Drug/Small Molecule:
cisplatin

PharmGKB contains no dosing guidelines for this drug/small molecule. To report known genotype-based dosing guidelines, or if you are interested in developing guidelines, click here.

PharmGKB gathers information regarding PGx on FDA drug labels from the FDA's "Table of Pharmacogenomic Biomarkers in Drug Labels", and from FDA-approved FDA and EMA-approved (European Medicines Agency) EMA labels brought to our attention. Excerpts from the label and downloadable highlighted label PDFs are manually curated by PharmGKB.

Please note that some drugs may have been removed from or added to the FDA's "Table of Pharmacogenomic Biomarkers in Drug Labels" without our knowledge. We periodically check the table for additions to this table and update PharmGKB accordingly.

There is currently no such list for European drug labels - we are working with the EMA to establish a list of European Public Assessment Reports (EPAR)s that contain PGx information. We are constructing this list by initially searching for drugs for which we have PGx-containing FDA drug labels - of these 44 EMA EPARs were identified and are being curated for pgx information.

We welcome any information regarding drug labels containing PGx information approved by the FDA, EMA or other Medicine Agencies around the world - please contact feedback.


last updated 10/25/2013

FDA Label for cisplatin and TPMT

This label is on the FDA Biomarker List
Actionable PGx

Summary

The FDA-approved drug label for cisplatin (PLATINOL) highlights warnings and precautions when treating children with certain TPMT gene variants (e.g., TPMT *3B and TPMT *3C) due to an increased risk of ototoxicity. The drug label states that all children undergoing cisplatin (PLATINOL) treatment have a risk of ototoxicity, and all children should undergo audiometric testing.

Annotation

We are aware of data that questions the relationship between TPMT and cisplatin currently described on the drug label. This is under discussion with the FDA. Please contact us if you have any data that may aid in the resolution of this issue.

Cisplatin (PLATINOL) is a chemotherapy drug. The FDA-approved drug label highlights warnings and precautions when treating children who have certain TPMT gene variants due to an increased risk of ototoxicity, and refers to a study in children that found an association between TPMT gene variants and ototoxicity: [Article:19898482].

Excerpt from the cisplatin (PLATINOL) drug label:

Certain genetic variants in the thiopurine S-methyltransferase gene (e.g., TPMT*3B and TPMT*3C) are associated with an increased risk of ototoxicity in children administered conventional doses of cisplatin...Children who do not have one of these TPMT gene variants remain at risk for ototoxicity. All pediatric patients receiving cisplatin should have audiometric testing at baseline, prior to each subsequent dose, of drug and for several years post therapy.

For the complete drug label text with sections containing pharmacogenetic information highlighted, see the cisplatin drug label.

*Disclaimer: The contents of this page have not been endorsed by the FDA and are the sole responsibility of PharmGKB.

Full label available at DailyMed

Genes and/or phenotypes found in this label

  • Anemia
    • Adverse reactions section
    • source: PHONT
  • Carcinoma, Non-Small-Cell Lung
    • Indications & usage section, Precautions section
    • source: PHONT
  • Carcinoma, Small Cell
    • Indications & usage section, Precautions section
    • source: PHONT
  • Neoplasms
    • Indications & usage section, Warnings section, Adverse reactions section, Precautions section
    • source: PHONT
  • Neutropenia
    • Adverse reactions section, Precautions section
    • source: PHONT
  • Ototoxicity
    • Boxed warning section, Warnings section, Adverse reactions section, Clinical pharmacology section, Precautions section
    • source: FDA Label
  • Ovarian Neoplasms
    • Precautions section
    • source: PHONT
  • Peripheral Nervous System Diseases
    • Warnings section, Adverse reactions section, Precautions section
    • source: PHONT
  • Thrombocytopenia
    • Adverse reactions section, Precautions section
    • source: PHONT
  • TPMT
    • Warnings section, Adverse reactions section, Clinical pharmacology section, Precautions section, toxicity
    • source: FDA Label

Clinical Variants that meet the highest level of criteria, manually curated by PharmGKB, are shown below.

To see more Clinical Variants with lower levels of criteria, click the button at the bottom of the page.

Disclaimer: The PharmGKB's clinical annotations reflect expert consensus based on clinical evidence and peer-reviewed literature available at the time they are written and are intended only to assist clinicians in decision-making and to identify questions for further research. New evidence may have emerged since the time an annotation was submitted to the PharmGKB. The annotations are limited in scope and are not applicable to interventions or diseases that are not specifically identified.

The annotations do not account for individual variations among patients, and cannot be considered inclusive of all proper methods of care or exclusive of other treatments. It remains the responsibility of the health-care provider to determine the best course of treatment for a patient. Adherence to any guideline is voluntary, with the ultimate determination regarding its application to be made solely by the clinician and the patient. PharmGKB assumes no responsibility for any injury or damage to persons or property arising out of or related to any use of the PharmGKB clinical annotations, or for any errors or omissions.

? = Mouse-over for quick help

This is a non-comprehensive list of genetic tests with pharmacogenetics relevance, typically submitted by the manufacturer and manually curated by PharmGKB. The information listed is provided for educational purposes only and does not constitute an endorsement of any listed test or manufacturer.

A more complete listing of genetic tests is found at the Genetic Testing Registry (GTR).

PGx Test Variants Assayed Gene?

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Links in the "Gene" column lead to PharmGKB Gene Pages.

Gene ? Variant?
(138)
Alternate Names / Tag SNPs ? Drugs ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
Translation
No VIP available No VIP available VA DPYD *2A N/A N/A N/A
No VIP available CA VA GSTM1 non-null N/A N/A N/A
No VIP available CA VA GSTM1 null N/A N/A N/A
No VIP available CA VA GSTT1 non-null N/A N/A N/A
No VIP available CA VA GSTT1 null N/A N/A N/A
No VIP available No Clinical Annotations available VA
rs10209881 10068136T>C, 130-30376A>G, 31246249T>C, 315-57081A>G, 70-30376A>G, 903-30376A>G
T > C
Intronic
No VIP available CA VA
rs10276036 1000-44G>A, 167367G>A, 25213041C>T, 87180198C>T, ABCB1: IVS9 ¿44a>G
C > T
Intronic
No VIP available CA VA
rs1042522 -278-661C>G, 16397C>G, 215C>G, 7182846G>C, 7579472G>C, 98C>G, P53:Arg72Pro, Pro33Arg, Pro72Arg, R72P, TP53 Arg72Pro, mRNA 412C>G, p.Pro72Arg, p52 codon 72
G > C
5' Flanking
Pro33Arg
No VIP available No Clinical Annotations available VA
rs1042858 2232G>A, 4099466G>A, 4159466G>A, 48543G>A, Ala744=, RRM1:2464G>A, rs1042858
G > A
Synonymous
Ala744Ala
No VIP available No Clinical Annotations available VA
rs10434 *847A>G, *913A>G, *929A>G, 20260A>G, 43693212A>G, 43753212A>G
A > G
3' UTR
No VIP available No Clinical Annotations available VA
rs1044457 *360C>T, 1119C>T, 17814695C>T, 47842777C>T
C > T
Not Available
rs1045642 208920T>A, 208920T>C, 25171488A>G, 25171488A>T, 3435T>A, 3435T>C, 87138645A>G, 87138645A>T, ABCB1*6, ABCB1: 3435C>T, ABCB1: C3435T, ABCB1: c.3435C>T, ABCB1:3435C>T, Ile1145=, Ile1145Ile, MDR1 3435C>T, MDR1 C3435T, PGP C3435T, c.3435C>T, mRNA 3853C>T
A > T
A > G
Synonymous
Ile1145Ile
No VIP available CA VA
rs1051640 14042638A>G, 4509A>G, 48768486A>G, Glu1503=
A > G
Synonymous
Glu1503Glu
No VIP available CA VA
rs1051740 19537412T>C, 226019633T>C, 26837T>C, 337T>C, EPHX1: Y113H, NM_000120.2: c.337T>C, NT_004559.13: g.2221786T>C, Tyr113His, c.337T>C, mRNA 378T>C, mRNA 612T>C, p.Tyr113His
T > C
Missense
Tyr113His
No VIP available CA VA
rs1052536 *50C>T, 29059C>T, 33331575C>T, 8068569C>T
C > T
3' UTR
No VIP available No Clinical Annotations available VA
rs1056836 10122C>C, 1294C>C, 17120090C>G, 38298203C>G, CYP1B1*3, CYP1B1: L432V, CYP1B1:4326 C>G, CYP1B1:L432V, Leu432=
G > C
Not Available
No VIP available No Clinical Annotations available VA
rs1065634 *1022A>G, -507A>G, 115259768T>C, 4748A>G, 85231686T>C
T > C
5' Flanking
No VIP available CA VA
rs10981694 -36+2451T>G, 115986409T>G, 45150941T>G
T > G
Intronic
No VIP available No Clinical Annotations available VA
rs11030918 -756T>C, 243555T>C, 4055487T>C, 4115487T>C, 4564T>C
T > C
5' Flanking
No VIP available No Clinical Annotations available VA
rs11211524 172-5414A>C, 172-928A>C, 17805131A>C, 321-928A>C, 47833213A>C
A > C
Intronic
No VIP available CA VA
rs11226 *744C>T, 1021813G>A, 164589G>A, 42051C>T, 961813G>A
G > A
3' UTR
No VIP available CA VA
rs1128503 1236T>C, 167964T>C, 25043506A>G, 87550285A>G, ABCB1 1236C>T, ABCB1*8, ABCB1: c.1236T>C, ABCB1:1236C>T, ABCB1:1236T>C, Gly412=, Gly412Gly, mRNA 1654T>C, p.Gly412Gly
A > G
Not Available
Gly412Gly
No VIP available CA VA
rs1130214 -163-187G>T, -350G>T, -79-675G>T, 105259734C>A, 7348G>T, 86259734C>A
C > A
5' UTR
No VIP available No Clinical Annotations available VA
rs1131341 16665C>G, 16665C>T, 23363068G>A, 23363068G>C, 304-1837C>G, 304-1837C>T, 415C>G, 415C>T, 69748869G>A, 69748869G>C, Arg139Gly, Arg139Trp, NQO1*3, NQO1:C465T, NQO1:R139W, T allele
C > G
C > A
Intronic
Arg139Trp
Arg139Gly
rs1138272 12659374C>T, 341C>T, 67353579C>T, 7514C>T, A114V, Ala114Val, GSTP1: A114V, GSTP1: C341T
C > T
Missense
Ala114Val
No VIP available CA VA
rs1142345 18070918T>C, 18130918T>C, 29457A>G, 719A>G, TPMT*3C, Tyr240Cys
T > C
Missense
Tyr240Cys
No VIP available CA VA
rs11615 18191871A>G, 354T>C, 45923653A>G, 63434T>C, Asn118=, ERCC1:19007T>C, ERCC1:Asn118Asn
A > G
Synonymous
Asn118Asn
No VIP available No Clinical Annotations available VA
rs11710163 -27+9024T>C, 12636288A>G, 12696288A>G, 14391T>C
A > G
Intronic
No VIP available No Clinical Annotations available VA
rs12090346 17813475C>T, 47841557C>T, 498+592C>T, 645+592C>T, 717+592C>T
C > T
Intronic
No VIP available No Clinical Annotations available VA
rs12118636 23048077G>A, 53076159G>A
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs12139042 *396C>T, 11167146G>A, 7171878G>A
G > A
3' UTR
No VIP available CA VA
rs12201199 18079802A>T, 18139802A>T, 20573T>A, 419+94T>A, TPMT:rs12201199 A/T
A > T
Intronic
No VIP available CA VA
rs12613732 10071314T>G, 130-33554A>C, 31249427T>G, 315-60259A>C, 70-33554A>C, 903-33554A>C
T > G
Intronic
No VIP available CA VA
rs12659 15830T>C, 3945997A>G, 46951556A>G, 576T>C, 696T>C, Pro192=, Pro232=
A > G
Synonymous
Pro192Pro
No VIP available No Clinical Annotations available VA
rs12806698 -269C>A, 244042C>A, 4055974C>A, 4115974C>A, 5051C>A
C > A
5' UTR
No VIP available No Clinical Annotations available VA
rs12999804 10067537A>T, 130-29777T>A, 31245650A>T, 315-56482T>A, 70-29777T>A, 903-29777T>A
A > T
Intronic
No VIP available CA VA
rs13181 *304T>G, 18123137T>G, 2251A>C, 23927A>C, 45854919T>G, ERCC2 Lys751Gln, ERCC2:2251A>C, ERCC2:Lys751Gln, Lys751Gln, rs13181:T>G
T > G
Missense
Lys751Gln
No VIP available No Clinical Annotations available VA
rs1617640 -1306C>A, 100317298C>A, 38350141C>A, 3876C>A
C > A
5' Flanking
No VIP available No Clinical Annotations available VA
rs16886403 33347T>C, 483-13181T>C, 56139246T>C, 6733605T>C
T > C
Intronic
rs1695 12658484A>G, 313A>G, 6624A>G, 67352689A>G, GSTP1*2, GSTP1*B, GSTP1: I105V, GSTP1:A313G, GSTP1:I105V, GSTP1:Ile105Val, Ile105Val, Part of haplotypes GSTP1*B and GSTP1*C, rs1695:A>G
A > G
Missense
Ile105Val
No VIP available CA VA
rs16950650 2456-7177G>A, 8865108C>T, 95775432C>T
C > T
Intronic
No VIP available No Clinical Annotations available VA
rs17216177 -34T>C, 101603522T>C, 3742-34T>C, 52407986T>C, 66060T>C
T > C
Intronic
No VIP available No Clinical Annotations available VA
rs17309872 *771A>T, *843T>A, 32814T>A, 33515788A>T, 3711880A>T, 58044A>T
A > T
3' Flanking
No VIP available No Clinical Annotations available VA
rs1734787 153325446A>C, 27-27438T>G, 4243384A>C, 42684T>G, 63-27438T>G
A > C
Intronic
No VIP available No Clinical Annotations available VA
rs1734791 153330920A>T, 26+26722T>A, 37210T>A, 4248858A>T, 62+32141T>A
A > T
Intronic
No VIP available No Clinical Annotations available VA
rs17435 153311980T>A, 27-13972A>T, 4229918T>A, 56150A>T, 63-13972A>T
T > A
Intronic
No VIP available CA VA
rs17574269 113-8802A>G, 117816128A>G, 21985585A>G
A > G
Intronic
No VIP available No Clinical Annotations available VA
rs17655 103528002G>C, 16617678G>C, 3310G>C, 34829G>C, 4672G>C, Asp1104His, Asp1558His
G > C
Missense
Asp1104His
No VIP available No Clinical Annotations available VA
rs17661089 56105996A>G, 6700355A>G, 97A>G
A > G
Not Available
No VIP available CA VA
rs1799735 110280254delC, 110280254delCinsCCT, 3-bp deletion, 468+24delG, 468+24delGinsAGG, 702+24delG, 702+24delGinsAGG, 80252172delC, 80252172delCinsCCT, GSTM3, intron 6, rs1799735:AGG/-
C > CCT
C > -
Intronic
No VIP available No Clinical Annotations available VA
rs1799782 16325792G>A, 44057574G>A, 580C>T, Arg194Trp
G > A
Missense
Arg194Trp
No VIP available CA VA
rs1799793 11587G>A, 18135477C>T, 45867259C>T, 862G>A, 934G>A, Asp288Asn, Asp312Asn, XPD Asp312Asn, XPD:Asp312Asn
C > T
Missense
Asp288Asn
No VIP available No Clinical Annotations available VA
rs1800440 10186A>G, 1358A>G, 17120026T>C, 38298139T>C, Asn453Ser
T > C
Missense
Asn453Ser
No VIP available CA VA
rs1800460 18079228C>T, 18139228C>T, 21147G>A, 460G>A, Ala154Thr, TPMT*3B
C > T
Missense
Ala154Thr
rs1800566 20389C>T, 23359344G>A, 445C>T, 457C>T, 559C>T, 69745145G>A, NQO1*2, NQO1:C609T, NQO1:P187S, NQO1:c.558C>T, Pro149Ser, Pro153Ser, Pro187Ser, rs1800566 C>T
G > A
Missense
Pro149Ser
No VIP available CA VA
rs1801131 1040A>C, 11208431T>G, 11794419T>G, 1286A>C, 1409A>C, 16685A>C, A1298C, Glu347Ala, Glu429Ala, Glu470Ala, MTHFR:1298A>C
T > G
Not Available
Glu347Ala
No VIP available CA VA
rs1801133 11210333G>A, 11796321G>A, 14783C>T, 419C>T, 665C>T, 677C>T, 788C>T, A222V, Ala140Val, Ala222Val, Ala263Val, C677T, MTHFR: c.677C>T, MTHFR:667C>T, p.A222V
G > A
Not Available
Ala140Val
No VIP available CA VA
rs1801280 14100T>C, 18257854T>C, 341T>C, 6116000T>C, Ile114Thr, NAT2:341T>C, NAT2:ILE114THR, signature SNP for NAT2*5 allelic group
T > C
Missense
Ile114Thr
No VIP available CA VA
rs1805087 237048500A>G, 2756A>G, 30566279A>G, 94920A>G, Asp919Gly, MS 2756A>G, MS D919G, MTR:2756A>G, MTR:Asp919Gly
A > G
Missense
Asp919Gly
No VIP available No Clinical Annotations available VA
rs183484 30209C>A, 4081132C>A, 4141132C>A, 850C>A, Arg284=
C > A
Synonymous
Arg284Arg
No VIP available No Clinical Annotations available VA
rs1870377 1416A>T, 23789A>T, 3312857T>A, 55972974T>A, Gln472His
T > A
Missense
Gln472His
No VIP available No Clinical Annotations available VA
rs1885301 -1549A>G, -1549G>A, 101541053A>G, 3591A>G, 52345517A>G
A > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs2010963 -634C>G, -94C>G, 43678350C>G, 43738350C>G, 5398C>G, VEGF-A 405 G/C, VEGFA:405G>C, VEGFA:C405G
C > G
5' UTR
No VIP available No Clinical Annotations available VA
rs2018683 29004195G>T, 29014195G>T
G > T
Not Available
No VIP available No Clinical Annotations available VA
rs2031920 (-1053)C>T (Rsa 1 c1>c2), -1055C>T, 135339845C>T, 3979C>T, 6573776C>T, CYP2E1(-1055)C>T, Rsa1
C > T
5' Flanking
No VIP available No Clinical Annotations available VA
rs2032582 186947T>A, 186947T>G, 25193461A>C, 25193461A>T, 2677A, 2677G, 2677T, 2677T>A, 2677T>G, 3095G>T/A, 87160618A>C, 87160618A>T, 893 Ala, 893 Ser, 893 Thr, ABCB1*7, ABCB1: 2677G>T/A, ABCB1: 2677T/A>G, ABCB1: A893S, ABCB1: G2677T/A, ABCB1: c.2677G>T/A, ABCB1:2677G>A/T, ABCB1:2677G>T/A, ABCB1:A893T, Ala893Ser/Thr, MDR1, MDR1 G2677T/A, Ser893Ala, Ser893Thr, mRNA 3095G>T/A, p.Ala893Ser/Thr
A > C
A > T
Missense
Ser893Ala
Ser893Thr
No VIP available CA VA
rs2070676 1156-118G>C, 135351137G>C, 15271G>C, 6585068G>C
G > C
Intronic
No VIP available No Clinical Annotations available VA
rs2071559 -906T>C, 3332249A>G, 4397T>C, 55992366A>G
A > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs2072671 20915701A>C, 7595789A>C, 79A>C, CDA: c.79A>C, CDA:79A>C, K27Q, Lys27Gln, p.Lys27Gln
A > C
Missense
Lys27Gln
No VIP available CA VA
rs2075252 12280A>G, 170010985T>C, 20220403T>C, 213138A>G, Lys4094Glu
T > C
Missense
Lys4094Glu
No VIP available No Clinical Annotations available VA
rs2166219 19617302T>C, 3287578T>C
T > C
Not Available
No VIP available CA VA
rs2207396 1369+123G>A, 152382382G>A, 375752G>A, 56551839G>A
G > A
Intronic
No VIP available CA VA
rs2228001 14127449G>T, 14187449G>T, 2704C>A, 2795C>A, 2815C>A, 37724C>A, Gln902Lys, Gln939Lys, XPC Lys939Gln, XPC:Lys939Gln, rs2228001:A>C
G > T
Not Available
Gln902Lys
No VIP available No Clinical Annotations available VA
rs2228171 170053505C>A, 170053505C>G, 170053505C>T, 170618G>A, 170618G>C, 170618G>T, 20262923C>A, 20262923C>G, 20262923C>T, 8614G>A, 8614G>C, 8614G>T, Ala2872Pro, Ala2872Ser, Ala2872Thr
C > G
C > T
C > A
Missense
Ala2872Pro
Ala2872Thr
Ala2872Ser
No VIP available No Clinical Annotations available VA
rs2273697 101563815G>A, 1249G>A, 26353G>A, 52368279G>A, ABCC2: c.1249G>A, ABCC2:1249G>A, ABCC2:V417I, ABCC2:c.1249G>A, Val417Ile, p.V417I
G > A
Missense
Val417Ile
No VIP available No Clinical Annotations available VA
rs2284449 20-2374T>C, 4060849T>C, 4120849T>C, 9926T>C
T > C
Intronic
No VIP available No Clinical Annotations available VA
rs2299939 164+3284C>A, 38955C>A, 40461614C>A, 89657150C>A
C > A
Intronic
No VIP available No Clinical Annotations available VA
rs2305948 17205G>A, 3319441C>T, 55979558C>T, 889G>A, Val297Ile
C > T
Missense
Val297Ile
No VIP available No Clinical Annotations available VA
rs232043 28202G>A, 4079125G>A, 4139125G>A, 651-425G>A
G > A
Intronic
No VIP available No Clinical Annotations available VA
rs2494750 -1172C>G, -1256C>G, 105262912G>C, 4169C>G, 86262912G>C
G > C
5' Flanking
No VIP available CA VA
rs2494752 -1868T>C, -1952T>C, 105263608A>G, 3473T>C, 86263608A>G
A > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs2498786 -628G>C, -712G>C, 105262368C>G, 4713G>C, 86262368C>G
C > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs2498804 105233095C>A, 86233095C>A
C > A
Not Available
No VIP available CA VA
rs25487 1196A>G, 16323944T>C, 44055726T>C, Gln399Arg, XRCC1 Arg399Gln, XRCC1:Arg399Gln
T > C
Missense
Gln399Arg
No VIP available No Clinical Annotations available VA
rs25489 16324630C>T, 44056412C>T, 839G>A, Arg280His
C > T
Missense
Arg280His
No VIP available CA VA
rs25648 -7C>T, 43678977C>T, 43738977C>T, 534C>T, 6025C>T, Ser178=
C > T
Synonymous
Ser178Ser
No VIP available No Clinical Annotations available VA
rs2699887 -77+17C>T, 178866408C>T, 5098C>T, 85361554C>T
C > T
Intronic
No VIP available No Clinical Annotations available VA
rs2762939 14266C>G, 22977343G>C, 52781251G>C, 733-149C>G
G > C
Intronic
No VIP available No Clinical Annotations available VA
rs2804402 -1019A>G, 101541583A>G, 4121A>G, 52346047A>G, ABCC2: ¿1019a>G
A > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs3025039 *171C>T, *237C>T, *253C>T, 19584C>T, 43692536C>T, 43752536C>T, VEGFA:C936T
C > T
3' UTR
No VIP available No Clinical Annotations available VA
rs307805 -942A>G, 180077487T>C, 24888760T>C, 4138A>G
T > C
5' Flanking
No VIP available No Clinical Annotations available VA
rs307822 *1475A>G, 180028717T>C, 24839990T>C, 52908A>G
T > C
3' UTR
No VIP available CA VA
rs316019 160670282A>C, 64839739A>C, 808T>G, SLC22A2: A270S, SLC22A2: Ala270Ser, Ser270Ala
A > C
Missense
Ser270Ala
No VIP available CA VA
rs3212986 *197G>T, 1510C>A, 18180954C>A, 45912736C>A, 74351G>T, ERCC1 C8092A, ERCC1:8090C>A, ERCC1:8092C>A, Gln504Lys
C > A
3' UTR
Gln504Lys
No VIP available CA VA
rs3219484 10987G>A, 15772074C>T, 22G>A, 45800156C>T, 64G>A, Val22Met, Val8Met
C > T
Missense
Val22Met
No VIP available No Clinical Annotations available VA
rs34716810 -1586C>T, -1642C>T, -1735C>T, 13060807G>A, 3677C>T, 40792589G>A
G > A
5' Flanking
No VIP available No Clinical Annotations available VA
rs34743033 28-bp tandem repeats, CCGCGCCACTTGGCCTGCCTCCGTCCCG, TSER*2, TSER*3, TYMS: 28 bp tandem repeat, TYMS: 2R, TYMS: TSER *2/*3, TYMS:TSER 28-basepair 5'UTR enhancer region repeat
CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC > CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC
CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC > CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC
CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC > CCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTGGCCTGCCTCCGTCCCGCCGCGCCACTTCGCCTGCCTCCGTCCCCC
Not Available
No VIP available No Clinical Annotations available VA
rs3740066 101604207C>T, 3972C>T, 52408671C>T, 66745C>T, ABCC2:3972C>T, I1324I, Ile1324=
C > T
Synonymous
Ile1324Ile
No VIP available CA VA
rs3740556 -7C>T, 120840195G>A, 71644659G>A
G > A
5' UTR
No VIP available No Clinical Annotations available VA
rs3787554 12837C>T, 22978772G>A, 52782680G>A, 641-308C>T
G > A
Intronic
No VIP available No Clinical Annotations available VA
rs3803304 105239146C>G, 1172+69G>C, 27936G>C, 86239146C>G
C > G
Intronic
No VIP available No Clinical Annotations available VA
rs3817657 31669T>C, 4082592T>C, 4142592T>C, 877-242T>C
T > C
Intronic
No VIP available No Clinical Annotations available VA
rs3832043 -127delT, 10, 234580454delT, 526713delT, 855+34431delT, 855+53246delT, 87065delT, 9/, T, UGT1A9*22, UGT1A9:
T > -
5' Flanking
No VIP available CA VA
rs3957357 -135T>C, -69, 5' flanking, 52608687A>G, 52668687A>G, Eam1104I, GSTA1, GSTA1 -69 C>T polymorphism, GSTA1:
A > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs4124874 -1668A>C, 172270T>G, 234665659T>G, 61-10021T>G, 611918T>G, 856-10021T>G, 862-10021T>G, 868-10021T>G, UGT1A1*60, UGT1A1:-3263T>G, UGT1A1:-3279T>G
T > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs4148323 175755G>A, 211G>A, 234669144G>A, 61-6536G>A, 615403G>A, 856-6536G>A, 862-6536G>A, 868-6536G>A, Gly71Arg, UGT1A1*6, UGT1A1: G71R, UGT1A1:211G>A, UGT1A1:G211A, UGT1A1:Gly71Arg
G > A
Intronic
Gly71Arg
No VIP available CA VA
rs4148416 14027575C>T, 3039C>T, 48753423C>T, Gly1013=
C > T
Synonymous
Gly1013Gly
No VIP available CA VA
rs4148737 176413A>G, 2212-372A>G, 25203995T>C, 87171152T>C
T > C
Intronic
No VIP available No Clinical Annotations available VA
rs4492666 171+1057A>C, 17772763A>C, 320+1057A>C, 47800845A>C
A > C
Intronic
No VIP available No Clinical Annotations available VA
rs451774 *606A>G, *851A>G, 24754A>G, 28442550A>G, 28502550A>G
A > G
3' UTR
No VIP available CA VA
rs4646316 19952132C>T, 27870C>T, 3104282C>T, 465+310C>T, 615+310C>T
C > T
Intronic
No VIP available No Clinical Annotations available VA
rs4655567 38073558G>C, 68101640G>C
G > C
Not Available
No VIP available No Clinical Annotations available VA
rs4834232 129024273C>T, 53571994C>T, 814-4021C>T
C > T
Intronic
No VIP available No Clinical Annotations available VA
rs4932551 7037485G>C, 92071958G>C
G > C
Not Available
No VIP available No Clinical Annotations available VA
rs5009910 10070901T>C, 130-33141A>G, 31249014T>C, 315-59846A>G, 70-33141A>G, 903-33141A>G
T > C
Intronic
No VIP available No Clinical Annotations available VA
rs560018 110200360T>C, 260-34T>C, 492-34T>C, 80172278T>C
T > C
Intronic
No VIP available No Clinical Annotations available VA
rs5906072 45640507T>C, 8492251T>C
T > C
Not Available
No VIP available No Clinical Annotations available VA
rs5934731 447C>T, 7817606C>T, 9935844C>T, Tyr149=
C > T
Synonymous
Tyr149Tyr
No VIP available No Clinical Annotations available VA
rs60369023 208G>A, 20931474G>A, 7611562G>A, A70T, Ala70Thr, CDA: c.208G>A, CDA:208G>A, p.Ala70Thr
G > A
Missense
Ala70Thr
No VIP available No Clinical Annotations available VA
rs62107593 -1923G>C, -1979G>C, -2072G>C, 13061144C>G, 3340G>C, 40792926C>G
C > G
5' Flanking
No VIP available CA VA
rs6413432 12678T>A, 135348544T>A, 6582475T>A, 967+1143T>A, CYP2E1*6 (DraI RFLP, T7632A SNP, rs6413432)
T > A
Intronic
No VIP available No Clinical Annotations available VA
rs6458232 41569726C>A, 41629726C>A
C > A
Not Available
No VIP available No Clinical Annotations available VA
rs664393 -2021A>G, 10051001T>C, 29071001T>C, 3265A>G
T > C
5' Flanking
No VIP available No Clinical Annotations available VA
rs6752303 10069372T>C, 130-31612A>G, 31247485T>C, 315-58317A>G, 70-31612A>G, 903-31612A>G
T > C
Intronic
No VIP available No Clinical Annotations available VA
rs6848982 128959213G>A, 53506934G>A
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs6877011 *721G>C, 180029471C>G, 24840744C>G, 52154G>C
C > G
3' UTR
No VIP available CA VA
rs698 100260789T>A, 100260789T>C, 1048A>G, 1048A>T, 18129A>G, 18129A>T, 24808510T>A, 24808510T>C, ADH1C*2, Ile350Phe, Ile350Val
T > A
T > C
Missense
Ile350Val
No VIP available No Clinical Annotations available VA
rs7121 *254C>T, *299C>T, 2322C>T, 27674899C>T, 348C>T, 351C>T, 393C>T, 396C>T, 483C>T, 57478807C>T, 69013C>T, Ile116=, Ile117=, Ile131=, Ile132=, Ile774=
C > T
Synonymous
Ile117Ile
No VIP available No Clinical Annotations available VA
rs7131224 24187531T>C, 24247531T>C
T > C
Not Available
No VIP available No Clinical Annotations available VA
rs715171 7223610C>T, 9341848C>T
C > T
Not Available
No VIP available No Clinical Annotations available VA
rs7170769 7035732C>T, 92070205C>T
C > T
Not Available
No VIP available No Clinical Annotations available VA
rs717620 -24C>T, 101542578C>T, 5116C>T, 52347042C>T, ABCC2: 5'UTR, ABCC2:(-24)C>T, mRNA 118C>T
C > T
5' UTR
No VIP available CA VA
rs7186128 16897915G>A, 16957915G>A
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs720106 29055T>C, 4079978T>C, 4139978T>C, 792+287T>C
T > C
Intronic
No VIP available No Clinical Annotations available VA
rs725518 17922G>A, 387+80G>A, 4068845G>A, 4128845G>A
G > A
Intronic
No VIP available CA VA
rs726501 21967G>A, 482+15984G>A, 56127866G>A, 6722225G>A
G > A
Intronic
No VIP available No Clinical Annotations available VA
rs74090038 -1041G>A, -1125G>A, 105262781C>T, 4300G>A, 86262781C>T
C > T
5' Flanking
No VIP available No Clinical Annotations available VA
rs7483 110279701C>T, 670G>A, 80251619C>T, 904G>A, Val224Ile
C > T
Not Available
Val224Ile
No VIP available No Clinical Annotations available VA
rs7608731 10071861T>C, 130-34101A>G, 31249974T>C, 315-60806A>G, 70-34101A>G, 903-34101A>G
T > C
Intronic
No VIP available No Clinical Annotations available VA
rs7664413 102156428C>T, 177608707C>T, 812-33G>A
C > T
Not Available
No VIP available No Clinical Annotations available VA
rs7667298 -271A>G, 3331614T>C, 5032A>G, 55991731T>C
T > C
5' UTR
No VIP available CA VA
rs7851395 -35-15930A>G, 116002464A>G, 45166996A>G
A > G
Intronic
No VIP available No Clinical Annotations available VA
rs7940013 27381C>T, 4078304C>T, 4138304C>T, 651-1246C>T
C > T
Intronic
No VIP available No Clinical Annotations available VA
rs7993418 191205C>T, 28883061G>A, 3639C>T, 9863061G>A, Tyr1213=
G > A
Synonymous
Tyr1213Tyr
No VIP available No Clinical Annotations available VA
rs8020368 -1390A>G, 76943548T>C, 95943548T>C
T > C
5' Flanking
No VIP available No Clinical Annotations available VA
rs8175347 233760235_233760236TA[5][6][7][8], 5-TA insertion in promoter, 7-TA insertion in promoter, 8-TA insertion in promoter, UGT1A1*28, UGT1A1*36, UGT1A1*37, microsatellite, short tandem repeat
(TA)6 > (TA)8
(TA)6 > (TA)5
(TA)6 > (TA)7
Not Available
No VIP available No Clinical Annotations available VA
rs8187710 101611294G>A, 4544G>A, 52415758G>A, 73832G>A, ABCC2 rs8187710, Cys1515Tyr, MRP2 Cys1515Tyr
G > A
Missense
Cys1515Tyr
No VIP available No Clinical Annotations available VA
rs833061 -1498C>T, -460, -958C>T, 43677486C>T, 43737486C>T, 4534C>T, VEGF-A -460 C/T, VEGFA:C-460T, VEGFA:T-1498C
C > T
5' Flanking
No VIP available CA VA
rs861539 104165753G>A, 1651-1239G>A, 1782-1239G>A, 21071C>T, 722C>T, 75229G>A, 85165753G>A, Thr241Met
G > A
Intronic
Thr241Met
No VIP available CA VA
rs9332377 19955692C>T, 3107842C>T, 31430C>T, 466-367C>T, 53618G>A, 616-367C>T, COMT:rs9332377 A/G
C > T
Intronic
No VIP available CA VA
rs9597 *157C>G, 1314951C>G, 1374951C>G
C > G
3' UTR
No VIP available CA VA
rs9679162 10069401G>T, 130-31641C>A, 31247514G>T, 315-58346C>A, 70-31641C>A, 903-31641C>A
G > T
Intronic
No VIP available No Clinical Annotations available VA
rs9937 2223A>G, 4099457A>G, 4159457A>G, 48534A>G, RRM1:2455A>G, Thr741=, rs3177016
A > G
Synonymous
Thr741Thr
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 138
2D structure from PubChem
provided by PubChem

Overview

Generic Names
  • CACP
  • CPDC
  • CPDD
  • Cis-DDP
  • Cis-Diaminedichloroplatinum
  • Cis-Diamminedichloroplatinum
  • DDP
  • DDPT
  • Diamminedichloroplatinum
  • Platinum Ammine Chloride
  • Platinum Ammonium Chloride
  • Platinum Diamine Dichloride
  • Trans-DDP
  • Trans-Diaminedichloroplatinum
  • Trans-Diamminedichloroplatinum
  • Trans-Dichlorodiammine Platinum
  • Trans-Platinumdiammine Dichloride
Trade Names
  • Abiplatin
  • Biocisplatinum
  • Briplatin
  • Carboquone
  • Cis Pt II
  • Cismaplat
  • Cisplatine
  • Cisplatyl
  • Citoplationo
  • Lederplatin
  • Neoplatin
  • Plastin
  • Platamine
  • Platiblastin
  • Platidiam
  • Platinex
  • Platinol
  • Platinol-AQ
  • Platinoxan
  • Randa
Brand Mixture Names

PharmGKB Accession Id:
PA449014

Description

Cisplatin, cisplatinum or cis-diamminedichloroplatinum(II) (CDDP) is a platinum-based chemotherapy drug used to treat various types of cancers, including sarcomas, some carcinomas (e.g. small cell lung cancer, and ovarian cancer), lymphomas and germ cell tumors. It was the first member of its class, which now also includes carboplatin and oxaliplatin.

Source: Drug Bank

Indication

For the treatment of metastatic testicular tumors, metastatic ovarian tumors and advanced bladder cancer.

Source: Drug Bank

Other Vocabularies

Information pulled from DrugBank has not been reviewed by PharmGKB.

Pharmacology, Interactions, and Contraindications

Mechanism of Action

Alkylating agents work by three different mechanisms: 1) attachment of alkyl groups to DNA bases, resulting in the DNA being fragmented by repair enzymes in their attempts to replace the alkylated bases, preventing DNA synthesis and RNA transcription from the affected DNA, 2) DNA damage via the formation of cross-links (bonds between atoms in the DNA) which prevents DNA from being separated for synthesis or transcription, and 3) the induction of mispairing of the nucleotides leading to mutations.

Source: Drug Bank

Pharmacology

Cisplatin is an antineoplastic in the class of alkylating agents and is used to treat various forms of cancer. Alkylating agents are so named because of their ability to add alkyl groups to many electronegative groups under conditions present in cells. They stop tumor growth by cross-linking guanine bases in DNA double-helix strands - directly attacking DNA. This makes the strands unable to uncoil and separate. As this is necessary in DNA replication, the cells can no longer divide. In addition, these drugs add methyl or other alkyl groups onto molecules where they do not belong which in turn inhibits their correct utilization by base pairing and causes a miscoding of DNA. Alkylating agents are cell cycle-nonspecific. Alkylating agents work by three different mechanisms all of which achieve the same end result - disruption of DNA function and cell death.

Source: Drug Bank

Food Interaction

Echinacea should be used with caution, if at all, in patients receiving therapeutic immunosuppressants. Monitor for reduced efficacy of the immunosuppressant during concomitant use.

Source: Drug Bank

Absorption, Distribution, Metabolism, Elimination & Toxicity

Protein Binding

Greater than 90%.

Source: Drug Bank

Half-Life

20-30 minutes

Source: Drug Bank

Clearance

Source: Drug Bank

Route of Elimination

The parent compound, cisplatin, is excreted in the urine. Although small amounts of platinum are present in the bile and large intestine after administration of cisplatin, the fecal excretion of platinum appears to be insignificant.

Source: Drug Bank

Chemical Properties

Chemical Formula

Cl2H6N2Pt

Source: Drug Bank

Isomeric SMILES

[NH3][Pt]([NH3])(Cl)Cl

Source: OpenEye

Canonical SMILES

N[Pt](N)(Cl)Cl

Source: Drug Bank

Average Molecular Weight

300.051

Source: Drug Bank

Monoisotopic Molecular Weight

298.955578065

Source: Drug Bank

Genes that are associated with this drug in PharmGKB's database based on (1) variant annotations, (2) literature review, (3) pathways or (4) information automatically retrieved from DrugBank, depending on the "evidence" and "source" listed below.

Curated Information ?

Drug Interactions

Drug Description
cisplatin Increased risk of nephrotoxicity (source: Drug Bank)
cisplatin Increased ototoxicity (source: Drug Bank)
cisplatin Increased ototoxicity (source: Drug Bank)
cisplatin Increased ototoxicity (source: Drug Bank)
cisplatin Increased ototoxicity (source: Drug Bank)
cisplatin The antineoplasic agent decreases the effect of hydantoin (source: Drug Bank)
cisplatin Increased ototoxicity (source: Drug Bank)
cisplatin Increased ototoxicity (source: Drug Bank)
cisplatin Increased risk of nephrotoxicity (source: Drug Bank)
cisplatin Increased risk of nephrotoxicity (source: Drug Bank)
cisplatin Cisplatin increases methotrexate toxicity (source: Drug Bank)
cisplatin Cisplatin increases methotrexate toxicity (source: Drug Bank)
cisplatin Increased risk of nephrotoxicity (source: Drug Bank)
cisplatin Cisplatin increases the effect and toxicity of paclitaxel (source: Drug Bank)
cisplatin Cisplatin increases the effect and toxicity of paclitaxel (source: Drug Bank)
cisplatin The antineoplasic agent decreases the effect of hydantoin (source: Drug Bank)
cisplatin The antineoplasic agent decreases the effect of hydantoin (source: Drug Bank)
cisplatin Additive renal impairment may occur during concomitant therapy with aminoglycosides such as Cisplatin. Use caution during concomitant therapy. (source: Drug Bank)
cisplatin Increased risk of nephrotoxicity (source: Drug Bank)
cisplatin Increased risk of nephrotoxicity (source: Drug Bank)
cisplatin Administration of Topotecan after Cisplatin therapy may increase the risk of hematologic toxicity, such as neutropenia and/or thrombocytopenia. A dose adjustment may be required or the sequence of administration reversed. (source: Drug Bank)
cisplatin Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank)

Curated Information ?

Relationships from National Drug File - Reference Terminology (NDF-RT)

May Treat
Contraindicated With

Publications related to cisplatin: 168

No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Application of next generation sequencing to CEPH cell lines to discover variants associated with FDA approved chemotherapeutics. BMC research notes. 2014. Hariani Gunjan D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PharmGKB summary: very important pharmacogene information for N-acetyltransferase 2. Pharmacogenetics and genomics. 2014. McDonagh Ellen M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Epigenetic perspectives on cancer chemotherapy response. Pharmacogenomics. 2014. Liu Mou-Ze, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenomic assessment of cisplatin-based chemotherapy outcomes in ovarian cancer. Pharmacogenomics. 2014. Khrunin Andrey V, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Tumor angiogenesis genotyping and efficacy of first-line chemotherapy in metastatic gastric cancer patients. Pharmacogenomics. 2013. Scartozzi Mario, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Replication of TPMT and ABCC3 Genetic Variants Highly Associated With Cisplatin-Induced Hearing Loss in Children. Clinical pharmacology and therapeutics. 2013. Pussegoda K, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The Role of Inherited TPMT and COMT Genetic Variation in Cisplatin-Induced Ototoxicity in Children With Cancer. Clinical pharmacology and therapeutics. 2013. Yang J J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
ERCC1 C8092A (rs3212986) polymorphism as a predictive marker in esophageal cancer patients treated with cisplatin/5-FU-based neoadjuvant therapy. Pharmacogenetics and genomics. 2013. Rumiato Enrica, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Understanding platinum-induced ototoxicity. Trends in pharmacological sciences. 2013. Langer Thorsten, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of ABCB1 genetic polymorphisms with susceptibility to colorectal cancer and therapeutic prognosis. Pharmacogenomics. 2013. Wu Huizhe, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
A phase I/II pharmacokinetic and pharmacogenomic study of calcitriol in combination with cisplatin and docetaxel in advanced non-small-cell lung cancer. Cancer chemotherapy and pharmacology. 2013. Ramnath N, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Cisplatin-induced ototoxicity in pediatric solid tumors: the role of glutathione S-transferases and megalin genetic polymorphisms. Journal of pediatric hematology/oncology. 2013. Choeyprasert Worawut, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Glutathione S-transferase P1 single nucleotide polymorphism predicts permanent ototoxicity in children with medulloblastoma. Pediatric blood & cancer. 2013. Rednam Surya, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DNA repair and cytotoxic drugs: the potential role of RAD51 in clinical outcome of non-small-cell lung cancer patients. Pharmacogenomics. 2013. Nogueira Augusto, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A genome-wide association study of survival in small-cell lung cancer patients treated with irinotecan plus cisplatin chemotherapy. The pharmacogenomics journal. 2013. Han J-Y, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Association between eIF3alpha polymorphism and severe toxicity caused by platinum-based chemotherapy in non-small cell lung cancer patients. British journal of clinical pharmacology. 2013. Xu Xiaojing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Excision repair cross-complementing gene-1, ribonucleotide reductase subunit M1, ribonucleotide reductase subunit M2, and human equilibrative nucleoside transporter-1 expression and prognostic value in biliary tract malignancy. Cancer. 2013. Fisher Sarah B, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The A/G allele of eIF3a rs3740556 predicts platinum-based chemotherapy resistance in lung cancer patients. Lung cancer (Amsterdam, Netherlands). 2013. Xu Xiaojing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genetic variability & chemotoxicity of 5-fluorouracil & cisplatin in head & neck cancer patients: a preliminary study. The Indian journal of medical research. 2013. Dhawan Dipali, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Epigenomics and Interindividual Differences in Drug Response. Clinical pharmacology and therapeutics. 2012. Ivanov M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
PharmGKB summary: very important pharmacogene information for GSTT1. Pharmacogenetics and genomics. 2012. Thorn Caroline F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
siRNA-mediated knock-down of NOX3: therapy for hearing loss?. Cellular and molecular life sciences : CMLS. 2012. Rybak Leonard P, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic polymorphism of copper transporter protein 1 is related to platinum resistance in Chinese non-small cell lung carcinoma patients. Clinical and experimental pharmacology & physiology. 2012. Xu Xiaojing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Associations Between ABCC2 Polymorphisms and Cisplatin Disposition and Efficacy. Clinical pharmacology and therapeutics. 2012. Sprowl J A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
First-SIGNAL: first-line single-agent iressa versus gemcitabine and cisplatin trial in never-smokers with adenocarcinoma of the lung. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2012. Han Ji-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Prediction of copper transport protein 1 (CTR1) genotype on severe cisplatin induced toxicity in non-small cell lung cancer (NSCLC) patients. Lung cancer (Amsterdam, Netherlands). 2012. Xu Xiaojing, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gene therapy for cisplatin-induced ototoxicity: a systematic review of in vitro and experimental animal studies. Otology & neurotology : official publication of the American Otological Society, American Neurotology Society [and] European Academy of Otology and Neurotology. 2012. Waissbluth Sofia, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association between polymorphisms of ERCC1 and survival in epithelial ovarian cancer patients with chemotherapy. Pharmacogenomics. 2012. Yan Li, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genomic approach towards personalized anticancer drug therapy. Pharmacogenomics. 2012. Midorikawa Yutaka, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenomics of cisplatin-based chemotherapy in ovarian cancer patients of different ethnic origins. Pharmacogenomics. 2012. Khrunin Andrey, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Arylamine N-acetyltransferase 1: a novel drug target in cancer development. Pharmacological reviews. 2012. Butcher Neville J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variants in the PI3K/PTEN/AKT/mTOR pathway predict platinum-based chemotherapy response of advanced non-small cell lung cancers in a Chinese population. Asian Pacific journal of cancer prevention : APJCP. 2012. Xu Jia-Li, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ERCC1 as a biomarker for bladder cancer patients likely to benefit from adjuvant chemotherapy. BMC cancer. 2012. Sun Jong-Mu, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Two minor NQO1 and NQO2 alleles predict poor response of breast cancer patients to adjuvant doxorubicin and cyclophosphamide therapy. Pharmacogenetics and genomics. 2011. Jamieson David, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association between DNA-repair polymorphisms and survival in pancreatic cancer patients treated with combination chemotherapy. Pharmacogenomics. 2011. Giovannetti Elisa, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Meta-analysis on pharmacogenetics of platinum-based chemotherapy in non small cell lung cancer (NSCLC) patients. PloS one. 2012. Yin Ji-Ye, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic analyses of cisplatin-induced nephrotoxicity indicate a renoprotective effect of ERCC1 polymorphisms. Pharmacogenomics. 2011. Tzvetkov Mladen V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Differential effect of polymorphisms of CMPK1 and RRM1 on survival in advanced non-small cell lung cancer patients treated with gemcitabine or taxane/cisplatinum. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2011. Ryu Jeong-Seon, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Genome-wide meta-analysis identifies variants associated with platinating agent susceptibility across populations. The pharmacogenomics journal. 2011. Wheeler H E, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Nucleotide excision repair gene variants and association with survival in osteosarcoma patients treated with neoadjuvant chemotherapy. The pharmacogenomics journal. 2011. Biason P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic effects and modifiers of radiotherapy and chemotherapy on survival in pancreatic cancer. Pancreas. 2011. Zeng Hongmei, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
GALNT14 SNP as a potential predictor of response to combination chemotherapy using 5-FU, mitoxantrone and cisplatin in advanced HCC. Pharmacogenomics. 2011. Liang Kung-Hao, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics of cisplatin-induced ototoxicity. Pharmacogenomics. 2011. Mukherjea Debashree, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Transporter-mediated drug-drug interactions. Pharmacogenomics. 2011. Müller Fabian, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variations in multiple drug action pathways and survival in advanced stage non-small cell lung cancer treated with chemotherapy. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Li Yafei, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
The NQO1*2/*2 polymorphism is associated with poor overall survival in patients following resection of stages II and IIIa non-small cell lung cancer. Oncology reports. 2011. Kolesar Jill M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Influence of polymorphisms in MTHFR 677 C¿T, TYMS 3R¿2R and MTR 2756 A¿G on NSCLC risk and response to platinum-based chemotherapy in advanced NSCLC. Pharmacogenomics. 2011. Cui Lian-Hua, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Estrogen receptor alpha single nucleotide polymorphism modifies the risk of azoospermia in childhood cancer survivors. Pharmacogenetics and genomics. 2011. Romerius Patrik, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Transporter-Mediated Drug Uptake and Efflux: Important Determinants of Adverse Drug Reactions. Clinical pharmacology and therapeutics. 2011. Zolk O, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Economic impact of a genetic test for cisplatin-induced ototoxicity. The pharmacogenomics journal. 2011. Dionne F, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Phase II trial of pemetrexed and bevacizumab in patients with recurrent or metastatic head and neck cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2011. Argiris Athanassios, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Very important pharmacogene summary: ABCB1 (MDR1, P-glycoprotein). Pharmacogenetics and genomics. 2011. Hodges Laura M, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Use of a comprehensive panel of biomarkers to predict response to a fluorouracil-oxaliplatin regimen in patients with metastatic colorectal cancer. Pharmacogenomics. 2011. Lamas Maria J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Impact of ABCB1 C3435T polymorphism on lymph node regression in multimodality treatment of locally advanced esophageal cancer. Pharmacogenomics. 2011. Narumiya Kosuke, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
THYMIDYLATE SYNTHASE AND EXCISION REPAIR-CROSS-COMPLEMENTING GROUP-1 AS PREDICTORS OF RESPONSIVENESS IN MESOTHELIOMA PATIENTS TREATED WITH PEMETREXED-CARBOPLATIN. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Zucali Paolo Andrea, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
PI3K/PTEN/AKT/mTOR pathway genetic variation predicts toxicity and distant progression in lung cancer patients receiving platinum-based chemotherapy. Lung cancer (Amsterdam, Netherlands). 2011. Pu Xia, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Multiple genetic polymorphisms in the prediction of clinical outcome of metastatic colorectal cancer patients treated with first-line FOLFOX-4 chemotherapy. Pharmacogenetics and genomics. 2011. Huang Ming-Yii, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genome-wide interrogation identifies YAP1 variants associated with survival of small-cell lung cancer patients. Cancer research. 2010. Wu Chen, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Effect of ABCB1 and ABCC3 polymorphisms on osteosarcoma survival after chemotherapy: a pharmacogenetic study. PloS one. 2011. Caronia Daniela, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Three-gene predictor of clinical outcome for gastric cancer patients treated with chemotherapy. The pharmacogenomics journal. 2010. Kim H K, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Distribution of TYMS, MTHFR, p53 and MDR1 gene polymorphisms in patients with breast cancer treated with neoadjuvant chemotherapy. Cancer epidemiology. 2010. Henríquez-Hernández Luis Alberto, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Nucleotide excision repair gene polymorphisms may predict acute toxicity in patients treated with chemoradiotherapy for bladder cancer. Pharmacogenomics. 2010. Sakano Shigeru, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A phase I/II and pharmacogenomic study of pemetrexed and cisplatin in patients with unresectable, advanced gastric carcinoma. Anti-cancer drugs. 2010. Chen Jen-Shi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Host genetic variants in the IGF binding protein-3 impact on survival of patients with advanced gastric cancer treated with palliative chemotherapy. Pharmacogenomics. 2010. Graziano Francesco, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Glutathione S-transferase polymorphisms in osteosarcoma patients. Pharmacogenetics and genomics. 2010. Salinas-Souza Carolina, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of the copper transporter, CTR1, in platinum-induced ototoxicity. The Journal of neuroscience : the official journal of the Society for Neuroscience. 2010. More Swati S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Blood-based CHRNA3 single nucleotide polymorphism and outcome in advanced non-small-cell lung cancer patients. Lung cancer (Amsterdam, Netherlands). 2010. Carcereny Enric, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Expression of gemcitabine- and cisplatin-related genes in non-small-cell lung cancer. The pharmacogenomics journal. 2010. Toffalorio F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Population differences in platinum toxicity as a means to identify novel genetic susceptibility variants. Pharmacogenetics and genomics. 2010. O'Donnell Peter H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Chemotherapeutic drug susceptibility associated SNPs are enriched in expression quantitative trait loci. Proceedings of the National Academy of Sciences of the United States of America. 2010. Gamazon Eric R, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PACdb: a database for cell-based pharmacogenomics. Pharmacogenetics and genomics. 2010. Gamazon Eric R, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics of membrane transporters: past, present and future. Pharmacogenomics. 2010. Yee Sook Wah, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of SUMO1 and UBC9 genotypes with tumor response in non-small-cell lung cancer treated with irinotecan-based chemotherapy. The pharmacogenomics journal. 2010. Han Ji-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Glutathione pathway genetic polymorphisms and lung cancer survival after platinum-based chemotherapy. Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology. 2010. Moyer Ann M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Association of MDR1 and ERCC1 polymorphisms with response and toxicity to cisplatin-based chemotherapy in non-small-cell lung cancer patients. International journal of hygiene and environmental health. 2010. Chen Songjian, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
BRCA1 185delAG mutant protein, BRAt, up-regulates maspin in ovarian epithelial cells. Gynecologic oncology. 2010. O'Donnell Joshua D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
ABC transporters in cancer: more than just drug efflux pumps. Nature reviews. Cancer. 2010. Fletcher Jamie I, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gefitinib versus cisplatin plus docetaxel in patients with non-small-cell lung cancer harbouring mutations of the epidermal growth factor receptor (WJTOG3405): an open label, randomised phase 3 trial. The lancet oncology. 2010. Mitsudomi Tetsuya, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic polymorphisms and the efficacy and toxicity of cisplatin-based chemotherapy in ovarian cancer patients. The pharmacogenomics journal. 2010. Khrunin A V, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Methylenetetrahydrofolate reductase (MTHFR) gene polymorphisms and FOLFOX response in colorectal cancer patients. British journal of clinical pharmacology. 2010. Etienne-Grimaldi Marie-Christine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Effects of excision repair cross-complementation group 1 (ERCC1) single nucleotide polymorphisms on the prognosis of non-small cell lung cancer patients. Lung cancer (Amsterdam, Netherlands). 2010. Takenaka Tomoyoshi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TaqMan low-density arrays and analysis by artificial neuronal networks predict response to neoadjuvant chemoradiation in esophageal cancer. Pharmacogenomics. 2010. Warnecke-Eberz Ute, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomics of taxane/platinum therapy in ovarian cancer. International journal of gynecological cancer : official journal of the International Gynecological Cancer Society. 2009. Marsh Sharon. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Genetic variants in TPMT and COMT are associated with hearing loss in children receiving cisplatin chemotherapy. Nature genetics. 2009. Ross Colin J D, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Contribution of organic cation transporter 2 (OCT2) to cisplatin-induced nephrotoxicity. Clinical pharmacology and therapeutics. 2009. Filipski K K, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Common variations in ERCC2 are associated with response to cisplatin chemotherapy and clinical outcome in osteosarcoma patients. The pharmacogenomics journal. 2009. Caronia D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The increasing role of pharmacogenetics in the treatment of gastrointestinal cancers. Gastrointestinal cancer research : GCR. 2009. Yalçin Suayib. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Cisplatin pharmacogenetics, DNA repair polymorphisms, and esophageal cancer outcomes. Pharmacogenetics and genomics. 2009. Bradbury Penelope A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
TP53 codon 72 polymorphism associated with prognosis in patients with advanced gastric cancer treated with paclitaxel and cisplatin. Cancer chemotherapy and pharmacology. 2009. Kim Jong Gwang, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Histone deacetylase inhibitors induce a very broad, pleiotropic anticancer drug resistance phenotype in acute myeloid leukemia cells by modulation of multiple ABC transporter genes. Clinical cancer research : an official journal of the American Association for Cancer Research. 2009. Hauswald Stefanie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic analyses of a phase III trial in metastatic gastroesophageal adenocarcinoma with fluorouracil and leucovorin plus either oxaliplatin or cisplatin: a study of the arbeitsgemeinschaft internistische onkologie. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2009. Goekkurt Eray, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
GNAS1 T393C polymorphism is associated with histopathological response to neoadjuvant radiochemotherapy in esophageal cancer. The pharmacogenomics journal. 2009. Alakus H, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms affecting clinical outcomes in epithelial ovarian cancer patients treated with taxanes and platinum compounds: a Korean population-based study. Gynecologic oncology. 2009. Kim Hee Seung, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Phase III trial of irinotecan/cisplatin compared with etoposide/cisplatin in extensive-stage small-cell lung cancer: clinical and pharmacogenomic results from SWOG S0124. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2009. Lara Primo N, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Methotrexate in pediatric osteosarcoma: response and toxicity in relation to genetic polymorphisms and dihydrofolate reductase and reduced folate carrier 1 expression. The Journal of pediatrics. 2009. Patiño-García Ana, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Genetic determinants of response to clopidogrel and cardiovascular events. The New England journal of medicine. 2009. Simon Tabassome, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Randomized phase II and pharmacogenetic study of pemetrexed compared with pemetrexed plus carboplatin in pretreated patients with advanced non-small-cell lung cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2009. Smit Egbert F, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
DNA repair gene polymorphisms predict favorable clinical outcome in advanced non-small-cell lung cancer. Clinical lung cancer. 2009. Kalikaki Aristea, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Redox regulation of multidrug resistance in cancer chemotherapy: molecular mechanisms and therapeutic opportunities. Antioxidants & redox signaling. 2009. Kuo Macus Tien. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Platinum neurotoxicity pharmacogenetics. Molecular cancer therapeutics. 2009. McWhinney Sarah R, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Resistance gene expression determines the in vitro chemosensitivity of non-small cell lung cancer (NSCLC). BMC cancer. 2009. Glaysher Sharon, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms of copper- and platinum drug-efflux transporters ATP7A and ATP7B in Japanese cancer patients. Drug metabolism and pharmacokinetics. 2009. Fukushima-Uesaka Hiromi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Several major antiepileptic drugs are substrates for human P-glycoprotein. Neuropharmacology. 2008. Luna-Tortós Carlos, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Clinical significance of UDP-glucuronosyltransferase 1A1*6 for toxicities of combination chemotherapy with irinotecan and cisplatin in gynecologic cancers: a prospective multi-institutional study. Oncology. 2009. Takano Masashi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
High orotate phosphoribosyltransferase gene expression predicts complete response to chemoradiotherapy in patients with squamous cell carcinoma of the esophagus. Oncology. 2009. Kajiwara Takeshi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Expression of MRP1, BCRP, LRP and ERCC1 as prognostic factors in non-small cell lung cancer patients receiving postoperative cisplatin-based chemotherapy. The International journal of biological markers. 2009. Li Xiao-Qin, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Cisplatin plus weekly CPT-11/docetaxel in advanced esophagogastric cancer: a phase I study with pharmacogenetic assessment of XPD, XRCC3 and UGT1A1 polymorphisms. Cancer chemotherapy and pharmacology. 2008. Font Albert, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Prognostic role of p53 codon 72 polymorphism in gastric cancer patients treated with fluorouracil-based adjuvant chemotherapy. Journal of cancer research and clinical oncology. 2008. Huang Zhao-Hui, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of glutathione S-transferase P1-1 in the cellular detoxification of cisplatin. Molecular cancer therapeutics. 2008. Peklak-Scott Christina, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Integrated pathway analysis of rat urine metabolic profiles and kidney transcriptomic profiles to elucidate the systems toxicology of model nephrotoxicants. Chemical research in toxicology. 2008. Xu Ethan Yixun, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
NAD(P)H:quinone oxidoreductase 1 NQO1*2 genotype (P187S) is a strong prognostic and predictive factor in breast cancer. Nature genetics. 2008. Fagerholm Rainer, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Structure, function and regulation of P-glycoprotein and its clinical relevance in drug disposition. Xenobiotica; the fate of foreign compounds in biological systems. 2008. Zhou S-F. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Identification of the xenobiotic-metabolizing enzyme arylamine N-acetyltransferase 1 as a new target of cisplatin in breast cancer cells: molecular and cellular mechanisms of inhibition. Molecular pharmacology. 2008. Ragunathan Nilusha, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Tumor suppressor FUS1 signaling pathway. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2008. Ji Lin, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Correlation of CDA, ERCC1, and XPD polymorphisms with response and survival in gemcitabine/cisplatin-treated advanced non-small cell lung cancer patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2008. Tibaldi Carmelo, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Secondary mutations as a mechanism of cisplatin resistance in BRCA2-mutated cancers. Nature. 2008. Sakai Wataru, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Megalin genetic polymorphisms and individual sensitivity to the ototoxic effect of cisplatin. The pharmacogenomics journal. 2008. Riedemann L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Enhancement of antitumor activity of cisplatin in human lung cancer cells by tumor suppressor FUS1. Cancer gene therapy. 2008. Deng W-G, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Polymorphisms in the drug transporter gene ABCB1 predict antidepressant treatment response in depression. Neuron. 2008. Uhr Manfred, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Citalopram enantiomers in plasma and cerebrospinal fluid of ABCB1 genotyped depressive patients and clinical response: a pilot study. Pharmacological research : the official journal of the Italian Pharmacological Society. 2008. Nikisch Georg, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cisplatin and fluorouracil alone or with docetaxel in head and neck cancer. The New England journal of medicine. 2007. Posner Marshall R, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cisplatin, fluorouracil, and docetaxel in unresectable head and neck cancer. The New England journal of medicine. 2007. Vermorken Jan B, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Identification of genetic variants contributing to cisplatin-induced cytotoxicity by use of a genomewide approach. American journal of human genetics. 2007. Huang R Stephanie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gene expression response to cisplatin treatment in drug-sensitive and drug-resistant ovarian cancer cells. Oncogene. 2007. Li J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Cisplatin-induced long-term hearing impairment is associated with specific glutathione s-transferase genotypes in testicular cancer survivors. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2007. Oldenburg Jan, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A naturally occurring genetic variant of human XRCC2 (R188H) confers increased resistance to cisplatin-induced DNA damage. Biochemical and biophysical research communications. 2007. Danoy Patrick, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Effect of population and gender on chemotherapeutic agent-induced cytotoxicity. Molecular cancer therapeutics. 2007. Huang Rong Stephanie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Cobalamin potentiates vinblastine cytotoxicity through downregulation of mdr-1 gene expression in HepG2 cells. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology. 2007. Marguerite Véronique, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
XRCC1 R399Q polymorphism is associated with response to platinum-based neoadjuvant chemotherapy in bulky cervical cancer. Gynecologic oncology. 2006. Chung Hyun Hoon, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Mechanism of inhibition of P-glycoprotein mediated efflux by vitamin E TPGS: influence on ATPase activity and membrane fluidity. Molecular pharmaceutics. 2007. Collnot Eva-Maria, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinical relevance of different dihydropyrimidine dehydrogenase gene single nucleotide polymorphisms on 5-fluorouracil tolerance. Molecular cancer therapeutics. 2006. Morel Alain, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Organic cation transporters are determinants of oxaliplatin cytotoxicity. Cancer research. 2006. Zhang Shuzhong, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DNA repair by ERCC1 in non-small-cell lung cancer and cisplatin-based adjuvant chemotherapy. The New England journal of medicine. 2006. Olaussen Ken A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cancer and leukemia group B gastrointestinal cancer committee. Clinical cancer research : an official journal of the American Association for Cancer Research. 2006. Goldberg Richard M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Gefitinib modulates the function of multiple ATP-binding cassette transporters in vivo. Cancer research. 2006. Leggas Markos, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Impact of P-glycoprotein on clopidogrel absorption. Clinical pharmacology and therapeutics. 2006. Taubert Dirk, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Comprehensive analysis of UGT1A polymorphisms predictive for pharmacokinetics and treatment outcome in patients with non-small-cell lung cancer treated with irinotecan and cisplatin. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2006. Han Ji-Youn, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cisplatin-induced hepatotoxicity is enhanced by elevated expression of cytochrome P450 2E1. Toxicological sciences : an official journal of the Society of Toxicology. 2006. Lu Yongke, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of GADD34 in modulation of cisplatin cytotoxicity. Biochemical pharmacology. 2006. Fishel Melissa L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Polymorphisms of glutathione S-transferases (GST) and thymidylate synthase (TS)--novel predictors for response and survival in gastric cancer patients. British journal of cancer. 2006. Goekkurt E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Single nucleotide polymorphisms in human P-glycoprotein: its impact on drug delivery and disposition. Expert opinion on drug delivery. 2006. Dey Surajit. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Hearing genes and cisplatin deafness: a pilot study. The Laryngoscope. 2006. Knoll Christine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Pharmacogenetics of long-term responses to antiretroviral regimens containing Efavirenz and/or Nelfinavir: an Adult Aids Clinical Trials Group Study. The Journal of infectious diseases. 2005. Haas David W, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacogenetics of extraordinary responses to 5-FU/cisplatin chemotherapy in advanced gastric cancer -- report of 2 cases. Onkologie. 2005. Wolschke Christine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
The pregnane X receptor regulates gene expression in a ligand- and promoter-selective fashion. Molecular endocrinology (Baltimore, Md.). 2005. Masuyama Hisashi, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Severe drug toxicity associated with a single-nucleotide polymorphism of the cytidine deaminase gene in a Japanese cancer patient treated with gemcitabine plus cisplatin. Clinical cancer research : an official journal of the American Association for Cancer Research. 2005. Yonemori Kan, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
A multivariate analysis of genomic polymorphisms: prediction of clinical outcome to 5-FU/oxaliplatin combination chemotherapy in refractory colorectal cancer. British journal of cancer. 2004. Stoehlmacher J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Increased expression of the copper efflux transporter ATP7A mediates resistance to cisplatin, carboplatin, and oxaliplatin in ovarian cancer cells. Clinical cancer research : an official journal of the American Association for Cancer Research. 2004. Samimi Goli, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
XPD and XRCC1 genetic polymorphisms are prognostic factors in advanced non-small-cell lung cancer patients treated with platinum chemotherapy. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2004. Gurubhagavatula Sarada, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Heritability and linkage analysis of sensitivity to cisplatin-induced cytotoxicity. Cancer research. 2004. Dolan M Eileen, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Influence of lipid lowering fibrates on P-glycoprotein activity in vitro. Biochemical pharmacology. 2004. Ehrhardt Manuela, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Interactions of human P-glycoprotein with simvastatin, simvastatin acid, and atorvastatin. Pharmaceutical research. 2004. Hochman Jerome H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Breast cancer resistance protein impacts clinical outcome in platinum-based chemotherapy for advanced non-small cell lung cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2004. Yoh Kiyotaka, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Ribonucleotide reductase messenger RNA expression and survival in gemcitabine/cisplatin-treated advanced non-small cell lung cancer patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2004. Rosell Rafael, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Polymorphisms in human MDR1 (P-glycoprotein): recent advances and clinical relevance. Clinical pharmacology and therapeutics. 2004. Marzolini Catia, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Genetic polymorphisms of the human MDR1 drug transporter. Annual review of pharmacology and toxicology. 2003. Schwab Matthias, et al. PubMed
Evaluation of NQO1 gene expression and variant allele in human NSCLC tumors and matched normal lung tissue. International journal of oncology. 2002. Kolesar Jill M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Efficacy of a glutathione S-transferase pi-activated prodrug in platinum-resistant ovarian cancer cells. Molecular cancer therapeutics. 2002. Townsend Danyelle M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Interaction of omeprazole, lansoprazole and pantoprazole with P-glycoprotein. Naunyn-Schmiedeberg's archives of pharmacology. 2001. Pauli-Magnus C, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Low NAD(P)H:quinone oxidoreductase 1 activity is associated with increased risk of acute leukemia in adults. Blood. 2001. Smith M T, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Rapid polyubiquitination and proteasomal degradation of a mutant form of NAD(P)H:quinone oxidoreductase 1. Molecular pharmacology. 2001. Siegel D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A family of drug transporters: the multidrug resistance-associated proteins. Journal of the National Cancer Institute. 2000. Borst P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
The role of intestinal P-glycoprotein in the interaction of digoxin and rifampin. The Journal of clinical investigation. 1999. Greiner B, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genotype-phenotype relationships in studies of a polymorphism in NAD(P)H:quinone oxidoreductase 1. Pharmacogenetics. 1999. Siegel D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Biochemical, cellular, and pharmacological aspects of the multidrug transporter. Annual review of pharmacology and toxicology. 1999. Ambudkar S V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
Competitive, non-competitive and cooperative interactions between substrates of P-glycoprotein as measured by its ATPase activity. Biochimica et biophysica acta. 1997. Litman T, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Preclinical evaluation of CPT-11 and its active metabolite SN-38. Seminars in oncology. 1996. Lavelle F, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available VIP No VIP available
P-glycoprotein structure and evolutionary homologies. Cytotechnology. 1993. Croop J M. PubMed

LinkOuts

Web Resource:
Wikipedia
National Drug Code Directory:
0015-3072-20
DrugBank:
DB00515
ChEBI:
27899
KEGG Compound:
C06911
KEGG Drug:
D00275
PubChem Compound:
441203
PubChem Substance:
46504561
7847341
Drugs Product Database (DPD):
2126613
ChemSpider:
389985
Therapeutic Targets Database:
DAP000215

Clinical Trials

These are trials that mention cisplatin and are related to either pharmacogenetics or pharmacogenomics.

Common Searches

Search PubMed
Search Medline Plus
Search PubChem
Search CTD

Sources for PharmGKB drug information: DrugBank, Open Eye Scientific Software.