Drug/Small Molecule:

PharmGKB contains no dosing guidelines for this drug/small molecule. To report known genotype-based dosing guidelines, or if you are interested in developing guidelines, click here.

PharmGKB has no annotated drug labels with pharmacogenomic information for this drug/small molecule. If you know of a drug label with PGx, send us a message.

Links to Unannotated Labels

These links are to labels associated with oxaliplatin that have not been annotated by PharmGKB.

  1. DailyMed - DrugLabel PA166105021

PharmGKB contains no Clinical Variants that meet the highest level of criteria.

To see more Clinical Variants with lower levels of criteria, click the button at the bottom of the page.

Disclaimer: The PharmGKB's clinical annotations reflect expert consensus based on clinical evidence and peer-reviewed literature available at the time they are written and are intended only to assist clinicians in decision-making and to identify questions for further research. New evidence may have emerged since the time an annotation was submitted to the PharmGKB. The annotations are limited in scope and are not applicable to interventions or diseases that are not specifically identified.

The annotations do not account for individual variations among patients, and cannot be considered inclusive of all proper methods of care or exclusive of other treatments. It remains the responsibility of the health-care provider to determine the best course of treatment for a patient. Adherence to any guideline is voluntary, with the ultimate determination regarding its application to be made solely by the clinician and the patient. PharmGKB assumes no responsibility for any injury or damage to persons or property arising out of or related to any use of the PharmGKB clinical annotations, or for any errors or omissions.

? = Mouse-over for quick help

This is a non-comprehensive list of genetic tests with pharmacogenetics relevance, typically submitted by the manufacturer and manually curated by PharmGKB. The information listed is provided for educational purposes only and does not constitute an endorsement of any listed test or manufacturer.

A more complete listing of genetic tests is found at the Genetic Testing Registry (GTR).

PGx Test Variants Assayed Gene?

The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.

The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.

Links in the "Gene" column lead to PharmGKB Gene Pages.

Gene ? Variant?
Alternate Names / Tag SNPs ? Drugs ? Alleles ?
(+ chr strand)
Function ? Amino Acid?
No VIP available CA VA ABCB1 *2 (PMID: 11503014) N/A N/A N/A
No VIP available No VIP available VA CYP2A6 *1A N/A N/A N/A
No VIP available No VIP available VA CYP2A6 *4A N/A N/A N/A
No VIP available No VIP available VA CYP2A6 *7 N/A N/A N/A
No VIP available No VIP available VA CYP2A6 *9 N/A N/A N/A
No VIP available No VIP available VA GSTM1 non-null N/A N/A N/A
No VIP available No VIP available VA GSTM1 null N/A N/A N/A
No VIP available No VIP available VA UGT1A1 *6 N/A N/A N/A
No VIP available No VIP available VA UGT1A1 *28 N/A N/A N/A
No VIP available No VIP available VA UGT1A1 *60 N/A N/A N/A
No VIP available No VIP available VA UGT1A6 *2a N/A N/A N/A
No VIP available No VIP available VA UGT1A7 *3 N/A N/A N/A
No VIP available No Clinical Annotations available VA
rs10434 *847A>G, *913A>G, *929A>G, 20260A>G, 43693212A>G, 43753212A>G
A > G
3' UTR
No VIP available CA VA
rs1045642 208920T>A, 208920T>C, 25171488A>G, 25171488A>T, 3435T>A, 3435T>C, 87138645A>G, 87138645A>T, ABCB1*6, ABCB1: 3435C>T, ABCB1: C3435T, ABCB1: c.3435C>T, ABCB1:3435C>T, Ile1145=, Ile1145Ile, MDR1 3435C>T, MDR1 C3435T, PGP C3435T, c.3435C>T, mRNA 3853C>T
A > T
A > G
No VIP available CA VA
rs1128503 1236T>C, 167964T>C, 25043506A>G, 87550285A>G, ABCB1 1236C>T, ABCB1*8, ABCB1: c.1236T>C, ABCB1:1236C>T, ABCB1:1236T>C, Gly412=, Gly412Gly, mRNA 1654T>C, p.Gly412Gly
A > G
Not Available
rs1138272 12659374C>T, 341C>T, 67353579C>T, 7514C>T, A114V, Ala114Val, GSTP1: A114V, GSTP1: C341T
C > T
No VIP available CA VA
rs11615 18191871A>G, 354T>C, 45923653A>G, 63434T>C, Asn118=, ERCC1:19007T>C, ERCC1:Asn118Asn
A > G
No VIP available CA VA
rs13181 *304T>G, 18123137T>G, 2251A>C, 23927A>C, 45854919T>G, ERCC2 Lys751Gln, ERCC2:2251A>C, ERCC2:Lys751Gln, Lys751Gln, rs13181:T>G
T > G
rs1695 12658484A>G, 313A>G, 6624A>G, 67352689A>G, GSTP1*2, GSTP1*B, GSTP1: I105V, GSTP1:A313G, GSTP1:I105V, GSTP1:Ile105Val, Ile105Val, Part of haplotypes GSTP1*B and GSTP1*C, rs1695:A>G
A > G
No VIP available CA VA
rs17376848 1896T>C, 475992T>C, 67887542A>G, 97915624A>G, Phe632=, Phe632Phe
A > G
No VIP available CA VA
rs17626122 206474012T>C, 2958-6168T>C, 3054-6168T>C, 3075-6168T>C, 56683430T>C
T > C
No VIP available No Clinical Annotations available VA
rs1799794 -260-1363A>G, -316A>G, 104179267T>C, 7557A>G, 85179267T>C
T > C
5' UTR
No VIP available CA VA
rs1801131 1040A>C, 11208431T>G, 11794419T>G, 1286A>C, 1409A>C, 16685A>C, A1298C, Glu347Ala, Glu429Ala, Glu470Ala, MTHFR:1298A>C
T > G
Not Available
No VIP available No Clinical Annotations available VA
rs1801133 11210333G>A, 11796321G>A, 14783C>T, 419C>T, 665C>T, 677C>T, 788C>T, A222V, Ala140Val, Ala222Val, Ala263Val, C677T, MTHFR: c.677C>T, MTHFR:667C>T, p.A222V
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs1801160 129-825C>T, 2194G>A, 620696G>A, 67742838C>T, 97770920C>T, Val732Ile
C > T
No VIP available No Clinical Annotations available VA
rs1870377 1416A>T, 23789A>T, 3312857T>A, 55972974T>A, Gln472His
T > A
No VIP available No Clinical Annotations available VA
rs1885301 -1549A>G, -1549G>A, 101541053A>G, 3591A>G, 52345517A>G
A > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs2010963 -634C>G, -94C>G, 43678350C>G, 43738350C>G, 5398C>G, VEGF-A 405 G/C, VEGFA:405G>C, VEGFA:C405G
C > G
5' UTR
No VIP available No Clinical Annotations available VA
rs2032582 186947T>A, 186947T>G, 25193461A>C, 25193461A>T, 2677A, 2677G, 2677T, 2677T>A, 2677T>G, 3095G>T/A, 87160618A>C, 87160618A>T, 893 Ala, 893 Ser, 893 Thr, ABCB1*7, ABCB1: 2677G>T/A, ABCB1: 2677T/A>G, ABCB1: A893S, ABCB1: G2677T/A, ABCB1: c.2677G>T/A, ABCB1:2677G>A/T, ABCB1:2677G>T/A, ABCB1:A893T, Ala893Ser/Thr, MDR1, MDR1 G2677T/A, Ser893Ala, Ser893Thr, mRNA 3095G>T/A, p.Ala893Ser/Thr
A > C
A > T
No VIP available No Clinical Annotations available VA
rs2071559 -906T>C, 3332249A>G, 4397T>C, 55992366A>G
A > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs2074087 145799C>G, 16124232C>G, 16184232C>G, 2461-30C>G
C > G
No VIP available No Clinical Annotations available VA
rs2286455 16020162C>T, 70462G>A, 7201959C>T, 759G>A, 786G>A, Ala253=, Ala262=
C > T
No VIP available No Clinical Annotations available VA
rs2297595 226525A>G, 496A>G, 68137009T>C, 98165091T>C, DPYD:496A>G, DPYD:Met166Val, Met166Val
T > C
No VIP available No Clinical Annotations available VA
rs2305948 17205G>A, 3319441C>T, 55979558C>T, 889G>A, Val297Ile
C > T
No VIP available CA VA
rs25487 1196A>G, 16323944T>C, 44055726T>C, Gln399Arg, XRCC1 Arg399Gln, XRCC1:Arg399Gln
T > C
No VIP available CA VA
rs25648 -7C>T, 43678977C>T, 43738977C>T, 534C>T, 6025C>T, Ser178=
C > T
No VIP available No Clinical Annotations available VA
rs3025039 *171C>T, *237C>T, *253C>T, 19584C>T, 43692536C>T, 43752536C>T, VEGFA:C936T
C > T
3' UTR
No VIP available No Clinical Annotations available VA
rs307805 -942A>G, 180077487T>C, 24888760T>C, 4138A>G
T > C
5' Flanking
No VIP available No Clinical Annotations available VA
rs307822 *1475A>G, 180028717T>C, 24839990T>C, 52908A>G
T > C
3' UTR
No VIP available No Clinical Annotations available VA
rs3130 *1078A>G, 120686A>G, 15969938T>C, 7151735T>C
T > C
3' UTR
No VIP available No Clinical Annotations available VA
rs3136228 -152-405T>G, 26831703T>G, 4531T>G, 48009816T>G
T > G
5' Flanking
No VIP available No Clinical Annotations available VA
rs3212948 18192580G>C, 321+74C>G, 45924362G>C, 62725C>G
G > C
No VIP available No Clinical Annotations available VA
rs34116584 241808314C>A, 241808314C>G, 241808314C>T, 32C>A, 32C>G, 32C>T, 5153C>A, 5153C>G, 5153C>T, 999182C>A, 999182C>G, 999182C>T, Pro11Arg, Pro11His, Pro11Leu
C > G
C > T
C > A
No VIP available No Clinical Annotations available VA
rs34489327 *145-370delT, *145-370delTinsCTTTAA, *449delA, *449delAinsTTAAAG, *859delT, *859delTinsCTTTAA, 20843delA, 20843delAinsTTAAAG, 6-basepair 3'UTR repeat, 663446delA, 663446delAinsTTAAAG, 673446delA, 673446delAinsTTAAAG, TYMS:-TTAAAG, TYMS:1494del, TYMS:1494del TTAAAG, ttaaag
T > -
3' UTR
No VIP available No Clinical Annotations available VA
rs34743033 28-bp tandem repeats, CCGCGCCACTTGGCCTGCCTCCGTCCCG, TSER*2, TSER*3, TYMS: 28 bp tandem repeat, TYMS: 2R, TYMS: TSER *2/*3, TYMS:TSER 28-basepair 5'UTR enhancer region repeat
Not Available
No VIP available No Clinical Annotations available VA
rs3740066 101604207C>T, 3972C>T, 52408671C>T, 66745C>T, ABCC2:3972C>T, I1324I, Ile1324=
C > T
No VIP available No Clinical Annotations available VA
rs3918290 1905+1G>A, 476002G>A, 67887532C>T, 97915614C>T, DPYD*2A, DPYD:67887533 G>A, DPYD:IVS14 + 1G>A
C > T
No VIP available No Clinical Annotations available VA
rs4243761 26282791G>T, 2717938G>T, 896-11481G>T
G > T
No VIP available No Clinical Annotations available VA
rs4426527 1008384A>G, 1020A>G, 14355A>G, 241817516A>G, Ile340Met
A > G
No VIP available No Clinical Annotations available VA
rs45445694 2, 28-bp tandem repeats located in the TS enhancer region of 5'UTR, TYMS:*2
Not Available
rs5275 *427T>C, 11502T>C, 186643058A>G, 38131700A>G, COX-2 8473T>C, PTGS2 exon10+837T>C, PTGS2: 6498T>C, PTGS2:8473T>C
A > G
3' UTR
No VIP available No Clinical Annotations available VA
rs56038477 1236G>A, 352197G>A, 68011337C>T, 98039419C>T, Glu412=
C > T
No VIP available No Clinical Annotations available VA
rs664393 -2021A>G, 10051001T>C, 29071001T>C, 3265A>G
T > C
5' Flanking
No VIP available CA VA
rs67376798 2846A>T, 67519865T>A, 843669A>T, 97547947T>A, Asp949Val
T > A
No VIP available No Clinical Annotations available VA
rs6877011 *721G>C, 180029471C>G, 24840744C>G, 52154G>C
C > G
3' UTR
No VIP available No Clinical Annotations available VA
rs699947 -2055A>C, -2578, -2595A>C, 3437A>C, 43676389A>C, 43736389A>C, VEGF-A -2578 C/A, VEGFA:, VEGFA:C-2578A
A > C
5' Flanking
No VIP available CA VA
rs717620 -24C>T, 101542578C>T, 5116C>T, 52347042C>T, ABCC2: 5'UTR, ABCC2:(-24)C>T, mRNA 118C>T
C > T
5' UTR
No VIP available CA VA
rs7325568 21798284C>T, 40818284C>T
C > T
Not Available
No VIP available No Clinical Annotations available VA
rs7664413 102156428C>T, 177608707C>T, 812-33G>A
C > T
Not Available
No VIP available No Clinical Annotations available VA
rs7667298 -271A>G, 3331614T>C, 5032A>G, 55991731T>C
T > C
5' UTR
No VIP available No Clinical Annotations available VA
rs7952081 12630728G>A, 67324933G>A
G > A
Not Available
No VIP available No Clinical Annotations available VA
rs7993418 191205C>T, 28883061G>A, 3639C>T, 9863061G>A, Tyr1213=
G > A
No VIP available No Clinical Annotations available VA
rs833061 -1498C>T, -460, -958C>T, 43677486C>T, 43737486C>T, 4534C>T, VEGF-A -460 C/T, VEGFA:C-460T, VEGFA:T-1498C
C > T
5' Flanking
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP 138
2D structure from PubChem
provided by PubChem


Generic Names
  • Oxalatoplatin
  • Oxalatoplatinum
  • Oxaliplatin [Usan:Inn:Ban]
  • Oxaliplatino [Spanish]
  • Oxaliplatinum [Latin]
  • Oxaloplatine [French]
  • Oxaloplatino [Spanish]
  • oxaliplatin
Trade Names
  • Eloxatin
  • Elplat
  • Foloxatine
  • Transplatin
Brand Mixture Names

PharmGKB Accession Id:


Oxaliplatin is a platinum-based chemotherapy drug in the same family as cisplatin and carboplatin. It is typically administered in combination with fluorouracil and leucovorin in a combination known as Folfox for the treatment of colorectal cancer. Compared to cisplatin the two amine groups are replaced by cyclohexyldiamine for improved antitumour activity. The chlorine ligands are replaced by the oxalato bidentate derived from oxalic acid in order to improve water solubility. Oxaliplatin is marketed by Sanofi-Aventis under the trademark Eloxatin R .

Source: Drug Bank


Used in combination with infusional 5-FU/LV, is indicated for the treatment of advanced carcinoma of the colon or rectum and for adjuvant treatment of stage III colon cancer patients who have undergone complete resection of the primary tumor.

Source: Drug Bank

Other Vocabularies

Information pulled from DrugBank has not been reviewed by PharmGKB.

Pharmacology, Interactions, and Contraindications

Mechanism of Action

After activation, oxaliplatin binds preferentially to the guanine and cytosine moieties of DNA, leading to cross-linking of DNA, thus inhibiting DNA synthesis and function.

Source: Drug Bank


Oxaliplatin selectively inhibits the synthesis of deoxyribonucleic acid (DNA). The guanine and cytosine content correlates with the degree of Oxaliplatin-induced cross-linking. At high concentrations of the drug, cellular RNA and protein synthesis are also suppressed.

Source: Drug Bank

Absorption, Distribution, Metabolism, Elimination & Toxicity


Oxaliplatin undergoes nonenzymatic conversion in physiologic solutions to active derivatives via displacement of the labile oxalate ligand. Several transient reactive species are formed, including monoaquo and diaquo DACH platinum, which covalently bind with macromolecules. There is no evidence of cytochrome P450-mediated metabolism in vitro.

Source: Drug Bank

Protein Binding

Plasma protein binding of platinum (active metabolite) is irreversible and is greater than 90%.

Source: Drug Bank


Bioavailability is complete following intravenous administration.

Source: Drug Bank


Approximately 10 - 25 minutes

Source: Drug Bank


There have been five cases of oxaliplatin overdose reported. One patient received two 130 mg/m2 doses of oxaliplatin (cumulative dose of 260 mg/m 2) within a 24-hour period. The patient experienced Grade 4 thrombocytopenia (<25,000/mm 3) without any bleeding, which resolved. Two other patients were mistakenly administered oxaliplatin instead of carboplatin. One patient received a total oxaliplatin dose of 500 mg and the other received 650 mg. The first patient experienced dyspnea, wheezing, paresthesia, profuse vomiting and chest pain on the day of administration. She developed respiratory failure and severe bradycardia, and subsequently did not respond to resuscitation efforts. The other patient also experienced dyspnea, wheezing, paresthesia, and vomiting.

Source: Drug Bank

Route of Elimination

The major route of platinum elimination is renal excretion. At five days after a single 2-hour infusion of oxaliplatin, urinary elimination accounted for about 54% of the platinum eliminated, with fecal excretion accounting for only about 2%.

Source: Drug Bank

Volume of Distribution

  • 440 L

Source: Drug Bank

Chemical Properties

Chemical Formula


Source: Drug Bank

Isomeric SMILES


Source: Drug Bank


Source: Drug Bank

Canonical SMILES


Source: Drug Bank

Average Molecular Weight


Source: Drug Bank

Monoisotopic Molecular Weight


Source: Drug Bank

Genes that are associated with this drug in PharmGKB's database based on (1) variant annotations, (2) literature review, (3) pathways or (4) information automatically retrieved from DrugBank, depending on the "evidence" and "source" listed below.

Curated Information ?

Drug Interactions

Drug Description
oxaliplatin Administration of Topotecan after Oxaliplatin therapy may increase the risk of hematologic toxicity, such as neutropenia and/or thrombocytopenia. A dose adjustment may be required or the sequence of administration reversed. (source: Drug Bank)
oxaliplatin Trastuzumab may increase the risk of neutropenia and anemia. Monitor closely for signs and symptoms of adverse events. (source: Drug Bank)

Curated Information ?

Relationships from National Drug File - Reference Terminology (NDF-RT)

May Treat
Contraindicated With

Publications related to oxaliplatin: 74

No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genetic variants in the glutathione S-transferase genes and survival in colorectal cancer patients after chemotherapy and differences according to treatment with oxaliplatin. Pharmacogenetics and genomics. 2014. Kap Elisabeth J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Role of solute carrier transporters in pancreatic cancer: a review. Pharmacogenomics. 2014. Lemstrová Radmila, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Tumor angiogenesis genotyping and efficacy of first-line chemotherapy in metastatic gastric cancer patients. Pharmacogenomics. 2013. Scartozzi Mario, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Thymidylate synthase genotype-directed chemotherapy for patients with gastric and gastroesophageal junction cancers. PloS one. 2014. Goff Laura W, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Excision Repair Cross-Complementation group 1 (ERCC1) C118T SNP does not affect cellular response to oxaliplatin. Mutation research. 2013. van Huis-Tanja Lieke H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
S-1 plus irinotecan and oxaliplatin for the first-line treatment of patients with metastatic colorectal cancer: a prospective phase II study and pharmacogenetic analysis. British journal of cancer. 2013. Kim S Y, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Association of ABCB1 genetic polymorphisms with susceptibility to colorectal cancer and therapeutic prognosis. Pharmacogenomics. 2013. Wu Huizhe, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic analysis of adjuvant FOLFOX for Korean patients with colon cancer. Cancer chemotherapy and pharmacology. 2013. Lee Kyung-Hun, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
PharmGKB summary: very important pharmacogene information for GSTT1. Pharmacogenetics and genomics. 2012. Thorn Caroline F, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
A prospective validation pharmacogenomic study in the adjuvant setting of colorectal cancer patients treated with the 5-fluorouracil/leucovorin/oxaliplatin (FOLFOX4) regimen. The pharmacogenomics journal. 2012. Cecchin E, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Intratumoral expression profiling of genes involved in angiogenesis in colorectal cancer patients treated with chemotherapy plus the VEGFR inhibitor PTK787/ZK 222584 (vatalanib). The pharmacogenomics journal. 2012. Wilson P M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Absence of transcriptomic signature of response to chemotherapy in metastatic colorectal carcinoma patients. Pharmacogenomics. 2012. Laroche-Clary Audrey, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association between polymorphisms of ERCC1 and survival in epithelial ovarian cancer patients with chemotherapy. Pharmacogenomics. 2012. Yan Li, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenomics in colorectal cancer: a genome-wide association study to predict toxicity after 5-fluorouracil or FOLFOX administration. The pharmacogenomics journal. 2012. Fernandez-Rozadilla C, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genomic approach towards personalized anticancer drug therapy. Pharmacogenomics. 2012. Midorikawa Yutaka, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenomics of cisplatin-based chemotherapy in ovarian cancer patients of different ethnic origins. Pharmacogenomics. 2012. Khrunin Andrey, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Pharmacogenetic profiling of CD133 is associated with response rate (RR) and progression-free survival (PFS) in patients with metastatic colorectal cancer (mCRC), treated with bevacizumab-based chemotherapy. The pharmacogenomics journal. 2012. Pohl A, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Association between DNA-repair polymorphisms and survival in pancreatic cancer patients treated with combination chemotherapy. Pharmacogenomics. 2011. Giovannetti Elisa, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Modeling the 5-fluorouracil area under the curve versus dose relationship to develop a pharmacokinetic dosing algorithm for colorectal cancer patients receiving FOLFOX6. The oncologist. 2012. Kaldate Rajesh R, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Potential responders to FOLFOX therapy for colorectal cancer by Random Forests analysis. British journal of cancer. 2011. Tsuji S, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics of Oxaliplatin as Adjuvant Treatment in Colon Carcinoma: Are Single Nucleotide Polymorphisms in GSTP1, ERCC1, and ERCC2 Good Predictive Markers?. Molecular diagnosis & therapy. 2011. Fariña Sarasqueta Arantza, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Pharmacogenetic analyses of cisplatin-induced nephrotoxicity indicate a renoprotective effect of ERCC1 polymorphisms. Pharmacogenomics. 2011. Tzvetkov Mladen V, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomic characterization of US FDA-approved cytotoxic drugs. Pharmacogenomics. 2011. Peters Eric J, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Nucleotide excision repair gene variants and association with survival in osteosarcoma patients treated with neoadjuvant chemotherapy. The pharmacogenomics journal. 2011. Biason P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic effects and modifiers of radiotherapy and chemotherapy on survival in pancreatic cancer. Pancreas. 2011. Zeng Hongmei, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
TS and ERCC-1 mRNA expressions and clinical outcome in patients with metastatic colon cancer in CONFIRM-1 and -2 clinical trials. The pharmacogenomics journal. 2011. Grimminger P P, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
EGF61 polymorphism predicts complete pathologic response to cetuximab-based chemoradiation independent of KRAS status in locally advanced rectal cancer patients. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Hu-Lieskovan Siwen, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
VEGF -460T ¿ C polymorphism and its association with VEGF expression and outcome to FOLFOX-4 treatment in patients with colorectal carcinoma. The pharmacogenomics journal. 2011. Chen M-H, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Relationship between single nucleotide polymorphisms and haplotypes in DPYD and toxicity and efficacy of capecitabine in advanced colorectal cancer. Clinical cancer research : an official journal of the American Association for Cancer Research. 2011. Deenen Maarten J, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Use of a comprehensive panel of biomarkers to predict response to a fluorouracil-oxaliplatin regimen in patients with metastatic colorectal cancer. Pharmacogenomics. 2011. Lamas Maria J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Phase II study of S-1 combined with oxaliplatin as therapy for patients with metastatic biliary tract cancer: influence of the CYP2A6 polymorphism on pharmacokinetics and clinical activity. British journal of cancer. 2011. Kim K-p, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
The predictive value of genetic variations in the vascular endothelial growth factor A gene in metastatic colorectal cancer. The pharmacogenomics journal. 2011. Hansen T F, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Multiple genetic polymorphisms in the prediction of clinical outcome of metastatic colorectal cancer patients treated with first-line FOLFOX-4 chemotherapy. Pharmacogenetics and genomics. 2011. Huang Ming-Yii, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gender-specific genomic profiling in metastatic colorectal cancer patients treated with 5-fluorouracil and oxaliplatin. Pharmacogenomics. 2011. Gordon Michael A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenomic contribution to drug response. Cancer journal (Sudbury, Mass.). 2011. Watson Roshawn G, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Systematic review of pharmacoeconomic studies of pharmacogenomic tests. Pharmacogenomics. 2010. Beaulieu Mathieu, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic predictors of adverse events and response to chemotherapy in metastatic colorectal cancer: results from North American Gastrointestinal Intergroup Trial N9741. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2010. McLeod Howard L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A large-scale candidate gene approach identifies SNPs in SOD2 and IL13 as predictive markers of response to preoperative chemoradiation in rectal cancer. The pharmacogenomics journal. 2010. Ho-Pun-Cheung A, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic assessment of toxicity and outcome in patients with metastatic colorectal cancer treated with LV5FU2, FOLFOX, and FOLFIRI: FFCD 2000-05. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2010. Boige Valérie, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Oxaliplatin, irinotecan and capecitabine as first-line therapy in metastatic colorectal cancer (mCRC): a dose-finding study and pharmacogenomic analysis. British journal of cancer. 2010. Zarate R, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms and the efficacy and toxicity of cisplatin-based chemotherapy in ovarian cancer patients. The pharmacogenomics journal. 2010. Khrunin A V, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Methylenetetrahydrofolate reductase (MTHFR) gene polymorphisms and FOLFOX response in colorectal cancer patients. British journal of clinical pharmacology. 2010. Etienne-Grimaldi Marie-Christine, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Genetic polymorphisms in GST genes and survival of colorectal cancer patients treated with chemotherapy. Pharmacogenomics. 2010. Funke Silvia, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Variants in the dihydropyrimidine dehydrogenase, methylenetetrahydrofolate reductase and thymidylate synthase genes predict early toxicity of 5-fluorouracil in colorectal cancer patients. The Journal of international medical research. 2010. Kristensen M H, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Leveraging learning from a phase III colorectal cancer clinical trial: outcomes, methodology, meta-analysis and pharmacogenetics. Transactions of the American Clinical and Climatological Association. 2010. Goldberg Richard M, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available VA No VIP available No VIP available
Prostaglandin synthase 2/cyclooxygenase 2 (PTGS2/COX2) 8473T>C polymorphism associated with prognosis for patients with colorectal cancer treated with capecitabine and oxaliplatin. Cancer chemotherapy and pharmacology. 2009. Kim Jong Gwang, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Common variations in ERCC2 are associated with response to cisplatin chemotherapy and clinical outcome in osteosarcoma patients. The pharmacogenomics journal. 2009. Caronia D, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
The increasing role of pharmacogenetics in the treatment of gastrointestinal cancers. Gastrointestinal cancer research : GCR. 2009. Yalçin Suayib. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Cisplatin pharmacogenetics, DNA repair polymorphisms, and esophageal cancer outcomes. Pharmacogenetics and genomics. 2009. Bradbury Penelope A, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetic analyses of a phase III trial in metastatic gastroesophageal adenocarcinoma with fluorouracil and leucovorin plus either oxaliplatin or cisplatin: a study of the arbeitsgemeinschaft internistische onkologie. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2009. Goekkurt Eray, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics and biomarkers in colorectal cancer. The pharmacogenomics journal. 2009. Strimpakos A S, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Genetic polymorphisms affecting clinical outcomes in epithelial ovarian cancer patients treated with taxanes and platinum compounds: a Korean population-based study. Gynecologic oncology. 2009. Kim Hee Seung, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Genetic variants in multidrug and toxic compound extrusion-1, hMATE1, alter transport function. The pharmacogenomics journal. 2009. Chen Ying, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
DNA repair gene polymorphisms predict favorable clinical outcome in advanced non-small-cell lung cancer. Clinical lung cancer. 2009. Kalikaki Aristea, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Platinum neurotoxicity pharmacogenetics. Molecular cancer therapeutics. 2009. McWhinney Sarah R, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Predictive Factors for Response and Toxicity in Chemotherapy: Pharmacogenomics. Seminars in colon & rectal surgery. 2008. Sanoff Hanna K, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Transcription factor-binding sites in the thymidylate synthase gene: predictors of outcome in patients with metastatic colorectal cancer treated with 5-fluorouracil and oxaliplatin?. The pharmacogenomics journal. 2008. Paré L, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Pharmacogenetics in colorectal cancer: a systematic review. Pharmacogenomics. 2008. Funke Silvia, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Gilbert's Syndrome and irinotecan toxicity: combination with UDP-glucuronosyltransferase 1A7 variants increases risk. Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology. 2008. Lankisch Tim O, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Capecitabine and oxaliplatin for advanced esophagogastric cancer. The New England journal of medicine. 2008. Cunningham David, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
ERCC2 2251A>C genetic polymorphism was highly correlated with early relapse in high-risk stage II and stage III colorectal cancer patients: a preliminary study. BMC cancer. 2008. Huang Ming-Yii, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Determination of ERCC2 Lys751Gln and GSTP1 Ile105Val gene polymorphisms in colorectal cancer patients: relationships with treatment outcome. Pharmacogenomics. 2007. Le Morvan Valérie, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Pharmacogenetic profiling in patients with advanced colorectal cancer treated with first-line FOLFOX-4 chemotherapy. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. 2007. Ruzzo Annamaria, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
XRCC1 R399Q polymorphism is associated with response to platinum-based neoadjuvant chemotherapy in bulky cervical cancer. Gynecologic oncology. 2006. Chung Hyun Hoon, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
DPYD*5 gene mutation contributes to the reduced DPYD enzyme activity and chemotherapeutic toxicity of 5-FU: results from genotyping study on 75 gastric carcinoma and colon carcinoma patients. Medical oncology (Northwood, London, England). 2007. Zhang Hong, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Clinical relevance of different dihydropyrimidine dehydrogenase gene single nucleotide polymorphisms on 5-fluorouracil tolerance. Molecular cancer therapeutics. 2006. Morel Alain, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Organic cation transporters are determinants of oxaliplatin cytotoxicity. Cancer research. 2006. Zhang Shuzhong, et al. PubMed
No Dosing Guideline available No Drug Label available CA No Variant Annotation available No VIP available No VIP available
Glutathione-S-transferase P1 isoenzyme polymorphisms, platinum-based chemotherapy, and non-small cell lung cancer. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer. 2006. Booton Richard, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Cancer and leukemia group B gastrointestinal cancer committee. Clinical cancer research : an official journal of the American Association for Cancer Research. 2006. Goldberg Richard M, et al. PubMed
No Dosing Guideline available No Drug Label available CA VA No VIP available No VIP available
Glutathione S-transferase P1 polymorphism (Ile105Val) predicts cumulative neuropathy in patients receiving oxaliplatin-based chemotherapy. Clinical cancer research : an official journal of the American Association for Cancer Research. 2006. Lecomte Thierry, et al. PubMed
A multivariate analysis of genomic polymorphisms: prediction of clinical outcome to 5-FU/oxaliplatin combination chemotherapy in refractory colorectal cancer. British journal of cancer. 2004. Stoehlmacher J, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
Increased expression of the copper efflux transporter ATP7A mediates resistance to cisplatin, carboplatin, and oxaliplatin in ovarian cancer cells. Clinical cancer research : an official journal of the American Association for Cancer Research. 2004. Samimi Goli, et al. PubMed
No Dosing Guideline available No Drug Label available No Clinical Annotation available No Variant Annotation available No VIP available No VIP available
A Xeroderma pigmentosum group D gene polymorphism predicts clinical outcome to platinum-based chemotherapy in patients with advanced colorectal cancer. Cancer research. 2001. Park D J, et al. PubMed


Web Resource:
National Drug Code Directory:
KEGG Drug:
PubChem Compound:
PubChem Substance:
Therapeutic Targets Database:
FDA Drug Label at DailyMed:

Clinical Trials

These are trials that mention oxaliplatin and are related to either pharmacogenetics or pharmacogenomics.

Common Searches

Search PubMed
Search Medline Plus
Search PubChem
Search CTD

Sources for PharmGKB drug information: DrugBank, Open Eye Scientific Software.