PharmGKB:  The Pharmacogenetics and Pharmacogenomics Knowledge Base
Search PharmGKB:?
 

Important Variant Information for TYMS

Submitted by: Sharon Marsh, Derek J. Van Booven, Howard L. McLeod (CREATE)
Reviewed by: Under Review
Submitted date: April 14th, 2008

There are Three Important Variants for TYMS.

  1. TYMS 28 bp tandem repeat:
  2. TYMS 1494del TTAAAG:
  3. TYMS TSER*3G>C:


1. TYMS 28 bp tandem repeat

Gene HGNC Name: TYMS
Variant Summary: A polymorphic tandem repeat in the 5'UTR of the TYMS enhancer region (TSER) resulting in from 2 (TSER*2) up to 9 (TSER*9) copies of a 28bp repeated sequence has been identified [7586009]. Data suggests that increased number of repeats increase TYMS RNA and protein expression [7586009 11913730 10652619].

Frequency of the TSER*3 variant is significantly higher in Asian populations (>80%) than other world populations (~50-60%) [11102983 7586009 10373329 11989786], with TSER*2 making up the majority of the remaining alleles. TSER*4 is rare in Caucasians (<1%), but is more frequent in African populations (2-7%) [11102983], TSER*5 has been described in Asians (0.18%) [11989786]. TSER*9 has to date only been identified in Ghanaians (1% frequency) [11102983].

Several studies have identified links between TSER genotype (predominantly TSER*2 and *3) and response to chemotherapy, including:

In 50 patients receiving 5-fluorouracil for metastatic colorectal cancer, a 35% higher response rate was seen in TSER*2/TSER*2 patients compared to TSER*2/TSER*3, and 41% higher response rate compared to patients TSER*3/TSER*3 (p=0.041) [11913730].

In 117 patients receiving 5FU adjuvant therapy and 104 patients receiving surgery alone, no significant benefit of chemotherapy on survival was observed for TSER*3/TSER*3 patients. 5-fluorouracil provided improved survival compared with surgery alone to patients with at least one TSER*2 allele (relative risk of treatment failure 0.52 compared with surgery alone; p=005) [11556832].

In 205 acute lymphoblastic leukaemia (ALL) patients treated with methotrexate, patients with at least one TSER*2 allele had a significantly greater chance of response to treatment than patients homozygous for TSER*3 (odds ratio 4.1, p = 0.001) [11937185].

In a study of 65 patients with stage T2-T4 rectal cancer, patients with at least one TSER*2 allele had a significantly increased frequency of tumor downstaging from 5-fluorouracil/radiation therapy at the time of surgical resection compared to TSER*3/TSER*3 patients (p=0.036) [11251009].

A genotype-guided clinical cancer trial has now been initiated to determine the utility of pre-screening colorectal caner patients for the TYMS TSER genotype prior to therapy selection (McLeod et al, ASCO 2005).
Key PubMed IDs: 7586009 10652619 11913730 11102983 10373329 11989786 11556832 11937185 11251009
Genomic Variant & GenBank ID: First complete repeat from 606067 to 606094 on NW_001838461
28 bp repeat is (CCGCGCCACTTGGCCTGCCTCCGTCCCG)
mRNA Variant & GenBank ID: Partial repeats begin at position 14 on NM_001071
Protein Variant & GenBank ID: N/A
dbSNP rs#: rs34743033
GoldenPath Position: chr18:647646 on hg18
Key Drugs/Substrates: 5-fluorouracil [11556832], methotrexate [11937185]
Phenotype Data Sets: Folate pathway gene expression and methotrexate pharmacodynamics, Folate, Homocysteine and Vitamin B12 in Young Healthy Individuals, Pharmacogenetic Risk Factors for Osteonecrosis of the Hip Among Children With Leukemia, RNA expression in metabolite and transport genes, RNA expression of genes in the gemcitabine pathway in pancreatic samples, Risk classification of childhood ALL and TYMS, GSTM1 gene expression in ALL cells


2. TYMS 1494del TTAAAG

Gene HGNC Name: TYMS
Variant Summary: This polymorphism is a 6bp deletion 447bp downstream of the TYMS transcription stop codon. It was identified by aligning sequence from exressed sequence tag databases [11142426]. The deletion occurs at an allele frequency of 26-29% in Caucasians, ~50% in Africans, and up to 76% in Asians [11142426 15115918]. Data suggests that this deletion alters TYMS mRNA stability [15115918], and that this stability is likely regulated by AUF1 [16787927].

A study of TYMS RNA expression in 43 colorectal cancer patients suggests that patients homozygous for the 6bp deletion express around 3-fold less TYMS RNA than patients homozygous for the presence of the 6bp (p=0.017) [15115918].

The pharmacogenetic role of this deletion polymorphism remains unclear. In a study of 259 ALL patients treated with methotrexate, homozygosity for the 6bp deletion appeared to have a protective effect in TSER*3 patients (p=0.04) [16130010]. Additionally, in 129 colorectal cancer patients treated with 5-fluorouracil, the 6bp deletion (tumor genotype) also had a protective effect (p=0.0034) [16575011].
Key PubMed IDs: 11142426 16130010 15115918 16787927 16575011
Genomic Variant & GenBank ID: NW_001838461 contains the deleted sequence from 610556 to 610571
mRNA Variant & GenBank ID: Deletion occurs between 1493 and 1494 of NM_001071
Protein Variant & GenBank ID: N/A
dbSNP rs#: rs34489327
GoldenPath Position: chr18:663451 (hg18)
Key Drugs/Substrates: 5-fluorouracil [16575011] methotrexate [16130010]
Phenotype Data Sets: Folate pathway gene expression and methotrexate pharmacodynamics, Folate, Homocysteine and Vitamin B12 in Young Healthy Individuals, Pharmacogenetic Risk Factors for Osteonecrosis of the Hip Among Children With Leukemia, RNA expression in metabolite and transport genes, RNA expression of genes in the gemcitabine pathway in pancreatic samples, Risk classification of childhood ALL and TYMS, GSTM1 gene expression in ALL cells


3. TYMS TSER*3G>C

Gene HGNC Name: TYMS
Variant Summary: The G>C substitution within the 12th nucleotide of the second repeat of TSER*3 abolishes a USF-1 binding site, altering TYMS expression levels [12782596]. Electrophoretic mobility shift analysis has shown that the presence of the cytosine allele abolishes a transcription factor (USF-1) binding site within the TSER resulting in reduced TYMS expression [12782596]. In addition, TSER*3 G>C SNP has demonstrated 3-4 fold reduction in TYMS expression for the C allele [14522928], and significant differences in TYMS mRNA expression between TSER*3G homozygotes and other genotypes (p=0.017) [16182121].

Frequency of this polymorphism varies among different world populations. Reported frequencies for TSE*3 alleles are as follows: African Americans 29%, Caucasians 59%, Chinese 29%, and Hispanics 46% [12782596].

In 89 metastatic colorectal cancer patients receiving 5-fluorouracil, the low expression genotypes (patients without any TSER*3G alleles) showed an improved overall response (p=0.035) [15386371].

This SNP may further stratify TSER*3 individuals into high and low TYMS expression groups.
Key PubMed IDs: 12782596 14522928 16182121 15386371
Genomic Variant & GenBank ID: 606106 C>G on NW_001838461 (sequence contains the SNP)
mRNA Variant & GenBank ID: 76 C>G on NM_001071 (sequence contains the SNP)
Protein Variant & GenBank ID: N/A
dbSNP rs#: N/A
GoldenPath Position: This polymorphism occurs in the 3rd repeat, but the Golden Path sequence only has two repeats. If it were to be in Golden Path, the third repeat would occur between chr18:647728 and chr18:647729 (hg18)
Key Drugs/Substrates: 5-fluorouracil [15386371]
Phenotype Data Sets: Folate pathway gene expression and methotrexate pharmacodynamics, Folate, Homocysteine and Vitamin B12 in Young Healthy Individuals, Pharmacogenetic Risk Factors for Osteonecrosis of the Hip Among Children With Leukemia, RNA expression in metabolite and transport genes, RNA expression of genes in the gemcitabine pathway in pancreatic samples, Risk classification of childhood ALL and TYMS, GSTM1 gene expression in ALL cells

(allele frequence table optional)

The PGRN is financially supported by grants from NIGMS, NHLBI, NHGRI, NIEHS, NCI, and NLM within the NIH, HHS. PharmGKB is managed at Stanford University. This work is supported by the NIH/NIGMS Pharmacogenetics Research Network and Database (U01GM61374). ©2001-2008 PharmGKB.