g.102056T>C, NM_000314.4:c.802-400T>C, NM_000314.6:c.802-400T>C, NM_001304717.2:c.1321-400T>C, NM_001304718.1:c.211-400T>C, XM_006717926.2:c.757-400T>C, XM_011539981.1:c.802-400T>C, XM_011539982.1:c.706-400T>C, XR_945791.1:n.1372-400T>C, rs60289874
T > C
No VIP available No Clinical Annotations available VA
rs17435 AJ132917.1:c.27-13972A>T, NC_000023.10:g.153311980T>A, NC_000023.11:g.154046529T>A, NG_007107.2:g.95599A>T, NM_001110792.1:c.63-13972A>T, NM_001316337.1:c.-254+11870A>T, NM_004992.3:c.27-13972A>T, NW_003871103.3:g.1480508T>A, XM_005274681.1:c.27-13972A>T, XM_005274681.3:c.27-13972A>T, XM_005274682.1:c.-365-6626A>T, XM_005274682.3:c.-365-6626A>T, XM_005274683.1:c.-254+10412A>T, XM_005274683.3:c.-254+10412A>T, XM_005277851.1:c.27-13972A>T, XM_005277852.1:c.-365-6626A>T, XM_005277853.1:c.-254+10412A>T, XM_011531165.1:c.-254+11870A>T, XM_011531166.1:c.-254+1988A>T, rs60248475, rs61484111
T > A
No VIP available CA VA
rs17626122 NC_000002.11:g.206474012T>C, NC_000002.12:g.205609288T>C, NM_001302769.1:c.3261-6168T>C, NM_057177.6:c.3054-6168T>C, NM_152526.5:c.3075-6168T>C, NM_205863.3:c.2958-6168T>C, XM_005246273.1:c.3261-6168T>C, XM_005246274.1:c.2664-6168T>C, XM_011510550.1:c.3321-908T>C, XM_011510551.1:c.3261-908T>C, XM_011510552.1:c.3285-6168T>C, rs56463399, rs57676795
T > C
No VIP available No Clinical Annotations available VA
C > T
No VIP available No Clinical Annotations available VA
rs17822471 NC_000016.10:g.48208468G>A, NC_000016.9:g.48242379G>A, NG_011522.1:g.31710C>T, NM_032583.3:c.1637C>T, NM_033151.3:c.1637C>T, NM_145186.2:c.1637C>T, NP_115972.2:p.Thr546Met, NP_149163.2:p.Thr546Met, NP_660187.1:p.Thr546Met, XM_005256208.1:c.1637C>T, XM_005256209.1:c.1637C>T, XM_005256210.1:c.1637C>T, XM_011523396.1:c.1439C>T, XM_011523397.1:c.680C>T, XP_005256265.1:p.Thr546Met, XP_005256266.1:p.Thr546Met, XP_005256267.1:p.Thr546Met, XP_011521698.1:p.Thr480Met, XP_011521699.1:p.Thr227Met, XR_243432.1:n.1742C>T, rs386492901, rs52810988, rs57560138
G > A
No VIP available No Clinical Annotations available VA
rs17822931 NC_000016.10:g.48224287C>T, NC_000016.9:g.48258198C>T, NG_011522.1:g.15891G>A, NM_032583.3:c.538G>A, NM_033151.3:c.538G>A, NM_145186.2:c.538G>A, NP_115972.2:p.Gly180Arg, NP_149163.2:p.Gly180Arg, NP_660187.1:p.Gly180Arg, XM_005256208.1:c.538G>A, XM_005256209.1:c.538G>A, XM_005256210.1:c.538G>A, XM_011523396.1:c.340G>A, XM_011523397.1:c.-1144G>A, XP_005256265.1:p.Gly180Arg, XP_005256266.1:p.Gly180Arg, XP_005256267.1:p.Gly180Arg, XP_011521698.1:p.Gly114Arg, XR_243432.1:n.643G>A, rs52813591, rs58140753
C > T
No VIP available No Clinical Annotations available VA
rs1799793 NC_000019.10:g.45364001C>T, NC_000019.9:g.45867259C>T, NG_007067.2:g.11587G>A, NM_000400.3:c.934G>A, NM_001130867.1:c.862G>A, NP_000391.1:p.Asp312Asn, NP_001124339.1:p.Asp288Asn, XM_005258639.1:c.862G>A, XM_005258640.1:c.700G>A, XM_005258641.1:c.196G>A, XM_005258642.1:c.934G>A, XM_011526611.1:c.856G>A, XP_005258696.1:p.Asp288Asn, XP_005258697.1:p.Asp234Asn, XP_005258698.1:p.Asp66Asn, XP_005258699.1:p.Asp312Asn, XP_011524913.1:p.Asp286Asn, XR_935763.1:n.981G>A, rs3916814, rs58989209
C > T
No VIP available No Clinical Annotations available VA
rs1799794 NC_000014.8:g.104179267T>C, NC_000014.9:g.103712930T>C, NG_011516.1:g.7557A>G, NM_001100118.1:c.-260-1363A>G, NM_001100119.1:c.-316A>G, NM_005432.3:c.-316A>G, XM_005268045.1:c.-316A>G, XM_005268046.1:c.-354-1269A>G, XM_005268047.1:c.-251A>G, XM_005268048.1:c.-260-1363A>G, XM_011537138.1:c.-316A>G, rs3212034
T > C
No VIP available No Clinical Annotations available VA
rs1799895 NC_000004.11:g.24801834C>G, NC_000004.12:g.24800212C>G, NG_012213.1:g.9750C>G, NM_003102.2:c.691C>G, NP_003093.2:p.Arg231Gly, XR_427488.1:n.881C>G, XR_925483.1:n.1189G>C, rs8192292
C > G
No VIP available CA VA
rs1799983 NC_000007.13:g.150696111T>G, NC_000007.14:g.150999023T>G, NG_011992.1:g.12965T>G, NM_000603.4:c.894T>G, NM_001160109.1:c.894T>G, NM_001160110.1:c.894T>G, NM_001160111.1:c.894T>G, NP_000594.2:p.Asp298Glu, NP_001153581.1:p.Asp298Glu, NP_001153582.1:p.Asp298Glu, NP_001153583.1:p.Asp298Glu, XM_006716002.2:c.894T>G, XP_006716065.1:p.Asp298Glu, rs11266811, rs13238975, rs13305983, rs13308813, rs17173672, rs3730304, rs57135373
T > G
No VIP available CA VA
rs1800566 NC_000016.10:g.69711242G>A, NC_000016.9:g.69745145G>A, NG_011504.1:g.20389C>T, NM_000903.2:c.559C>T, NM_001025433.1:c.457C>T, NM_001025434.1:c.445C>T, NM_001286137.1:c.343C>T, NP_000894.1:p.Pro187Ser, NP_001020604.1:p.Pro153Ser, NP_001020605.1:p.Pro149Ser, NP_001273066.1:p.Pro115Ser, XM_005255830.1:c.343C>T, XP_005255887.1:p.Pro115Ser, rs4134727, rs4149351, rs57135274
G > A
No VIP available CA VA
rs1801019 NC_000003.11:g.124456742G>C, NC_000003.12:g.124737895G>C, NG_017037.1:g.12530G>C, NM_000373.3:c.638G>C, NP_000364.1:p.Gly213Ala, NR_033434.1:n.590G>C, NR_033437.1:n.843G>C, XM_005247741.1:c.362G>C, XM_005247742.1:c.104G>C, XM_005247743.1:c.124-20G>C, XM_005247744.1:c.104G>C, XP_005247798.1:p.Gly121Ala, XP_005247799.1:p.Gly35Ala, XP_005247801.1:p.Gly35Ala, rs17843818, rs199469590, rs3172286, rs3772805, rs52826107, rs58177968
G > C
No VIP available CA VA
rs1801131 NC_000001.10:g.11854476T>G, NC_000001.11:g.11794419T>G, NG_013351.1:g.16685A>C, NM_005957.4:c.1286A>C, NP_005948.3:p.Glu429Ala, XM_005263458.1:c.1409A>C, XM_005263458.2:c.1409A>C, XM_005263459.1:c.1355A>C, XM_005263460.1:c.1286A>C, XM_005263460.3:c.1286A>C, XM_005263461.1:c.1286A>C, XM_005263461.3:c.1286A>C, XM_005263462.1:c.1286A>C, XM_005263462.3:c.1286A>C, XM_005263463.1:c.1040A>C, XM_005263463.2:c.1040A>C, XM_011541495.1:c.1406A>C, XM_011541496.1:c.1409A>C, XP_005263515.1:p.Glu470Ala, XP_005263516.1:p.Glu452Ala, XP_005263517.1:p.Glu429Ala, XP_005263518.1:p.Glu429Ala, XP_005263519.1:p.Glu429Ala, XP_005263520.1:p.Glu347Ala, XP_011539797.1:p.Glu469Ala, XP_011539798.1:p.Glu470Ala, rs17367365, rs17857426, rs4134712
T > G
rs1801133 NC_000001.10:g.11856378G>A, NC_000001.11:g.11796321G>A, NG_013351.1:g.14783C>T, NM_005957.4:c.665C>T, NP_005948.3:p.Ala222Val, XM_005263458.1:c.788C>T, XM_005263458.2:c.788C>T, XM_005263459.1:c.734C>T, XM_005263460.1:c.665C>T, XM_005263460.3:c.665C>T, XM_005263461.1:c.665C>T, XM_005263461.3:c.665C>T, XM_005263462.1:c.665C>T, XM_005263462.3:c.665C>T, XM_005263463.1:c.419C>T, XM_005263463.2:c.419C>T, XM_011541495.1:c.785C>T, XM_011541496.1:c.788C>T, XP_005263515.1:p.Ala263Val, XP_005263516.1:p.Ala245Val, XP_005263517.1:p.Ala222Val, XP_005263518.1:p.Ala222Val, XP_005263519.1:p.Ala222Val, XP_005263520.1:p.Ala140Val, XP_011539797.1:p.Ala262Val, XP_011539798.1:p.Ala263Val, rs386545618, rs4134713, rs59514310
G > A
No VIP available CA VA
rs1801158 NC_000001.10:g.97981421C>T, NC_000001.11:g.97515865C>T, NG_008807.2:g.410195G>A, NM_000110.3:c.1601G>A, NP_000101.2:p.Ser534Asn, XM_005270561.1:c.1490G>A, XM_005270562.1:c.1524+33695G>A, XM_005270562.3:c.1524+33695G>A, XM_005270563.1:c.1601G>A, XM_005270564.1:c.1601G>A, XM_006710397.2:c.1601G>A, XP_005270618.1:p.Ser497Asn, XP_005270620.1:p.Ser534Asn, XP_005270621.1:p.Ser534Asn, XP_006710460.1:p.Ser534Asn, rs199469539, rs52824375, rs59516208
C > T
No VIP available CA VA
rs1801159 NC_000001.10:g.97981395T>C, NC_000001.11:g.97515839T>C, NG_008807.2:g.410221A>G, NM_000110.3:c.1627A>G, NP_000101.2:p.Ile543Val, XM_005270561.1:c.1516A>G, XM_005270562.1:c.1524+33721A>G, XM_005270562.3:c.1524+33721A>G, XM_005270563.1:c.1627A>G, XM_005270564.1:c.1627A>G, XM_006710397.2:c.1627A>G, XP_005270618.1:p.Ile506Val, XP_005270620.1:p.Ile543Val, XP_005270621.1:p.Ile543Val, XP_006710460.1:p.Ile543Val, rs117999026, rs17116825, rs199469541, rs386545620, rs58945530
T > C
No VIP available CA VA
rs1801160 NC_000001.10:g.97770920C>T, NC_000001.11:g.97305364C>T, NG_008807.2:g.620696G>A, NM_000110.3:c.2194G>A, NP_000101.2:p.Val732Ile, NR_046590.1:n.129-825C>T, XM_005270561.1:c.2083G>A, XM_005270562.1:c.1978G>A, XM_005270562.3:c.1978G>A, XM_005270563.1:c.2194G>A, XM_006710397.2:c.2194G>A, XP_005270618.1:p.Val695Ile, XP_005270619.1:p.Val660Ile, XP_005270619.2:p.Val660Ile, XP_005270620.1:p.Val732Ile, XP_006710460.1:p.Val732Ile, rs12720467, rs12720468, rs199469554
C > T
No VIP available CA VA
rs1801265 NC_000001.10:g.98348885G=, NC_000001.10:g.98348885G>A, NC_000001.11:g.97883329A=, NC_000001.11:g.97883329A>G, NG_008807.2:g.42731T=, NG_008807.2:g.42731T>C, NM_000110.3:c.85T=, NM_000110.3:c.85T>C, NM_001160301.1:c.85T=, NM_001160301.1:c.85T>C, NP_000101.2:p.Cys29=, NP_000101.2:p.Cys29Arg, NP_001153773.1:p.Cys29=, NP_001153773.1:p.Cys29Arg, XM_005270561.1:c.39+37555C>T, XM_005270561.1:c.39+37555T>C, XM_005270562.1:c.85C=, XM_005270562.1:c.85C>T, XM_005270562.3:c.85T=, XM_005270562.3:c.85T>C, XM_005270563.1:c.85C=, XM_005270563.1:c.85C>T, XM_005270564.1:c.85C=, XM_005270564.1:c.85C>T, XM_006710397.2:c.85T=, XM_006710397.2:c.85T>C, XP_005270619.1:p.Arg29=, XP_005270619.1:p.Arg29Cys, XP_005270619.2:p.Cys29=, XP_005270619.2:p.Cys29Arg, XP_005270620.1:p.Arg29=, XP_005270620.1:p.Arg29Cys, XP_005270621.1:p.Arg29=, XP_005270621.1:p.Arg29Cys, XP_006710460.1:p.Cys29=, XP_006710460.1:p.Cys29Arg, rs199469510, rs3211355, rs52823090, rs57596852
G > A
No VIP available CA VA
rs1801266 NC_000001.10:g.98157332G>A, NC_000001.11:g.97691776G>A, NG_008807.2:g.234284C>T, NM_000110.3:c.703C>T, NP_000101.2:p.Arg235Trp, XM_005270561.1:c.592C>T, XM_005270562.1:c.703C>T, XM_005270562.3:c.703C>T, XM_005270563.1:c.703C>T, XM_005270564.1:c.703C>T, XM_006710397.2:c.703C>T, XP_005270618.1:p.Arg198Trp, XP_005270619.1:p.Arg235Trp, XP_005270619.2:p.Arg235Trp, XP_005270620.1:p.Arg235Trp, XP_005270621.1:p.Arg235Trp, XP_006710460.1:p.Arg235Trp, rs386545627
G > A
No VIP available No Clinical Annotations available VA
rs1801267 NC_000001.10:g.97564154C>T, NC_000001.11:g.97098598C>T, NG_008807.2:g.827462G>A, NM_000110.3:c.2657G>A, NP_000101.2:p.Arg886His, NR_046590.1:n.64+2612C>T, XM_005270561.1:c.2546G>A, XM_005270562.1:c.2441G>A, XM_005270562.3:c.2441G>A, XP_005270618.1:p.Arg849His, XP_005270619.1:p.Arg814His, XP_005270619.2:p.Arg814His, rs386545628
C > T
No VIP available CA VA
rs1801268 NC_000001.10:g.97544627C>A, NC_000001.11:g.97079071C>A, NG_008807.2:g.846989G>T, NM_000110.3:c.2983G>T, NP_000101.2:p.Val995Phe, XM_005270561.1:c.2872G>T, XM_005270562.1:c.2767G>T, XM_005270562.3:c.2767G>T, XP_005270618.1:p.Val958Phe, XP_005270619.1:p.Val923Phe, XP_005270619.2:p.Val923Phe, rs386545629
C > A
No VIP available No Clinical Annotations available VA
rs183105782 NC_000001.10:g.98060663A>G, NC_000001.11:g.97595107A>G, NG_008807.2:g.330953T>C, NM_000110.3:c.910T>C, NP_000101.2:p.Tyr304His, XM_005270561.1:c.799T>C, XM_005270562.1:c.910T>C, XM_005270562.3:c.910T>C, XM_005270563.1:c.910T>C, XM_005270564.1:c.910T>C, XM_006710397.2:c.910T>C, XP_005270618.1:p.Tyr267His, XP_005270619.1:p.Tyr304His, XP_005270619.2:p.Tyr304His, XP_005270620.1:p.Tyr304His, XP_005270621.1:p.Tyr304His, XP_006710460.1:p.Tyr304His
A > G
No VIP available CA VA
rs183205964 NC_000018.10:g.657657G>C, NC_000018.9:g.657657G>C, NG_028255.1:g.5054G>C, NM_001012716.2:c.*34+185C>G, NM_001071.2:c.-86G>C, XM_005258137.1:c.-86G>C, XM_005258138.1:c.-86G>C
G > C
No VIP available No Clinical Annotations available VA
rs183385770 NC_000001.10:g.98058878C>T, NC_000001.11:g.97593322C>T, NG_008807.2:g.332738G>A, NM_000110.3:c.1024G>A, NP_000101.2:p.Asp342Asn, XM_005270561.1:c.913G>A, XM_005270562.1:c.1024G>A, XM_005270562.3:c.1024G>A, XM_005270563.1:c.1024G>A, XM_005270564.1:c.1024G>A, XM_006710397.2:c.1024G>A, XP_005270618.1:p.Asp305Asn, XP_005270619.1:p.Asp342Asn, XP_005270619.2:p.Asp342Asn, XP_005270620.1:p.Asp342Asn, XP_005270621.1:p.Asp342Asn, XP_006710460.1:p.Asp342Asn
C > T
No VIP available No Clinical Annotations available VA
rs186169810 NC_000001.10:g.98039341A>C, NC_000001.11:g.97573785A>C, NG_008807.2:g.352275T>G, NM_000110.3:c.1314T>G, NP_000101.2:p.Phe438Leu, XM_005270561.1:c.1203T>G, XM_005270562.1:c.1314T>G, XM_005270562.3:c.1314T>G, XM_005270563.1:c.1314T>G, XM_005270564.1:c.1314T>G, XM_006710397.2:c.1314T>G, XP_005270618.1:p.Phe401Leu, XP_005270619.1:p.Phe438Leu, XP_005270619.2:p.Phe438Leu, XP_005270620.1:p.Phe438Leu, XP_005270621.1:p.Phe438Leu, XP_006710460.1:p.Phe438Leu
A > C
No VIP available No Clinical Annotations available VA
rs1870377 NC_000004.11:g.55972974T>A, NC_000004.12:g.55106807T>A, NG_012004.1:g.23789A>T, NM_002253.2:c.1416A>T, NP_002244.1:p.Gln472His, rs52810770
T > A
No VIP available No Clinical Annotations available VA
rs188052243 NC_000001.10:g.97564133T>C, NC_000001.11:g.97098577T>C, NG_008807.2:g.827483A>G, NM_000110.3:c.2678A>G, NP_000101.2:p.Asn893Ser, NR_046590.1:n.64+2591T>C, XM_005270561.1:c.2567A>G, XM_005270562.1:c.2462A>G, XM_005270562.3:c.2462A>G, XP_005270618.1:p.Asn856Ser, XP_005270619.1:p.Asn821Ser, XP_005270619.2:p.Asn821Ser
T > C
No VIP available No Clinical Annotations available VA
rs1885301 NC_000010.10:g.101541053A>G, NC_000010.11:g.99781296A>G, NG_011798.1:g.3591A>G, NM_000392.4:c.-1549A>G, XM_005269536.1:c.-1549A>G, XM_006717631.2:c.-1549A>G, XM_011539291.1:c.-1549A>G, XR_945604.1:n.-1360A>G, XR_945605.1:n.-1358A>G, rs17216261, rs59934936
A > G
No VIP available No Clinical Annotations available VA
rs190577302 NC_000001.10:g.98058848G>C, NC_000001.11:g.97593292G>C, NG_008807.2:g.332768C>G, NM_000110.3:c.1054C>G, NP_000101.2:p.Leu352Val, XM_005270561.1:c.943C>G, XM_005270562.1:c.1054C>G, XM_005270562.3:c.1054C>G, XM_005270563.1:c.1054C>G, XM_005270564.1:c.1054C>G, XM_006710397.2:c.1054C>G, XP_005270618.1:p.Leu315Val, XP_005270619.1:p.Leu352Val, XP_005270619.2:p.Leu352Val, XP_005270620.1:p.Leu352Val, XP_005270621.1:p.Leu352Val, XP_006710460.1:p.Leu352Val
G > C
No VIP available No Clinical Annotations available VA
G > C
No VIP available No Clinical Annotations available VA
G > A
No VIP available CA VA
rs1979277 NC_000017.10:g.18232096G>A, NC_000017.11:g.18328782G>A, NG_017111.1:g.39761C>T, NM_001281786.1:c.1006C>T, NM_004169.4:c.1420C>T, NM_148918.2:c.1303C>T, NP_001268715.1:p.Leu336Phe, NP_004160.3:p.Leu474Phe, NP_683718.1:p.Leu435Phe, XM_005256767.1:c.1420C>T, XM_005256767.2:c.1420C>T, XM_005256768.1:c.1006C>T, XM_011523992.1:c.1180C>T, XP_005256824.1:p.Leu474Phe, XP_005256825.1:p.Leu336Phe, XP_011522294.1:p.Leu394Phe, rs17850285, rs2230025, rs3183766, rs57933897
G > A
No VIP available No Clinical Annotations available VA
G > T
No VIP available No Clinical Annotations available VA
G > T
No VIP available No Clinical Annotations available VA
A > T
No VIP available No Clinical Annotations available VA
T > C
No VIP available No Clinical Annotations available VA
rs200687447 NC_000001.10:g.97658765C>G, NC_000001.10:g.97658765C>T, NC_000001.11:g.97193209C>G, NC_000001.11:g.97193209C>T, NG_008807.2:g.732851G>A, NG_008807.2:g.732851G>C, NM_000110.3:c.2482G>A, NM_000110.3:c.2482G>C, NP_000101.2:p.Glu828Gln, NP_000101.2:p.Glu828Lys, NR_046590.1:n.65-72205C>G, NR_046590.1:n.65-72205C>T, XM_005270561.1:c.2371G>A, XM_005270561.1:c.2371G>C, XM_005270562.1:c.2266G>A, XM_005270562.1:c.2266G>C, XM_005270562.3:c.2266G>A, XM_005270562.3:c.2266G>C, XM_006710397.2:c.2482G>A, XM_006710397.2:c.2482G>C, XP_005270618.1:p.Glu791Gln, XP_005270618.1:p.Glu791Lys, XP_005270619.1:p.Glu756Gln, XP_005270619.1:p.Glu756Lys, XP_005270619.2:p.Glu756Gln, XP_005270619.2:p.Glu756Lys, XP_006710460.1:p.Glu828Gln, XP_006710460.1:p.Glu828Lys
C > G
C > T
No VIP available No Clinical Annotations available VA
C > T
No VIP available No Clinical Annotations available VA
T > G
No VIP available CA VA
rs201045130 NC_000001.10:g.40125139A>G, NC_000001.11:g.39659467A>G, NM_032526.2:c.761T>C, NP_115915.1:p.Leu254Pro
A > G
No VIP available CA VA
rs2010851 NC_000012.11:g.1756642C>A, NC_000012.12:g.1647476C>A, NM_030775.2:c.*1224C>A, NM_032642.2:c.*1224C>A, XM_005253792.1:c.*1224C>A, XM_005253793.1:c.*1224C>A, XM_005253794.1:c.*1224C>A, XM_011521026.1:c.*1224C>A, rs57028820
C > A
No VIP available No Clinical Annotations available VA
rs2010963 NC_000006.11:g.43738350C>G, NC_000006.12:g.43770613C>G, NG_008732.1:g.5398C>G, NM_001025366.2:c.-94C>G, NM_001025367.2:c.-94C>G, NM_001025368.2:c.-94C>G, NM_001025369.2:c.-94C>G, NM_001025370.2:c.-94C>G, NM_001033756.2:c.-94C>G, NM_001171622.1:c.-94C>G, NM_001171623.1:c.-634C>G, NM_001171624.1:c.-634C>G, NM_001171625.1:c.-634C>G, NM_001171626.1:c.-634C>G, NM_001171627.1:c.-634C>G, NM_001171628.1:c.-634C>G, NM_001171629.1:c.-634C>G, NM_001171630.1:c.-634C>G, NM_001204384.1:c.-634C>G, NM_001204385.1:c.-94C>G, NM_001287044.1:c.-1507C>G, NM_001317010.1:c.-634C>G, NM_003376.5:c.-94C>G, XM_005249363.1:c.-1507C>G
C > G
No VIP available No Clinical Annotations available VA
C > A
C > T
No VIP available No Clinical Annotations available VA
G > A
No VIP available No Clinical Annotations available VA
rs2032582 NC_000007.13:g.87160618A>C, NC_000007.13:g.87160618A>T, NC_000007.14:g.87531302A>C, NC_000007.14:g.87531302A>T, NG_011513.1:g.186947T>A, NG_011513.1:g.186947T>G, NM_000927.4:c.2677T>A, NM_000927.4:c.2677T>G, NP_000918.2:p.Ser893Ala, NP_000918.2:p.Ser893Thr, rs10228331, rs2229106, rs386553610, rs57135550, rs9641018
A > C
A > T
No VIP available No Clinical Annotations available VA
rs2070474 NC_000022.10:g.24891292C>G, NC_000022.11:g.24495324C>G, NG_012858.1:g.5042C>G, NM_016327.2:c.-80C>G, NR_028483.2:n.-250G>C, NR_028484.2:n.-250G>C, XM_005261633.1:c.-112C>G, XM_011530222.1:c.-80C>G, XM_011530223.1:c.-80C>G, XM_011530224.1:c.-80C>G, XM_011530225.1:c.-522C>G, XR_244378.1:n.265C>G, XR_937867.1:n.858C>G, rs199469575
C > G
No VIP available CA No Variant Annotations available
rs2070744 NC_000007.13:g.150690079C=, NC_000007.13:g.150690079C>T, NC_000007.14:g.150992991C=, NC_000007.14:g.150992991C>T, NG_011992.1:g.6933C=, NG_011992.1:g.6933C>T, NM_000603.4:c.-51-762C=, NM_000603.4:c.-51-762C>T, NM_001160109.1:c.-813C=, NM_001160109.1:c.-813C>T, NM_001160110.1:c.-813C=, NM_001160110.1:c.-813C>T, NM_001160111.1:c.-813C=, NM_001160111.1:c.-813C>T, XM_006716002.2:c.-813C=, XM_006716002.2:c.-813C>T, rs10333298, rs34629525, rs61324345
C > T
No VIP available No Clinical Annotations available VA
rs2071559 NC_000004.11:g.55992366A>G, NC_000004.12:g.55126199A>G, NG_012004.1:g.4397T>C, NM_002253.2:c.-906T>C, rs59863954
A > G
No VIP available No Clinical Annotations available VA
rs2072671 NC_000001.10:g.20915701A>C, NC_000001.11:g.20589208A>C, NM_001785.2:c.79A>C, NP_001776.1:p.Lys27Gln, rs57221291
A > C
No VIP available No Clinical Annotations available VA
rs2074087 NC_000016.10:g.16090375C=, NC_000016.10:g.16090375C>G, NC_000016.9:g.16184232C>G, NG_028268.1:g.145799C=, NG_028268.1:g.145799C>G, NM_004996.3:c.2461-30C>G, NM_004996.3:c.2461-30G>C, NT_187607.1:g.1748233G=, NT_187607.1:g.1748233G>C, XM_005255326.1:c.2461-30C>G, XM_005255327.1:c.2335-30C>G, XM_005255328.1:c.2323-30C>G, XM_005255329.1:c.2284-30C>G, XM_011522497.1:c.2437-30C>G, XM_011522497.1:c.2437-30G>C, XM_011522498.1:c.2368-30C>G, XM_011522498.1:c.2368-30G>C, rs57718684
C > G
No VIP available CA VA
rs2231142 NC_000004.11:g.89052323G>T, NC_000004.12:g.88131171G>T, NG_032067.2:g.105152C>A, NM_001257386.1:c.421C>A, NM_004827.2:c.421C>A, NP_001244315.1:p.Gln141Lys, NP_004818.2:p.Gln141Lys, XM_005263354.1:c.421C>A, XM_005263354.2:c.421C>A, XM_005263355.1:c.421C>A, XM_005263355.2:c.421C>A, XM_005263356.1:c.421C>A, XM_005263356.2:c.421C>A, XM_011532420.1:c.421C>A, XP_005263411.1:p.Gln141Lys, XP_005263412.1:p.Gln141Lys, XP_005263413.1:p.Gln141Lys, XP_011530722.1:p.Gln141Lys, rs12721641, rs28365035, rs3736117, rs52809243, rs58973676
G > T
No VIP available No Clinical Annotations available VA
rs2236225 NC_000014.8:g.64908845G>A, NC_000014.9:g.64442127G>A, NG_012450.1:g.59087G>A, NM_005956.3:c.1958G>A, NP_005947.3:p.Arg653Gln, XM_005267693.1:c.2126G>A, XP_005267750.1:p.Arg709Gln, rs117048039, rs17751608, rs17850560, rs52810262, rs56503831, rs58065500
G > A
No VIP available CA VA
rs2236722 NC_000015.10:g.51242798A>G, NC_000015.9:g.51534995A>G, NG_007982.1:g.100801T>C, NM_000103.3:c.115T>C, NM_031226.2:c.115T>C, NP_000094.2:p.Trp39Arg, NP_112503.1:p.Trp39Arg, XM_005254190.1:c.115T>C, XM_005254191.1:c.115T>C, XM_005254192.1:c.115T>C, XP_005254247.1:p.Trp39Arg, XP_005254248.1:p.Trp39Arg, XP_005254249.1:p.Trp39Arg, XR_932222.1:n.99-35185A>G, rs17703921, rs52795506, rs57951984
A > G
No VIP available CA VA
rs225440 NC_000021.8:g.43653053C>T, NC_000021.9:g.42232943C>T, NM_004915.3:c.286+7029C>T, NM_016818.2:c.286+7029C>T, NM_207174.1:c.319+7029C>T, NM_207627.1:c.292+7029C>T, NM_207628.1:c.220+7029C>T, NM_207629.1:c.277+7029C>T, XM_005261209.1:c.319+7029C>T, XM_011529806.1:c.319+7029C>T, XM_011529807.1:c.319+7029C>T, rs3827226, rs386562698, rs474673, rs56980987, rs872748
C > T
No VIP available No Clinical Annotations available VA
rs2266637 NC_000022.10:g.24376845C>T, NM_000853.3:c.505G>A, NM_001293807.1:c.463G>A, NM_001293808.1:c.151G>A, NM_001293809.1:c.151G>A, NM_001293810.1:c.151G>A, NM_001293811.1:c.151G>A, NM_001293812.1:c.151G>A, NM_001293813.1:c.201-228G>A, NM_001293814.1:c.113-228G>A, NP_000844.2:p.Val169Ile, NP_001280736.1:p.Val155Ile, NP_001280737.1:p.Val51Ile, NP_001280738.1:p.Val51Ile, NP_001280739.1:p.Val51Ile, NP_001280740.1:p.Val51Ile, NP_001280741.1:p.Val51Ile, NT_187633.1:g.271020C>T, XM_005261587.1:c.652G>A, XM_005261587.2:c.652G>A, XM_005261588.1:c.151G>A, XM_005261589.1:c.151G>A, XP_005261644.1:p.Val218Ile, XP_005261645.1:p.Val51Ile, XP_005261646.1:p.Val51Ile, rs56671512, rs762585649
C > T
No VIP available No Clinical Annotations available VA
rs2286455 NC_000004.11:g.16020162C>T, NC_000004.12:g.16018539C>T, NG_011696.1:g.70462G>A, NM_001145847.1:c.759G>A, NM_001145848.1:c.759G>A, NM_001145849.1:c.786G>A, NM_001145850.1:c.786G>A, NM_001145851.1:c.759G>A, NM_001145852.1:c.759G>A, NM_006017.2:c.786G>A, NP_001139319.1:p.Ala253=, NP_001139320.1:p.Ala253=, NP_001139321.1:p.Ala262=, NP_001139322.1:p.Ala262=, NP_001139323.1:p.Ala253=, NP_001139324.1:p.Ala253=, NP_006008.1:p.Ala262=, XM_005248194.1:c.786G>A, XM_005248195.1:c.759G>A, XM_005248195.3:c.759G>A, XM_005248196.1:c.759G>A, XM_005248196.3:c.759G>A, XM_006713974.2:c.552G>A, XM_011513890.1:c.786G>A, XM_011513891.1:c.786G>A, XM_011513892.1:c.786G>A, XM_011513893.1:c.786G>A, XM_011513894.1:c.786G>A, XM_011513895.1:c.786G>A, XM_011513896.1:c.786G>A, XM_011513897.1:c.786G>A, XM_011513898.1:c.786G>A, XM_011513899.1:c.759G>A, XM_011513900.1:c.786G>A, XM_011513901.1:c.786G>A, XM_011513902.1:c.786G>A, XM_011513903.1:c.579G>A, XM_011513904.1:c.513G>A, XP_005248251.1:p.Ala262=, XP_005248252.1:p.Ala253=, XP_005248253.1:p.Ala253=, XP_006714037.1:p.Ala184=, XP_011512192.1:p.Ala262=, XP_011512193.1:p.Ala262=, XP_011512194.1:p.Ala262=, XP_011512195.1:p.Ala262=, XP_011512196.1:p.Ala262=, XP_011512197.1:p.Ala262=, XP_011512198.1:p.Ala262=, XP_011512199.1:p.Ala262=, XP_011512200.1:p.Ala262=, XP_011512201.1:p.Ala253=, XP_011512202.1:p.Ala262=, XP_011512203.1:p.Ala262=, XP_011512204.1:p.Ala262=, XP_011512205.1:p.Ala193=, XP_011512206.1:p.Ala171=, rs56605149, rs60672150
C > T
No VIP available CA VA
rs2289310 NC_000010.10:g.79570873G>T, NC_000010.11:g.77811115G>T, NG_011484.1:g.120476C>A, NM_004747.3:c.4442C>A, NP_004738.3:p.Pro1481Gln, NT_187580.1:g.49807G>T, XM_005270276.1:c.4430C>A, XM_005270276.3:c.4430C>A, XM_006718056.2:c.3422C>A, XM_006725120.2:c.4430C>A, XM_006725122.2:c.3422C>A, XM_011540341.1:c.4265C>A, XM_011540342.1:c.4172C>A, XM_011540343.1:c.4112C>A, XM_011540344.1:c.4106C>A, XM_011540345.1:c.3977C>A, XM_011540346.1:c.4442C>A, XM_011540347.1:c.3524C>A, XM_011546575.1:c.4265C>A, XM_011546576.1:c.4172C>A, XM_011546577.1:c.4106C>A, XM_011546578.1:c.3977C>A, XM_011546579.1:c.4442C>A, XM_011546580.1:c.3524C>A, XP_005270333.1:p.Pro1477Gln, XP_006718119.1:p.Pro1141Gln, XP_006725183.1:p.Pro1477Gln, XP_006725185.1:p.Pro1141Gln, XP_011538643.1:p.Pro1422Gln, XP_011538644.1:p.Pro1391Gln, XP_011538645.1:p.Pro1371Gln, XP_011538646.1:p.Pro1369Gln, XP_011538647.1:p.Pro1326Gln, XP_011538648.1:p.Pro1481Gln, XP_011538649.1:p.Pro1175Gln, XP_011544877.1:p.Pro1422Gln, XP_011544878.1:p.Pro1391Gln, XP_011544879.1:p.Pro1369Gln, XP_011544880.1:p.Pro1326Gln, XP_011544881.1:p.Pro1481Gln, XP_011544882.1:p.Pro1175Gln
G > T
No VIP available No Clinical Annotations available VA
T > C
No VIP available CA VA
rs2291078 NC_000003.11:g.124458938T>A, NC_000003.12:g.124740091T>A, NG_017037.1:g.14726T>A, NM_000373.3:c.1050T>A, NP_000364.1:p.Val350=, NR_033434.1:n.1002T>A, NR_033437.1:n.1255T>A, XM_005247741.1:c.774T>A, XM_005247742.1:c.516T>A, XM_005247743.1:c.516T>A, XM_005247744.1:c.448+1852T>A, XP_005247798.1:p.Val258=, XP_005247799.1:p.Val172=, XP_005247800.1:p.Val172=, rs17843836, rs199469592
T > -
T > A
No VIP available CA VA
rs2292997 NC_000003.11:g.183724072G>A, NC_000003.12:g.184006284G>A, NM_001023587.2:c.129+7980C>T, NM_001320032.1:c.-1403+7980C>T, NM_005688.3:c.129+7980C>T, NR_046570.1:n.-54G>A, NR_135125.1:n.315+7980C>T, XM_005247058.1:c.129+7980C>T, XM_005247058.3:c.129+7980C>T, XM_005247059.1:c.129+7980C>T, XM_005247059.3:c.129+7980C>T, XM_005247060.1:c.129+7980C>T, XM_005247061.1:c.129+7980C>T, XM_005247062.1:c.-1403+7980C>T, XM_011512314.1:c.129+7980C>T, XM_011512315.1:c.129+7980C>T, XM_011512316.1:c.-1403+7980C>T, rs17750557, rs56715946
G > A
No VIP available CA VA
rs2293347 NC_000007.13:g.55268916C>T, NC_000007.14:g.55201223C>T, NG_007726.3:g.187192C>T, NM_005228.3:c.2982C>T, NP_005219.2:p.Asp994=, XM_005271746.1:c.2847C>T, XM_005271747.1:c.2823C>T, XP_005271803.1:p.Asp949=, XP_005271804.1:p.Asp941=, rs10435501, rs17337472, rs386564009, rs56649858, rs61150996
C > T
No VIP available CA VA
rs2297595 NC_000001.10:g.98165091T>C, NC_000001.11:g.97699535T>C, NG_008807.2:g.226525A>G, NM_000110.3:c.496A>G, NP_000101.2:p.Met166Val, XM_005270561.1:c.385A>G, XM_005270562.1:c.496A>G, XM_005270562.3:c.496A>G, XM_005270563.1:c.496A>G, XM_005270564.1:c.496A>G, XM_006710397.2:c.496A>G, XP_005270618.1:p.Met129Val, XP_005270619.1:p.Met166Val, XP_005270619.2:p.Met166Val, XP_005270620.1:p.Met166Val, XP_005270621.1:p.Met166Val, XP_006710460.1:p.Met166Val, rs118014431, rs199469517, rs52827192, rs61243782
T > C
No VIP available No Clinical Annotations available VA
rs2302273 NC_000005.10:g.150155692G>A, NC_000005.9:g.149535255G>A, NG_023367.1:g.5168C>T, NM_002609.3:c.-302C>T, XM_005268464.1:c.-448C>T, XM_005268464.2:c.-448C>T, XM_011537659.1:c.-769C>T, rs56934659
G > A
No VIP available No Clinical Annotations available VA
rs2305948 NC_000004.11:g.55979558C>T, NC_000004.12:g.55113391C>T, NG_012004.1:g.17205G>A, NM_002253.2:c.889G>A, NP_002244.1:p.Val297Ile, rs386564519, rs52830740, rs56532927, rs56973163
C > T
No VIP available No Clinical Annotations available VA
rs2306283 NC_000012.11:g.21329738A>G, NC_000012.12:g.21176804A>G, NG_011745.1:g.50611A>G, NM_006446.4:c.388A>G, NP_006437.3:p.Asn130Asp, rs17389242, rs52832430, rs60767041
A > G
No VIP available No Clinical Annotations available VA
C > G
No VIP available No Clinical Annotations available VA
rs2465403 NC_000008.10:g.120090827G>A, NC_000008.11:g.119078588G>A, NM_006438.3:c.149-11092G>A, XM_005250756.1:c.-59-11092G>A, XM_005250756.2:c.-59-11092G>A, XM_011516795.1:c.-59-11092G>A
G > A
No VIP available CA VA
rs25487 NC_000019.10:g.43551574T>C, NC_000019.9:g.44055726T>C, NG_033799.1:g.29005A>G, NM_006297.2:c.1196A>G, NP_006288.2:p.Gln399Arg, rs11553658, rs17435395, rs3817410, rs386493716, rs57378728
T > C
No VIP available CA VA
rs25648 NC_000006.11:g.43738977C>T, NC_000006.12:g.43771240C>T, NG_008732.1:g.6025C>T, NM_001025366.2:c.534C>T, NM_001025367.2:c.534C>T, NM_001025368.2:c.534C>T, NM_001025369.2:c.534C>T, NM_001025370.2:c.534C>T, NM_001033756.2:c.534C>T, NM_001171622.1:c.534C>T, NM_001171623.1:c.-7C>T, NM_001171624.1:c.-7C>T, NM_001171625.1:c.-7C>T, NM_001171626.1:c.-7C>T, NM_001171627.1:c.-7C>T, NM_001171628.1:c.-7C>T, NM_001171629.1:c.-7C>T, NM_001171630.1:c.-7C>T, NM_001204384.1:c.-7C>T, NM_001204385.1:c.534C>T, NM_001287044.1:c.-880C>T, NM_001317010.1:c.-7C>T, NM_003376.5:c.534C>T, NP_001020537.2:p.Ser178=, NP_001020538.2:p.Ser178=, NP_001020539.2:p.Ser178=, NP_001020540.2:p.Ser178=, NP_001020541.2:p.Ser178=, NP_001028928.1:p.Ser178=, NP_001165093.1:p.Ser178=, NP_001191314.1:p.Ser178=, NP_003367.4:p.Ser178=, XM_005249363.1:c.-880C>T
C > T
No VIP available No Clinical Annotations available VA
A > G
No VIP available No Clinical Annotations available VA
A > C
No VIP available No Clinical Annotations available VA
rs2661280 NC_000001.10:g.163113375G>C, NC_000001.11:g.163143585G>C, NG_027731.2:g.183207C>G, NM_001195303.2:c.*3757C>G, NM_001254748.1:c.*3757C>G, NM_001254749.1:c.*3757C>G, NM_003617.3:c.*3757C>G, rs17361582, rs56558782, rs57479307, rs60251204
G > C
No VIP available No Clinical Annotations available VA
rs2669429 NC_000008.10:g.105463690A>G, NC_000008.11:g.104451462A>G, NG_008840.1:g.20588T>C, NM_001385.2:c.265-58T>C, XM_005250818.1:c.265-58T>C, XM_005250818.2:c.265-58T>C, XM_005250819.1:c.265-58T>C, XM_006716518.2:c.265-3959T>C, XM_011516903.1:c.265-58T>C, XM_011516904.1:c.265-58T>C, rs17246278, rs199469604, rs3750186, rs60334774
A > G
No VIP available No Clinical Annotations available VA
rs2740574 NC_000007.13:g.99382096C>T, NC_000007.14:g.99784473C>T, NG_008421.1:g.4713G>A, NM_001202855.2:c.-392G>A, NM_017460.5:c.-392G>A, XM_011515841.1:c.-392G>A, XM_011515842.1:c.-392G>A, rs3176920, rs36231114, rs59393892
C > T
No VIP available No Clinical Annotations available VA
T > C
No VIP available CA VA
rs2847153 NC_000018.10:g.661647G>A, NC_000018.9:g.661647G>A, NG_028255.1:g.9044G>A, NM_001071.2:c.280-499G>A, XM_005258137.1:c.280-499G>A, XM_005258138.1:c.205+3700G>A, rs57253344
G > A
No VIP available No Clinical Annotations available VA
G > C
No VIP available CA VA
rs2854744 NC_000007.13:g.45961075G>T, NC_000007.14:g.45921476G>T, NG_011508.1:g.4797C>A, NM_000598.4:c.-336C>A, NM_001013398.1:c.-336C>A, XM_005249743.1:c.-336C>A
G > T
No VIP available No Clinical Annotations available VA
rs2854746 NC_000007.13:g.45960645G>C, NC_000007.14:g.45921046G>C, NG_011508.1:g.5227C>G, NM_000598.4:c.95C>G, NM_001013398.1:c.95C>G, NP_000589.2:p.Ala32Gly, NP_001013416.1:p.Ala32Gly, XM_005249743.1:c.9+86C>G, rs11537918, rs17849244, rs17856581
G > C
No VIP available No Clinical Annotations available VA
rs2959023 NC_000008.10:g.105479149A>G, NC_000008.11:g.104466921A>G, NG_008840.1:g.5129T>C, NM_001385.2:c.-1T>C, XM_005250818.1:c.-1T>C, XM_005250818.2:c.-1T>C, XM_005250819.1:c.-1T>C, XM_006716518.2:c.-1T>C, XM_011516903.1:c.-1T>C, XM_011516904.1:c.-1T>C, XR_928507.1:n.112+934A>G, rs199469597, rs58165447
A > G
No VIP available CA VA
rs2960436 NC_000007.13:g.45977282G>A, NC_000007.14:g.45937683G>A, rs11535201, rs17187020, rs56987504
G > A
No VIP available CA VA
rs3025039 NC_000006.11:g.43752536C>T, NC_000006.12:g.43784799C>T, NG_008732.1:g.19584C>T, NM_001025366.2:c.*237C>T, NM_001025367.2:c.*237C>T, NM_001025368.2:c.*237C>T, NM_001025369.2:c.*253C>T, NM_001025370.2:c.*237C>T, NM_001033756.2:c.*171C>T, NM_001171622.1:c.*237C>T, NM_001171623.1:c.*237C>T, NM_001171624.1:c.*237C>T, NM_001171625.1:c.*237C>T, NM_001171626.1:c.*237C>T, NM_001171627.1:c.*253C>T, NM_001171628.1:c.*237C>T, NM_001171629.1:c.*171C>T, NM_001171630.1:c.*237C>T, NM_001204384.1:c.*237C>T, NM_001204385.1:c.*237C>T, NM_001287044.1:c.*237C>T, NM_001317010.1:c.*171C>T, NM_003376.5:c.*237C>T, XM_005249363.1:c.*237C>T, rs11575898
C > T
No VIP available No Clinical Annotations available VA
rs307805 NC_000005.10:g.180650487T>C, NC_000005.9:g.180077487T>C, NG_011536.1:g.4138A>G, NM_002020.4:c.-942A>G, NM_182925.4:c.-942A>G, XM_011534482.1:c.-942A>G, XM_011534483.1:c.-289A>G, rs1309960, rs57113127
T > C
No VIP available No Clinical Annotations available VA
rs307822 NC_000005.10:g.180601717T>C, NC_000005.9:g.180028717T>C, NG_011536.1:g.52908A>G, NM_182925.4:c.*1475A>G, XM_011534477.1:c.*1475A>G, XM_011534478.1:c.*1475A>G, XM_011534482.1:c.*1475A>G, XM_011534483.1:c.*1475A>G, XM_011534484.1:c.*1475A>G, rs1309977
T > C
No VIP available No Clinical Annotations available VA
rs3110697 NC_000007.13:g.45955029A>G, NC_000007.14:g.45915430A>G, NG_011508.1:g.10843T>C, NM_000598.4:c.751-485T>C, NM_001013398.1:c.769-485T>C, XM_005249743.1:c.460-485T>C, rs386579587, rs59896265
A > G
No VIP available No Clinical Annotations available VA
rs3130 NC_000004.11:g.15969938T>C, NC_000004.12:g.15968315T>C, NG_011696.1:g.120686A>G, NM_001145847.1:c.*1078A>G, NM_001145848.1:c.*1078A>G, NM_001145849.1:c.*1078A>G, NM_001145850.1:c.*1078A>G, NM_001145851.1:c.*1078A>G, NM_001145852.1:c.*1078A>G, NM_006017.2:c.*1078A>G, XM_005248194.1:c.*1078A>G, XM_005248195.1:c.*1078A>G, XM_005248195.3:c.*1078A>G, XM_005248196.1:c.*1078A>G, XM_005248196.3:c.*1078A>G, XM_006713974.2:c.*1078A>G, XM_011513890.1:c.*1078A>G, XM_011513891.1:c.*1078A>G, XM_011513892.1:c.*1078A>G, XM_011513893.1:c.*1078A>G, XM_011513894.1:c.*1078A>G, XM_011513895.1:c.*1078A>G, XM_011513896.1:c.*1078A>G, XM_011513897.1:c.*1078A>G, XM_011513900.1:c.*1078A>G, XM_011513901.1:c.*1078A>G, XM_011513902.1:c.*1078A>G, XM_011513903.1:c.*1078A>G, XM_011513904.1:c.*1078A>G, rs11552440, rs17477709, rs3194369, rs56565902, rs60023481, rs60646405, rs7752
T > C
No VIP available No Clinical Annotations available VA
rs3136228 NC_000002.11:g.48009816T>G, NC_000002.12:g.47782677T>G, NG_007111.1:g.4531T>G, NM_000179.2:c.-557T>G, NM_001281492.1:c.-557T>G, NM_001281493.1:c.-1293T>G, NM_001281494.1:c.-2071T>G, XM_005264271.1:c.-1599T>G, XM_011532798.1:c.-1253T>G, XM_011532799.1:c.-1139T>G, XM_011532800.1:c.-592T>G, rs58009211
T > G
No VIP available No Clinical Annotations available VA
C > T
No VIP available No Clinical Annotations available VA
rs3212948 NC_000019.10:g.45421104G>C, NC_000019.9:g.45924362G>C, NG_015839.2:g.62725C>G, NM_001166049.1:c.321+74C>G, NM_001983.3:c.321+74C>G, NM_202001.2:c.321+74C>G, XM_005258634.1:c.321+74C>G, XM_005258635.1:c.321+74C>G, XM_005258635.2:c.321+74C>G, XM_005258636.1:c.321+74C>G, XM_005258636.3:c.321+74C>G, XM_005258637.1:c.321+74C>G, XM_005258638.1:c.106-677C>G, XM_011526610.1:c.321+74C>G, rs3737560, rs57311942
G > C
No VIP available No Clinical Annotations available VA
rs3212986 NC_000019.10:g.45409478C>A, NC_000019.9:g.45912736C>A, NG_015839.2:g.74351G>T, NM_001166049.1:c.*197G>T, NM_001297590.1:c.1516C>A, NM_001983.3:c.*197G>T, NM_012099.1:c.1510C>A, NP_001284519.1:p.Gln506Lys, NP_036231.1:p.Gln504Lys, XM_005258425.1:c.1516C>A, XM_005258638.1:c.*197G>T, XP_005258482.1:p.Gln506Lys, rs386580934, rs60333438
C > A
C > T
No VIP available CA VA
rs3218592 NC_000006.11:g.111643838C>T, NC_000006.12:g.111322635C>T, NM_001286431.1:c.8051G>A, NM_001286432.1:c.8051G>A, NM_002912.4:c.8285G>A, NP_001273360.1:p.Arg2684Gln, NP_001273361.1:p.Arg2684Gln, NP_002903.3:p.Arg2762Gln, XM_005267088.1:c.8051G>A, XM_005267089.1:c.7919G>A, XM_006715543.2:c.8285G>A, XM_006715544.2:c.8051G>A, XM_011536028.1:c.8366G>A, XM_011536029.1:c.8363G>A, XM_011536030.1:c.8288G>A, XM_011536031.1:c.8132G>A, XM_011536032.1:c.8132G>A, XP_005267145.1:p.Arg2684Gln, XP_005267146.1:p.Arg2640Gln, XP_006715606.1:p.Arg2762Gln, XP_006715607.1:p.Arg2684Gln, XP_011534330.1:p.Arg2789Gln, XP_011534331.1:p.Arg2788Gln, XP_011534332.1:p.Arg2763Gln, XP_011534333.1:p.Arg2711Gln, XP_011534334.1:p.Arg2711Gln, XR_942871.1:n.2046-15110C>T, rs17511399, rs386581148, rs52802396
C > T
No VIP available No Clinical Annotations available VA
rs329007 NC_000018.10:g.9522608G>A, NC_000018.9:g.9522606G>A, NM_006788.3:c.1053+99G>A, XM_005258080.1:c.1053+99G>A, rs59437962
G > A
No VIP available No Clinical Annotations available VA
rs34116584 NC_000002.11:g.241808314C>A, NC_000002.11:g.241808314C>G, NC_000002.11:g.241808314C>T, NC_000002.12:g.240868897C>A, NC_000002.12:g.240868897C>G, NC_000002.12:g.240868897C>T, NG_008005.1:g.5153C>A, NG_008005.1:g.5153C>G, NG_008005.1:g.5153C>T, NM_000030.2:c.32C>A, NM_000030.2:c.32C>G, NM_000030.2:c.32C>T, NP_000021.1:p.Pro11Arg, NP_000021.1:p.Pro11His, NP_000021.1:p.Pro11Leu, XR_924060.1:n.405+1336G>A, XR_924060.1:n.405+1336G>C, XR_924060.1:n.405+1336G>T
C > A
C > G
C > T
No VIP available CA VA
rs351855 NC_000005.10:g.177093242G>A, NC_000005.9:g.176520243G>A, NG_012067.1:g.11323G>A, NM_001291980.1:c.1097+65G>A, NM_002011.4:c.1162G>A, NM_022963.3:c.1058-90G>A, NM_213647.2:c.1162G>A, NP_002002.3:p.Gly388Arg, NP_998812.1:p.Gly388Arg, XM_005265837.1:c.1258G>A, XM_005265838.1:c.1162G>A, XM_005265838.2:c.1162G>A, XM_005265839.1:c.1097+65G>A, XM_011534464.1:c.1255G>A, XM_011534465.1:c.844G>A, XP_005265894.1:p.Gly420Arg, XP_005265895.1:p.Gly388Arg, XP_011532766.1:p.Gly419Arg, XP_011532767.1:p.Gly282Arg, XR_941090.1:n.1207G>A, rs117475361, rs56695235
G > A
No VIP available No Clinical Annotations available VA
T > C
No VIP available CA VA
rs370457585 NC_000001.10:g.40126852C>G, NC_000001.10:g.40126852C>T, NC_000001.11:g.39661180C>G, NC_000001.11:g.39661180C>T, NM_032526.2:c.640G>A, NM_032526.2:c.640G>C, NP_115915.1:p.Ala214Pro, NP_115915.1:p.Ala214Thr
C > G
C > T
No VIP available CA VA
rs371194629 NC_000006.11:g.29798581_29798582insATTTGT, NC_000006.11:g.29798581_29798582insATTTGTTCATGCCT, NC_000006.12:g.29830804_29830805insATTTGT, NC_000006.12:g.29830804_29830805insATTTGTTCATGCCT, NG_029039.1:g.8826_8827insATTTGT, NG_029039.1:g.8826_8827insATTTGTTCATGCCT, NM_002127.5:c.*65_*66insATTTGT, NM_002127.5:c.*65_*66insATTTGTTCATGCCT, NT_113891.3:g.1314366_1314381insATTTGT, NT_113891.3:g.1314366_1314381insATTTGTTCATGCCT, NT_167244.2:g.1096416_1096431insATTTGT, NT_167244.2:g.1096416_1096431insATTTGTTCATGCCT, NT_167245.1:g.1099202_1099203insATTTGT, NT_167245.1:g.1099202_1099203insATTTGTTCATGCCT, NT_167245.2:g.1093617_1093618insATTTGT, NT_167245.2:g.1093617_1093618insATTTGTTCATGCCT, NT_167246.1:g.1098910_1098911insATTTGT, NT_167246.1:g.1098910_1098911insATTTGTTCATGCCT, NT_167246.2:g.1093290_1093291insATTTGT, NT_167246.2:g.1093290_1093291insATTTGTTCATGCCT, NT_167247.1:g.1098860_1098861insATTTGT, NT_167247.1:g.1098860_1098861insATTTGTTCATGCCT, NT_167247.2:g.1093275_1093276insATTTGT, NT_167247.2:g.1093275_1093276insATTTGTTCATGCCT, NT_167248.2:g.1093570_1093585insATTTGT, NT_167248.2:g.1093570_1093585insATTTGTTCATGCCT, NT_167249.2:g.1136835_1136850insATTTGT, NT_167249.2:g.1136835_1136850insATTTGTTCATGCCT, XM_005249055.1:c.*65_*66insATTTGT, XM_005249055.1:c.*65_*66insATTTGTTCATGCCT, XM_005249056.1:c.*65_*66insATTTGT, XM_005249056.1:c.*65_*66insATTTGTTCATGCCT, XM_005249057.1:c.*280_*281insATTTGT, XM_005249057.1:c.*280_*281insATTTGTTCATGCCT, XM_005249058.1:c.*65_*66insATTTGT, XM_005249058.1:c.*65_*66insATTTGTTCATGCCT, XM_005272810.1:c.*65_*67insATTTGT, XM_005272810.1:c.*65_*67insATTTGTTCATGCCT, XM_005274964.1:c.*65_*66insATTTGT, XM_005274964.1:c.*65_*66insATTTGTTCATGCCT, XM_005274965.1:c.*65_*66insATTTGT, XM_005274965.1:c.*65_*66insATTTGTTCATGCCT, XM_005274966.1:c.*280_*281insATTTGT, XM_005274966.1:c.*280_*281insATTTGTTCATGCCT, XM_005274967.1:c.*65_*66insATTTGT, XM_005274967.1:c.*65_*66insATTTGTTCATGCCT, XM_005275119.1:c.*65_*66insATTTGT, XM_005275119.1:c.*65_*66insATTTGTTCATGCCT, XM_005275120.1:c.*65_*66insATTTGT, XM_005275120.1:c.*65_*66insATTTGTTCATGCCT, XM_005275121.1:c.*280_*281insATTTGT, XM_005275121.1:c.*280_*281insATTTGTTCATGCCT, XM_005275122.1:c.*65_*66insATTTGT, XM_005275122.1:c.*65_*66insATTTGTTCATGCCT, XM_005275246.1:c.*65_*66insATTTGT, XM_005275246.1:c.*65_*66insATTTGTTCATGCCT, XM_005275247.1:c.*65_*66insATTTGT, XM_005275247.1:c.*65_*66insATTTGTTCATGCCT, XM_005275248.1:c.*280_*281insATTTGT, XM_005275248.1:c.*280_*281insATTTGTTCATGCCT, XM_005275249.1:c.*65_*66insATTTGT, XM_005275249.1:c.*65_*66insATTTGTTCATGCCT, XM_005275394.1:c.*76_*80insATTTGT, XM_005275394.1:c.*76_*80insATTTGTTCATGCCT, XM_005275549.1:c.*76_*80insATTTGT, XM_005275549.1:c.*76_*80insATTTGTTCATGCCT, XM_005275550.1:c.*76_*80insATTTGT, XM_005275550.1:c.*76_*80insATTTGTTCATGCCT, XM_005275551.1:c.*291_*295insATTTGT, XM_005275551.1:c.*291_*295insATTTGTTCATGCCT, XM_005275552.1:c.*76_*80insATTTGT, XM_005275552.1:c.*76_*80insATTTGTTCATGCCT, XM_011547651.1:c.*65_*66insATTTGT, XM_011547651.1:c.*65_*66insATTTGTTCATGCCT, XM_011547882.1:c.*65_*66insATTTGT, XM_011547882.1:c.*65_*66insATTTGTTCATGCCT, XM_011548048.1:c.*65_*66insATTTGT, XM_011548048.1:c.*65_*66insATTTGTTCATGCCT, XM_011548236.1:c.*65_*80insATTTGT, XM_011548236.1:c.*65_*80insATTTGTTCATGCCT, XM_011548237.1:c.*65_*80insATTTGT, XM_011548237.1:c.*65_*80insATTTGTTCATGCCT, XM_011548430.1:c.*65_*80insATTTGT, XM_011548430.1:c.*65_*80insATTTGTTCATGCCT, XM_011548431.1:c.*65_*80insATTTGT, XM_011548431.1:c.*65_*80insATTTGTTCATGCCT, XR_241896.1:n.1692-1_1692insATTTGT, XR_241896.1:n.1692-1_1692insATTTGTTCATGCCT, XR_246963.1:n.1612-1_1613insATTTGT, XR_246963.1:n.1612-1_1613insATTTGTTCATGCCT, XR_247353.1:n.1692-1_1692insATTTGT, XR_247353.1:n.1692-1_1692insATTTGTTCATGCCT, XR_247370.1:n.1692-1_1692insATTTGT, XR_247370.1:n.1692-1_1692insATTTGTTCATGCCT, XR_247389.1:n.1692-1_1692insATTTGT, XR_247389.1:n.1692-1_1692insATTTGTTCATGCCT, XR_247402.1:n.1622_1626insATTTGT, XR_247402.1:n.1622_1626insATTTGTTCATGCCT, XR_247423.1:n.1680_1684insATTTGT, XR_247423.1:n.1680_1684insATTTGTTCATGCCT
No VIP available No Clinical Annotations available VA
rs3740066 NC_000010.10:g.101604207C>T, NC_000010.11:g.99844450C>T, NG_011798.1:g.66745C>T, NM_000392.4:c.3972C>T, NP_000383.1:p.Ile1324=, XM_005269536.1:c.3693C>T, XM_006717630.2:c.3276C>T, XP_005269593.1:p.Ile1231=, XP_006717693.1:p.Ile1092=, XR_945604.1:n.4161C>T, XR_945605.1:n.4036C>T, rs12780340, rs17216303, rs59292214
C > T
No VIP available CA VA
rs374150125 NC_000001.10:g.40129002G>A, NC_000001.11:g.39663330G>A, NM_032526.2:c.538C>T, NP_115915.1:p.Arg180Ter
G > A
No VIP available CA VA
rs3749438 NC_000003.11:g.183705184G>A, NC_000003.12:g.183987396G>A, NM_001023587.2:c.591+374C>T, NM_001320032.1:c.-941+374C>T, NM_005688.3:c.591+374C>T, NR_135125.1:n.777+374C>T, XM_005247058.1:c.591+374C>T, XM_005247058.3:c.591+374C>T, XM_005247059.1:c.591+374C>T, XM_005247059.3:c.591+374C>T, XM_005247060.1:c.591+374C>T, XM_005247061.1:c.591+374C>T, XM_005247062.1:c.-941+374C>T, XM_011512314.1:c.591+374C>T, XM_011512315.1:c.591+374C>T, XM_011512316.1:c.-941+374C>T, rs117658700, rs17218232, rs60372003
G > A
No VIP available No Clinical Annotations available VA
C > A
C > T
No VIP available CA VA
rs3772809 NC_000003.11:g.124462824A>G, NC_000003.12:g.124743977A>G, NG_017037.1:g.18612A>G, NM_000373.3:c.1336A>G, NP_000364.1:p.Ile446Val, NR_033434.1:n.1288A>G, NR_033437.1:n.1541A>G, XM_005247741.1:c.1060A>G, XM_005247742.1:c.802A>G, XM_005247743.1:c.802A>G, XM_005247744.1:c.511A>G, XP_005247798.1:p.Ile354Val, XP_005247799.1:p.Ile268Val, XP_005247800.1:p.Ile268Val, XP_005247801.1:p.Ile171Val, rs17843849, rs52824449
A > -
A > G
No VIP available CA VA
rs3772810 NC_000003.11:g.124462959A>G, NC_000003.12:g.124744112A>G, NG_017037.1:g.18747A>G, NM_000373.3:c.*28A>G, NR_033434.1:n.1423A>G, NR_033437.1:n.1676A>G, XM_005247741.1:c.*28A>G, XM_005247742.1:c.*28A>G, XM_005247743.1:c.*28A>G, XM_005247744.1:c.*28A>G, rs17843850
A > -
A > G
No VIP available No Clinical Annotations available VA
rs3812718 AB093548.1:c.603-91G>A, NC_000002.11:g.166909544C>T, NC_000002.12:g.166053034C>T, NG_011906.1:g.25606G>A, NM_001165963.1:c.603-91G>A, NM_001165964.1:c.603-91G>A, NM_001202435.1:c.603-91G>A, NM_006920.4:c.603-91G>A, XM_011511598.1:c.603-91G>A, XM_011511599.1:c.603-91G>A, XM_011511600.1:c.603-91G>A, XM_011511601.1:c.603-91G>A, XM_011511602.1:c.603-91G>A, XM_011511603.1:c.603-91G>A, XM_011511604.1:c.603-91G>A, XM_011511605.1:c.603-91G>A, XM_011511606.1:c.603-91G>A, XM_011511607.1:c.603-91G>A, XR_922981.1:n.787-91G>A, rs57229005
C > T
No VIP available CA VA
rs3917412 NC_000001.10:g.169700502T>C, NC_000001.11:g.169731361T>C, NG_012124.1:g.7719A>G, NM_000450.2:c.529+474A>G, rs56521004, rs57050939, rs60581130
T > C
No VIP available No Clinical Annotations available VA
G > A
G > C
rs3918290 NC_000001.10:g.97915614C>T, NC_000001.11:g.97450058C>T, NG_008807.2:g.476002G>A, NM_000110.3:c.1905+1G>A, XM_005270561.1:c.1794+1G>A, XM_005270562.1:c.1689+1G>A, XM_005270562.3:c.1689+1G>A, XM_005270563.1:c.1905+1G>A, XM_006710397.2:c.1905+1G>A, rs199469548, rs386589337
C > G
C > T
No VIP available No Clinical Annotations available VA
rs4073 NC_000004.11:g.74606024A>T, NC_000004.12:g.73740307A>T, NG_029889.1:g.4802A>T, NM_000584.3:c.-352A>T
A > T
No VIP available CA VA
rs4149056 NC_000012.11:g.21331549T>C, NC_000012.12:g.21178615T>C, NG_011745.1:g.52422T>C, NM_006446.4:c.521T>C, NP_006437.3:p.Val174Ala, rs52816141, rs60037639
T > C
No VIP available No Clinical Annotations available VA
rs4243761 NC_000015.10:g.26037644G>T, NC_000015.9:g.26282791G>T, NR_040082.1:n.896-11481G>T, rs17558024, rs61389947
G > T
No VIP available No Clinical Annotations available VA
A > G
No VIP available No Clinical Annotations available VA
rs4402960 NC_000003.11:g.185511687G>T, NC_000003.12:g.185793899G>T, NG_011602.1:g.36141C>A, NM_001007225.1:c.239+29254C>A, NM_001291869.1:c.239+29254C>A, NM_001291872.1:c.50+27113C>A, NM_001291873.1:c.50+27113C>A, NM_001291874.1:c.50+27113C>A, NM_001291875.1:c.-106+27113C>A, NM_006548.4:c.239+29254C>A, XM_005247073.1:c.50+27113C>A, XM_005247074.1:c.50+27113C>A, XM_005247075.1:c.50+27113C>A, XM_011512338.1:c.239+29254C>A, XM_011512339.1:c.239+29254C>A, XM_011512341.1:c.239+29254C>A, XR_427358.2:n.318+29254C>A, rs58419650
G > T
No VIP available No Clinical Annotations available VA
rs4426527 NC_000002.11:g.241817516A>G, NC_000002.12:g.240878099A>G, NG_008005.1:g.14355A>G, NM_000030.2:c.1020A>G, NP_000021.1:p.Ile340Met, rs17501831
A > G
rs45445694 NC_000018.10:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NC_000018.9:g.657646_657673CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NG_028255.1:g.5043_5070CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], NM_001012716.2:c.*34+169_*34+196CGGGACGGAGGCAGGCCAAGTGGCGCGG[2][3][4][7][8][9], NM_001071.2:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258137.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], XM_005258138.1:c.-97_-70CCGCGCCACTTGGCCTGCCTCCGTCCCG[2][3][4][7][8][9], rs34743033 (retired)
No VIP available No Clinical Annotations available VA
rs45589337 NC_000001.10:g.98144726T>C, NC_000001.11:g.97679170T>C, NG_008807.2:g.246890A>G, NM_000110.3:c.775A>G, NP_000101.2:p.Lys259Glu, XM_005270561.1:c.664A>G, XM_005270562.1:c.775A>G, XM_005270562.3:c.775A>G, XM_005270563.1:c.775A>G, XM_005270564.1:c.775A>G, XM_006710397.2:c.775A>G, XP_005270618.1:p.Lys222Glu, XP_005270619.1:p.Lys259Glu, XP_005270619.2:p.Lys259Glu, XP_005270620.1:p.Lys259Glu, XP_005270621.1:p.Lys259Glu, XP_006710460.1:p.Lys259Glu, rs59034382
T > C
No VIP available CA VA
rs4646 NC_000015.10:g.51210647A>C, NC_000015.9:g.51502844A>C, NG_007982.1:g.132952T>G, NM_000103.3:c.*161T>G, NM_031226.2:c.*161T>G, XM_005254190.1:c.*161T>G, XM_005254191.1:c.*161T>G, XM_005254192.1:c.*161T>G, XR_932222.1:n.99-67336A>C, rs16964193, rs3191019, rs58335330
A > C
No VIP available No Clinical Annotations available VA
rs470119 NC_000022.10:g.50966914T>C, NC_000022.11:g.50528485T>C, NG_011860.1:g.6601A>G, NG_016235.1:g.2955A>G, NM_001113755.2:c.516+27A>G, NM_001113756.2:c.516+27A>G, NM_001257988.1:c.516+27A>G, NM_001257989.1:c.516+27A>G, NM_001953.4:c.516+27A>G, rs56469193, rs58161200
T > C
T > G
No VIP available No Clinical Annotations available VA
rs4880 NC_000006.11:g.160113872A>G, NC_000006.12:g.159692840A>G, NG_008729.1:g.5482T>C, NM_000636.2:c.47T>C, NM_001024465.1:c.47T>C, NM_001024466.1:c.47T>C, NP_000627.2:p.Val16Ala, NP_001019636.1:p.Val16Ala, NP_001019637.1:p.Val16Ala, rs1141717, rs11551083, rs116851270, rs17362379, rs17405198, rs17856520, rs1799725, rs3205539, rs386596107
A > G
No VIP available No Clinical Annotations available VA
rs4932551 NC_000015.10:g.91528728G>C, NC_000015.9:g.92071958G>C, rs17772730, rs56529178, rs57899076, rs58182249
G > C
No VIP available No Clinical Annotations available VA
A > G
No VIP available No Clinical Annotations available VA
rs4970722 NC_000001.10:g.98352053A>T, NC_000001.11:g.97886497A>T, NG_008807.2:g.39563T>A, NM_000110.3:c.40-3123T>A, NM_001160301.1:c.40-3123T>A, XM_005270561.1:c.39+34387T>A, XM_005270562.1:c.40-3123T>A, XM_005270562.3:c.40-3123T>A, XM_005270563.1:c.40-3123T>A, XM_005270564.1:c.40-3123T>A, XM_006710397.2:c.40-3123T>A, rs56417891, rs60365769, rs61301156
A > T
No VIP available No Clinical Annotations available VA
rs5009910 NC_000002.11:g.31249014T>C, NC_000002.12:g.31026148T>C, NM_001253826.1:c.315-59846A>G, NM_001253827.1:c.70-33141A>G, NM_024572.3:c.130-33141A>G, NR_045602.1:n.903-33141A>G, XM_005264559.1:c.25-33141A>G, XM_011533104.1:c.448-33141A>G, XM_011533105.1:c.70-33141A>G, XM_011533106.1:c.43-33141A>G, rs56597185, rs59566663, rs60531112
T > C
No VIP available No Clinical Annotations available VA
rs501415 NC_000018.10:g.56651611A>G, NC_000018.9:g.54318842A>G, NM_015285.2:c.-20+35A>G, NM_052834.2:c.-20+35A>G, XM_005266673.1:c.-20+35A>G, XM_006722431.1:c.-207A>G, XM_011525888.1:c.-20+35A>G
A > G
No VIP available No Clinical Annotations available VA
rs55674432 NC_000001.10:g.97564172C>A, NC_000001.11:g.97098616C>A, NG_008807.2:g.827444G>T, NM_000110.3:c.2639G>T, NP_000101.2:p.Gly880Val, NR_046590.1:n.64+2630C>A, XM_005270561.1:c.2528G>T, XM_005270562.1:c.2423G>T, XM_005270562.3:c.2423G>T, XP_005270618.1:p.Gly843Val, XP_005270619.1:p.Gly808Val, XP_005270619.2:p.Gly808Val
C > A
No VIP available CA VA
rs55886062 NC_000001.10:g.97981343A>C, NC_000001.11:g.97515787A>C, NG_008807.2:g.410273T>G, NM_000110.3:c.1679T>G, NP_000101.2:p.Ile560Ser, XM_005270561.1:c.1568T>G, XM_005270562.1:c.1524+33773T>G, XM_005270562.3:c.1524+33773T>G, XM_005270563.1:c.1679T>G, XM_005270564.1:c.1679T>G, XM_006710397.2:c.1679T>G, XP_005270618.1:p.Ile523Ser, XP_005270620.1:p.Ile560Ser, XP_005270621.1:p.Ile560Ser, XP_006710460.1:p.Ile560Ser, rs199469542
A > C
No VIP available No Clinical Annotations available VA
T > G
No VIP available CA VA
rs56038477 NC_000001.10:g.98039419C>T, NC_000001.11:g.97573863C>T, NG_008807.2:g.352197G>A, NM_000110.3:c.1236G>A, NP_000101.2:p.Glu412=, XM_005270561.1:c.1125G>A, XM_005270562.1:c.1236G>A, XM_005270562.3:c.1236G>A, XM_005270563.1:c.1236G>A, XM_005270564.1:c.1236G>A, XM_006710397.2:c.1236G>A, XP_005270618.1:p.Glu375=, XP_005270619.1:p.Glu412=, XP_005270619.2:p.Glu412=, XP_005270620.1:p.Glu412=, XP_005270621.1:p.Glu412=, XP_006710460.1:p.Glu412=, rs199469533, rs61730901
C > T
No VIP available No Clinical Annotations available VA
rs56160474 NC_000001.10:g.97544258A>G, NC_000001.11:g.97078702A>G, NG_008807.2:g.847358T>C, NM_000110.3:c.*274T>C, XM_005270561.1:c.*274T>C, XM_005270562.1:c.*274T>C, XM_005270562.3:c.*274T>C
A > G
No VIP available No Clinical Annotations available VA
C > T
No VIP available No Clinical Annotations available VA
A > G
No VIP available No Clinical Annotations available VA
rs5906072 NC_000023.10:g.45640507T>C, NC_000023.11:g.45781104T>C, NW_004070879.1:g.105769T>C, rs59017433, rs59105359, rs6609373
T > C
No VIP available No Clinical Annotations available VA
rs59086055 NC_000001.10:g.97915746G>A, NC_000001.11:g.97450190G>A, NG_008807.2:g.475870C>T, NM_000110.3:c.1774C>T, NP_000101.2:p.Arg592Trp, XM_005270561.1:c.1663C>T, XM_005270562.1:c.1558C>T, XM_005270562.3:c.1558C>T, XM_005270563.1:c.1774C>T, XM_006710397.2:c.1774C>T, XP_005270618.1:p.Arg555Trp, XP_005270619.1:p.Arg520Trp, XP_005270619.2:p.Arg520Trp, XP_005270620.1:p.Arg592Trp, XP_006710460.1:p.Arg592Trp
G > A
No VIP available No Clinical Annotations available VA
rs5934731 NC_000023.10:g.9935844C>T, NC_000023.11:g.9967804C>T, NM_001195081.1:c.447C>T, NP_001182010.1:p.Tyr149=, XM_006724448.2:c.579C>T, XP_006724511.2:p.Tyr193=, rs56455686, rs57784312, rs6640581
C > T
No VIP available No Clinical Annotations available VA
rs60139309 NC_000001.10:g.97658665T>C, NC_000001.11:g.97193109T>C, NG_008807.2:g.732951A>G, NM_000110.3:c.2582A>G, NP_000101.2:p.Lys861Arg, NR_046590.1:n.65-72305T>C, XM_005270561.1:c.2471A>G, XM_005270562.1:c.2366A>G, XM_005270562.3:c.2366A>G, XM_006710397.2:c.2582A>G, XP_005270618.1:p.Lys824Arg, XP_005270619.1:p.Lys789Arg, XP_005270619.2:p.Lys789Arg, XP_006710460.1:p.Lys861Arg, rs61730905
T > C
No VIP available No Clinical Annotations available VA
A > C
No VIP available No Clinical Annotations available VA
C > T
No VIP available No Clinical Annotations available VA
rs61757362 NC_000001.10:g.97544662G>A, NC_000001.11:g.97079106G>A, NG_008807.2:g.846954C>T, NM_000110.3:c.2948C>T, NP_000101.2:p.Thr983Ile, XM_005270561.1:c.2837C>T, XM_005270562.1:c.2732C>T, XM_005270562.3:c.2732C>T, XP_005270618.1:p.Thr946Ile, XP_005270619.1:p.Thr911Ile, XP_005270619.2:p.Thr911Ile
G > A
No VIP available No Clinical Annotations available VA
rs61764370 NC_000012.11:g.25360224A>C, NC_000012.12:g.25207290A>C, NG_007524.1:g.48631T>G, NM_004985.4:c.*2505T>G, NM_033360.3:c.*2626T>G, XM_011520653.1:c.*2505T>G, rs200812391
A > C
No VIP available No Clinical Annotations available VA
rs6458232 NC_000006.11:g.41629726C>A, NC_000006.12:g.41661988C>A, rs59690886
C > A
No VIP available CA VA
rs662 NC_000007.13:g.94937446T>C, NC_000007.14:g.95308134T>C, NG_008779.1:g.21439A>G, NM_000446.5:c.575A>G, NP_000437.3:p.Gln192Arg, rs11567868, rs13306697, rs17773773, rs386603940, rs60480675
T > C
No VIP available No Clinical Annotations available VA
rs664393 NC_000013.10:g.29071001T>C, NC_000013.11:g.28496864T>C, NG_012003.1:g.3265A>G, NM_001159920.1:c.-2021A>G, NM_001160030.1:c.-2021A>G, NM_001160031.1:c.-2021A>G, NM_002019.4:c.-2021A>G, XM_011535014.1:c.-2021A>G, rs59180014
T > C
No VIP available No Clinical Annotations available VA
C > T
No VIP available CA VA
rs67376798 NC_000001.10:g.97547947T>A, NC_000001.11:g.97082391T>A, NG_008807.2:g.843669A>T, NM_000110.3:c.2846A>T, NP_000101.2:p.Asp949Val, XM_005270561.1:c.2735A>T, XM_005270562.1:c.2630A>T, XM_005270562.3:c.2630A>T, XP_005270618.1:p.Asp912Val, XP_005270619.1:p.Asp877Val, XP_005270619.2:p.Asp877Val, rs199469564, rs386467430, rs67376799
T > A
No VIP available No Clinical Annotations available VA
rs6752303 NC_000002.11:g.31247485T>C, NC_000002.12:g.31024619T>C, NM_001253826.1:c.315-58317A>G, NM_001253827.1:c.70-31612A>G, NM_024572.3:c.130-31612A>G, NR_045602.1:n.903-31612A>G, XM_005264559.1:c.25-31612A>G, XM_011533104.1:c.448-31612A>G, XM_011533105.1:c.70-31612A>G, XM_011533106.1:c.43-31612A>G, rs111184598, rs56566923, rs56952366, rs61068192
T > C
No VIP available No Clinical Annotations available VA
rs6769511 NC_000003.11:g.185530290T>C, NC_000003.12:g.185812502T>C, NG_011602.1:g.17538A>G, NM_001007225.1:c.239+10651A>G, NM_001291869.1:c.239+10651A>G, NM_001291872.1:c.50+8510A>G, NM_001291873.1:c.50+8510A>G, NM_001291874.1:c.50+8510A>G, NM_001291875.1:c.-106+8510A>G, NM_006548.4:c.239+10651A>G, XM_005247073.1:c.50+8510A>G, XM_005247074.1:c.50+8510A>G, XM_005247075.1:c.50+8510A>G, XM_011512338.1:c.239+10651A>G, XM_011512339.1:c.239+10651A>G, XM_011512341.1:c.239+10651A>G, XR_427358.2:n.318+10651A>G, rs17436166, rs57496207
T > C
No VIP available No Clinical Annotations available VA
rs6877011 NC_000005.10:g.180602471C>G, NC_000005.9:g.180029471C>G, NG_011536.1:g.52154G>C, NM_182925.4:c.*721G>C, XM_011534477.1:c.*721G>C, XM_011534478.1:c.*721G>C, XM_011534482.1:c.*721G>C, XM_011534483.1:c.*721G>C, XM_011534484.1:c.*721G>C, rs59862001
C > G
No VIP available CA VA
rs699947 NC_000006.11:g.43736389A>C, NC_000006.12:g.43768652A>C, NG_008732.1:g.3437A>C, NM_001025366.2:c.-2055A>C, NM_001025367.2:c.-2055A>C, NM_001025368.2:c.-2055A>C, NM_001025369.2:c.-2055A>C, NM_001025370.2:c.-2055A>C, NM_001033756.2:c.-2055A>C, NM_001171622.1:c.-2055A>C, NM_001171623.1:c.-2595A>C, NM_001171624.1:c.-2595A>C, NM_001171625.1:c.-2595A>C, NM_001171626.1:c.-2595A>C, NM_001171627.1:c.-2595A>C, NM_001171628.1:c.-2595A>C, NM_001171629.1:c.-2595A>C, NM_001171630.1:c.-2595A>C, NM_001204384.1:c.-2595A>C, NM_001204385.1:c.-2055A>C, NM_001317010.1:c.-2595A>C, NM_003376.5:c.-2055A>C, rs1310065, rs36208051, rs61399354
A > C
No VIP available No Clinical Annotations available VA
rs7121 NC_000020.10:g.57478807C>T, NC_000020.11:g.58903752C>T, NG_016194.1:g.69013C>T, NM_000516.5:c.393C>T, NM_001077488.3:c.396C>T, NM_001077489.3:c.348C>T, NM_001077490.2:c.*254C>T, NM_001309840.1:c.216C>T, NM_001309861.1:c.216C>T, NM_016592.3:c.*299C>T, NM_080425.3:c.2322C>T, NM_080426.3:c.351C>T, NP_000507.1:p.Ile131=, NP_001070956.1:p.Ile132=, NP_001070957.1:p.Ile116=, NP_001296769.1:p.Ile72=, NP_001296790.1:p.Ile72=, NP_536350.2:p.Ile774=, NP_536351.1:p.Ile117=, NR_003259.1:n.483C>T, XM_005260396.1:c.336C>T, XM_005260397.1:c.297C>T, XM_005260398.1:c.252C>T, XM_005260399.1:c.171C>T, XM_005260400.1:c.171C>T, XM_005260401.1:c.171C>T, XM_005260402.1:c.219C>T, XP_005260453.1:p.Ile112=, XP_005260454.1:p.Ile99=, XP_005260455.1:p.Ile84=, XP_005260456.1:p.Ile57=, XP_005260457.1:p.Ile57=, XP_005260458.1:p.Ile57=, XP_005260459.1:p.Ile73=, XR_244140.1:n.1443C>T, rs1053389, rs17829840, rs3171206, rs3730167, rs61041002
C > -
C > T
No VIP available No Clinical Annotations available VA
rs715171 NC_000023.10:g.9341848C>T, NC_000023.11:g.9373808C>T, rs61410664
C > T
No VIP available No Clinical Annotations available VA
rs7170769 NC_000015.10:g.91526975C>T, NC_000015.9:g.92070205C>T, rs58543442
C > T
No VIP available CA VA
rs717620 NC_000010.10:g.101542578C>T, NC_000010.11:g.99782821C>T, NG_011798.1:g.5116C>T, NM_000392.4:c.-24C>T, XM_005269536.1:c.-24C>T, XM_006717631.2:c.-24C>T, XM_011539291.1:c.-24C>T, XR_945604.1:n.166C>T, XR_945605.1:n.168C>T, rs17216163, rs386485129, rs58371376
C > T
No VIP available CA VA
rs7194667 NC_000016.10:g.48208987T>G, NC_000016.9:g.48242898T>G, NG_011522.1:g.31191A>C, NM_032583.3:c.1609-491A>C, NM_033151.3:c.1609-491A>C, NM_145186.2:c.1609-491A>C, XM_005256208.1:c.1609-491A>C, XM_005256209.1:c.1609-491A>C, XM_005256210.1:c.1609-491A>C, XM_011523396.1:c.1411-491A>C, XM_011523397.1:c.652-491A>C, XR_243432.1:n.1714-491A>C, rs61621252
T > G
No VIP available No Clinical Annotations available VA
rs72547601 NC_000001.10:g.97544677T>C, NC_000001.11:g.97079121T>C, NG_008807.2:g.846939A>G, NM_000110.3:c.2933A>G, NP_000101.2:p.His978Arg, XM_005270561.1:c.2822A>G, XM_005270562.1:c.2717A>G, XM_005270562.3:c.2717A>G, XP_005270618.1:p.His941Arg, XP_005270619.1:p.His906Arg, XP_005270619.2:p.His906Arg
T > C
No VIP available No Clinical Annotations available VA
T > A
No VIP available CA VA
rs72549303 NC_000001.10:g.97915622delG, NC_000001.11:g.97450066delG, NG_008807.2:g.475994delC, NM_000110.3:c.1898delC, NP_000101.2:p.Pro633Glnfs, XM_005270561.1:c.1787delC, XM_005270562.1:c.1682delC, XM_005270562.3:c.1682delC, XM_005270563.1:c.1898delC, XM_006710397.2:c.1898delC, XP_005270618.1:p.Pro596Glnfs, XP_005270619.1:p.Pro561Glnfs, XP_005270619.2:p.Pro561Glnfs, XP_005270620.1:p.Pro633Glnfs, XP_006710460.1:p.Pro633Glnfs
G > -
G > G
No VIP available No Clinical Annotations available VA
rs72549304 NC_000001.10:g.98015165G>A, NC_000001.11:g.97549609G>A, NG_008807.2:g.376451C>T, NM_000110.3:c.1475C>T, NP_000101.2:p.Ser492Leu, XM_005270561.1:c.1364C>T, XM_005270562.1:c.1475C>T, XM_005270562.3:c.1475C>T, XM_005270563.1:c.1475C>T, XM_005270564.1:c.1475C>T, XM_006710397.2:c.1475C>T, XP_005270618.1:p.Ser455Leu, XP_005270619.1:p.Ser492Leu, XP_005270619.2:p.Ser492Leu, XP_005270620.1:p.Ser492Leu, XP_005270621.1:p.Ser492Leu, XP_006710460.1:p.Ser492Leu
G > A
No VIP available No Clinical Annotations available VA
T > C
No VIP available CA VA
rs72549306 NC_000001.10:g.98058899C>A, NC_000001.11:g.97593343C>A, NG_008807.2:g.332717G>T, NM_000110.3:c.1003G>T, NP_000101.2:p.Val335Leu, XM_005270561.1:c.892G>T, XM_005270562.1:c.1003G>T, XM_005270562.3:c.1003G>T, XM_005270563.1:c.1003G>T, XM_005270564.1:c.1003G>T, XM_006710397.2:c.1003G>T, XP_005270618.1:p.Val298Leu, XP_005270619.1:p.Val335Leu, XP_005270619.2:p.Val335Leu, XP_005270620.1:p.Val335Leu, XP_005270621.1:p.Val335Leu, XP_006710460.1:p.Val335Leu
C > A
No VIP available No Clinical Annotations available VA
rs72549307 NC_000001.10:g.98164955T>C, NC_000001.11:g.97699399T>C, NG_008807.2:g.226661A>G, NM_000110.3:c.632A>G, NP_000101.2:p.Tyr211Cys, XM_005270561.1:c.521A>G, XM_005270562.1:c.632A>G, XM_005270562.3:c.632A>G, XM_005270563.1:c.632A>G, XM_005270564.1:c.632A>G, XM_006710397.2:c.632A>G, XP_005270618.1:p.Tyr174Cys, XP_005270619.1:p.Tyr211Cys, XP_005270619.2:p.Tyr211Cys, XP_005270620.1:p.Tyr211Cys, XP_005270621.1:p.Tyr211Cys, XP_006710460.1:p.Tyr211Cys
T > C
No VIP available No Clinical Annotations available VA
rs72549308 NC_000001.10:g.98164986T>G, NC_000001.11:g.97699430T>G, NG_008807.2:g.226630A>C, NM_000110.3:c.601A>C, NP_000101.2:p.Ser201Arg, XM_005270561.1:c.490A>C, XM_005270562.1:c.601A>C, XM_005270562.3:c.601A>C, XM_005270563.1:c.601A>C, XM_005270564.1:c.601A>C, XM_006710397.2:c.601A>C, XP_005270618.1:p.Ser164Arg, XP_005270619.1:p.Ser201Arg, XP_005270619.2:p.Ser201Arg, XP_005270620.1:p.Ser201Arg, XP_005270621.1:p.Ser201Arg, XP_006710460.1:p.Ser201Arg
T > G
No VIP available CA VA
rs72549309 NC_000001.10:g.98205971_98205974delATGA, NC_000001.11:g.97740415_97740418delATGA, NG_008807.2:g.185642_185645delTCAT, NM_000110.3:c.295_298delTCAT, NM_001160301.1:c.295_298delTCAT, NP_000101.2:p.Phe100Serfs, NP_001153773.1:p.Phe100Serfs, XM_005270561.1:c.184_187delTCAT, XM_005270562.1:c.295_298delTCAT, XM_005270562.3:c.295_298delTCAT, XM_005270563.1:c.295_298delTCAT, XM_005270564.1:c.295_298delTCAT, XM_006710397.2:c.295_298delTCAT, XP_005270618.1:p.Phe63Serfs, XP_005270619.1:p.Phe100Serfs, XP_005270619.2:p.Phe100Serfs, XP_005270620.1:p.Phe100Serfs, XP_005270621.1:p.Phe100Serfs, XP_006710460.1:p.Phe100Serfs
ATGA > -
No VIP available No Clinical Annotations available VA
G > A
No VIP available CA VA
rs72728438 NC_000001.10:g.97847874T>C, NC_000001.11:g.97382318T>C, NG_008807.2:g.543742A>G, NM_000110.3:c.1974+75A>G, XM_005270561.1:c.1863+75A>G, XM_005270562.1:c.1758+75A>G, XM_005270562.3:c.1758+75A>G, XM_005270563.1:c.1974+75A>G, XM_006710397.2:c.1974+75A>G, XR_947619.1:n.1347-1316T>C, XR_947620.1:n.1125-1316T>C, XR_947621.1:n.1347-1316T>C, rs199469549, rs74105154
T > C
No VIP available No Clinical Annotations available VA
G > A
G > C
No VIP available CA VA
rs7325568 NC_000013.10:g.40818284C>T, NC_000013.11:g.40244147C>T
C > T
No VIP available CA VA
rs75017182 NC_000001.10:g.98045449G>C, NC_000001.11:g.97579893G>C, NG_008807.2:g.346167C>G, NM_000110.3:c.1129-5923C>G, XM_005270561.1:c.1018-5923C>G, XM_005270562.1:c.1129-5923C>G, XM_005270562.3:c.1129-5923C>G, XM_005270563.1:c.1129-5923C>G, XM_005270564.1:c.1129-5923C>G, XM_006710397.2:c.1129-5923C>G
G > C
No VIP available No Clinical Annotations available VA
rs7608731 NC_000002.11:g.31249974T>C, NC_000002.12:g.31027108T>C, NM_001253826.1:c.315-60806A>G, NM_001253827.1:c.70-34101A>G, NM_024572.3:c.130-34101A>G, NR_045602.1:n.903-34101A>G, XM_005264559.1:c.25-34101A>G, XM_011533104.1:c.448-34101A>G, XM_011533105.1:c.70-34101A>G, XM_011533106.1:c.43-34101A>G, rs56452495, rs57143999
T > C
No VIP available No Clinical Annotations available VA
rs7664413 NC_000004.11:g.177608707C>T, NC_000004.12:g.176687553C>T, NG_034216.1:g.110193G>A, NM_005429.4:c.812-33G>A, XR_939498.1:n.260+7803C>T, XR_939499.1:n.209+17844C>T, rs58304891
C > T
No VIP available No Clinical Annotations available VA
rs7667298 NC_000004.11:g.55991731T>C, NC_000004.12:g.55125564T>C, NG_012004.1:g.5032A>G, NM_002253.2:c.-271A>G, rs386485376, rs60563091
T > C
No VIP available CA VA
rs7699188 NC_000004.11:g.89096061G>A, NC_000004.12:g.88174909G>A, NG_032067.2:g.61414C>T, NM_001257386.1:c.-19-34895C>T, XM_005263355.1:c.-19-34895C>T, XM_005263355.2:c.-19-34895C>T, XM_011532420.1:c.-19-34895C>T, rs57955088
G > A
G > C
No VIP available No Clinical Annotations available VA
rs770063251 NC_000008.10:g.105436493C>T, NC_000008.11:g.104424265C>T, NG_008840.1:g.47785G>A, NM_001385.2:c.1217G>A, NP_001376.1:p.Trp406Ter, XM_005250818.1:c.1217G>A, XM_005250818.2:c.1217G>A, XM_005250819.1:c.1217G>A, XM_006716518.2:c.1058G>A, XM_011516903.1:c.1217G>A, XM_011516904.1:c.1217G>A, XP_005250875.1:p.Trp406Ter, XP_005250876.1:p.Trp406Ter, XP_006716581.1:p.Trp353Ter, XP_011515205.1:p.Trp406Ter, XP_011515206.1:p.Trp406Ter
C > T
No VIP available No Clinical Annotations available VA
rs780093 NC_000002.11:g.27742603T>C, NC_000002.12:g.27519736T>C, NG_028024.1:g.27898T>C, NM_001486.3:c.1572+799T>C, XM_005264256.1:c.1566+799T>C, XM_005264257.1:c.1503+799T>C, XM_005264258.1:c.1002+799T>C, XM_011532761.1:c.1419+799T>C, XM_011532762.1:c.1002+799T>C, rs386613274, rs61268282, rs8179238
T > C
No VIP available No Clinical Annotations available VA
rs780094 NC_000002.11:g.27741237T>C, NC_000002.12:g.27518370T>C, NG_028024.1:g.26532T>C, NM_001486.3:c.1423-418T>C, XM_005264256.1:c.1417-418T>C, XM_005264257.1:c.1354-418T>C, XM_005264258.1:c.853-418T>C, XM_011532761.1:c.1270-418T>C, XM_011532762.1:c.853-418T>C, rs17705107, rs386613275, rs59441336
T > C
No VIP available No Clinical Annotations available VA
rs78060119 NC_000001.10:g.98039499C>A, NC_000001.11:g.97573943C>A, NG_008807.2:g.352117G>T, NM_000110.3:c.1156G>T, NP_000101.2:p.Glu386Ter, XM_005270561.1:c.1045G>T, XM_005270562.1:c.1156G>T, XM_005270562.3:c.1156G>T, XM_005270563.1:c.1156G>T, XM_005270564.1:c.1156G>T, XM_006710397.2:c.1156G>T, XP_005270618.1:p.Glu349Ter, XP_005270619.1:p.Glu386Ter, XP_005270619.2:p.Glu386Ter, XP_005270620.1:p.Glu386Ter, XP_005270621.1:p.Glu386Ter, XP_006710460.1:p.Glu386Ter, rs386508634
C > A
No VIP available No Clinical Annotations available VA
rs7952081 NC_000011.10:g.67557462G>A, NC_000011.9:g.67324933G>A, rs56809733
G > A
No VIP available No Clinical Annotations available VA
rs7993418 NC_000013.10:g.28883061G>A, NC_000013.11:g.28308924G>A, NG_012003.1:g.191205C>T, NM_002019.4:c.3639C>T, NP_002010.2:p.Tyr1213=, rs117224149, rs57281829
G > A
No VIP available No Clinical Annotations available VA
rs80081766 NC_000001.10:g.98348908C>T, NC_000001.11:g.97883352C>T, NG_008807.2:g.42708G>A, NM_000110.3:c.62G>A, NM_001160301.1:c.62G>A, NP_000101.2:p.Arg21Gln, NP_001153773.1:p.Arg21Gln, XM_005270561.1:c.39+37532G>A, XM_005270562.1:c.62G>A, XM_005270562.3:c.62G>A, XM_005270563.1:c.62G>A, XM_005270564.1:c.62G>A, XM_006710397.2:c.62G>A, XP_005270619.1:p.Arg21Gln, XP_005270619.2:p.Arg21Gln, XP_005270620.1:p.Arg21Gln, XP_005270621.1:p.Arg21Gln, XP_006710460.1:p.Arg21Gln, rs386508633
C > T
No VIP available No Clinical Annotations available VA
T > C
No VIP available No Clinical Annotations available VA
rs8056100 NC_000016.10:g.48226719G>A, NC_000016.9:g.48260630G>A, NG_011522.1:g.13459C>T, NM_032583.3:c.395+1087C>T, NM_033151.3:c.395+1087C>T, NM_145186.2:c.395+1087C>T, XM_005256208.1:c.395+1087C>T, XM_005256209.1:c.395+1087C>T, XM_005256210.1:c.395+1087C>T, XM_011523396.1:c.197+1087C>T, XR_243432.1:n.500+1087C>T, rs58118497
G > A
No VIP available No Clinical Annotations available VA
rs8071253 NC_000017.10:g.76184467G>A, NC_000017.11:g.78188386G>A, NM_001010982.4:c.63+953G>A, NM_001145526.2:c.63+953G>A, NM_003258.4:c.-1392C>T, NR_027083.1:n.117+953G>A, XM_011524326.1:c.63+953G>A, XM_011524327.1:c.-292+953G>A, XM_011524328.1:c.-303+953G>A, XM_011524329.1:c.-291-2584G>A, XM_011524330.1:c.-292+1556G>A, XM_011524331.1:c.-206+953G>A, XM_011524332.1:c.-217+953G>A, XM_011524333.1:c.63+953G>A, XM_011524334.1:c.-206+953G>A, XM_011524335.1:c.-206+953G>A, XM_011524336.1:c.63+953G>A, XM_011524337.1:c.63+953G>A, XR_934369.1:n.76+953G>A
G > A
No VIP available No Clinical Annotations available VA
(TA)6 > (TA)5
(TA)6 > (TA)7
(TA)6 > (TA)8
No VIP available No Clinical Annotations available VA
rs833061 NC_000006.11:g.43737486C>T, NC_000006.12:g.43769749C>T, NG_008732.1:g.4534C>T, NM_001025366.2:c.-958C>T, NM_001025367.2:c.-958C>T, NM_001025368.2:c.-958C>T, NM_001025369.2:c.-958C>T, NM_001025370.2:c.-958C>T, NM_001033756.2:c.-958C>T, NM_001171622.1:c.-958C>T, NM_001171623.1:c.-1498C>T, NM_001171624.1:c.-1498C>T, NM_001171625.1:c.-1498C>T, NM_001171626.1:c.-1498C>T, NM_001171627.1:c.-1498C>T, NM_001171628.1:c.-1498C>T, NM_001171629.1:c.-1498C>T, NM_001171630.1:c.-1498C>T, NM_001204384.1:c.-1498C>T, NM_001204385.1:c.-958C>T, NM_001317010.1:c.-1498C>T, NM_003376.5:c.-958C>T, rs36208046, rs60746584
C > T
No VIP available No Clinical Annotations available VA
rs854560 NC_000007.13:g.94946084A>T, NC_000007.14:g.95316772A>T, NG_008779.1:g.12801T>A, NM_000446.5:c.163T>A, NP_000437.3:p.Leu55Met, rs1138340, rs11567862, rs117860432, rs17434839, rs1801051, rs2228157, rs3179555, rs3202100, rs57937067
A > T
No VIP available CA VA
rs861539 NC_000014.8:g.104165753G>A, NC_000014.9:g.103699416G>A, NG_011516.1:g.21071C>T, NG_012307.1:g.75229G>A, NM_001100118.1:c.722C>T, NM_001100119.1:c.722C>T, NM_001130107.1:c.1782-1239G>A, NM_005432.3:c.722C>T, NM_182923.3:c.1651-1239G>A, NP_001093588.1:p.Thr241Met, NP_001093589.1:p.Thr241Met, NP_005423.1:p.Thr241Met, XM_005267599.1:c.1924-1239G>A, XM_005267600.1:c.*17-1239G>A, XM_005267602.1:c.1897-1239G>A, XM_005267603.1:c.*17-1239G>A, XM_005267604.1:c.1857-1239G>A, XM_005267605.1:c.1849-1239G>A, XM_005267606.1:c.*17-1239G>A, XM_005267607.1:c.1830-1239G>A, XM_005267608.1:c.1825-1239G>A, XM_005267609.1:c.1822-1239G>A, XM_005267610.1:c.*46-1239G>A, XM_005267612.1:c.*17-1239G>A, XM_005267613.1:c.1758-1239G>A, XM_005267614.1:c.1755-1239G>A, XM_005267615.1:c.1726-1239G>A, XM_005267616.1:c.*17-1239G>A, XM_005267617.1:c.1699-1239G>A, XM_005267618.1:c.*17-1239G>A, XM_005267624.1:c.1624-1239G>A, XM_005268045.1:c.722C>T, XM_005268046.1:c.722C>T, XM_005268047.1:c.722C>T, XM_011537138.1:c.722C>T, XP_005268102.1:p.Thr241Met, XP_005268103.1:p.Thr241Met, XP_005268104.1:p.Thr241Met, XP_011535440.1:p.Thr241Met, rs1734804, rs17435402, rs17850783, rs3212111, rs56934996
G > A
No VIP available CA VA
rs895819 NC_000019.10:g.13836478T>C, NC_000019.9:g.13947292T>C, NR_029495.1:n.182A>G, NR_029497.1:n.-119A>G, NR_029501.1:n.40A>G, NR_036515.1:n.-189A>G, rs117072305, rs61371382
T > C
No VIP available CA VA
rs9344 NC_000011.10:g.69648142G>A, NC_000011.9:g.69462910G>A, NG_007375.1:g.12038G>A, NM_053056.2:c.723G>A, NP_444284.1:p.Pro241=, XM_006718653.2:c.747G>A, XP_006718716.1:p.Pro249=, rs1131451, rs11557586, rs17295377, rs17349816, rs17359282, rs17852153, rs2227951, rs3191361, rs59807553, rs603965
G > A
No VIP available CA VA
rs9380142 NC_000006.11:g.29798794A=, NC_000006.11:g.29798794A>G, NC_000006.12:g.29831017A=, NC_000006.12:g.29831017A>G, NG_029039.1:g.9039A=, NG_029039.1:g.9039A>G, NM_002127.5:c.*278A=, NM_002127.5:c.*278A>G, NT_113891.3:g.1314593A=, NT_113891.3:g.1314593A>G, NT_167244.2:g.1096643A=, NT_167244.2:g.1096643A>G, NT_167245.1:g.1099415G=, NT_167245.1:g.1099415G>A, NT_167245.2:g.1093830G=, NT_167245.2:g.1093830G>A, NT_167246.1:g.1099123A=, NT_167246.1:g.1099123A>G, NT_167246.2:g.1093503A=, NT_167246.2:g.1093503A>G, NT_167247.1:g.1099073G=, NT_167247.1:g.1099073G>A, NT_167247.2:g.1093488G=, NT_167247.2:g.1093488G>A, NT_167248.2:g.1093797A=, NT_167248.2:g.1093797A>G, NT_167249.2:g.1137062A=, NT_167249.2:g.1137062A>G, XM_005249055.1:c.*278A=, XM_005249055.1:c.*278A>G, XM_005249056.1:c.*278A>G, XM_005249056.1:c.*278G>A, XM_005249057.1:c.*493A>G, XM_005249057.1:c.*493G>A, XM_005249058.1:c.*278A=, XM_005249058.1:c.*278A>G, XM_005272810.1:c.*292A=, XM_005272810.1:c.*292A>G, XM_005274964.1:c.*278G=, XM_005274964.1:c.*278G>A, XM_005274965.1:c.*278G=, XM_005274965.1:c.*278G>A, XM_005274966.1:c.*493A>G, XM_005274966.1:c.*493G>A, XM_005274967.1:c.*278G=, XM_005274967.1:c.*278G>A, XM_005275119.1:c.*278A=, XM_005275119.1:c.*278A>G, XM_005275120.1:c.*278A>G, XM_005275120.1:c.*278G>A, XM_005275121.1:c.*493A>G, XM_005275121.1:c.*493G>A, XM_005275122.1:c.*278A>G, XM_005275122.1:c.*278G>A, XM_005275246.1:c.*278G=, XM_005275246.1:c.*278G>A, XM_005275247.1:c.*278G=, XM_005275247.1:c.*278G>A, XM_005275248.1:c.*493A>G, XM_005275248.1:c.*493G>A, XM_005275249.1:c.*278G=, XM_005275249.1:c.*278G>A, XM_005275394.1:c.*292A=, XM_005275394.1:c.*292A>G, XM_005275549.1:c.*292A=, XM_005275549.1:c.*292A>G, XM_005275550.1:c.*292A>G, XM_005275550.1:c.*292G>A, XM_005275551.1:c.*507A>G, XM_005275551.1:c.*507G>A, XM_005275552.1:c.*292A=, XM_005275552.1:c.*292A>G, XM_011547651.1:c.*278G=, XM_011547651.1:c.*278G>A, XM_011547882.1:c.*278A=, XM_011547882.1:c.*278A>G, XM_011548048.1:c.*278G=, XM_011548048.1:c.*278G>A, XM_011548236.1:c.*292A=, XM_011548236.1:c.*292A>G, XM_011548237.1:c.*292A=, XM_011548237.1:c.*292A>G, XM_011548430.1:c.*292A=, XM_011548430.1:c.*292A>G, XM_011548431.1:c.*292A=, XM_011548431.1:c.*292A>G, XR_241896.1:n.1904A>G, XR_241896.1:n.1904G>A, XR_246963.1:n.1838A>G, XR_246963.1:n.1838G>A, XR_247353.1:n.1904A>G, XR_247353.1:n.1904G>A, XR_247370.1:n.1904A=, XR_247370.1:n.1904A>G, XR_247389.1:n.1904A>G, XR_247389.1:n.1904G>A, XR_247402.1:n.1838A>G, XR_247402.1:n.1838G>A, XR_247423.1:n.1896A>G, XR_247423.1:n.1896G>A, rs114317070, rs117803891, rs17185503, rs60341608
A > G
No VIP available No Clinical Annotations available VA
T > C
No VIP available CA VA
rs9561778 NC_000013.10:g.95713715G>T, NC_000013.11:g.95061461G>T, NM_001301829.1:c.3225+1243C>A, NM_005845.4:c.3366+1243C>A, XM_005254025.1:c.3237+1243C>A, XM_005254025.2:c.3237+1243C>A, XM_005254026.1:c.3225+1243C>A, XM_005254027.1:c.3141+1243C>A, XM_006719914.1:c.3276+1243C>A, XM_011521047.1:c.2817+1243C>A, rs17234943
G > A
G > T
No VIP available No Clinical Annotations available VA
T > C
No VIP available CA VA
rs9679162 NC_000002.11:g.31247514G>T, NC_000002.12:g.31024648G>T, NM_001253826.1:c.315-58346C>A, NM_001253827.1:c.70-31641C>A, NM_024572.3:c.130-31641C>A, NR_045602.1:n.903-31641C>A, XM_005264559.1:c.25-31641C>A, XM_011533104.1:c.448-31641C>A, XM_011533105.1:c.70-31641C>A, XM_011533106.1:c.43-31641C>A, rs56573917, rs57478659, rs60984987
G > T
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 147


Generic Names
Trade Names
  • 5 Fluorouracil
  • Adrucil
  • Arumel
  • Carac
  • Carzonal
  • Effluderm
  • Efudex
  • Efudix
  • Efurix
  • FU
  • Fluoroblastin
  • Fluoroplex
  • Fluracil
  • Fluracilum
  • Fluri
  • Fluril
  • Fluro Uracil
  • Flurouracil
  • Ftoruracil
  • Kecimeton
  • Phthoruracil
  • Phtoruracil
  • Queroplex
  • Timazin
  • URF
  • Ulup
Brand Mixture Names

PharmGKB Accession Id






There are several routes of fluorouracil metabolism (see Fluoropyrimidine Pathway, Pharmacokinetics for details). The primary route of detoxification is via DPYD, DPYS and UPB1 [Articles:14555507, 18075467]. Activation to FdUMP occurs via TYMP [Articles:10741735, 12724731] and TK1 [Article:12724731]. Additional routes of metabolism include via UMPS [Article:12724731], PPAT [Article:12724731], UPP1 [Article:11956089], UPP2 [Article:11956089], UCK1 [Article:12724731], UCK2 [Article:12724731], RRM1 [Article:12724731], and RRM2 [Article:12724731].

Variants in DPYD [Articles:10071185, 18299612, 17165084, 15858133, 17848752, 19104657], DPYS [Article:14555507], GSTP1 ([Article:18540691] in a study of radiochemotherapy) and UMPS [Article:16818689] are associated with fluorouracil toxicity.


Import of fluorouracil occurs via SLC22A7 [Article:15901346] and possibly SLC29A1 ([Article:17695509], but in [Article:18992248], no association with fluorouracil was found).

Fluorouracil resistance is associated with efflux transporters ABCG2 [Articles:18820913, 18837291], ABCC3, ABCC4 and ABCC5 [Article:19077464].


The target of fluorouracil is TYMS [Article:15638735]. Incorporation of metabolites of fluorouracil into DNA and RNA also causes cell death [Articles:19383847, 8996164] (see Fluoropyrimidine Pathway, Pharmacodynamics for details).

Fluorouracil suppresses expression of ATP7B and SLC22A2 transporters and increases expression of ABCC2 [Article:19622348], which may aid response to [Chemical:oxaliplatin].

Variants in TYMS [Articles:16818689, 11913730, 11556832, 14522928, 16575011, 16141798, 15386371, 19082493], ERCC2 [Article:18267032], MTHFR [Articles:19465420, 12738713, 15608557, 17704422] and TP53 [Article:18357466] are associated with fluorouracil response.

Source: PharmGKB

Other Vocabularies

Chemical Properties



Source: PubChem

InChI String


Source: PubChem

PharmGKB Curated Pathways

Pathways created internally by PharmGKB based primarily on literature evidence.

  1. Fluoropyrimidine Pathway, Pharmacodynamics
    Model non-tissue-specific cancer cell displaying genes which may be involved in the pharmacodynamics of the fluoropyrimidines, 5-fluorouracil (5-FU), capecitabine and tegafur.
  1. Fluoropyrimidine Pathway, Pharmacokinetics
    Representation of the metabolic pathways for fluoropyrimidines.

Genes that are associated with this drug in PharmGKB's database based on (1) variant annotations, (2) literature review, (3) pathways or (4) information automatically retrieved from DrugBank, depending on the "evidence" and "source" listed below.

Curated Information ?

Drug Targets

Gene Description
TYMS (source: Drug Bank )

Curated Information ?

No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available PW
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available PW

Drug Interactions

Interaction Description
cimetidine - fluorouracil Increases the effect of and toxicity of fluorouacil (source: Drug Bank )
cimetidine - fluorouracil Increases the effect of and toxicity of fluorouacil (source: Drug Bank )
fluorouracil - acenocoumarol The antineoplasic agent increases the anticoagulant effect (source: Drug Bank )
fluorouracil - acenocoumarol The antineoplasic agent, fluorouracil, may increase the anticoagulant effect of acenocoumarol. (source: Drug Bank )
fluorouracil - anisindione The antineoplasic agent, fluorouracil, may increase the anticoagulant effect of anisindione. (source: Drug Bank )
fluorouracil - cimetidine Cimetidine increases the effect and toxicity of fluorouracil (source: Drug Bank )
fluorouracil - cimetidine Cimetidine increases the effect and toxicity of fluorouracil (source: Drug Bank )
fluorouracil - dicumarol The antineoplasic agent increases the anticoagulant effect (source: Drug Bank )
fluorouracil - dicumarol The antineoplasic agent, fluorouracil, may increase the anticoagulant effect of dicumarol. (source: Drug Bank )
fluorouracil - ethotoin Fluorouracil increases the effect of hydantoin (source: Drug Bank )
fluorouracil - fosphenytoin Fluorouracil increases the effect of hydantoin (source: Drug Bank )
fluorouracil - mephenytoin Fluorouracil increases the effect of hydantoin (source: Drug Bank )
fluorouracil - mephenytoin Fluorouracil increases the effect of hydantoin (source: Drug Bank )
fluorouracil - metronidazole Risk of 5-FU toxicity when associated with metronidazole (source: Drug Bank )
fluorouracil - metronidazole Risk of 5-FU toxicity when associated with metronidazole (source: Drug Bank )
fluorouracil - phenytoin Fluorouracil increases the effect of hydantoin (source: Drug Bank )
fluorouracil - phenytoin Fluorouracil increases the effect of hydantoin (source: Drug Bank )
fluorouracil - warfarin The antineoplasic agent increases the anticoagulant effect (source: Drug Bank )
fluorouracil - warfarin The antineoplasic agent, fluorouracil, may increase the anticoagulant effect of warfarin. (source: Drug Bank )
fosphenytoin - fluorouracil Fluorouracil increases the effect of hydantoin (source: Drug Bank )
metronidazole - fluorouracil Risk of 5-FU toxicity when associated with metronidazole (source: Drug Bank )
metronidazole - fluorouracil Risk of 5-FU toxicity when associated with metronidazole (source: Drug Bank )
phenytoin - fluorouracil Fluorouracil increases the effect of hydantoin (source: Drug Bank )
phenytoin - fluorouracil Fluorouracil increases the effect of hydantoin (source: Drug Bank )
tamoxifen - fluorouracil Fluorouracil may reduce clearance rate of Tamoxifen. Monitor for changes in therapeutic/adverse effects of Tamoxifen if Fluorouracil is initiated, discontinued or dose changed. (source: Drug Bank )
tamoxifen - fluorouracil Fluorouracil may reduce clearance rate of Tamoxifen. Monitor for changes in therapeutic/adverse effects of Tamoxifen if Fluorouracil is initiated, discontinued or dose changed. (source: Drug Bank )
tolbutamide - fluorouracil Fluorouracil, a strong CYP2C9 inhibitor, may decrease the metabolism and clearance of Tolbutamide, a CYP2C9 substrate. Consider alternate therapy or monitor for changes in Tolbutamide therapeutic and adverse effects if Fluorouracil is initiated, discontinued or dose changed. (source: Drug Bank )
tolbutamide - fluorouracil Fluorouracil, a strong CYP2C9 inhibitor, may decrease the metabolism and clearance of Tolbutamide, a CYP2C9 substrate. Consider alternate therapy or monitor for changes in Tolbutamide therapeutic and adverse effects if Fluorouracil is initiated, discontinued or dose changed. (source: Drug Bank )
torasemide - fluorouracil Fluorouracil, a strong CYP2C9 inhibitor, may increase the serum concentration of Torasemide, a CYP2C9 substrate, by decreasing Torasemide metabolism and clearance. Consider alternate therapy or monitor for changes in the therapeutic and adverse effects of Torasemide if Fluorouracil is initiated, discontinued or dose changed. (source: Drug Bank )
trastuzumab - fluorouracil Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank )
trimethoprim - fluorouracil The strong CYP2C9 inhibitor, Fluorouracil, may decrease the metabolism and clearance of Trimethoprim, a CYP2C9 substrate. Consider alternate therapy or monitor for changes in therapeutic and adverse effects of Trimethoprim if Fluorouracil is initiated, discontinued or dose changed. (source: Drug Bank )
voriconazole - fluorouracil Fluorouracil, a strong CYP2C9 inhibitor, may increase the serum concentration of voriconazole by decreasing its metabolism. Monitor for changes in the therapeutic and adverse effects of voriconazole if fluorouracil is initiated, discontinued or dose changed. (source: Drug Bank )
warfarin - fluorouracil Fluorouracil, a strong CYP2C9 inhibitor, may decrease the metabolism of warfarin. Consider alternate therapy or monitor for changes in the therapeutic and adverse effects of warfarin if fluorouracil is initiated, discontinued or dose changed. (source: Drug Bank )
zafirlukast - fluorouracil Fluorouracil, a strong CYP2C9 inhibitor, may decrease the metabolism and clearance of zafirlukast. Consider alternate therapy or monitor for changes in zafirlukast therapeutic and adverse effects if fluorouracil is initiated, discontinued or dose changed. (source: Drug Bank )

Curated Information ?

Relationships from National Drug File - Reference Terminology (NDF-RT)

May Treat
Contraindicated With

Publications related to fluorouracil: 392

No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Clinical validation of genetic variants associated with in vitro chemotherapy-related lymphoblastoid cell toxicity. Oncotarget. 2017. Fasching Peter A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Quantitative contribution of rs75017182 to dihydropyrimidine dehydrogenase mRNA splicing and enzyme activity. Clinical pharmacology and therapeutics. 2017. Nie Qian, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Correlative analysis of plasma SN-38 levels and DPD activity with outcomes of FOLFIRI regimen for metastatic colorectal cancer with UGT1A1 *28 and *6 wild type and its implication for individualized chemotherapy. Cancer biology & therapy. 2017. Cai Xun, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic variants associated with outcome in patients with advanced gastric cancer treated with fluoropyrimidine and platinum-based triplet combinations: a pooled analysis of three prospective studies. The pharmacogenomics journal. 2016. Meulendijks D, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Evaluation of 5-fluorouracil degradation rate and Pharmacogenetic profiling to predict toxicity following adjuvant Capecitabine. European journal of clinical pharmacology. 2016. Roberto Michela, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Novel deleterious dihydropyrimidine dehydrogenase variants may contribute to 5-fluorouracil sensitivity in an East African population. Clinical pharmacology and therapeutics. 2016. Elraiyah Tarig, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pancytopenia and Severe Gastrointestinal Toxicities Associated with 5-Fluorouracil in a Patient with Thymidylate Synthase (TYMS) Polymorphism. Cureus. 2016. Wang Bo, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The First Case of Severe Takotsubo Cardiomyopathy Associated with 5-Fluorouracil in a Patient with Abnormalities of Both Dihydropyrimidine Dehydrogenase (DPYD) and Thymidylate Synthase (TYMS) Genes. Cureus. 2016. Saif Muhammad W, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The TYMS-TSER polymorphism is associated with toxicity of low-dose capecitabine in patients with advanced gastrointestinal cancer. Anti-cancer drugs. 2016. Romiti Adriana, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Patients homozygous for DPYD c.1129-5923C>G/haplotype B3 have partial DPD deficiency and require a dose reduction when treated with fluoropyrimidines. Cancer chemotherapy and pharmacology. 2016. Meulendijks Didier, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Rs895819 in MIR27A improves the predictive value of DPYD variants to identify patients at risk of severe fluoropyrimidine-associated toxicity. International journal of cancer. 2016. Meulendijks Didier, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available