The table below contains information about pharmacogenomic variants on PharmGKB. Please follow the link in the "Variant" column for more information about a particular variant. Each link in the "Variant" column leads to the corresponding PharmGKB Variant Page. The Variant Page contains summary data, including PharmGKB manually curated information about variant-drug pairs based on individual PubMed publications. The PMIDs for these PubMed publications can be found on the Variant Page.
The tags in the first column of the table indicate what type of information can be found on the corresponding Variant Page.
| Gene ? |
Variant?
(build 137) |
Alternate Names / Tag SNPs ? | Drugs ? |
Alleles
?
(+ chr strand) |
Function ? |
Amino Acid?
Translation |
|
|---|---|---|---|---|---|---|---|
| rs13181 | ERCC2 Lys751Gln, ERCC2:2251A>C, ERCC2:Lys751Gln, c.2251A>C, g.18123137T>G, g.23927A>C, g.45854919T>G, p.Lys751Gln, rs13181:T>G |
T > G
|
Missense |
Lys751Gln
|
|||
| rs1799735 | 3-bp deletion, GSTM3, c.468+24delG, c.468+24delGinsAGG, g.110280254delC, g.110280254delCinsCCT, intron 6, n.702+24delG, n.702+24delGinsAGG, rs1799735:AGG/- |
C > CCT
C > -
|
Intronic | ||||
| rs1799793 | XPD Asp312Asn, XPD:Asp312Asn, c.862G>A, c.934G>A, g.11587G>A, g.18135477C>T, g.45867259C>T, p.Asp288Asn, p.Asp312Asn |
C > T
|
Missense |
Asp288Asn
|
|||
| rs1801133 | 677C>T, A222V, Ala222Val, C677T, MTHFR: c.677C>T, MTHFR:667C>T, c.665C>T, g.11778965G>A, g.11856378G>A, g.14783C>T, g.7861110G>A, p.A222V, p.Ala222Val |
G > A
|
Missense |
Ala222Val
|
|||
| rs1805087 | MS 2756A>G, MS D919G, MTR:2756A>G, MTR:Asp919Gly, c.2756A>G, g.237048500A>G, g.30566279A>G, g.94920A>G, p.Asp919Gly |
A > G
|
Missense |
Asp919Gly
|
|||
| rs2228001 | XPC Lys939Gln, XPC:Lys939Gln, c.2704C>A, c.2795C>A, c.2815C>A, g.14127449G>T, g.14187449G>T, g.37724C>A, n.2795C>A, p.Gln902Lys, p.Gln939Lys, rs2228001:A>C |
G > T
|
Missense |
Gln902Lys
|
|||
| rs34743033 | 28-bp tandem repeats, CCGCGCCACTTGGCCTGCCTCCGTCCCG, TSER*2, TSER*3, TYMS: 28 bp tandem repeat, TYMS: 2R, TYMS: TSER *2/*3, TYMS:TSER 28-basepair 5'UTR enhancer region repeat |
(CCGCGCCACTTCGCCTGCCTCCGTCCCG)2/3/4
|
Not Available |
Alleles, Functions, and Amino Acid Translations are all sourced from dbSNP build 137
Overview
| Alternate Names: |
|
|---|---|
| PharmGKB Accession Id: | PA445601 |
| External Vocabularies |
|
Curated Information ?
Relationships from National Drug File - Reference Terminology (NDF-RT)
May Treat
- carboplatin may treat Osteosarcoma
- cisplatin may treat Osteosarcoma
- methotrexate may treat Osteosarcoma
