Gene:
CCR5
chemokine (C-C motif) receptor 5 (gene/pseudogene)

PharmGKB contains no dosing guidelines for this . To report known genotype-based dosing guidelines, or if you are interested in developing guidelines, click here.

PharmGKB annotates drug labels containing pharmacogenetic information approved by the US Food and Drug Administration (FDA), European Medicines Agency (EMA) and the Pharmaceuticals and Medical Devices Agency, Japan (PMDA). PharmGKB annotations provide a brief summary of the PGx in the label, an excerpt from the label and a downloadable highlighted label PDF file. A list of genes and phenotypes found within the label is mapped to label section headers and listed at the end of each annotation. PharmGKB also attempts to interpret the level of action implied in each label with the "PGx Level" tag.

Sources:

  • FDA Information is gathered from the FDA's "Table of Pharmacogenomic Biomarkers in Drug Labels" and from FDA-approved labels brought to our attention. Please note that drugs may be removed from or added to the FDA's Table without our knowledge. We periodically check the Table for changes and update PharmGKB accordingly. Drugs listed on the Table to our knowledge are tagged with the Biomarker icon. A drug label that has been removed from the Table will not have the Biomarker icon but will continue to have an annotation on PharmGKB stating the label has been removed from the FDA's Table. We acquire label PDF files from DailyMed.
  • EMA European Public Assessment Reports (EPARs) that contain PGx information were identified from [Article:24433361] and also by searching for drugs for which we have PGx-containing FDA drug labels.

We welcome any information regarding drug labels containing PGx information approved by the FDA, EMA, PMDA or other Medicine Agencies around the world - please contact feedback.



last updated 10/25/2013

FDA Label for maraviroc and CCR5

Genetic testing required

Summary

The drug labeling for maraviroc is not related to genetic testing of the patient, rather testing of the HIV-1 strain that has infected the patient. The FDA-approved label states that HIV tropism testing be carried out before treatment with Maraviroc. This drug is indicated only for CCR5-tropic HIV-1 infection, and due to its mechanism of action, is not effective against CXCR4-tropic and dual-tropic HIV-1.

Annotation

Maraviroc (Selzentry) is a CCR5 antagonist, and works by preventing HIV-1 from entering cells via the CCR5 cell surface receptor. The drug labeling information demonstrates why a sensitive HIV tropism assay should be used to diagnose CCR5-tropic HIV-1, in order to avoid treating individuals with CXCR4- or Dual/ Mixed- tropic virus (discussed in section 14.3).

Maraviroc is principally metabolized by CYP3A enzymes. Drug labeling information also includes Maraviroc dosage recommendations if CYP3A inhibitors or CYP3A inducers are taken concomitantly.

Excerpt from the maraviroc drug label:

SELZENTRY, in combination with other antiretroviral agents, is indicated for adult
patients infected with only CCR5-tropic HIV-1.


The following points should be considered when initiating therapy with SELZENTRY:

  • Adult patients infected with only CCR5-tropic HIV-1 should use SELZENTRY.
  • Tropism testing must be conducted with a highly sensitive tropism assay that has demonstrated the ability to identify patients appropriate for use of SELZENTRY. Outgrowth of pre-existing low-level CXCR4-or dual/mixed-tropic HIV-1 not detected by tropism testing at screening has been associated with virologic failure on SELZENTRY

For the complete drug label text with sections containing pharmacogenetic information highlighted, see the Maraviroc drug label.

*Disclaimer: The contents of this page have not been endorsed by the FDA and are the sole responsibility of PharmGKB.

Genes and/or phenotypes found in this label

  • CCR5
    • Indications & usage section, Information for patients section, Description section, Clinical studies section, Mechanism of action section, Pharmacokinetics section, Warnings and precautions section, Microbiology section, efficacy
    • source: FDA Label
  • CYP3A4
    • Dosage & administration section, Contraindications section, Drug interactions section, Overdosage section, Pharmacokinetics section, Use in specific populations section, Warnings and precautions section, dosage
    • source: FDA Label
  • CYP3A5
    • Dosage & administration section, Contraindications section, Drug interactions section, Overdosage section, Pharmacokinetics section, Use in specific populations section, Warnings and precautions section, dosage
    • source: FDA Label

last updated 10/27/2013

European Medicines Agency (EMA) Label for maraviroc and CCR5

Genetic testing required

Summary

The drug labeling for maraviroc is not related to genetic testing of the patient, rather testing of the HIV-1 strain that has infected the patient. The EMA European Public Assessment Report (EPAR) for Maraviroc (CELSENTRI) contains information regarding its indication only in patients with CCR5-tropic HIV-1 and not CXCR4- or dual/mixed tropic virus, due to its mechanism of action as a CCR5 antagonist.

Annotation

The EPAR details that a test on newly drawn blood should be carried out prior to treatment to confirm only CCR5-tropic HIV-1 virus is detectable and treatment should be started soon after the test. Under safety data, the EPAR states that no significant adverse consequences in humans that lack CCR5 expression due to genetic deletion have been reported.

Excerpts from the Maraviroc (CELSENTRI) EPAR:

Maraviroc selectively binds to the human chemokine receptor CCR5, preventing CCR5-tropic HIV-1 from entering cells.


Maraviroc has no antiviral activity in vitro against viruses which can use CXCR4 as their entry co-receptor (dual-tropic or CXCR4-tropic viruses).


Before taking CELSENTRI it has to be confirmed that only CCR5-tropic HIV-1 is detectable (i.e. CXCR4 or dual/mixed tropic virus not detected) using an adequately validated and sensitive detection method on a newly drawn blood sample. The Monogram Trofile assay was used in the clinical studies of CELSENTRI (see sections 4.4 and 5.1). Other phenotypic and genotypic assays are currently being evaluated. The viral tropism cannot be safely predicted by treatment history and assessment of stored samples.

This information is highlighted in the following sections:
Therapeutic indications, posology and method of administration, tropism, pharmacodynamic properties, preclinical safety data, package leaflet - information for the user.

For the complete drug label text with sections containing pharmacogenetic information highlighted, see the Maraviroc (CELSENTRI) EMA drug label.

*Disclaimer: The contents of this page have not been endorsed by the EMA and are the sole responsibility of PharmGKB.

Genes and/or phenotypes found in this label

  • CYP3A4
    • Dosage & administration section, Drug interactions section, Pharmacokinetics section, Warnings and precautions section, metabolism/PK
    • source: European Medicines Agency (EMA) Label

PharmGKB contains no Clinical Variants that meet the highest level of criteria.

Disclaimer: The PharmGKB's clinical annotations reflect expert consensus based on clinical evidence and peer-reviewed literature available at the time they are written and are intended only to assist clinicians in decision-making and to identify questions for further research. New evidence may have emerged since the time an annotation was submitted to the PharmGKB. The annotations are limited in scope and are not applicable to interventions or diseases that are not specifically identified.

The annotations do not account for individual variations among patients, and cannot be considered inclusive of all proper methods of care or exclusive of other treatments. It remains the responsibility of the health-care provider to determine the best course of treatment for a patient. Adherence to any guideline is voluntary, with the ultimate determination regarding its application to be made solely by the clinician and the patient. PharmGKB assumes no responsibility for any injury or damage to persons or property arising out of or related to any use of the PharmGKB clinical annotations, or for any errors or omissions.

? = Mouse-over for quick help

This is a non-comprehensive list of genetic tests with pharmacogenetics relevance, typically submitted by the manufacturer and manually curated by PharmGKB. The information listed is provided for educational purposes only and does not constitute an endorsement of any listed test or manufacturer.

A more complete listing of genetic tests is found at the Genetic Testing Registry (GTR).

PGx Test Variants Assayed Related Drugs?

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page on the appropriate tab.

Links in the "Drugs" column lead to PharmGKB Drug Pages.

List of all CCR5 variant annotations

Variant?
(142)
Alternate Names ? Drugs ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
Translation
No VIP available No Clinical Annotations available VA
rs333 46354947_46354978del32, 46414947_46414978del32, 554_585del32, 8315_8346del32, CCR5: 554_585del32, Ser185_Thr195delinsIlefs, delta32, ¿32
GTCAGTATCAATTCTGGAAGAATTTCCAGACA > -
Frameshift
SerGlnTyrGlnPheTrpLysAsnPheGlnThr185Ile
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 142

Overview

Alternate Names:  CMKBR5
Alternate Symbols:  CC-CKR-5; CD195; CKR-5; CKR5; IDDM22
PharmGKB Accession Id: PA26170

Details

Cytogenetic Location: chr3 : p21.31 - p21.31
GP mRNA Boundary: chr3 : 46411633 - 46417697
GP Gene Boundary: chr3 : 46401633 - 46420697
Strand: plus
The mRNA boundaries are calculated using the gene's default feature set from NCBI, mapped onto the UCSC Golden Path. PharmGKB sets gene boundaries by expanding the mRNA boundaries by no less than 10,000 bases upstream (5') and 3,000 bases downstream (3') to allow for potential regulatory regions.

PharmGKB Curated Pathways

Pathways created internally by PharmGKB based primarily on literature evidence.

PharmGKB contains no curated pathways for this gene. If you would like to volunteer to work on a pathway, please let us know.

External Pathways

Links to non-PharmGKB pathways.

  1. il12 and stat4 dependent signaling pathway in th1 development - (BioCarta via Pathway Interaction Database)
  2. IL12-mediated signaling events - (Pathway Interaction Database NCI-Nature Curated)
  3. pertussis toxin-insensitive ccr5 signaling in macrophage - (BioCarta via Pathway Interaction Database)
No related genes are available

Curated Information ?

Curated Information ?

Evidence Disease
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Multiple Sclerosis

Publications related to CCR5: 10

No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The Dual Role of Pharmacogenetics in HIV Treatment: Mutations and Polymorphisms Regulating Antiretroviral Drug Resistance and Disposition. Pharmacological reviews. 2012. Michaud Veronique, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
HIV-1 antiretroviral drug therapy. Cold Spring Harbor perspectives in medicine. 2012. Arts Eric J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Allelic combinations of immune-response genes associated with glatiramer acetate treatment response in Russian multiple sclerosis patients. Pharmacogenomics. 2012. Tsareva Ekaterina Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic association of the CCR5 region with lipid levels in at-risk cardiovascular patients. Circulation. Cardiovascular genetics. 2010. Hyde Craig L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Diverse genome-wide association studies associate the IL12/IL23 pathway with Crohn Disease. American journal of human genetics. 2009. Wang Kai, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Reduction of CCR5 with low-dose rapamycin enhances the antiviral activity of vicriviroc against both sensitive and drug-resistant HIV-1. Proceedings of the National Academy of Sciences of the United States of America. 2008. Heredia Alonso, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of antiretroviral agents. Current opinion in HIV and AIDS. 2008. Owen Andrew, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CCL3L1-CCR5 genotype influences durability of immune recovery during antiretroviral therapy of HIV-1-infected individuals. Nature medicine. 2008. Ahuja Sunil K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of minimal residual disease response in children with B-precursor acute lymphoblastic leukemia: a report from the Children's Oncology Group. Blood. 2008. Davies Stella M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Chemokine receptor CCR5 promotes leukocyte trafficking to the brain and survival in West Nile virus infection. The Journal of experimental medicine. 2005. Glass William G, et al. PubMed

LinkOuts

UniProtKB:
CCR5_HUMAN (P51681)
Q38L21_HUMAN (Q38L21)
Ensembl:
ENSG00000160791
GenAtlas:
CCR5
GeneCard:
CCR5
MutDB:
CCR5
ALFRED:
LO000410F
HuGE:
CCR5
Comparative Toxicogenomics Database:
1234
ModBase:
O14708
HumanCyc Gene:
HS08536
IUPHAR Receptor:
CCR5 (62)
HGNC:
1606

Common Searches