PharmGKB:  The Pharmacogenetics and Pharmacogenomics Knowledge Base
Search PharmGKB:?
 

Important Variant Information for SLC19A1

Submitted by: Ilaria Badagnani (PMT)
Reviewed by: Reviewed
Submitted date: July 11, 2006

There are Two Important Variants for SLC19A1.

  1. SLC19A1:Arg27His
  2. SLC19A1:upstream inserted repeat


1. SLC19A1:Arg27His

Gene HGNC Name: SLC19A1
Variant Summary: Among Caucasians, the genotype frequencies were found to be: GG=0.29, GA=0.473, AA=0.237 [PMID: 11461197]. The frequency of allele A was 0.473 in Caucasians, 0.564 in African Americans, and 0.472 in Hispanics. The functional effect of the G80A polymorphism was assessed in transport-impaired K562 cells expressing the human reference or variant RFC1 proteins [PMID: 11705857]. The variant protein, Arg27His, transported methotrexate and 5-formyl tetrahydrofolate similarly compared to reference RFC1. Although the kinetics of methotrexate transport by Arg27His were not significantly different compared to reference RFC1 , minor differences were detected between the variant and reference proteins in the interaction affinity (Ki) of other anti-folates, including Tomudex, 5,10-dideazatetrahydrofolate, GW1843U89, 10-ethyl-10-deazaaminopterin, and 5-formyl tetrahydrofolate.

Several studies have investigated whether the naturally-occurring polymorphism, G80A, is associated with any clinical phenotypes. One study investigated whether the variant G80A influenced the risk of neural tube defects, or NTD [PMID: 11813127]. It was determined that in this Italian population the G allele was observed at higher frequencies in affected children with NTD, their mothers, and their fathers. A second study investigated the interaction between use of periconceptional folate supplementation in mothers and the risk of spina bifida in their infants as a function of the genotype at nucleotide position 80 of RFC1 in the infants [PMID: 11857541]. It was found that infants born from mothers who did not take folate during periconception were at higher risk of having spina bifida if they carried the GG genotype (OR=2.4) compared to infants with the AA genotype. On the other hand, infants whose mothers took folate during periconception had a decreased risk of spina bifida if they carried the GG genotype compared to infants with the AA genotype. Although the findings did not reach statistical significance, this study reveals a potentially interesting gene-nutrient interaction involving folate use in mothers and RFC1 genotype at nucleotide position 80 in infants and risk of spina bifida.

Another study investigated whether periconceptional use of folate influenced the risk of congenital defects, such as congenital heart disease and cleft palate, in infants based on their genotypes at nucleotide position 80 in RFC1 [PMID: 16019224]. It was determined that infants born from mothers who did not use folate supplementation were at significantly higher risk of CHD (OR=2.94) compared to infants whose mothers took folate during periconception. In addition, the CHD risk was significantly higher in infants with the GG (OR=4.03) and GA (OR=4.14) genotypes compared to infants with the AA genotype, if their mothers did not use folate supplementation. A fourth study investigated whether there was an association between the G80A polymorphism and risk of thrombosis [PMID: 15964598]. It was shown that the A allele had a significant protective effect against thrombosis (OR = 0.56). Another clinical study assessed whether there was an association between the G80A polymorphism and clinical outcome in pediatric patients with acute lymphoblastic leukemia [PMID: 12411325]. Children with the AA genotype had more events and worse overall prognosis than patients with the GG genotype. In addition, it was determined that patients carrying the AA genotype had higher plasma levels of MTX (P =.004) than patients with either the GG or GA genotypes.
Key PubMed IDs: 11461197, 11705857, 11813127, 11857541, 15964598, 16019224, 12411325
Genomic Variant & GenBank ID: 2,275,130 G>A on NT_011515
mRNA Variant & GenBank ID: 199 G>A on NM_194255
Protein Variant & GenBank ID: 27 Arg>His on NP_919231
dbSNP rs#: rs1051266
GoldenPath Position: Chr21:45,782,222  (hg18)
Key Drugs/Substrates: Methotrexate [PMID: 11705857], Tomudex [PMID: 11705857], 5,10-dideazatetrahydrofolate [PMID: 11705857], GW1843U89 [PMID: 11705857], and 10-ethyl-10-deazaaminopterin [PMID: 11705857]
Key Phenotypes/Diseases: Congenital heart disease [PMID: 16019224], thrombosis [PMID: 15964598], MTX plasma levels [PMID: 12411325], ALL outcome [PMID: 12411325]
Phenotype Data Sets: Phenotype file: Homocysteine concentrations in leukemia patients (PA128747822). This variant was not associated with significant differences in plasma or CSF homocysteine levels or in neurological toxicities.
Phenotype file: Pharmacogenetic Risk Factors for Osteonecrosis of the Hip Among Children With Leukemia (PA136096708). This variant was not associated with drug-induced osteonecrosis.


2. SLC19A1:upstream inserted repeat

Gene HGNC Name: SLC19A1
Variant Summary: In the 72 normal human genomic DNA samples surveyed, 63% were homozygous for the 61bp repeat sequence and 30% were heterozygous [PMID: 12228234].Only 7% were homozygous for the sequence without the 61bp repeat. The promoter construct with the 61bp insertion included had a highly significant increase in luciferase activity compared with the activity of the construct with no 61bp insertion (63 ± 12%; p < 0.05).
Key PubMed IDs: 12228234
Genomic Variant & GenBank ID: 1243 C > CCTGGGGTCCGCGGGGCCCTGGGGAGGGTGCGGGGCGTGGGCCGGGGTCTGCGGTCTGCAGC on AF046920
mRNA Variant & GenBank ID: NA
Protein Variant & GenBank ID: NA
dbSNP rs#: None
GoldenPath Position: Chr21:45,786,522  (hg18) (The Golden Path sequence does not have the insertion.)
The PGRN is financially supported by grants from NIGMS, NHLBI, NHGRI, NIEHS, NCI, and NLM within the NIH, HHS. PharmGKB is managed at Stanford University. This work is supported by the NIH/NIGMS Pharmacogenetics Research Network and Database (U01GM61374). ©2001-2008 PharmGKB.