Drug/Small Molecule:
mercaptopurine

Available Guidelines

  1. CPIC Dosing Guideline for mercaptopurine and TPMT
  2. Dutch Pharmacogenetics Working Group Guideline for mercaptopurine and TPMT

last updated 01/17/2013

CPIC Dosing Guideline for mercaptopurine and TPMT

Summary

Start with reduced doses of mercaptopurine for patients with one nonfunctional TPMT allele, or drastically reduced doses for patients with malignancy and two nonfunctional alleles; adjust dose based on degree of myelosuppression and disease-specific guidelines. Consider alternative nonthiopurine immunosuppressant therapy for patients with nonmalignant conditions and two nonfunctional alleles.

Annotation

April 2013 Update

Advance online publication January 2013

March 2011

Advance online publication January 2011.

  • Guidelines regarding the use of pharmacogenomic tests in dosing for azathioprine, thioguanine and mercaptopurine were published in Clinical Pharmacology and Therapeutics by the Clinical Pharmacogenetics Implementation Consortium (CPIC).
  • Excerpt from the 2011 thiopurine dosing guidelines:
    • "Thiopurines are most commonly used to treat nonmalignant conditions but are also critical anticancer agents. The approach to dosing adjustments based on TPMT status may differ depending on the clinical indication and the propensity to initiate therapy at higher vs. lower starting doses. We and others advocate testing for TPMT status prior to initiating thiopurine therapy, so that starting dosages can be adjusted accordingly."
  • Download and read:

Table 1: Recommended dosing of mercaptopurine by TPMT phenotype

Adapted from Tables 1 and 2 of the 2011 guideline manuscript.

Phenotype (Genotype) Examples of diplotypes Implications for mercaptopurine and azathioprine pharmacologic measures Dosing recommendations for mercaptopurine Classification of recommendations
Homozygous wild-type or normal, high activity (two functional *1 alleles) *1/*1 Lower concentrations of TGN metabolites, higher methylTIMP, this is the "normal" pattern Start with normal starting dose (e.g., 75 mg/m2/d or 1.5 mg/kg/d) and adjust doses of mercaptopurine (and of any other myelosuppressive therapy) without any special emphasis on mercaptopurine compared to other agents. Allow 2 weeks to reach steady state after each dose adjustment. Strong
Heterozygote or intermediate activity (one functional allele - *1, plus one nonfunctional allele - *2, *3A, *3B, *3C, or *4) *1/*2, *1/*3A, *1/*3B, *1/*3C, *1/*4 Moderate to high concentrations of TGN metabolites; low concentrations of methylTIMP Start with reduced doses (start at 30-70% of full dose: e.g., at 50 mg/m2/d or 0.75 mg/kg/d) and adjust doses of MP based on degree of myelosuppression and disease-specific guidelines. Allow 2-4 weeks to reach steady state after each dose adjustment. In those who require a dosage reduction based on myelosuppression, the median dose may be ~40% lower (44 mg/m2) than that tolerated in wild-type patients (75 mg/m2). In setting of myelosuppression, and depending on other therapy, emphasis should be on reducing mercaptopurine over other agents. Strong
Homozygous variant, mutant, low, or deficient activity (two nonfunctional alleles - *2, *3A, *3B, *3C, or *4) *3A/*3A, *2/*3A, *3C/*3A, *3C/*4, *3C/*2, *3A/*4 Extremely high concentrations of TGN metabolites; fatal toxicity possible without dose decrease; no methylTIMP metabolites For malignancy, start with drastically reduced doses (reduce daily dose by 10-fold and reduce frequency to thrice weekly instead of daily, e.g., 10 mg/m2/d given just 3 days/week) and adjust doses of MP based on degree of myelosuppression and disease-specific guidelines. Allow 4-6 weeks to reach steady state after each dose adjustment. In setting of myelosuppression, emphasis should be on reducing mercaptopurine over other agents. For nonmalignant conditions, consider alternative nonthiopurine immunosuppressant therapy. Strong

last updated 08/10/2011

Dutch Pharmacogenetics Working Group Guideline for mercaptopurine and TPMT

Summary

Select an alternative drug or reduce the initial dose for intermediate or poor metabolizers.

Annotation

The Royal Dutch Pharmacists Association - Pharmacogenetics Working Group has evaluated therapeutic dose recommendations for mercaptopurine based on TPMT genotype [Article:21412232]. They recommend selecting an alternative drug or reducing the initial dose for patients carrying inactive alleles.

Phenotype (Genotype) Therapeutic Dose Recommendation Level of Evidence Clinical Relevance
IM (one inactive allele: *2, *3, *4-*18) Select alternative drug or reduce dose by 50%. Increase dose in response of hematologic monitoring and efficacy. Published controlled studies of good quality* relating to phenotyped and/or genotyped patients or healthy volunteers, and having relevant pharmacokinetic or clinical endpoints. Clinical effect (S): Failure of lifesaving therapy e.g. anticipated myelosuppression; prevention of breast cancer relapse; arrhythmia; neutropenia < 0.5x109/l; leucopenia < 1.0x109/l; thrombocytopenia < 25x109/l; life-threatening complications from diarrhea.
PM (two inactive alleles: *2, *3, *4-*18) Select alternative drug or reduce dose by 90%. Increase dose in response of hematologic monitoring and efficacy. Published controlled studies of good quality* relating to phenotyped and/or genotyped patients or healthy volunteers, and having relevant pharmacokinetic or clinical endpoints. Clinical effect (S): death; arrhythmia; unanticipated myelosuppression.

PharmGKB gathers information regarding PGx on FDA drug labels from the FDA's "Table of Pharmacogenomic Biomarkers in Drug Labels", and from FDA-approved FDA and EMA-approved (European Medicines Agency) EMA labels brought to our attention. Excerpts from the label and downloadable highlighted label PDFs are manually curated by PharmGKB.

Please note that some drugs may have been removed from or added to the FDA's "Table of Pharmacogenomic Biomarkers in Drug Labels" without our knowledge. We periodically check the table for additions to this table and update PharmGKB accordingly.

There is currently no such list for European drug labels - we are working with the EMA to establish a list of European Public Assessment Reports (EPAR)s that contain PGx information. We are constructing this list by initially searching for drugs for which we have PGx-containing FDA drug labels - of these 44 EMA EPARs were identified and are being curated for pgx information.

We welcome any information regarding drug labels containing PGx information approved by the FDA, EMA or other Medicine Agencies around the world - please contact feedback.



last updated 10/25/2013

FDA Label for mercaptopurine and TPMT

This label is on the FDA Biomarker List
Genetic testing recommended

Summary

TPMT genotyping or phenotyping can identify patients who are homozygous deficient, which predisposes them to mercaptopurine toxicity, or who have low/intermediate TPMT activity, which makes them more likely to experience mercaptopurine toxicity than people with normal TPMT activity.

Annotation

The pharmacogenomic relationship between mercaptopurine and TPMT is well described. See the TPMT VIP and Thiopurines Pathway for more details. Recent work by the Clinical Pharmacogenomics Implementation Consortium (CPIC) has published guidelines for dosing of mercaptopurine in individuals with TPMT variants.

Excerpt from the Mercaptopurine drug label:

Mercaptopurine is inactivated via two major pathways. One is thiol methylation, which is catalyzed by the polymorphic enzyme thiopurine S-methyltransferase (TPMT), to form the inactive metabolite methyl-6-MP. TPMT activity is highly variable in patients because of a genetic polymorphism in the TPMT gene. For Caucasians and African Americans, approximately 0.3% (1:300) of patients have two non-functional alleles (homozygous-deficient) of the TPMT gene and have little or no detectable enzyme activity. Approximately 10% of patients have one TPMT non-functional allele (heterozygous) leading to low or intermediate TPMT activity and 90% of individuals have normal TPMT activity with two functional alleles. Homozygous-deficient patients (two non-functional alleles), if given usual doses of mercaptopurine, accumulate excessive cellular concentrations of active thioguanine nucleotides predisposing them to PURINETHOL toxicity (see WARNINGS and PRECAUTIONS). Heterozygous patients with low or intermediate TPMT activity accumulate higher concentrations of active thioguanine nucleotides than people with normal TPMT activity and are more likely to experience mercaptopurine toxicity (see WARNINGS and PRECAUTIONS). TPMT genotyping or phenotyping (red blood cell TPMT activity) can identify patients who are homozygous deficient or have low or intermediate TPMT activity.

If a patient has clinical or laboratory evidence of severe bone marrow toxicity, particularly myelosuppression, TPMT testing should be considered.

For the complete drug label text with sections containing pharmacogenetic information highlighted, see the Mercaptopurine drug label.

*Disclaimer: The contents of this page have not been endorsed by the FDA and are the sole responsibility of PharmGKB.

Full label available at DailyMed

Genes and/or phenotypes found in this label

  • Drug Toxicity
    • Warnings section, Adverse reactions section, Precautions section
    • source: PHONT
  • Inflammatory Bowel Diseases
    • Warnings section
    • source: PHONT
  • Leukemia
    • Indications & usage section, Warnings section, Adverse reactions section, Precautions section
    • source: PHONT
  • Leukemia, Lymphoid
    • Indications & usage section, Adverse reactions section, Precautions section
    • source: PHONT
  • Leukemia, Myeloid, Acute
    • Indications & usage section, Adverse reactions section
    • source: PHONT
  • Myelosuppression
    • Warnings section, Adverse reactions section, Precautions section
    • source: PHONT
  • Neoplasms
    • Warnings section, Adverse reactions section
    • source: PHONT
  • Neutropenia
    • Warnings section
    • source: PHONT
  • Precursor Cell Lymphoblastic Leukemia-Lymphoma
    • Indications & usage section, Adverse reactions section
    • source: PHONT
  • TPMT
    • Dosage & administration section, Warnings section, Adverse reactions section, Clinical pharmacology section, Precautions section, dosage, efficacy, toxicity, metabolism/PK
    • source: FDA Label

last updated 10/27/2013

European Medicines Agency (EMA) Label for mercaptopurine and TPMT

Actionable PGx

Summary

The EMA European Public Assessment Report (EPAR) for mercaptopurine (Xaluprine) contains information regarding its metabolism by TPMT, and that patients with reduced activity are at increased risk of severe toxicity and likely require a reduced dose. TPMT genotyping or phenotyping can be used to identify these patients, although this should not replace close monitoring of blood counts.

Annotation

Excerpts from the mercaptopurine (Xaluprine) EPAR:

6-mercaptopurine is metabolised by the polymorphic TPMT enzyme. Patients with little or no inherited TPMT activity are at increased risk for severe toxicity from conventional doses of mercaptopurine and generally require substantial dose reduction. TPMT genotyping or phenotyping can be used to identify patients with absent or reduced TPMT activity. TPMT testing cannot substitute for haematological monitoring in patients receiving Xaluprine. The optimal starting dose for homozygous deficient patients has not been established (see section 4.4).

For the complete drug label text with sections containing pharmacogenetic information highlighted, see the mercaptopurine (Xaluprine) EMA drug label.

*Disclaimer: The contents of this page have not been endorsed by the EMA and are the sole responsibility of PharmGKB.

Genes and/or phenotypes found in this label

  • TPMT
    • Dosage & administration section, Drug interactions section, Information for patients section, Pharmacokinetics section, Warnings and precautions section, dosage, toxicity
    • source: European Medicines Agency (EMA) Label

Clinical Variants that meet the highest level of criteria, manually curated by PharmGKB, are shown below.

To see more Clinical Variants with lower levels of criteria, click the button at the bottom of the page.

Disclaimer: The PharmGKB's clinical annotations reflect expert consensus based on clinical evidence and peer-reviewed literature available at the time they are written and are intended only to assist clinicians in decision-making and to identify questions for further research. New evidence may have emerged since the time an annotation was submitted to the PharmGKB. The annotations are limited in scope and are not applicable to interventions or diseases that are not specifically identified.

The annotations do not account for individual variations among patients, and cannot be considered inclusive of all proper methods of care or exclusive of other treatments. It remains the responsibility of the health-care provider to determine the best course of treatment for a patient. Adherence to any guideline is voluntary, with the ultimate determination regarding its application to be made solely by the clinician and the patient. PharmGKB assumes no responsibility for any injury or damage to persons or property arising out of or related to any use of the PharmGKB clinical annotations, or for any errors or omissions.

? = Mouse-over for quick help

This is a non-comprehensive list of genetic tests with pharmacogenetics relevance, typically submitted by the manufacturer and manually curated by PharmGKB. The information listed is provided for educational purposes only and does not constitute an endorsement of any listed test or manufacturer.

A more complete listing of genetic tests is found at the Genetic Testing Registry (GTR).

PGx Test Variants Assayed Gene?
DMET Plus (Affymetrix, Inc) Variant in TPMT
Prometheus TPMT Genetics TPMT Not available
TPMT GenotypR rs1142345 , rs1800460 , rs1800462

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Links in the "Gene" column lead to PharmGKB Gene Pages.

Gene ? Variant?
(138)
Alternate Names / Tag SNPs ? Drugs ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
Translation
No VIP available CA VA HLA-DQA1 *02:01 N/A N/A N/A
No VIP available CA VA HLA-DRB1 *07:01:01:01 N/A N/A N/A
No VIP available CA VA TPMT *1 N/A N/A N/A
No VIP available CA VA TPMT *1A N/A N/A N/A
No VIP available CA VA TPMT *1S N/A N/A N/A
No VIP available CA VA TPMT *2 N/A N/A N/A
No VIP available CA VA TPMT *3A N/A N/A N/A
No VIP available CA VA TPMT *3B N/A N/A N/A
No VIP available CA VA TPMT *3C N/A N/A N/A
No VIP available CA VA TPMT *3D N/A N/A N/A
No VIP available CA VA TPMT *4 N/A N/A N/A
No VIP available CA VA TPMT *5 N/A N/A N/A
No VIP available CA VA TPMT *6 N/A N/A N/A
No VIP available CA VA TPMT *7 N/A N/A N/A
No VIP available CA VA TPMT *8 N/A N/A N/A
No VIP available CA VA TPMT *9 N/A N/A N/A
No VIP available CA VA TPMT *10 N/A N/A N/A
No VIP available CA VA TPMT *11 N/A N/A N/A
No VIP available CA VA TPMT *12 N/A N/A N/A
No VIP available CA VA TPMT *13 N/A N/A N/A
No VIP available CA VA TPMT *14 N/A N/A N/A
No VIP available CA VA TPMT *15 N/A N/A N/A
No VIP available CA No VIP available TPMT *16 N/A N/A N/A
No VIP available CA No VIP available TPMT *17 N/A N/A N/A
No VIP available CA VA TPMT *18 N/A N/A N/A
No VIP available CA No VIP available TPMT *19 N/A N/A N/A
No VIP available CA No VIP available TPMT *20 N/A N/A N/A
No VIP available CA VA TPMT *21 N/A N/A N/A
No VIP available CA VA TPMT *22 N/A N/A N/A
No VIP available CA VA TPMT *23 N/A N/A N/A
No VIP available CA VA TPMT *24 N/A N/A N/A
No VIP available CA VA TPMT *25 N/A N/A N/A
No VIP available CA VA TPMT *26 N/A N/A N/A
No VIP available CA No VIP available TPMT *27 N/A N/A N/A
No VIP available CA No VIP available TPMT *28 N/A N/A N/A
No VIP available CA No VIP available TPMT *30 N/A N/A N/A
No VIP available CA VA TPMT *31 N/A N/A N/A
No VIP available CA VA TPMT *32 N/A N/A N/A
No VIP available CA VA TPMT *33 N/A N/A N/A
No VIP available CA VA TPMT *34 N/A N/A N/A
No VIP available CA VA TPMT *37 N/A N/A N/A
No VIP available No Clinical Annotations available VA
rs10035440 31529463T>C, 31539463T>C, 807+667T>C
T > C
Intronic
No VIP available No Clinical Annotations available VA
rs10061133 -94T>C, 126+1872T>C, 27T>C, 5060903A>G, 54466544A>G
A > G
Not Available
No VIP available No Clinical Annotations available VA
rs10505168 113655752T>C, 26929301T>C, 2998+1586A>G, 3190+1586A>G, 31T>C, 3310+1586A>G
T > C
Intronic
No VIP available CA VA
rs1051266 3952235T>C, 46957794T>C, 80A>G, 9592A>G, : 80A>G, His27Arg, RFC-1, SCL19A1:80G>A, SLC19A1:Arg27His, SLC19A1:G80A, mRNA 199A>G
T > C
Missense
His27Arg
No VIP available No Clinical Annotations available VA
rs11045879 103492T>C, 14142743T>C, 1865+4846T>C, 21382619T>C, OATP1B1: intronic C/T
T > C
Intronic
No VIP available No Clinical Annotations available VA
rs1127354 194C>A, 194C>G, 194C>T, 286C>A, 286C>G, 286C>T, 3133842C>A, 3133842C>G, 3133842C>T, 3193842C>A, 3193842C>G, 3193842C>T, 43C>A, 43C>G, 43C>T, 49-62C>A, 49-62C>G, 49-62C>T, 67-789C>A, 67-789C>G, 67-789C>T, 8787C>A, 8787C>G, 8787C>T, 94C>A, 94C>G, 94C>T, ITPA, ITPA: 94C>A, P32T, Pro15Ala, Pro15Ser, Pro15Thr, Pro32Ala, Pro32Ser, Pro32Thr
C > G
C > T
C > A
Not Available
Pro15Thr
rs1142345 18070918T>C, 18130918T>C, 29457A>G, 719A>G, TPMT*3C, Tyr240Cys
T > C
Missense
Tyr240Cys
No VIP available CA VA
rs116855232 29599855C>T, 415C>T, 48619855C>T, Arg139Cys
C > T
Missense
Arg139Cys
No VIP available No Clinical Annotations available VA
rs11866002 12201936C>T, 2904G>A, 2919G>A, 3237G>A, 58587737C>T, Gln968=, Gln973=
G > T
G > C
Synonymous
Gln973Gln
No VIP available No Clinical Annotations available VA
rs12201199 18079802A>T, 18139802A>T, 20573T>A, 419+94T>A, TPMT:rs12201199 A/T
A > T
Intronic
No VIP available No Clinical Annotations available VA
rs12529220 12128A>T, 141-101A>T, 18088247T>A, 18148247T>A
T > A
Intronic
No VIP available No Clinical Annotations available VA
rs12894467 -1587C>T, 101507727C>T, 28C>T, 82507727C>T
C > T
5' Flanking
No VIP available No Clinical Annotations available VA
rs1695 12658484A>G, 313A>G, 6624A>G, 67352689A>G, GSTP1*2, GSTP1*B, GSTP1: I105V, GSTP1:A313G, GSTP1:I105V, GSTP1:Ile105Val, Ile105Val, Part of haplotypes GSTP1*B and GSTP1*C, rs1695:A>G
A > G
Missense
Ile105Val
No VIP available No Clinical Annotations available VA
rs17087144 -45-9125A>T, 16129250T>A, 86964718T>A
T > A
Intronic
No VIP available No Clinical Annotations available VA
rs17268122 1263+2596C>A, 8934170G>T, 95844494G>T
G > T
Intronic
No VIP available No Clinical Annotations available VA
rs17428030 16118153A>G, 206+1868T>C, 60+1868T>C, 86953621A>G
A > G
Intronic
No VIP available No Clinical Annotations available VA
rs17839843 16521C>T, 18083854G>A, 18143854G>A, 339C>T, Thr113=
G > A
Synonymous
Thr113Thr
rs1800460 18079228C>T, 18139228C>T, 21147G>A, 460G>A, Ala154Thr, TPMT*3B
C > T
Missense
Ala154Thr
rs1800462 16420G>C, 18083955C>G, 18143955C>G, 238G>C, Ala80Pro, TPMT*2, TPMT:238G>C
C > G
Missense
Ala80Pro
VIP No Clinical Annotations available No Variant Annotations available
rs1800584 18071012C>T, 18131012C>T, 29363G>A, 626-1G>A, TPMT*4
C > T
Acceptor
No VIP available No Clinical Annotations available VA
rs1801131 1040A>C, 11208431T>G, 11794419T>G, 1286A>C, 1409A>C, 16685A>C, A1298C, Glu347Ala, Glu429Ala, Glu470Ala, MTHFR:1298A>C
T > G
Not Available
Glu347Ala
No VIP available CA VA
rs1801133 11210333G>A, 11796321G>A, 14783C>T, 419C>T, 665C>T, 677C>T, 788C>T, A222V, Ala140Val, Ala222Val, Ala263Val, C677T, MTHFR: c.677C>T, MTHFR:667C>T, p.A222V
G > A
Not Available
Ala140Val
No VIP available No Clinical Annotations available VA
rs1805087 237048500A>G, 2756A>G, 30566279A>G, 94920A>G, Asp919Gly, MS 2756A>G, MS D919G, MTR:2756A>G, MTR:Asp919Gly
A > G
Missense
Asp919Gly
No VIP available No Clinical Annotations available VA
rs197388 -1065A>T, 112297482A>T, 12+841T>A, 82269400A>T
A > T
5' Flanking
No VIP available No Clinical Annotations available VA
rs1979277 1303C>T, 1420C>T, 17835470G>A, 18232096G>A, 39761C>T, Leu435Phe, Leu474Phe, SHMT1 L435F
G > A
Missense
Leu435Phe
No VIP available No Clinical Annotations available VA
rs2114358 129021179G>A, 36G>A, 42294728G>A, 971+19642G>A
G > A
Intronic
No VIP available No Clinical Annotations available VA
rs2274407 8948711C>A, 8948711C>G, 8948711C>T, 912G>A, 912G>C, 912G>T, 95859035C>A, 95859035C>G, 95859035C>T, Lys304=, Lys304Asn
C > G
C > T
C > A
Missense
Lys304Asn
Lys304Lys
No VIP available No Clinical Annotations available VA
rs2287584 31413007T>C, 31423007T>C, 3195A>G, 3306A>G, Pro1065=, Pro1102=
T > C
Synonymous
Pro1065Pro
No VIP available No Clinical Annotations available VA
rs2289030 113G>C, 57371592G>C, 57G>C, 95228286G>C
G > C
Not Available
No VIP available No Clinical Annotations available VA
rs2368393 29773998A>G, 29833998A>G, 29T>C, 827+5528T>C
A > G
Intronic
No VIP available No Clinical Annotations available VA
rs2413739 -78+13991G>A, 22787605C>T, 43397036C>T
C > T
Intronic
No VIP available No Clinical Annotations available VA
rs2518463 16606T>C, 18083769A>G, 18143769A>G, 366+58T>C
A > G
Intronic
No VIP available CA VA
rs2647087 32621049A>C, 32681049A>C, 3913118A>C, 3962959C>C, 4017591A>C, 4112694A>C, 4126664A>C, 4138195C>C
A > C
Not Available
No VIP available No Clinical Annotations available VA
rs2682818 43472842A>C, 77T>G, 81329536A>C, 82+1884T>G
A > C
Intronic
No VIP available No Clinical Annotations available VA
rs2842934 18079214G>A, 18139214G>A, 21161C>T, 474C>T, Ile158=
G > A
Synonymous
Ile158Ile
No VIP available No Clinical Annotations available VA
rs2842949 18074021C>A, 18134021C>A, 26354G>T, 580+14G>T
C > A
Intronic
No VIP available No Clinical Annotations available VA
rs2910164 159912418C>G, 4723691C>G, 60C>G
C > G
Not Available
No VIP available No Clinical Annotations available VA
rs34115976 115577997C>G, 40125718C>G, 823-7154C>G, 83C>G
C > G
Intronic
No VIP available No Clinical Annotations available VA
rs34324334 43475018C>T, 43535018C>T, 722G>A, Ser241Asn
C > T
Missense
Ser241Asn
No VIP available No Clinical Annotations available VA
rs34743033 28-bp tandem repeats, CCGCGCCACTTGGCCTGCCTCCGTCCCG, TSER*2, TSER*3, TYMS: 28 bp tandem repeat, TYMS: 2R, TYMS: TSER *2/*3, TYMS:TSER 28-basepair 5'UTR enhancer region repeat
CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC > CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC
CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC > CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC
CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC > CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC
Not Available
No VIP available No Clinical Annotations available VA
rs3744741 2051G>A, 252606C>T, 649232C>T, Arg684Gln
G > T
G > C
Missense
Arg684Gln
No VIP available No Clinical Annotations available VA
rs3765534 2269G>A, 8905091C>T, 95815415C>T, ABCC4:E857K, ABCC4:G2269A, Glu757Lys
C > T
Missense
Glu757Lys
No VIP available No Clinical Annotations available VA
rs3805500 2463+1366C>T, 2574+1366C>T, 31452977G>A, 31462977G>A
G > A
Intronic
No VIP available CA VA
rs3824662 12542C>A, 779-1748C>A, 779-1751C>A, 8044208C>A, 8104208C>A
C > A
Intronic
No VIP available No Clinical Annotations available VA
rs3931660 11270T>A, 140+114T>A, 18089105A>T, 18149105A>T
A > T
Intronic
No VIP available No Clinical Annotations available VA
rs4305983 16108983A>G, 206+11038T>C, 60+11038T>C, 86944451A>G
A > G
Intronic
No VIP available No Clinical Annotations available VA
rs4449636 12356C>T, 18088019G>A, 18148019G>A, 233+35C>T
G > A
Intronic
No VIP available No Clinical Annotations available VA
rs4588940 16106152A>G, 207-13251T>C, 61-13251T>C, 86941620A>G
A > G
Intronic
No VIP available No Clinical Annotations available VA
rs4731448 128041339A>G, 13698T>C, 148-169T>C, 295-169T>C, 304-169T>C, 373-169T>C, 403-169T>C, 66074182A>G
A > G
Intronic
No VIP available No Clinical Annotations available VA
rs4867329 2931+245T>G, 3042+245T>G, 31425627A>C, 31435627A>C
A > C
Intronic
No VIP available No Clinical Annotations available VA
rs494852 10446723C>T, 17776G>A, 198-642G>A, 31624836C>T
C > T
Intronic
No VIP available No Clinical Annotations available VA
rs56103835 101522556T>C, 1T>C, 82522556T>C
T > C
Not Available
No VIP available No Clinical Annotations available VA
rs595961 1264-25A>G, 36367780A>G, 6339698A>G
A > G
Intronic
No VIP available No Clinical Annotations available VA
rs61886492 1378C>T, 1423C>T, 48949C>T, 49126274G>A, 49186274G>A, 499C>T, His167Tyr, His460Tyr, His475Tyr
G > A
Missense
His167Tyr
No VIP available No Clinical Annotations available VA
rs639174 2932-1862G>A, 3043-1862G>A, 31423647C>T, 31433647C>T
C > T
Intronic
No VIP available No Clinical Annotations available VA
rs6497759 1774G>A, 24741737G>A, 24801737G>A, Ala592Thr
G > A
Missense
Ala592Thr
No VIP available No Clinical Annotations available VA
rs6505162 -49+302A>C, -5T>G, 20+302A>C, 28444183A>C, 3181177A>C, 87A>C
A > C
5' Flanking
No VIP available No Clinical Annotations available VA
rs7035753 -134G>A, -45-89G>A, 13G>A, 16120214C>T, 86955682C>T
C > T
Not Available
No VIP available No Clinical Annotations available VA
rs7043257 16118206T>C, 206+1815A>G, 60+1815A>G, 86953674T>C
T > C
Intronic
No VIP available No Clinical Annotations available VA
rs7911488 -10+1414T>C, -143T>C, -9-1866T>C, 105154089A>G, 55958553A>G, 70T>C
A > G
Intronic
No VIP available No Clinical Annotations available VA
rs9611280 19942688G>A, 40552119G>A, 46G>A, Val16Met
G > A
Missense
Val16Met
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 138
2D structure from PubChem
provided by PubChem

Overview

Generic Names
  • 6 MP
  • 6-Mercaptopurine
  • MP
  • Mercaptopurine Monohydrate
  • Mercapurin
Trade Names
  • Ismipur
  • Leukerin
  • Leupurin
  • Mercaleukim
  • Mercaleukin
  • Mern
  • Puri-Nethol
  • Purimethol
  • Purinethol
  • Xaluprine
Brand Mixture Names

PharmGKB Accession Id:
PA450379

Description

An antimetabolite antineoplastic agent with immunosuppressant properties. It interferes with nucleic acid synthesis by inhibiting purine metabolism and is used, usually in combination with other drugs, in the treatment of or in remission maintenance programs for leukemia.

Source: Drug Bank

Indication

For remission induction and maintenance therapy of acute lymphatic leukemia.

Source: Drug Bank

Other Vocabularies

Information pulled from DrugBank has not been reviewed by PharmGKB.

Pharmacology, Interactions, and Contraindications

Mechanism of Action

Mercaptopurine competes with hypoxanthine and guanine for the enzyme hypoxanthine-guanine phosphoribosyltransferase (HGPRTase) and is itself converted to thioinosinic acid (TIMP). This intracellular nucleotide inhibits several reactions involving inosinic acid (IMP), including the conversion of IMP to xanthylic acid (XMP) and the conversion of IMP to adenylic acid (AMP) via adenylosuccinate (SAMP). In addition, 6-methylthioinosinate (MTIMP) is formed by the methylation of TIMP. Both TIMP and MTIMP have been reported to inhibit glutamine-5-phosphoribosylpyrophosphate amidotransferase, the first enzyme unique to the de novo pathway for purine ribonucleotide synthesis. Experiments indicate that radiolabeled mercaptopurine may be recovered from the DNA in the form of deoxythioguanosine. Some mercaptopurine is converted to nucleotide derivatives of 6-thioguanine (6-TG) by the sequential actions of inosinate (IMP) dehydrogenase and xanthylate (XMP) aminase, converting TIMP to thioguanylic acid (TGMP).

Source: Drug Bank

Pharmacology

Mercaptopurine is one of a large series of purine analogues which interfere with nucleic acid biosynthesis and has been found active against human leukemias. It is an analogue of the purine bases adenine and hypoxanthine. It is not known exactly which of any one or more of the biochemical effects of mercaptopurine and its metabolites are directly or predominantly responsible for cell death.

Source: Drug Bank

Food Interaction

Preferably on an empty stomach, drink plenty of liquids, avoid alcohol.

Source: Drug Bank

Absorption, Distribution, Metabolism, Elimination & Toxicity

Biotransformation

Hepatic. Degradation primarily by xanthine oxidase. The catabolism of mercaptopurine and its metabolites is complex. In humans, after oral administration of ^35^S-6-mercaptopurine, urine contains intact mercaptopurine, thiouric acid (formed by direct oxidation by xanthine oxidase, probably via 6-mercapto-8-hydroxypurine), and a number of 6-methylated thiopurines. The methylthiopurines yield appreciable amounts of inorganic sulfate.

Source: Drug Bank

Protein Binding

Plasma protein binding averages 19% over the concentration range 10 to 50 microg/mL (a concentration only achieved by intravenous administration of mercaptopurine at doses exceeding 5 to 10 mg/kg).

Source: Drug Bank

Absorption

Clinical studies have shown that the absorption of an oral dose of mercaptopurine in humans is incomplete and variable, averaging approximately 50% of the administered dose. The factors influencing absorption are unknown.

Source: Drug Bank

Half-Life

Triphasic: 45 minutes, 2.5 hours, and 10 hours.

Source: Drug Bank

Toxicity

Signs and symptoms of overdosage may be immediate such as anorexia, nausea, vomiting, and diarrhea; or delayed such as myelosuppression, liver dysfunction, and gastroenteritis. The oral LD 50 of mercaptopurine was determined to be 480 mg/kg in the mouse and 425 mg/kg in the rat.

Source: Drug Bank

Chemical Properties

Chemical Formula

C5H4N4S

Source: Drug Bank

Isomeric SMILES

S=C1N=CNC2=C1NC=N2

Source: Drug Bank

Canonical SMILES

S=C1N=CNC2=C1NC=N2

Source: Drug Bank

Average Molecular Weight

152.177

Source: Drug Bank

Monoisotopic Molecular Weight

152.015666838

Source: Drug Bank

PharmGKB Curated Pathways

Pathways created internally by PharmGKB based primarily on literature evidence.

External Pathways

Links to non-PharmGKB pathways.

PharmGKB contains no links to external pathways for this drug. To report a pathway, click here.

Genes that are associated with this drug in PharmGKB's database based on (1) variant annotations, (2) literature review, (3) pathways or (4) information automatically retrieved from DrugBank, depending on the "evidence" and "source" listed below.

Curated Information ?

Drug Targets

Gene Description
ADSL (source: Drug Bank)
AMPD1 (source: Drug Bank)
AMPD2 (source: Drug Bank)
AMPD3 (source: Drug Bank)
GMPR (source: Drug Bank)
GMPR2 (source: Drug Bank)
GMPS (source: Drug Bank)
HPRT1 (source: Drug Bank)
IMPDH1 (source: Drug Bank)
IMPDH2 (source: Drug Bank)
PPAT (source: Drug Bank)

Drug Interactions

Drug Description
mercaptopurine Allopurinol increases the effect of thiopurine (source: Drug Bank)
mercaptopurine Allopurinol increases the effect of thiopurine (source: Drug Bank)
mercaptopurine The 5-ASA derivative increases the toxicity of thiopurine (source: Drug Bank)
mercaptopurine The 5-ASA derivative increases the toxicity of thiopurine (source: Drug Bank)
acenocoumarol Mercaptopurine may decrease the anticoagulant effect of acenocoumarol. (source: Drug Bank)
allopurinol Allopurinol increases the effect of thiopurine (source: Drug Bank)
anisindione Mercaptopurine may decrease the anticoagulant effect of anisindione. (source: Drug Bank)
atracurium The agent dereases the effect of the muscle relaxant (source: Drug Bank)
dicumarol Mercaptopurine may decrease the anticoagulant effect of dicumarol. (source: Drug Bank)
doxacurium The agent dereases the effect of the muscle relaxant (source: Drug Bank)
gallamine triethiodide The agent dereases the effect of the muscle relaxant (source: Drug Bank)
mesalazine The 5-ASA derivative increases the toxicity of thiopurine (source: Drug Bank)
metocurine The agent dereases the effect of the muscle relaxant (source: Drug Bank)
mivacurium The agent dereases the effect of the muscle relaxant (source: Drug Bank)
olsalazine The 5-ASA derivative increases the toxicity of thiopurine (source: Drug Bank)
pancuronium The agent dereases the effect of the muscle relaxant (source: Drug Bank)
sulfasalazine The 5-ASA derivative increases the toxicity of thiopurine (source: Drug Bank)
tubocurarine The agent dereases the effect of the muscle relaxant (source: Drug Bank)
vecuronium The agent dereases the effect of the muscle relaxant (source: Drug Bank)
warfarin Mercaptopurine may decrease the anticoagulant effect of warfarin. (source: Drug Bank)
mercaptopurine The 5-ASA derivative increases the toxicity of thiopurine (source: Drug Bank)
mercaptopurine The 5-ASA derivative increases the toxicity of thiopurine (source: Drug Bank)
mercaptopurine Complete cross resistance may occur. (source: Drug Bank)
mercaptopurine Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank)

Curated Information ?

Publications related to mercaptopurine: 234

No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
HLA-DQA1-HLA-DRB1 variants confer susceptibility to pancreatitis induced by thiopurine immunosuppressants. Nature genetics. 2014. Heap Graham A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine monitoring in children with inflammatory bowel disease: a systematic review. British journal of clinical pharmacology. 2014. Konidari Anastasia, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A common missense variant in NUDT15 confers susceptibility to thiopurine-induced leukopenia. Nature genetics. 2014. Yang Suk-Kyun, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of childhood acute lymphoblastic leukemia. Pharmacogenomics. 2014. Lopez-Lopez Elixabet, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Adherence to oral 6-mercaptopurine in African American and Asian children with acute lymphoblastic leukemia: a Children's Oncology Group study. Blood. 2014. Bhatia Smita, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Host thiopurine methyltransferase status affects mercaptopurine antileukemic effectiveness in a murine model. Pharmacogenetics and genomics. 2014. Ramsey Laura B, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Implementation of TPMT testing. British journal of clinical pharmacology. 2014. Lennard Lynne. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Identification of a novel thiopurine S-methyltransferase allele (TPMT*37). Pharmacogenetics and genomics. 2014. Roberts Rebecca L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Thiopurine pharmacogenomics: association of SNPs with clinical response and functional validation of candidate genes. Pharmacogenomics. 2014. Matimba Alice, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacogenetics of microRNAs and microRNAs biogenesis machinery in pediatric acute lymphoblastic leukemia. PloS one. 2014. López-López Elixabet, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Inherited GATA3 variants are associated with Ph-like childhood acute lymphoblastic leukemia and risk of relapse. Nature genetics. 2013. Perez-Andreu Virginia, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine methyltransferase genotype-phenotype discordance and thiopurine active metabolite formation in childhood acute lymphoblastic leukaemia. British journal of clinical pharmacology. 2013. Lennard Lynne, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Nomenclature for alleles of the thiopurine methyltransferase gene. Pharmacogenetics and genomics. 2013. Appell Malin L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics and pharmacogenomics: a bridge to individualized cancer therapy. Pharmacogenomics. 2013. Weng Liming, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinical Pharmacogenetics Implementation Consortium Guidelines for Thiopurine Methyltransferase Genotype and Thiopurine Dosing: 2013 Update. Clinical pharmacology and therapeutics. 2013. Relling M V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Optimising outcome on thiopurines in inflammatory bowel disease by co-prescription of allopurinol. Journal of Crohn's & colitis. 2012. Smith Melissa A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A Clinician-Driven Automated System for Integration of Pharmacogenetic Interpretations Into an Electronic Medical Record. Clinical pharmacology and therapeutics. 2012. Hicks J K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic determinants of mercaptopurine disposition in children with acute lymphoblastic leukemia. European journal of clinical pharmacology. 2012. Adam de Beaumais Tiphaine, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
PACSIN2 polymorphism influences TPMT activity and mercaptopurine-related gastrointestinal toxicity. Human molecular genetics. 2012. Stocco Gabriele, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PharmGKB summary: very important pharmacogene information for GSTT1. Pharmacogenetics and genomics. 2012. Thorn Caroline F, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variants of thiopurine and folate metabolic pathways determine 6-MP-mediated hematological toxicity in childhood ALL. Pharmacogenomics. 2012. Dorababu Patchva, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Nonadherence to Oral Mercaptopurine and Risk of Relapse in Hispanic and Non-Hispanic White Children With Acute Lymphoblastic Leukemia: A Report From the Children's Oncology Group. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2012. Bhatia Smita, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CDA deficiency as a possible culprit for life-threatening toxicities after cytarabine plus 6-mercaptopurine therapy: pharmacogenetic investigations. Pharmacogenomics. 2012. Ciccolini Joseph, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
6-mercaptopurine influences TPMT gene transcription in a TPMT gene promoter variable number of tandem repeats-dependent manner. Pharmacogenomics. 2012. Kotur Nikola, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic analysis of pediatric patients with acute lymphoblastic leukemia: a possible association between survival rate and ITPA polymorphism. PloS one. 2012. Kim Hyery, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase (TPMT) polymorphisms in children with acute lymphoblastic leukemia, and the need for reduction or cessation of 6-mercaptopurine doses during maintenance therapy: the Polish multicenter analysis. Pediatric blood & cancer. 2011. Peregud-Pogorzelski Jarosław, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine methyl-transferase activity and azathioprine metabolite concentrations do not predict clinical outcome in thiopurine-treated inflammatory bowel disease patients. Alimentary pharmacology & therapeutics. 2011. González-Lama Y, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase polymorphism in Iranian kidney transplant recipients. Experimental and clinical transplantation : official journal of the Middle East Society for Organ Transplantation. 2011. Aghdaie Mahdokht Hossein, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Azathioprine-related myelosuppression in a patient homozygous for TPMT*3A. Nature reviews. Nephrology. 2011. Budhiraja Pooja, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cancer Pharmacogenomics. Clinical pharmacology and therapeutics. 2011. Paugh S W, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Prospective-retrospective biomarker analysis for regulatory consideration: white paper from the industry pharmacogenomics working group. Pharmacogenomics. 2011. Patterson Scott D, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Novel thiopurine methyltransferase variant TPMT*28 results in a misdiagnosis of TPMT deficiency. Inflammatory bowel diseases. 2011. Landy J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A pragmatic randomized controlled trial of thiopurine methyltransferase genotyping prior to azathioprine treatment: the TARGET study. Pharmacogenomics. 2011. Newman William G, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics and individualized therapy in children: immunosuppressants, antidepressants, anticancer and anti-inflammatory drugs. Pharmacogenomics. 2011. Elie Valery, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pediatric pharmacogenetic and pharmacogenomic studies: the current state and future perspectives. European journal of clinical pharmacology. 2011. Russo Roberta, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Determinants of mercaptopurine toxicity in paediatric acute lymphoblastic leukemia maintenance therapy. British journal of clinical pharmacology. 2011. Adam de Beaumais Tiphaine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinical pharmacogenetics implementation consortium guidelines for thiopurine methyltransferase genotype and thiopurine dosing. Clinical pharmacology and therapeutics. 2011. Relling M V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics: From Bench to Byte- An Update of Guidelines. Clinical pharmacology and therapeutics. 2011. Swen J J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Practical recommendations for pharmacogenomics-based prescription: 2010 ESF-UB Conference on Pharmacogenetics and Pharmacogenomics. Pharmacogenomics. 2011. Becquemont Laurent, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomic contribution to drug response. Cancer journal (Sudbury, Mass.). 2011. Watson Roshawn G, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Promoter Polymorphisms in the beta-2 Adrenergic Receptor Are Associated With Drug-Induced Gene Expression Changes and Response in Acute Lymphoblastic Leukemia. Clinical pharmacology and therapeutics. 2010. Pottier N, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Ecto-5'-nucleotidase and thiopurine cellular circulation: association with cytotoxicity. Drug metabolism and disposition: the biological fate of chemicals. 2010. Li Fang, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine methyltransferase predicts the extent of cytotoxicty and DNA damage in astroglial cells after thioguanine exposure. PloS one. 2011. Hosni-Ahmed Amira, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Characterization of a novel sequence variant, TPMT*28, in the human thiopurine methyltransferase gene. Pharmacogenetics and genomics. 2010. Appell Malin Lindqvist, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Identifying genomic and developmental causes of adverse drug reactions in children. Pharmacogenomics. 2010. Becker Mara L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Systematic review of pharmacoeconomic studies of pharmacogenomic tests. Pharmacogenomics. 2010. Beaulieu Mathieu, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Multivariate models to detect genomic signatures for a class of drugs: application to thiopurines pharmacogenomics. The pharmacogenomics journal. 2010. Fridley B L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The multidrug-resistance protein 4 polymorphism is a new factor accounting for thiopurine sensitivity in Japanese patients with inflammatory bowel disease. Journal of gastroenterology. 2010. Ban Hiromistu, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine pathway. Pharmacogenetics and genomics. 2010. Zaza Gianluigi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DNA incorporation of 6-thioguanine nucleotides during maintenance therapy of childhood acute lymphoblastic leukaemia and non-Hodgkin lymphoma. Cancer chemotherapy and pharmacology. 2010. Hedeland Rikke L, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase gene polymorphism and 6-mercaptopurine dose intensity in Indian children with acute lymphoblastic leukemia. Leukemia research. 2010. Kapoor Gauri, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Influence of 5-aminosalicylic acid on 6-thioguanosine phosphate metabolite levels: a prospective study in patients under steady thiopurine therapy. British journal of pharmacology. 2010. de Graaf P, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase polymorphisms and thiopurine toxicity in treatment of inflammatory bowel disease. World journal of gastroenterology : WJG. 2010. Dong Xian-Wen, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The association of reduced folate carrier 80G>A polymorphism to outcome in childhood acute lymphoblastic leukemia interacts with chromosome 21 copy number. Blood. 2010. Gregers Jannie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Very important pharmacogene summary: thiopurine S-methyltransferase. Pharmacogenetics and genomics. 2010. Wang Liewei, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Drug transporter pharmacogenetics in nucleoside-based therapies. Pharmacogenomics. 2010. Errasti-Murugarren Ekaitz, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase pharmacogenetics: functional characterization of a novel rapidly degraded variant allozyme. Biochemical pharmacology. 2010. Feng Qiping, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Low-dose azathioprine or mercaptopurine in combination with allopurinol can bypass many adverse drug reactions in patients with inflammatory bowel disease. Alimentary pharmacology & therapeutics. 2010. Ansari A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Human lymphoblastoid cell line panels: novel tools for assessing shared drug pathways. Pharmacogenomics. 2010. Morag Ayelet, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics in the treatment of inflammatory bowel disease. Pharmacogenomics. 2010. Smith Melissa A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase genotype and the use of thiopurines in paediatric inflammatory bowel disease Greek patients. Journal of clinical pharmacy and therapeutics. 2010. Gazouli M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Long-term results of NOPHO ALL-92 and ALL-2000 studies of childhood acute lymphoblastic leukemia. Leukemia. 2010. Schmiegelow K, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Are patients with intermediate TPMT activity at increased risk of myelosuppression when taking thiopurine medications?. Pharmacogenomics. 2010. Higgs Jenny E, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Influences of thiopurine methyltransferase genotype and activity on thiopurine-induced leukopenia in Korean patients with inflammatory bowel disease: a retrospective cohort study. Journal of clinical gastroenterology. 2010. Kim Jae Hak, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase pharmacogenetics in a large-scale healthy Italian-Caucasian population: differences in enzyme activity. Pharmacogenomics. 2009. Serpe Loredana, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Polymorphisms in multidrug resistance-associated protein gene 4 is associated with outcome in childhood acute lymphoblastic leukemia. Blood. 2009. Ansari Marc, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine methyltransferase genetics is not a major risk factor for secondary malignant neoplasms after treatment of childhood acute lymphoblastic leukemia on Berlin-Frankfurt-Münster protocols. Blood. 2009. Stanulla Martin, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
TPMT*26 (208F-->L), a novel mutation detected in a Chinese. British journal of clinical pharmacology. 2009. Kham Shirley Kow Yin, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinically available pharmacogenomics tests. Clinical pharmacology and therapeutics. 2009. Flockhart D A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Impact of the heterozygous TPMT*1/*3C genotype on azathioprine-induced myelosuppression in kidney transplant recipients in Thailand. Clinical therapeutics. 2009. Vannaprasaht Suda, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Adverse reactions to azathioprine cannot be predicted by thiopurine S-methyltransferase genotype in Japanese patients with inflammatory bowel disease. Journal of gastroenterology and hepatology. 2009. Takatsu Noritaka, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Methotrexate/6-mercaptopurine maintenance therapy influences the risk of a second malignant neoplasm after childhood acute lymphoblastic leukemia: results from the NOPHO ALL-92 study. Blood. 2009. Schmiegelow Kjeld, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ADME pharmacogenetics: current practices and future outlook. Expert opinion on drug metabolism & toxicology. 2009. Grossman Iris. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Heterozygosity at the TPMT gene locus, augmented by mutated MTHFR gene, predisposes to 6-MP related toxicities in childhood ALL patients. Leukemia. 2009. Karas-Kuzelicki N, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Application of SNaPshot for analysis of thiopurine methyltransferase gene polymorphism. The Indian journal of medical research. 2009. Kapoor Gauri, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Relationships between thiopurine S-methyltransferase polymorphism and azathioprine-related adverse drug reactions in Chinese renal transplant recipients. European journal of clinical pharmacology. 2009. Xin Hua-Wen, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine methyltransferase activity is related to the risk of relapse of childhood acute lymphoblastic leukemia: results from the NOPHO ALL-92 study. Leukemia : official journal of the Leukemia Society of America, Leukemia Research Fund, U.K. 2009. Schmiegelow K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genetic polymorphism of inosine triphosphate pyrophosphatase is a determinant of mercaptopurine metabolism and toxicity during treatment for acute lymphoblastic leukemia. Clinical pharmacology and therapeutics. 2009. Stocco G, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
TPMT genetic variations in populations of the Russian Federation. Pediatric blood & cancer. 2009. Samochatova Elena V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics and pharmacogenomics of anticancer agents. CA: a cancer journal for clinicians. 2009. Huang R Stephanie, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase (TPMT) gene polymorphism in Brazilian children with acute lymphoblastic leukemia: association with clinical and laboratory data. Therapeutic drug monitoring. 2008. Silva Marcilene Rezende, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genome-wide copy number profiling reveals molecular evolution from diagnosis to relapse in childhood acute lymphoblastic leukemia. Blood. 2008. Yang Jun J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Prospective evaluation of the pharmacogenetics of azathioprine in the treatment of inflammatory bowel disease. Alimentary pharmacology & therapeutics. 2008. Ansari A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Functional characterization of 23 allelic variants of thiopurine S-methyltransferase gene (TPMT*2 - *24). Pharmacogenetics and genomics. 2008. Ujiie Shuta, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Long-term outcome of using allopurinol co-therapy as a strategy for overcoming thiopurine hepatotoxicity in treating inflammatory bowel disease. Alimentary pharmacology & therapeutics. 2008. Ansari A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Characterisation of novel defective thiopurine S-methyltransferase allelic variants. Biochemical pharmacology. 2008. Garat A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Transporter-mediated protection against thiopurine-induced hematopoietic toxicity. Cancer research. 2008. Krishnamurthy Partha, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Creating and evaluating genetic tests predictive of drug response. Nature reviews. Drug discovery. 2008. Weiss Scott T, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Structural basis of substrate recognition in thiopurine s-methyltransferase. Biochemistry. 2008. Peng Yi, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine dose in intermediate and normal metabolizers of thiopurine methyltransferase may differ three-fold. Clinical gastroenterology and hepatology : the official clinical practice journal of the American Gastroenterological Association. 2008. Gardiner Sharon J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
6-mercaptopurine and 9-(2-phosphonyl-methoxyethyl) adenine (PMEA) transport altered by two missense mutations in the drug transporter gene ABCC4. Human mutation. 2008. Janke Daniel, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Influence of MTHFR and RFC1 polymorphisms on toxicities during maintenance chemotherapy for childhood acute lymphoblastic leukemia or lymphoma. Journal of pediatric hematology/oncology : official journal of the American Society of Pediatric Hematology/Oncology. 2008. Shimasaki Noriko, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Up-regulation of MRP4 and down-regulation of influx transporters in human leukemic cells with acquired resistance to 6-mercaptopurine. Leukemia research. 2008. Peng Xing-Xiang, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Trinucleotide repeat variants in the promoter of the thiopurine S-methyltransferase gene of patients exhibiting ultra-high enzyme activity. Pharmacogenetics and genomics. 2008. Roberts Rebecca L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Functional characterization of human xanthine oxidase allelic variants. Pharmacogenetics and genomics. 2008. Kudo Mutsumi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Azathioprine-associated acute myeloid leukemia in a patient with Crohn's disease and thiopurine S-methyltransferase deficiency. American journal of hematology. 2008. Yenson Paul R, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase (TPMT) pharmacogenetics: three new mutations and haplotype analysis in the Estonian population. Clinical chemistry and laboratory medicine : CCLM / FESCC. 2008. Tamm Riin, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Analysis of thiopurine S-methyltransferase genotypes in Japanese patients with inflammatory bowel disease. Internal medicine (Tokyo, Japan). 2008. Ban Hiromitsu, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase gene (TMPT) polymorphisms in a Mexican population of healthy individuals and leukemic patients. Medical oncology (Northwood, London, England). 2008. Taja-Chayeb Lucia, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics of drug-metabolizing enzymes and drug transporters in chemotherapy. Methods in molecular biology (Clifton, N.J.). 2008. Bosch Tessa M. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The low frequency of defective TPMT alleles in Turkish population: a study on pediatric patients with acute lymphoblastic leukemia. American journal of hematology. 2007. Tumer Tugba Boyunegmez, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Explaining TPMT genotype/phenotype discrepancy by haplotyping of TPMT*3A and identification of a novel sequence variant, TPMT*23. Pharmacogenetics and genomics. 2007. Lindqvist Malin, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic significance of inosine triphosphatase. Pharmacogenomics. 2007. Bierau Jörgen, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic polymorphisms of folate metabolic enzymes and toxicities of high dose methotrexate in children with acute lymphoblastic leukemia. Annals of hematology. 2007. Pakakasama Samart, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Assessment of thiopurine methyltransferase enzyme activity is superior to genotype in predicting myelosuppression following azathioprine therapy in patients with inflammatory bowel disease. Alimentary pharmacology & therapeutics. 2007. Winter J W, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Ancestry and pharmacogenetics of antileukemic drug toxicity. Blood. 2007. Kishi Shinji, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Differential effects of targeted disruption of thiopurine methyltransferase on mercaptopurine and thioguanine pharmacodynamics. Cancer research. 2007. Hartford Christine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Using HapMap tools in pharmacogenomic discovery: the thiopurine methyltransferase polymorphism. Clinical pharmacology and therapeutics. 2007. Jones T S, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Efficient screening method of the thiopurine methyltransferase polymorphisms for patients considering taking thiopurine drugs in a Chinese Han population in Henan Province (central China). Clinica chimica acta; international journal of clinical chemistry. 2007. Zhang Li-Rong, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase gene polymorphism in Japanese patients with autoimmune liver diseases. Liver international : official journal of the International Association for the Study of the Liver. 2007. Tamori Akihiro, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Monitoring of thiopurine methyltransferase activity in postsurgical patients with Crohn's disease during 1 year of treatment with azathioprine or mesalazine. Therapeutic drug monitoring. 2007. Dilger Karin, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
TPMT genotype and its clinical implication in renal transplant recipients with azathioprine treatment. Journal of clinical pharmacy and therapeutics. 2006. Song D-K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Adding pharmacogenetics information to drug labels: lessons learned. Pharmacogenetics and genomics. 2006. Haga Susanne B, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Analysis of thiopurine S-methyltransferase polymorphism in the population of Serbia and Montenegro and mercaptopurine therapy tolerance in childhood acute lymphoblastic leukemia. Therapeutic drug monitoring. 2006. Dokmanovic Lidija, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The thiopurine methyltransferase genetic polymorphism is associated with thioguanine-related veno-occlusive disease of the liver in children with acute lymphoblastic leukemia. Clinical pharmacology and therapeutics. 2006. Lennard Lynne, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetics during standardised initiation of thiopurine treatment in inflammatory bowel disease. Gut. 2006. Hindorf U, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Toxicity and efficacy of 6-thioguanine versus 6-mercaptopurine in childhood lymphoblastic leukaemia: a randomised trial. Lancet. 2006. Vora Ajay, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Three novel thiopurine S-methyltransferase allelic variants (TPMT*20, *21, *22) - association with decreased enzyme function. Human mutation. 2006. Schaeffeler Elke, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Divergent activities of human glutathione transferases in the bioactivation of azathioprine. Molecular pharmacology. 2006. Eklund Birgitta I, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The frequency and significance of thiopurine S-methyltransferase gene polymorphisms in azathioprine-treated renal transplant recipients. The British journal of dermatology. 2006. Moloney F J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of thiopurine therapy in paediatric IBD patients. Alimentary pharmacology & therapeutics. 2006. De Ridder L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Involvement of the concentrative nucleoside transporter 3 and equilibrative nucleoside transporter 2 in the resistance of T-lymphoblastic cell lines to thiopurines. Biochemical and biophysical research communications. 2006. Fotoohi Alan Kambiz, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Determination of intra-ethnic differences in the polymorphisms of thiopurine S-methyltransferase in Chinese. Clinica chimica acta; international journal of clinical chemistry. 2006. Zhang Jian-Ping, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase pharmacogenetics: insights, challenges and future directions. Oncogene. 2006. Wang L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Predictors of immunomodulator use as early therapy in pediatric Crohn's disease. Journal of clinical gastroenterology. 2006. Jacobstein Douglas A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine methyltransferase in acute lymphoblastic leukemia. Blood. 2006. Relling Mary V, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Inosine triphosphate pyrophosphatase and thiopurine s-methyltransferase genotypes relationship to azathioprine-induced myelosuppression. Clinical gastroenterology and hepatology : the official clinical practice journal of the American Gastroenterological Association. 2006. Zelinkova Zuzana, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Azathioprine suppresses ezrin-radixin-moesin-dependent T cell-APC conjugation through inhibition of Vav guanosine exchange activity on Rac proteins. Journal of immunology (Baltimore, Md. : 1950). 2006. Poppe Daniela, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics and individualized drug therapy. Annual review of medicine. 2006. Eichelbaum Michel, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics: catechol O-methyltransferase to thiopurine S-methyltransferase. Cellular and molecular neurobiology. 2006. Weinshilboum Richard M. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
TPMT genotype and the use of thiopurines in paediatric inflammatory bowel disease. Digestive and liver disease : official journal of the Italian Society of Gastroenterology and the Italian Association for the Study of the Liver. 2005. Stocco G, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase phenotype-genotype correlation in hemodialyzed patients. Pharmacological reports : PR. 2006. Chrzanowska Maria, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase pharmacogenetics: genotype to phenotype correlation in the Slovenian population. Pharmacology. 2006. Milek M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine methyltransferase genotype and phenotype status in Japanese patients with systemic lupus erythematosus. Biological & pharmaceutical bulletin. 2005. Okada Yuko, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase pharmacogenetics: variant allele functional and comparative genomics. Pharmacogenetics and genomics. 2005. Salavaggione Oreste E, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine methyltransferase and 6-thioguanine nucleotide measurement: early experience of use in clinical practice. Internal medicine journal. 2005. Gearry R B, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A cost-effectiveness analysis of alternative disease management strategies in patients with Crohn's disease treated with azathioprine or 6-mercaptopurine. The American journal of gastroenterology. 2005. Dubinsky Marla C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gene expression and thioguanine nucleotide disposition in acute lymphoblastic leukemia after in vivo mercaptopurine treatment. Blood. 2005. Zaza Gianluigi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Karyotypic abnormalities create discordance of germline genotype and cancer cell phenotypes. Nature genetics. 2005. Cheng Qing, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The impact of thiopurine s-methyltransferase polymorphism on azathioprine-induced myelotoxicity in renal transplant recipients. Therapeutic drug monitoring. 2005. Kurzawski Mateusz, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic association with adverse drug reactions to azathioprine immunosuppressive therapy following liver transplantation. Liver transplantation : official publication of the American Association for the Study of Liver Diseases and the International Liver Transplantation Society. 2005. Breen David P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacogenetics of outcome in children with acute lymphoblastic leukemia. Blood. 2005. Rocha Jose Claudio C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Azathioprine induced nodular regenerative hyperplasia in IBD patients. Gastroentérologie clinique et biologique. 2005. Daniel Fady, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine methyltransferase (TPMT) heterozygosity and enzyme activity as predictive tests for the development of azathioprine-related adverse events. Journal of the neurological sciences. 2005. Heckmann Jeannine M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine methyltransferase (TPMT) genotype and early treatment response to mercaptopurine in childhood acute lymphoblastic leukemia. JAMA : the journal of the American Medical Association. 2005. Stanulla Martin, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Identification and functional analysis of two rare allelic variants of the thiopurine S-methyltransferase gene, TPMT*16 and TPMT*19. Biochemical pharmacology. 2005. Hamdan-Khalil Rima, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase polymorphisms and the relationship between the mutant alleles and the adverse effects in systemic lupus erythematosus patients taking azathioprine. Clinical and experimental rheumatology. 2005. Jun J B, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Assessment of thiopurine methyltransferase and metabolite formation during thiopurine therapy: results from a large Swedish patient population. Therapeutic drug monitoring. 2004. Hindorf Ulf, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase genotype predicts azathioprine-induced myelotoxicity in kidney transplant recipients. American journal of transplantation : official journal of the American Society of Transplantation and the American Society of Transplant Surgeons. 2004. Formea Christine M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Monitoring of long-term thiopurine therapy among adults with inflammatory bowel disease. Scandinavian journal of gastroenterology. 2004. Hindorf U, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Allele frequency of inosine triphosphate pyrophosphatase gene polymorphisms in a Japanese population. Nucleosides, nucleotides & nucleic acids. 2004. Marinaki A M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
The impact of thiopurine S-methyltransferase polymorphisms on azathioprine dose 1 year after renal transplantation. Transplant international : official journal of the European Society for Organ Transplantation. 2004. Fabre Margarete A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Comprehensive analysis of thiopurine S-methyltransferase phenotype-genotype correlation in a large population of German-Caucasians and identification of novel TPMT variants. Pharmacogenetics. 2004. Schaeffeler Elke, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Methylated metabolites of 6-mercaptopurine are associated with hepatotoxicity. Clinical pharmacology and therapeutics. 2004. Nygaard Ulrikka, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Phenotype and genotype for thiopurine methyltransferase activity in the French Caucasian population: impact of age. European journal of clinical pharmacology. 2004. Ganiere-Monteil Catherine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Analysis of variation in mouse TPMT genotype, expression and activity. Pharmacogenetics. 2004. Watters James W, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Identification of two novel sequence variants affecting thiopurine methyltransferase enzyme activity. Pharmacogenetics. 2004. Lindqvist Malin, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacogenetics of thiopurine S-methyltransferase and thiopurine therapy. Therapeutic drug monitoring. 2004. Evans William E. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pyrosequencing of TPMT alleles in a general Swedish population and in patients with inflammatory bowel disease. Clinical chemistry. 2004. Haglund Sofie, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Mistaken identity: misclassification of TPMT phenotype following blood transfusion. European journal of gastroenterology & hepatology. 2003. Cheung Seau-Tak, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
In vitro characterization of four novel non-functional variants of the thiopurine S-methyltransferase. Biochemical and biophysical research communications. 2003. Hamdan-Khalil Rima, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Drug methylation in cancer therapy: lessons from the TPMT polymorphism. Oncogene. 2003. Krynetski Eugene, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Phenotypic and genotypic analysis of thiopurine s-methyltransferase polymorphism in the bulgarian population. Therapeutic drug monitoring. 2003. Indjova Dessislava, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase pharmacogenetics: chaperone protein association and allozyme degradation. Pharmacogenetics. 2003. Wang Liewei, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic polymorphism of thiopurine S-methyltransferase in Argentina. Annals of clinical biochemistry. 2003. Laróvere L E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Dose reduction of coadministered 6-mercaptopurine decreases myelotoxicity following high-dose methotrexate in childhood leukemia. Leukemia. 2003. Nygaard U, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A novel TPMT missense mutation associated with TPMT deficiency in a 5-year-old boy with ALL. Leukemia : official journal of the Leukemia Society of America, Leukemia Research Fund, U.K. 2003. Schaeffeler E, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine methyltransferase phenotypes and genotypes in Brazilians. Pharmacogenetics. 2003. Reis Marcelo, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Treatment-specific changes in gene expression discriminate in vivo drug response in human leukemia cells. Nature genetics. 2003. Cheok Meyling H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CD28-dependent Rac1 activation is the molecular target of azathioprine in primary human CD4+ T lymphocytes. The Journal of clinical investigation. 2003. Tiede Imke, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Safe treatment of thiopurine S-methyltransferase deficient Crohn's disease patients with azathioprine. Gut. 2003. Kaskas B A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Is thiopurine methyltransferase genetic polymorphism a major factor for withdrawal of azathioprine in rheumatoid arthritis patients?. Rheumatology (Oxford, England). 2003. Corominas H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine metabolism and identification of the thiopurine metabolites transported by MRP4 and MRP5 overexpressed in human embryonic kidney cells. Molecular pharmacology. 2002. Wielinga P R, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine methyltransferase activity and the use of azathioprine in inflammatory bowel disease. Alimentary pharmacology & therapeutics. 2002. Ansari A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Azathioprine therapy and adverse drug reactions in patients with inflammatory bowel disease: impact of thiopurine S-methyltransferase polymorphism. Pharmacogenetics. 2002. Schwab Matthias, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine methyltransferase polymorphisms in a multiracial asian population and children with acute lymphoblastic leukemia. Journal of pediatric hematology/oncology. 2002. Kham S K Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Differing contribution of thiopurine methyltransferase to mercaptopurine versus thioguanine effects in human leukemic cells. Cancer research. 2001. Dervieux T, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Influence of the variable number of tandem repeats located in the promoter region of the thiopurine methyltransferase gene on enzymatic activity. Clinical pharmacology and therapeutics. 2001. Alves S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Rational dosing of azathioprine and 6-mercaptopurine. Gut. 2001. Sandborn W J. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine pharmacogenetics: clinical and molecular studies of thiopurine methyltransferase. Drug metabolism and disposition: the biological fate of chemicals. 2001. Weinshilboum R. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genotype-phenotype correlation for thiopurine S-methyltransferase in healthy Italian subjects. European journal of clinical pharmacology. 2001. Rossi A M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Preponderance of thiopurine S-methyltransferase deficiency and heterozygosity among patients intolerant to mercaptopurine or azathioprine. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2001. Evans W E, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic polymorphisms of thiopurine S-methyltransferase and 6-mercaptopurine toxicity in Japanese children with acute lymphoblastic leukaemia. Pharmacogenetics. 2001. Ando M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
6-mercaptopurine dosage and pharmacokinetics influence the degree of bone marrow toxicity following high-dose methotrexate in children with acute lymphoblastic leukemia. Leukemia. 2001. Schmiegelow K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Therapeutic drug monitoring of cytotoxic drugs. British journal of clinical pharmacology. 2001. Lennard L. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A multicenter trial of 6-mercaptopurine and prednisone in children with newly diagnosed Crohn's disease. Gastroenterology. 2000. Markowitz J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genotypic analysis of thiopurine S-methyltransferase in patients with Crohn's disease and severe myelosuppression during azathioprine therapy. Gastroenterology. 2000. Colombel J F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Multidrug-resistance protein 5 is a multispecific organic anion transporter able to transport nucleotide analogs. Proceedings of the National Academy of Sciences of the United States of America. 2000. Wijnholds J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenomics and metabolite measurement for 6-mercaptopurine therapy in inflammatory bowel disease. Gastroenterology. 2000. Dubinsky M C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic polymorphism of thiopurine methyltransferase and its clinical relevance for childhood acute lymphoblastic leukemia. Leukemia : official journal of the Leukemia Society of America, Leukemia Research Fund, U.K. 2000. McLeod H L, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase gene polymorphism is predictive of azathioprine-induced myelosuppression in heart transplant recipients. Transplantation. 2000. Sebbag L, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Severe 6-thioguanine-induced marrow aplasia in a child with acute lymphoblastic leukemia and inherited thiopurine methyltransferase deficiency. Journal of pediatric hematology/oncology. 2000. McBride K L, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Mercaptopurine therapy intolerance and heterozygosity at the thiopurine S-methyltransferase gene locus. Journal of the National Cancer Institute. 1999. Relling M V, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Enhanced proteasomal degradation of mutant human thiopurine S-methyltransferase (TPMT) in mammalian cells: mechanism for TPMT protein deficiency inherited by TPMT*2, TPMT*3A, TPMT*3B or TPMT*3C. Pharmacogenetics. 1999. Tai H L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Possible carcinogenic effect of 6-mercaptopurine on bone marrow stem cells: relation to thiopurine metabolism. Cancer. 1999. Bo J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
High incidence of secondary brain tumours after radiotherapy and antimetabolites. Lancet. 1999. Relling M V, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Analysis of thiopurine methyltransferase variant alleles in childhood acute lymphoblastic leukaemia. British journal of haematology. 1999. McLeod H L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Prognostic importance of 6-mercaptopurine dose intensity in acute lymphoblastic leukemia. Blood. 1999. Relling M V, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine methyltransferase pharmacogenetics: alternative molecular diagnosis and preliminary data from Northern Portugal. Pharmacogenetics. 1999. Alves S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Therapeutic drug monitoring of antimetabolic cytotoxic drugs. British journal of clinical pharmacology. 1999. Lennard L. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Polymorphism of the thiopurine S-methyltransferase gene in African-Americans. Human molecular genetics. 1999. Hon Y Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The frequency and distribution of thiopurine methyltransferase alleles in Caucasian and Asian populations. Pharmacogenetics. 1999. Collie-Duguid E S, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine methyltransferase genotype predicts therapy-limiting severe toxicity from azathioprine. Annals of internal medicine. 1998. Black A J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinical implications of thiopurine methyltransferase--optimization of drug dosage and potential drug interactions. Therapeutic drug monitoring. 1998. Lennard L. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Isolation of a human thiopurine S-methyltransferase (TPMT) complementary DNA with a single nucleotide transition A719G (TPMT*3C) and its association with loss of TPMT protein and catalytic activity in humans. Clinical pharmacology and therapeutics. 1998. Loennechen T, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Etoposide and antimetabolite pharmacology in patients who develop secondary acute myeloid leukemia. Leukemia : official journal of the Leukemia Society of America, Leukemia Research Fund, U.K. 1998. Relling M V, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Human thiopurine methyltransferase pharmacogenetics. Kindred with a terminal exon splice junction mutation that results in loss of activity. The Journal of clinical investigation. 1998. Otterness D M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacokinetics, dose adjustments, and 6-mercaptopurine/methotrexate drug interactions in two patients with thiopurine methyltransferase deficiency. Acta paediatrica (Oslo, Norway : 1992). 1998. Andersen J B, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Detection of known and new mutations in the thiopurine S-methyltransferase gene by single-strand conformation polymorphism analysis. Human mutation. 1998. Spire-Vayron de la Moureyre C, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Human thiopurine methyltransferase pharmacogenetics: gene sequence polymorphisms. Clinical pharmacology and therapeutics. 1997. Otterness D, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Enhanced proteolysis of thiopurine S-methyltransferase (TPMT) encoded by mutant alleles in humans (TPMT*3A, TPMT*2): mechanisms for the genetic polymorphism of TPMT activity. Proceedings of the National Academy of Sciences of the United States of America. 1997. Tai H L, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Molecular diagnosis of thiopurine S-methyltransferase deficiency: genetic basis for azathioprine and mercaptopurine intolerance. Annals of internal medicine. 1997. Yates C R, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Individualizing therapy with 6-mercaptopurine and 6-thioguanine related to the thiopurine methyltransferase genetic polymorphism. Therapeutic drug monitoring. 1996. Lennard L, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase deficiency: two nucleotide transitions define the most prevalent mutant allele associated with loss of catalytic activity in Caucasians. American journal of human genetics. 1996. Tai H L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Thiopurine methyltransferase pharmacogenetics: human gene cloning and characterization of a common polymorphism. DNA and cell biology. 1996. Szumlanski C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Methylation of mercaptopurine, thioguanine, and their nucleotide metabolites by heterologously expressed human thiopurine S-methyltransferase. Molecular pharmacology. 1995. Krynetski E Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Sulphasalazine inhibition of thiopurine methyltransferase: possible mechanism for interaction with 6-mercaptopurine and azathioprine. British journal of clinical pharmacology. 1995. Szumlanski C L, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A single point mutation leading to loss of catalytic activity in human thiopurine S-methyltransferase. Proceedings of the National Academy of Sciences of the United States of America. 1995. Krynetski E Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Purine substrates for human thiopurine methyltransferase. Biochemical pharmacology. 1994. Deininger M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Decrease in S-adenosylmethionine synthesis by 6-mercaptopurine and methylmercaptopurine ribonucleoside in Molt F4 human malignant lymphoblasts. The Biochemical journal. 1994. Stet E H, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Congenital thiopurine methyltransferase deficiency and 6-mercaptopurine toxicity during treatment for acute lymphoblastic leukaemia. Archives of disease in childhood. 1993. Lennard L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Reversal of 6-mercaptopurine and 6-methylmercaptopurine ribonucleoside cytotoxicity by amidoimidazole carboxamide ribonucleoside in Molt F4 human malignant T-lymphoblasts. Biochemical pharmacology. 1993. Stet E H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Azathioprine-induced myelosuppression in thiopurine methyltransferase deficient heart transplant recipient. Lancet. 1993. McLeod H L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
6-Mercaptopurine: cytotoxicity and biochemical pharmacology in human malignant T-lymphoblasts. Biochemical pharmacology. 1993. Bökkerink J P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Human liver thiopurine methyltransferase pharmacogenetics: biochemical properties, liver-erythrocyte correlation and presence of isozymes. Pharmacogenetics. 1992. Szumlanski C L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
The clinical pharmacology of 6-mercaptopurine. European journal of clinical pharmacology. 1992. Lennard L. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Altered mercaptopurine metabolism, toxic effects, and dosage requirement in a thiopurine methyltransferase-deficient child with acute lymphocytic leukemia. The Journal of pediatrics. 1991. Evans W E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic variation in response to 6-mercaptopurine for childhood acute lymphoblastic leukaemia. Lancet. 1990. Lennard L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of AMP on the activation of glycogen synthase and phosphorylase by adenosine, fructose, and glutamine in rat hepatocytes. The Journal of biological chemistry. 1990. Carabaza A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine methyltransferase isozymes in human renal tissue. Drug metabolism and disposition: the biological fate of chemicals. 1990. Van Loon J A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The effect of methotrexate on the bioavailability of oral 6-mercaptopurine. Clinical pharmacology and therapeutics. 1987. Balis F M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine pharmacogenetics in leukemia: correlation of erythrocyte thiopurine methyltransferase activity and 6-thioguanine nucleotide concentrations. Clinical pharmacology and therapeutics. 1987. Lennard L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The effects of 6-mercaptopurine nucleotide derivatives on the growth and survival of 6-mercaptopurine-sensitive and -resistant cell culture lines. British journal of cancer. 1985. Johnston H P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Mercaptopurine pharmacogenetics: monogenic inheritance of erythrocyte thiopurine methyltransferase activity. American journal of human genetics. 1980. Weinshilboum R M, et al. PubMed

LinkOuts

Web Resource:
Wikipedia
National Drug Code Directory:
0378-3547-52
DrugBank:
DB01033
ChEBI:
2208
KEGG Compound:
C02380
KEGG Drug:
D04931
PubChem Compound:
667490
PubChem Substance:
46506988
5422
Drugs Product Database (DPD):
4723
BindingDB:
50200098
ChemSpider:
580869
Therapeutic Targets Database:
DAP000147
FDA Drug Label at DailyMed:
15904472-4c32-4224-95d3-eb131a7ff9c8

Clinical Trials

These are trials that mention mercaptopurine and are related to either pharmacogenetics or pharmacogenomics.

Common Searches

Search PubMed
Search Medline Plus
Search PubChem
Search CTD

Sources for PharmGKB drug information: DrugBank, Open Eye Scientific Software.