Drug/Small Molecule:
mercaptopurine

last updated 01/17/2013

CPIC Dosing Guideline for mercaptopurine and TPMT

Summary

Start with reduced doses of mercaptopurine for patients with one nonfunctional TPMT allele, or drastically reduced doses for patients with malignancy and two nonfunctional alleles; adjust dose based on degree of myelosuppression and disease-specific guidelines. Consider alternative nonthiopurine immunosuppressant therapy for patients with nonmalignant conditions and two nonfunctional alleles.

Annotation

These guidelines apply to adults and pediatrics. Please see below for full details of these guidelines, with supporting evidence and disclaimers.

Guidelines regarding the use of pharmacogenomic tests in dosing for azothioprine, thioguanine and mercaptopurine were published March 2011 in Clinical Pharmacology and Therapeutics by the Clinical Pharmacogenetics Implementation Consortium (CPIC).

Download: article and supplement

Conclusions of the CPIC guidelines update 2013, accepted for publication by Clinical Pharmacology and Therapeutics and available online Jan 2013: Literature published between June 2010-November 2012 was reviewed and there is no new evidence that would change the original guidelines. Therefore, the dosing recommendations in the original publication remain clinically current. As much of the evidence used to support the guidelines was generated in children, and the dosing recommendations are in units mg/m2 and mg/kg (see table below), they are applicable to both pediatric and adult patients.
Read the Clinical Pharmacology and Therapeutics Updated Article and supplement

Excerpt from the original thiopurine dosing guidelines:

Thiopurines are most commonly used to treat nonmalignant conditions but are also critical anticancer agents. The approach to dosing adjustments based on TPMT status may differ depending on the clinical indication and the propensity to initiate therapy at higher vs. lower starting doses. We and others advocate testing for TPMT status prior to initiating thiopurine therapy, so that starting dosages can be adjusted accordingly.

Recommended dosing of mercaptopurine by TPMT phenotype

Phenotype (Genotype) Examples of diplotypes Implications for mercaptopurine and azathioprine pharmacologic measures Dosing recommendations for mercaptopurine Classification of recommendations
Homozygous wild-type or normal, high activity (two functional *1 alleles) *1/*1 Lower concentrations of TGN metabolites, higher methylTIMP, this is the "normal" pattern Start with normal starting dose (e.g., 75 mg/m2/d or 1.5 mg/kg/d) and adjust doses of mercaptopurine (and of any other myelosuppressive therapy) without any special emphasis on mercaptopurine compared to other agents. Allow 2 weeks to reach steady state after each dose adjustment. Strong
Heterozygote or intermediate activity (one functional allele - *1, plus one nonfunctional allele - *2, *3A, *3B, *3C, or *4) *1/*2, *1/*3A, *1/*3B, *1/*3C, *1/*4 Moderate to high concentrations of TGN metabolites; low concentrations of methylTIMP Start with reduced doses (start at 30-70% of full dose: e.g., at 50 mg/m2/d or 0.75 mg/kg/d) and adjust doses of MP based on degree of myelosuppression and disease-specific guidelines. Allow 2-4 weeks to reach steady state after each dose adjustment. In those who require a dosage reduction based on myelosuppression, the median dose may be ~40% lower (44 mg/m2) than that tolerated in wild-type patients (75 mg/m2). In setting of myelosuppression, and depending on other therapy, emphasis should be on reducing mercaptopurine over other agents. Strong
Homozygous variant, mutant, low, or deficient activity (two nonfunctional alleles - *2, *3A, *3B, *3C, or *4) *3A/*3A, *2/*3A, *3C/*3A, *3C/*4, *3C/*2, *3A/*4 Extremely high concentrations of TGN metabolites; fatal toxicity possible without dose decrease; no methylTIMP metabolites For malignancy, start with drastically reduced doses (reduce daily dose by 10-fold and reduce frequency to thrice weekly instead of daily, e.g., 10 mg/m2/d given just 3 days/week) and adjust doses of MP based on degree of myelosuppression and disease-specific guidelines. Allow 4-6 weeks to reach steady state after each dose adjustment. In setting of myelosuppression, emphasis should be on reducing mercaptopurine over other agents. For nonmalignant conditions, consider alternative nonthiopurine immunosuppressant therapy. Strong

last updated 08/10/2011

Dutch Pharmacogenetics Working Group Guideline for mercaptopurine and TPMT

Summary

Select an alternative drug or reduce the initial dose for intermediate or poor metabolizers.

Annotation

The Royal Dutch Pharmacists Association - Pharmacogenetics Working Group has evaluated therapeutic dose recommendations for mercaptopurine based on TPMT genotype (PMID:21412232). They recommend selecting an alternative drug or reducing the initial dose for patients carrying inactive alleles.

Phenotype (Genotype) Therapeutic Dose Recommendation Level of Evidence Clinical Relevance
IM (one inactive allele: *2, *3, *4-*18) Select alternative drug or reduce dose by 50%. Increase dose in response of hematologic monitoring and efficacy. Published controlled studies of good quality* relating to phenotyped and/or genotyped patients or healthy volunteers, and having relevant pharmacokinetic or clinical endpoints. Clinical effect (S): Failure of lifesaving therapy e.g. anticipated myelosuppression; prevention of breast cancer relapse; arrhythmia; neutropenia < 0.5x109/l; leucopenia < 1.0x109/l; thrombocytopenia < 25x109/l; life-threatening complications from diarrhea.
PM (two inactive alleles: *2, *3, *4-*18) Select alternative drug or reduce dose by 90%. Increase dose in response of hematologic monitoring and efficacy. Published controlled studies of good quality* relating to phenotyped and/or genotyped patients or healthy volunteers, and having relevant pharmacokinetic or clinical endpoints. Clinical effect (S): death; arrhythmia; unanticipated myelosuppression.

PharmGKB gathers information regarding PGx on FDA drug labels from the FDA's "Table of Pharmacogenomic Biomarkers in Drug Labels", and from FDA-approved FDA and EMA-approved (European Medicines Agency) EMA labels brought to our attention. Excerpts from the label and downloadable highlighted label PDFs are manually curated by PharmGKB.

Please note that some drugs may have been removed from or added to the FDA's "Table of Pharmacogenomic Biomarkers in Drug Labels" without our knowledge. We periodically check the table for additions to this table and update PharmGKB accordingly.

There is currently no such list for European drug labels - we are working with the EMA to establish a list of European Public Assessment Reports (EPAR)s that contain PGx information. We are constructing this list by initially searching for drugs for which we have PGx-containing FDA drug labels - of these 44 EMA EPARs were identified and are being curated for pgx information.

We welcome any information regarding drug labels containing PGx information approved by the FDA, EMA or other Medicine Agencies around the world - please contact feedback.


last updated 10/25/2013

FDA Label for mercaptopurine

This label is on the FDA Biomarker List
Genetic testing recommended

Summary

TPMT genotyping or phenotyping can identify patients who are homozygous deficient, which predisposes them to mercaptopurine toxicity, or who have low/intermediate TPMT activity, which makes them more likely to experience mercaptopurine toxicity than people with normal TPMT activity.

Annotation

The pharmacogenomic relationship between mercaptopurine and TPMT is well described. See the TPMT VIP and Thiopurines Pathway for more details. Recent work by the Clinical Pharmacogenomics Implementation Consortium (CPIC) has published guidelines for dosing of mercaptopurine in individuals with TPMT variants.

Excerpt from the Mercaptopurine drug label:

Mercaptopurine is inactivated via two major pathways. One is thiol methylation, which is catalyzed by the polymorphic enzyme thiopurine S-methyltransferase (TPMT), to form the inactive metabolite methyl-6-MP. TPMT activity is highly variable in patients because of a genetic polymorphism in the TPMT gene. For Caucasians and African Americans, approximately 0.3% (1:300) of patients have two non-functional alleles (homozygous-deficient) of the TPMT gene and have little or no detectable enzyme activity. Approximately 10% of patients have one TPMT non-functional allele (heterozygous) leading to low or intermediate TPMT activity and 90% of individuals have normal TPMT activity with two functional alleles. Homozygous-deficient patients (two non-functional alleles), if given usual doses of mercaptopurine, accumulate excessive cellular concentrations of active thioguanine nucleotides predisposing them to PURINETHOL toxicity (see WARNINGS and PRECAUTIONS). Heterozygous patients with low or intermediate TPMT activity accumulate higher concentrations of active thioguanine nucleotides than people with normal TPMT activity and are more likely to experience mercaptopurine toxicity (see WARNINGS and PRECAUTIONS). TPMT genotyping or phenotyping (red blood cell TPMT activity) can identify patients who are homozygous deficient or have low or intermediate TPMT activity.

If a patient has clinical or laboratory evidence of severe bone marrow toxicity, particularly myelosuppression, TPMT testing should be considered.

For the complete drug label text with sections containing pharmacogenetic information highlighted, see the Mercaptopurine drug label.

*Disclaimer: The contents of this page have not been endorsed by the FDA and are the sole responsibility of PharmGKB.

Full label available at DailyMed

Genes and/or phenotypes found in this label

  • Drug Toxicity
    • Warnings section, Adverse reactions section, Precautions section
    • source: PHONT
  • Inflammatory Bowel Diseases
    • Warnings section
    • source: PHONT
  • Leukemia
    • Indications & usage section, Warnings section, Adverse reactions section, Precautions section
    • source: PHONT
  • Leukemia, Lymphoid
    • Indications & usage section, Adverse reactions section, Precautions section
    • source: PHONT
  • Leukemia, Myeloid, Acute
    • Indications & usage section, Adverse reactions section
    • source: PHONT
  • Myelosuppression
    • Warnings section, Adverse reactions section, Precautions section
    • source: PHONT
  • Neoplasms
    • Warnings section, Adverse reactions section
    • source: PHONT
  • Neutropenia
    • Warnings section
    • source: PHONT
  • Precursor Cell Lymphoblastic Leukemia-Lymphoma
    • Indications & usage section, Adverse reactions section
    • source: PHONT
  • TPMT
    • Dosage & administration section, Warnings section, Adverse reactions section, Clinical pharmacology section, Precautions section, dosage, efficacy, toxicity, metabolism/PK
    • source: FDA Label

Clinical Variants that meet the highest level of criteria, manually curated by PharmGKB, are shown below.

To see more Clinical Variants with lower levels of criteria, click the button at the bottom of the page.

Disclaimer: The PharmGKB's clinical annotations reflect expert consensus based on clinical evidence and peer-reviewed literature available at the time they are written and are intended only to assist clinicians in decision-making and to identify questions for further research. New evidence may have emerged since the time an annotation was submitted to the PharmGKB. The annotations are limited in scope and are not applicable to interventions or diseases that are not specifically identified.

The annotations do not account for individual variations among patients, and cannot be considered inclusive of all proper methods of care or exclusive of other treatments. It remains the responsibility of the health-care provider to determine the best course of treatment for a patient. Adherence to any guideline is voluntary, with the ultimate determination regarding its application to be made solely by the clinician and the patient. PharmGKB assumes no responsibility for any injury or damage to persons or property arising out of or related to any use of the PharmGKB clinical annotations, or for any errors or omissions.

? = Mouse-over for quick help

This is a non-comprehensive list of genetic tests with pharmacogenetics relevance, typically submitted by the manufacturer and manually curated by PharmGKB. The information listed is provided for educational purposes only and does not constitute an endorsement of any listed test or manufacturer.

A more complete listing of genetic tests is found at the Genetic Testing Registry (GTR).

PGx Test Variants Assayed Gene?
DMET Plus (Affymetrix, Inc) Variant in TPMT
Prometheus TPMT Genetics Not available
TPMT GenotypR rs1142345 , rs1800460 , rs1800462

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Links in the "Gene" column lead to PharmGKB Gene Pages.

Gene ? Variant?
(138)
Alternate Names / Tag SNPs ? Drugs ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
Translation
No VIP available CA VA TPMT *1 N/A N/A N/A
No VIP available No VIP available VA TPMT *2 N/A N/A N/A
No VIP available CA VA TPMT *3A N/A N/A N/A
No VIP available No VIP available VA TPMT *3B N/A N/A N/A
No VIP available CA VA TPMT *3C N/A N/A N/A
No VIP available No VIP available VA TPMT *8 N/A N/A N/A
No VIP available No VIP available VA TPMT *12 N/A N/A N/A
No VIP available CA VA
rs1051266 3952235T>C, 46957794T>C, 80A>G, 9592A>G, : 80A>G, His27Arg, RFC-1, SCL19A1:80G>A, SLC19A1:Arg27His, SLC19A1:G80A, mRNA 199A>G
T > C
Missense
His27Arg
No VIP available No Clinical Annotations available VA
rs11045879 103492T>C, 14142743T>C, 1865+4846T>C, 21382619T>C, OATP1B1: intronic C/T
T > C
Intronic
No VIP available No Clinical Annotations available VA
rs1127354 194C>A, 194C>G, 194C>T, 286C>A, 286C>G, 286C>T, 3133842C>A, 3133842C>G, 3133842C>T, 3193842C>A, 3193842C>G, 3193842C>T, 43C>A, 43C>G, 43C>T, 49-62C>A, 49-62C>G, 49-62C>T, 67-789C>A, 67-789C>G, 67-789C>T, 8787C>A, 8787C>G, 8787C>T, 94C>A, 94C>G, 94C>T, ITPA, ITPA: 94C>A, P32T, Pro15Ala, Pro15Ser, Pro15Thr, Pro32Ala, Pro32Ser, Pro32Thr
C > G
C > T
C > A
Not Available
Pro15Thr
rs1142345 18070918T>C, 18130918T>C, 29457A>G, 719A>G, TPMT*3C, Tyr240Cys
T > C
Missense
Tyr240Cys
No VIP available No Clinical Annotations available VA
rs1695 12658484A>G, 313A>G, 6624A>G, 67352689A>G, GSTP1*2, GSTP1*B, GSTP1: I105V, GSTP1:A313G, GSTP1:I105V, GSTP1:Ile105Val, Ile105Val, Part of haplotypes GSTP1*B and GSTP1*C, rs1695:A>G
A > G
Missense
Ile105Val
rs1800460 18079228C>T, 18139228C>T, 21147G>A, 460G>A, Ala154Thr, TPMT*3B
C > T
Missense
Ala154Thr
rs1800462 16420G>C, 18083955C>G, 18143955C>G, 238G>C, Ala80Pro, TPMT*2, TPMT:238G>C
C > G
Missense
Ala80Pro
rs1800584 18071012C>T, 18131012C>T, 29363G>A, 626-1G>A, TPMT*4
C > T
Acceptor
No VIP available No Clinical Annotations available VA
rs1801131 11854476T>G, 1286A>C, 16685A>C, 7859208T>G, A1298C, Glu429Ala, MTHFR:1298A>C
T > G
Missense
Glu429Ala
No VIP available CA VA
rs1801133 11856378G>A, 14783C>T, 665C>T, 677C>T, 7861110G>A, A222V, Ala222Val, C677T, MTHFR: c.677C>T, MTHFR:667C>T, p.A222V
G > A
Missense
Ala222Val
No VIP available No Clinical Annotations available VA
rs1805087 237048500A>G, 2756A>G, 30566279A>G, 94920A>G, Asp919Gly, MS 2756A>G, MS D919G, MTR:2756A>G, MTR:Asp919Gly
A > G
Missense
Asp919Gly
No VIP available No Clinical Annotations available VA
rs1979277 1303C>T, 1420C>T, 17835470G>A, 18232096G>A, 39761C>T, Leu435Phe, Leu474Phe, SHMT1 L435F
G > A
Missense
Leu435Phe
No VIP available No Clinical Annotations available VA
rs2274407 8948711C>A, 8948711C>G, 8948711C>T, 912G>A, 912G>C, 912G>T, 95859035C>A, 95859035C>G, 95859035C>T, Lys304=, Lys304Asn
C > G
C > T
C > A
Missense
Lys304Lys
Lys304Asn
No VIP available No Clinical Annotations available VA
rs2413739 -78+13991G>A, 22787605C>T, 43397036C>T
C > T
Intronic
No VIP available No Clinical Annotations available VA
rs34743033 28-bp tandem repeats, CCGCGCCACTTGGCCTGCCTCCGTCCCG, TSER*2, TSER*3, TYMS: 28 bp tandem repeat, TYMS: 2R, TYMS: TSER *2/*3, TYMS:TSER 28-basepair 5'UTR enhancer region repeat
CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC > 4
CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC > 3
CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC > (CCGCGCCACTTCGCCTGCCTCCGTCCCG)2
Not Available
No VIP available No Clinical Annotations available VA
rs3765534 2269G>A, 8905091C>T, 95815415C>T, ABCC4:E857K, ABCC4:G2269A, Glu757Lys
C > T
Missense
Glu757Lys
No VIP available No Clinical Annotations available VA
rs61886492 1378C>T, 1423C>T, 48949C>T, 49126274G>A, 49186274G>A, 499C>T, His167Tyr, His460Tyr, His475Tyr
G > A
Missense
His167Tyr
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 138
2D structure from PubChem
provided by PubChem

Overview

Generic Names
  • 6 MP
  • 6-Mercaptopurine
  • MP
  • Mercaptopurine Monohydrate
  • Mercapurin
Trade Names
  • Ismipur
  • Leukerin
  • Leupurin
  • Mercaleukim
  • Mercaleukin
  • Mern
  • Puri-Nethol
  • Purimethol
  • Purinethol
Brand Mixture Names

PharmGKB Accession Id:
PA450379

Description

An antimetabolite antineoplastic agent with immunosuppressant properties. It interferes with nucleic acid synthesis by inhibiting purine metabolism and is used, usually in combination with other drugs, in the treatment of or in remission maintenance programs for leukemia.

Source: Drug Bank

Indication

For remission induction and maintenance therapy of acute lymphatic leukemia.

Source: Drug Bank

Other Vocabularies

Information pulled from DrugBank has not been reviewed by PharmGKB.

Pharmacology, Interactions, and Contraindications

Mechanism of Action

Mercaptopurine competes with hypoxanthine and guanine for the enzyme hypoxanthine-guanine phosphoribosyltransferase (HGPRTase) and is itself converted to thioinosinic acid (TIMP). This intracellular nucleotide inhibits several reactions involving inosinic acid (IMP), including the conversion of IMP to xanthylic acid (XMP) and the conversion of IMP to adenylic acid (AMP) via adenylosuccinate (SAMP). In addition, 6-methylthioinosinate (MTIMP) is formed by the methylation of TIMP. Both TIMP and MTIMP have been reported to inhibit glutamine-5-phosphoribosylpyrophosphate amidotransferase, the first enzyme unique to the de novo pathway for purine ribonucleotide synthesis. Experiments indicate that radiolabeled mercaptopurine may be recovered from the DNA in the form of deoxythioguanosine. Some mercaptopurine is converted to nucleotide derivatives of 6-thioguanine (6-TG) by the sequential actions of inosinate (IMP) dehydrogenase and xanthylate (XMP) aminase, converting TIMP to thioguanylic acid (TGMP).

Source: Drug Bank

Pharmacology

Mercaptopurine is one of a large series of purine analogues which interfere with nucleic acid biosynthesis and has been found active against human leukemias. It is an analogue of the purine bases adenine and hypoxanthine. It is not known exactly which of any one or more of the biochemical effects of mercaptopurine and its metabolites are directly or predominantly responsible for cell death.

Source: Drug Bank

Food Interaction

Preferably on an empty stomach, drink plenty of liquids, avoid alcohol.

Source: Drug Bank

Absorption, Distribution, Metabolism, Elimination & Toxicity

Biotransformation

Hepatic. Degradation primarily by xanthine oxidase. The catabolism of mercaptopurine and its metabolites is complex. In humans, after oral administration of ^35^S-6-mercaptopurine, urine contains intact mercaptopurine, thiouric acid (formed by direct oxidation by xanthine oxidase, probably via 6-mercapto-8-hydroxypurine), and a number of 6-methylated thiopurines. The methylthiopurines yield appreciable amounts of inorganic sulfate.

Source: Drug Bank

Protein Binding

Plasma protein binding averages 19% over the concentration range 10 to 50 microg/mL (a concentration only achieved by intravenous administration of mercaptopurine at doses exceeding 5 to 10 mg/kg).

Source: Drug Bank

Absorption

Clinical studies have shown that the absorption of an oral dose of mercaptopurine in humans is incomplete and variable, averaging approximately 50% of the administered dose. The factors influencing absorption are unknown.

Source: Drug Bank

Half-Life

Triphasic: 45 minutes, 2.5 hours, and 10 hours.

Source: Drug Bank

Toxicity

Signs and symptoms of overdosage may be immediate such as anorexia, nausea, vomiting, and diarrhea; or delayed such as myelosuppression, liver dysfunction, and gastroenteritis. The oral LD 50 of mercaptopurine was determined to be 480 mg/kg in the mouse and 425 mg/kg in the rat.

Source: Drug Bank

Chemical Properties

Chemical Formula

C5H4N4S

Source: Drug Bank

Isomeric SMILES

S=C1N=CNC2=C1NC=N2

Source: Drug Bank

Canonical SMILES

S=C1N=CNC2=C1NC=N2

Source: Drug Bank

Average Molecular Weight

152.177

Source: Drug Bank

Monoisotopic Molecular Weight

152.015666838

Source: Drug Bank

PharmGKB Curated Pathways

Pathways created internally by PharmGKB based primarily on literature evidence.

External Pathways

Links to non-PharmGKB pathways.

PharmGKB contains no links to external pathways for this drug. To report a pathway, click here.

Genes that are associated with this drug in PharmGKB's database based on (1) variant annotations, (2) literature review, (3) pathways or (4) information automatically retrieved from DrugBank, depending on the "evidence" and "source" listed below.

Curated Information ?

Drug Targets

Gene Description
ADSL (source: Drug Bank)
AMPD1 (source: Drug Bank)
AMPD2 (source: Drug Bank)
AMPD3 (source: Drug Bank)
GMPR (source: Drug Bank)
GMPR2 (source: Drug Bank)
GMPS (source: Drug Bank)
HPRT1 (source: Drug Bank)
IMPDH1 (source: Drug Bank)
IMPDH2 (source: Drug Bank)
PPAT (source: Drug Bank)

Drug Interactions

Drug Description
mercaptopurine Allopurinol increases the effect of thiopurine (source: Drug Bank)
mercaptopurine Allopurinol increases the effect of thiopurine (source: Drug Bank)
mercaptopurine The 5-ASA derivative increases the toxicity of thiopurine (source: Drug Bank)
mercaptopurine The 5-ASA derivative increases the toxicity of thiopurine (source: Drug Bank)
acenocoumarol Mercaptopurine may decrease the anticoagulant effect of acenocoumarol. (source: Drug Bank)
allopurinol Allopurinol increases the effect of thiopurine (source: Drug Bank)
anisindione Mercaptopurine may decrease the anticoagulant effect of anisindione. (source: Drug Bank)
atracurium The agent dereases the effect of the muscle relaxant (source: Drug Bank)
dicumarol Mercaptopurine may decrease the anticoagulant effect of dicumarol. (source: Drug Bank)
doxacurium The agent dereases the effect of the muscle relaxant (source: Drug Bank)
gallamine triethiodide The agent dereases the effect of the muscle relaxant (source: Drug Bank)
mesalazine The 5-ASA derivative increases the toxicity of thiopurine (source: Drug Bank)
metocurine The agent dereases the effect of the muscle relaxant (source: Drug Bank)
mivacurium The agent dereases the effect of the muscle relaxant (source: Drug Bank)
olsalazine The 5-ASA derivative increases the toxicity of thiopurine (source: Drug Bank)
pancuronium The agent dereases the effect of the muscle relaxant (source: Drug Bank)
sulfasalazine The 5-ASA derivative increases the toxicity of thiopurine (source: Drug Bank)
tubocurarine The agent dereases the effect of the muscle relaxant (source: Drug Bank)
vecuronium The agent dereases the effect of the muscle relaxant (source: Drug Bank)
warfarin Mercaptopurine may decrease the anticoagulant effect of warfarin. (source: Drug Bank)
mercaptopurine The 5-ASA derivative increases the toxicity of thiopurine (source: Drug Bank)
mercaptopurine The 5-ASA derivative increases the toxicity of thiopurine (source: Drug Bank)
mercaptopurine Complete cross resistance may occur. (source: Drug Bank)
mercaptopurine Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank)

Curated Information ?

Publications related to mercaptopurine: 134

No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Host thiopurine methyltransferase status affects mercaptopurine antileukemic effectiveness in a murine model. Pharmacogenetics and genomics. 2014. Ramsey Laura B, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine methyltransferase genotype-phenotype discordance and thiopurine active metabolite formation in childhood acute lymphoblastic leukaemia. British journal of clinical pharmacology. 2013. Lennard Lynne, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Nomenclature for alleles of the thiopurine methyltransferase gene. Pharmacogenetics and genomics. 2013. Appell Malin L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics and pharmacogenomics: a bridge to individualized cancer therapy. Pharmacogenomics. 2013. Weng Liming, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinical Pharmacogenetics Implementation Consortium Guidelines for Thiopurine Methyltransferase Genotype and Thiopurine Dosing: 2013 Update. Clinical pharmacology and therapeutics. 2013. Relling M V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A Clinician-Driven Automated System for Integration of Pharmacogenetic Interpretations Into an Electronic Medical Record. Clinical pharmacology and therapeutics. 2012. Hicks J K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic determinants of mercaptopurine disposition in children with acute lymphoblastic leukemia. European journal of clinical pharmacology. 2012. Adam de Beaumais Tiphaine, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
PACSIN2 polymorphism influences TPMT activity and mercaptopurine-related gastrointestinal toxicity. Human molecular genetics. 2012. Stocco Gabriele, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variants of thiopurine and folate metabolic pathways determine 6-MP-mediated hematological toxicity in childhood ALL. Pharmacogenomics. 2012. Dorababu Patchva, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Nonadherence to Oral Mercaptopurine and Risk of Relapse in Hispanic and Non-Hispanic White Children With Acute Lymphoblastic Leukemia: A Report From the Children's Oncology Group. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2012. Bhatia Smita, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CDA deficiency as a possible culprit for life-threatening toxicities after cytarabine plus 6-mercaptopurine therapy: pharmacogenetic investigations. Pharmacogenomics. 2012. Ciccolini Joseph, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
6-mercaptopurine influences TPMT gene transcription in a TPMT gene promoter variable number of tandem repeats-dependent manner. Pharmacogenomics. 2012. Kotur Nikola, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacogenetic analysis of pediatric patients with acute lymphoblastic leukemia: a possible association between survival rate and ITPA polymorphism. PloS one. 2012. Kim Hyery, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase polymorphism in Iranian kidney transplant recipients. Experimental and clinical transplantation : official journal of the Middle East Society for Organ Transplantation. 2011. Aghdaie Mahdokht Hossein, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cancer Pharmacogenomics. Clinical pharmacology and therapeutics. 2011. Paugh S W, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Prospective-retrospective biomarker analysis for regulatory consideration: white paper from the industry pharmacogenomics working group. Pharmacogenomics. 2011. Patterson Scott D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics and individualized therapy in children: immunosuppressants, antidepressants, anticancer and anti-inflammatory drugs. Pharmacogenomics. 2011. Elie Valery, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pediatric pharmacogenetic and pharmacogenomic studies: the current state and future perspectives. European journal of clinical pharmacology. 2011. Russo Roberta, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinical pharmacogenetics implementation consortium guidelines for thiopurine methyltransferase genotype and thiopurine dosing. Clinical pharmacology and therapeutics. 2011. Relling M V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics: From Bench to Byte- An Update of Guidelines. Clinical pharmacology and therapeutics. 2011. Swen J J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Practical recommendations for pharmacogenomics-based prescription: 2010 ESF-UB Conference on Pharmacogenetics and Pharmacogenomics. Pharmacogenomics. 2011. Becquemont Laurent, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomic contribution to drug response. Cancer journal (Sudbury, Mass.). 2011. Watson Roshawn G, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Promoter Polymorphisms in the beta-2 Adrenergic Receptor Are Associated With Drug-Induced Gene Expression Changes and Response in Acute Lymphoblastic Leukemia. Clinical pharmacology and therapeutics. 2010. Pottier N, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Ecto-5'-nucleotidase and thiopurine cellular circulation: association with cytotoxicity. Drug metabolism and disposition: the biological fate of chemicals. 2010. Li Fang, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Identifying genomic and developmental causes of adverse drug reactions in children. Pharmacogenomics. 2010. Becker Mara L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Systematic review of pharmacoeconomic studies of pharmacogenomic tests. Pharmacogenomics. 2010. Beaulieu Mathieu, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Multivariate models to detect genomic signatures for a class of drugs: application to thiopurines pharmacogenomics. The pharmacogenomics journal. 2010. Fridley B L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The multidrug-resistance protein 4 polymorphism is a new factor accounting for thiopurine sensitivity in Japanese patients with inflammatory bowel disease. Journal of gastroenterology. 2010. Ban Hiromistu, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine pathway. Pharmacogenetics and genomics. 2010. Zaza Gianluigi, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The association of reduced folate carrier 80G>A polymorphism to outcome in childhood acute lymphoblastic leukemia interacts with chromosome 21 copy number. Blood. 2010. Gregers Jannie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Very important pharmacogene summary: thiopurine S-methyltransferase. Pharmacogenetics and genomics. 2010. Wang Liewei, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Drug transporter pharmacogenetics in nucleoside-based therapies. Pharmacogenomics. 2010. Errasti-Murugarren Ekaitz, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Human lymphoblastoid cell line panels: novel tools for assessing shared drug pathways. Pharmacogenomics. 2010. Morag Ayelet, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics in the treatment of inflammatory bowel disease. Pharmacogenomics. 2010. Smith Melissa A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Thiopurine S-methyltransferase genotype and the use of thiopurines in paediatric inflammatory bowel disease Greek patients. Journal of clinical pharmacy and therapeutics. 2010. Gazouli M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Long-term results of NOPHO ALL-92 and ALL-2000 studies of childhood acute lymphoblastic leukemia. Leukemia. 2010. Schmiegelow K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Are patients with intermediate TPMT activity at increased risk of myelosuppression when taking thiopurine medications?. Pharmacogenomics. 2010. Higgs Jenny E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Polymorphisms in multidrug resistance-associated protein gene 4 is associated with outcome in childhood acute lymphoblastic leukemia. Blood. 2009. Ansari Marc, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinically available pharmacogenomics tests. Clinical pharmacology and therapeutics. 2009. Flockhart D A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ADME pharmacogenetics: current practices and future outlook. Expert opinion on drug metabolism & toxicology. 2009. Grossman Iris. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Application of SNaPshot for analysis of thiopurine methyltransferase gene polymorphism. The Indian journal of medical research. 2009. Kapoor Gauri, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genetic polymorphism of inosine triphosphate pyrophosphatase is a determinant of mercaptopurine metabolism and toxicity during treatment for acute lymphoblastic leukemia. Clinical pharmacology and therapeutics. 2009. Stocco G, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics and pharmacogenomics of anticancer agents. CA: a cancer journal for clinicians. 2009. Huang R Stephanie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genome-wide copy number profiling reveals molecular evolution from diagnosis to relapse in childhood acute lymphoblastic leukemia. Blood. 2008. Yang Jun J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Transporter-mediated protection against thiopurine-induced hematopoietic toxicity. Cancer research. 2008. Krishnamurthy Partha, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Creating and evaluating genetic tests predictive of drug response. Nature reviews. Drug discovery. 2008. Weiss Scott T, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Structural basis of substrate recognition in thiopurine s-methyltransferase. Biochemistry. 2008. Peng Yi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
6-mercaptopurine and 9-(2-phosphonyl-methoxyethyl) adenine (PMEA) transport altered by two missense mutations in the drug transporter gene ABCC4. Human mutation. 2008. Janke Daniel, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Influence of MTHFR and RFC1 polymorphisms on toxicities during maintenance chemotherapy for childhood acute lymphoblastic leukemia or lymphoma. Journal of pediatric hematology/oncology : official journal of the American Society of Pediatric Hematology/Oncology. 2008. Shimasaki Noriko, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Up-regulation of MRP4 and down-regulation of influx transporters in human leukemic cells with acquired resistance to 6-mercaptopurine. Leukemia research. 2008. Peng Xing-Xiang, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Trinucleotide repeat variants in the promoter of the thiopurine S-methyltransferase gene of patients exhibiting ultra-high enzyme activity. Pharmacogenetics and genomics. 2008. Roberts Rebecca L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Functional characterization of human xanthine oxidase allelic variants. Pharmacogenetics and genomics. 2008. Kudo Mutsumi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Azathioprine-associated acute myeloid leukemia in a patient with Crohn's disease and thiopurine S-methyltransferase deficiency. American journal of hematology. 2008. Yenson Paul R, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics of drug-metabolizing enzymes and drug transporters in chemotherapy. Methods in molecular biology (Clifton, N.J.). 2008. Bosch Tessa M. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic significance of inosine triphosphatase. Pharmacogenomics. 2007. Bierau Jörgen, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic polymorphisms of folate metabolic enzymes and toxicities of high dose methotrexate in children with acute lymphoblastic leukemia. Annals of hematology. 2007. Pakakasama Samart, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Ancestry and pharmacogenetics of antileukemic drug toxicity. Blood. 2007. Kishi Shinji, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Differential effects of targeted disruption of thiopurine methyltransferase on mercaptopurine and thioguanine pharmacodynamics. Cancer research. 2007. Hartford Christine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Using HapMap tools in pharmacogenomic discovery: the thiopurine methyltransferase polymorphism. Clinical pharmacology and therapeutics. 2007. Jones T S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Adding pharmacogenetics information to drug labels: lessons learned. Pharmacogenetics and genomics. 2006. Haga Susanne B, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Analysis of thiopurine S-methyltransferase polymorphism in the population of Serbia and Montenegro and mercaptopurine therapy tolerance in childhood acute lymphoblastic leukemia. Therapeutic drug monitoring. 2006. Dokmanovic Lidija, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The thiopurine methyltransferase genetic polymorphism is associated with thioguanine-related veno-occlusive disease of the liver in children with acute lymphoblastic leukemia. Clinical pharmacology and therapeutics. 2006. Lennard Lynne, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Three novel thiopurine S-methyltransferase allelic variants (TPMT*20, *21, *22) - association with decreased enzyme function. Human mutation. 2006. Schaeffeler Elke, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Divergent activities of human glutathione transferases in the bioactivation of azathioprine. Molecular pharmacology. 2006. Eklund Birgitta I, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Involvement of the concentrative nucleoside transporter 3 and equilibrative nucleoside transporter 2 in the resistance of T-lymphoblastic cell lines to thiopurines. Biochemical and biophysical research communications. 2006. Fotoohi Alan Kambiz, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase pharmacogenetics: insights, challenges and future directions. Oncogene. 2006. Wang L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Predictors of immunomodulator use as early therapy in pediatric Crohn's disease. Journal of clinical gastroenterology. 2006. Jacobstein Douglas A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine methyltransferase in acute lymphoblastic leukemia. Blood. 2006. Relling Mary V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Azathioprine suppresses ezrin-radixin-moesin-dependent T cell-APC conjugation through inhibition of Vav guanosine exchange activity on Rac proteins. Journal of immunology (Baltimore, Md. : 1950). 2006. Poppe Daniela, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics and individualized drug therapy. Annual review of medicine. 2006. Eichelbaum Michel, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics: catechol O-methyltransferase to thiopurine S-methyltransferase. Cellular and molecular neurobiology. 2006. Weinshilboum Richard M. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
TPMT genotype and the use of thiopurines in paediatric inflammatory bowel disease. Digestive and liver disease : official journal of the Italian Society of Gastroenterology and the Italian Association for the Study of the Liver. 2005. Stocco G, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase pharmacogenetics: variant allele functional and comparative genomics. Pharmacogenetics and genomics. 2005. Salavaggione Oreste E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gene expression and thioguanine nucleotide disposition in acute lymphoblastic leukemia after in vivo mercaptopurine treatment. Blood. 2005. Zaza Gianluigi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Karyotypic abnormalities create discordance of germline genotype and cancer cell phenotypes. Nature genetics. 2005. Cheng Qing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacogenetics of outcome in children with acute lymphoblastic leukemia. Blood. 2005. Rocha Jose Claudio C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Monitoring of long-term thiopurine therapy among adults with inflammatory bowel disease. Scandinavian journal of gastroenterology. 2004. Hindorf U, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Allele frequency of inosine triphosphate pyrophosphatase gene polymorphisms in a Japanese population. Nucleosides, nucleotides & nucleic acids. 2004. Marinaki A M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Methylated metabolites of 6-mercaptopurine are associated with hepatotoxicity. Clinical pharmacology and therapeutics. 2004. Nygaard Ulrikka, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Phenotype and genotype for thiopurine methyltransferase activity in the French Caucasian population: impact of age. European journal of clinical pharmacology. 2004. Ganiere-Monteil Catherine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Analysis of variation in mouse TPMT genotype, expression and activity. Pharmacogenetics. 2004. Watters James W, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetics of thiopurine S-methyltransferase and thiopurine therapy. Therapeutic drug monitoring. 2004. Evans William E. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pyrosequencing of TPMT alleles in a general Swedish population and in patients with inflammatory bowel disease. Clinical chemistry. 2004. Haglund Sofie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Drug methylation in cancer therapy: lessons from the TPMT polymorphism. Oncogene. 2003. Krynetski Eugene, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine S-methyltransferase pharmacogenetics: chaperone protein association and allozyme degradation. Pharmacogenetics. 2003. Wang Liewei, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Thiopurine methyltransferase phenotypes and genotypes in Brazilians. Pharmacogenetics. 2003. Reis Marcelo, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Treatment-specific changes in gene expression discriminate in vivo drug response in human leukemia cells. Nature genetics. 2003. Cheok Meyling H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
CD28-dependent Rac1 activation is the molecular target of azathioprine in primary human CD4+ T lymphocytes. The Journal of clinical investigation. 2003. Tiede Imke, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine metabolism and identification of the thiopurine metabolites transported by MRP4 and MRP5 overexpressed in human embryonic kidney cells. Molecular pharmacology. 2002. Wielinga P R, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine methyltransferase activity and the use of azathioprine in inflammatory bowel disease. Alimentary pharmacology & therapeutics. 2002. Ansari A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Differing contribution of thiopurine methyltransferase to mercaptopurine versus thioguanine effects in human leukemic cells. Cancer research. 2001. Dervieux T, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Influence of the variable number of tandem repeats located in the promoter region of the thiopurine methyltransferase gene on enzymatic activity. Clinical pharmacology and therapeutics. 2001. Alves S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Rational dosing of azathioprine and 6-mercaptopurine. Gut. 2001. Sandborn W J. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine pharmacogenetics: clinical and molecular studies of thiopurine methyltransferase. Drug metabolism and disposition: the biological fate of chemicals. 2001. Weinshilboum R. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genotype-phenotype correlation for thiopurine S-methyltransferase in healthy Italian subjects. European journal of clinical pharmacology. 2001. Rossi A M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Preponderance of thiopurine S-methyltransferase deficiency and heterozygosity among patients intolerant to mercaptopurine or azathioprine. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2001. Evans W E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Therapeutic drug monitoring of cytotoxic drugs. British journal of clinical pharmacology. 2001. Lennard L. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A multicenter trial of 6-mercaptopurine and prednisone in children with newly diagnosed Crohn's disease. Gastroenterology. 2000. Markowitz J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Multidrug-resistance protein 5 is a multispecific organic anion transporter able to transport nucleotide analogs. Proceedings of the National Academy of Sciences of the United States of America. 2000. Wijnholds J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic polymorphism of thiopurine methyltransferase and its clinical relevance for childhood acute lymphoblastic leukemia. Leukemia : official journal of the Leukemia Society of America, Leukemia Research Fund, U.K. 2000. McLeod H L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Severe 6-thioguanine-induced marrow aplasia in a child with acute lymphoblastic leukemia and inherited thiopurine methyltransferase deficiency. Journal of pediatric hematology/oncology. 2000. McBride K L, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Enhanced proteasomal degradation of mutant human thiopurine S-methyltransferase (TPMT) in mammalian cells: mechanism for TPMT protein deficiency inherited by TPMT*2, TPMT*3A, TPMT*3B or TPMT*3C. Pharmacogenetics. 1999. Tai H L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Possible carcinogenic effect of 6-mercaptopurine on bone marrow stem cells: relation to thiopurine metabolism. Cancer. 1999. Bo J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
High incidence of secondary brain tumours after radiotherapy and antimetabolites. Lancet. 1999. Relling M V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Prognostic importance of 6-mercaptopurine dose intensity in acute lymphoblastic leukemia. Blood. 1999. Relling M V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Thiopurine methyltransferase pharmacogenetics: alternative molecular diagnosis and preliminary data from Northern Portugal. Pharmacogenetics. 1999. Alves S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Therapeutic drug monitoring of antimetabolic cytotoxic drugs. British journal of clinical pharmacology. 1999. Lennard L. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Polymorphism of the thiopurine S-methyltransferase gene in African-Americans. Human molecular genetics. 1999. Hon Y Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The frequency and distribution of thiopurine methyltransferase alleles in Caucasian and Asian populations. Pharmacogenetics. 1999. Collie-Duguid E S, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genotypic and phenotypic analysis of the polymorphic thiopurine S-methyltransferase gene (TPMT) in a European population. British journal of pharmacology. 1998. Spire-Vayron de la Moureyre C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinical implications of thiopurine methyltransferase--optimization of drug dosage and potential drug interactions. Therapeutic drug monitoring. 1998. Lennard L. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Etoposide and antimetabolite pharmacology in patients who develop secondary acute myeloid leukemia. Leukemia : official journal of the Leukemia Society of America, Leukemia Research Fund, U.K. 1998. Relling M V, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Human thiopurine methyltransferase pharmacogenetics. Kindred with a terminal exon splice junction mutation that results in loss of activity. The Journal of clinical investigation. 1998. Otterness D M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Human thiopurine methyltransferase pharmacogenetics: gene sequence polymorphisms. Clinical pharmacology and therapeutics. 1997. Otterness D, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Enhanced proteolysis of thiopurine S-methyltransferase (TPMT) encoded by mutant alleles in humans (TPMT*3A, TPMT*2): mechanisms for the genetic polymorphism of TPMT activity. Proceedings of the National Academy of Sciences of the United States of America. 1997. Tai H L, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Molecular diagnosis of thiopurine S-methyltransferase deficiency: genetic basis for azathioprine and mercaptopurine intolerance. Annals of internal medicine. 1997. Yates C R, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Individualizing therapy with 6-mercaptopurine and 6-thioguanine related to the thiopurine methyltransferase genetic polymorphism. Therapeutic drug monitoring. 1996. Lennard L, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine S-methyltransferase deficiency: two nucleotide transitions define the most prevalent mutant allele associated with loss of catalytic activity in Caucasians. American journal of human genetics. 1996. Tai H L, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Thiopurine methyltransferase pharmacogenetics: human gene cloning and characterization of a common polymorphism. DNA and cell biology. 1996. Szumlanski C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Methylation of mercaptopurine, thioguanine, and their nucleotide metabolites by heterologously expressed human thiopurine S-methyltransferase. Molecular pharmacology. 1995. Krynetski E Y, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A single point mutation leading to loss of catalytic activity in human thiopurine S-methyltransferase. Proceedings of the National Academy of Sciences of the United States of America. 1995. Krynetski E Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Purine substrates for human thiopurine methyltransferase. Biochemical pharmacology. 1994. Deininger M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Decrease in S-adenosylmethionine synthesis by 6-mercaptopurine and methylmercaptopurine ribonucleoside in Molt F4 human malignant lymphoblasts. The Biochemical journal. 1994. Stet E H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Reversal of 6-mercaptopurine and 6-methylmercaptopurine ribonucleoside cytotoxicity by amidoimidazole carboxamide ribonucleoside in Molt F4 human malignant T-lymphoblasts. Biochemical pharmacology. 1993. Stet E H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
6-Mercaptopurine: cytotoxicity and biochemical pharmacology in human malignant T-lymphoblasts. Biochemical pharmacology. 1993. Bökkerink J P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Human liver thiopurine methyltransferase pharmacogenetics: biochemical properties, liver-erythrocyte correlation and presence of isozymes. Pharmacogenetics. 1992. Szumlanski C L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
The clinical pharmacology of 6-mercaptopurine. European journal of clinical pharmacology. 1992. Lennard L. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Altered mercaptopurine metabolism, toxic effects, and dosage requirement in a thiopurine methyltransferase-deficient child with acute lymphocytic leukemia. The Journal of pediatrics. 1991. Evans W E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic variation in response to 6-mercaptopurine for childhood acute lymphoblastic leukaemia. Lancet. 1990. Lennard L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of AMP on the activation of glycogen synthase and phosphorylase by adenosine, fructose, and glutamine in rat hepatocytes. The Journal of biological chemistry. 1990. Carabaza A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine methyltransferase isozymes in human renal tissue. Drug metabolism and disposition: the biological fate of chemicals. 1990. Van Loon J A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Thiopurine pharmacogenetics in leukemia: correlation of erythrocyte thiopurine methyltransferase activity and 6-thioguanine nucleotide concentrations. Clinical pharmacology and therapeutics. 1987. Lennard L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The effects of 6-mercaptopurine nucleotide derivatives on the growth and survival of 6-mercaptopurine-sensitive and -resistant cell culture lines. British journal of cancer. 1985. Johnston H P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Mercaptopurine pharmacogenetics: monogenic inheritance of erythrocyte thiopurine methyltransferase activity. American journal of human genetics. 1980. Weinshilboum R M, et al. PubMed

LinkOuts

Web Resource:
Wikipedia
National Drug Code Directory:
0378-3547-52
DrugBank:
DB01033
ChEBI:
2208
KEGG Compound:
C02380
KEGG Drug:
D04931
PubChem Compound:
667490
PubChem Substance:
46506988
5422
Drugs Product Database (DPD):
4723
BindingDB:
50200098
ChemSpider:
580869
Therapeutic Targets Database:
DAP000147
FDA Drug Label at DailyMed:
15904472-4c32-4224-95d3-eb131a7ff9c8

Clinical Trials

These are trials that mention mercaptopurine and are related to either pharmacogenetics or pharmacogenomics.

Common Searches

Search PubMed
Search Medline Plus
Search PubChem
Search CTD

Sources for PharmGKB drug information: DrugBank, Open Eye Scientific Software.